Supporting Information

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Supporting Information Gupta et al. 10.1073/pnas.1525387114 SI Methods objective, and a Canon EOS 40D digital single-lens reflex cam- Chemical Approach for Dissection of the Breast TIC Program. Only era. Correlation analysis for G3BP2 and SART3 staining in the selected compounds that target MDA-MB-231 LM2 cells in adjacent sections then was performed to assess colocalization. combination with paclitaxel (0.2 μM for 48 h) were used. Of Image pairs were subjected to automated contrast enhancement 60,000 compounds screened, 256 were selected for the second and then were registered using Photoshop (Adobe). Any non- screening step. To eliminate toxic compounds, nonmalignant overlapping image areas created in the registration process were cells were treated with these small molecules. One hundred eliminated by cropping both images. Next, the images were seventeen nontoxic compounds were selected for further analy- subjected to correlation analysis using ImageJ (https://imagej. sis. Cell viability (MTT) assays of modified MDA-MB-231 can- nih.gov/). Using the LAB color space, the images were seg- cer cells with five different concentrations (0.12, 0.37, 1.11, 3.33, mented to create binary images of the stained regions (thresh- and 10 mol/L) were carried out. To determine which genes bind olds for pass were L: 0–154; A: 0–255; BN: 123–255). An to this compound, TurboBeads carboxy nanoparticles (Turbo- automated procedure then quantified the number of positive Beads) were conjugated to compound C108 for 20 min per the pixels in 100 × 100 pixel (23 × 23 μm) regions of interest placed ’ manufacturer s protocol, followed by overnight immunoprecipi- in a grid pattern over the images. The corresponding datasets for tation at 4 °C. Proteins from metastatic cancer cells were pulled the two images then were subjected to statistical analysis to de- down with nanoparticles conjugated to compound C108 and with termine the correlation coefficient and P value using Prism nanoparticles alone as a control. Purified proteins were sepa- (GraphPad). rated on an 8% agarose gel, and a few bands that bound to compound C108 but not to the control were cut out from the gel RNA-Binding Protein Immunoprecipitation. A RNA-binding protein and analyzed by mass spectrometry. Mass spectrometry analy- immunoprecipitation kit (Millipore) was used per the manufac- sis revealed 44 proteins that bound to compound C108. We turer’s protocol. BT-474 cells were treated with 0.3 μM paclitaxel obtained shRNA-expressing lentivirus for each pull-down pro- for 1 h. RIP buffer was used to collect protein, followed by im- tein and infected modified MDA-MB-231 cells. The MTT assays munoprecipitation overnight at 4 °C with G3BP2 antibodies- were performed with shRNA stable cell lines treated with non- lethal doses of paclitaxel. Only shRNA G3BP2 made cells sen- A/G magnetic beads. A magnetic separator was used to separate sitive to treatment with paclitaxel. To confirm that compound the beads from the buffer, and the beads were washed three – C108 binds to G3BP2, immunoprecipitation with magnetic times with RIP wash buffer. The RNA protein complex was nanoparticles bound to compound C108 and nanoparticles alone digested with proteinase K for 30 min at 55 °C, and RNA was (control) was carried out. purified with a phenol:chloroform:isoamyl alcohol extraction. mRNA was purified with the RNAeasy Kit (Qiagen) and was Histologic Analysis of Clinical Samples. Adjacent tissue sections analyzed with the Affymetrix microarray. were stained for G3BP2 and SART3, respectively, and RGB Only mRNA data that showed an in increase of 1.6 or higher images were acquired using an Olympus BX40 microscope, 10× after treatment compared with the controls were selected. Gupta et al. www.pnas.org/cgi/content/short/1525387114 1of11 Fig. S1. Identification of anti-TIC chemical compounds. (A) Schematic illustration of screening approaches to identify anti-TIC chemical compounds. Of the 60,000 compounds screened, we selected 117 for the second screening step. We studied their efficacy at five different concentrations (0.12, 0.3, 1.11, 3.33, and 10 M). We then selected 78 of these 117 compounds that showed dose-dependent repression of cancer cell growth and that were nontoxic to normal human umbilical vein endothelial cells. (B) The molecular structures of the selected compounds. Gupta et al. www.pnas.org/cgi/content/short/1525387114 2of11 Fig. S2. G3BP2 rescues the decrease of ALDEFLUOR phenotype mediated by compound C108. (A) Magnetic beads were combined with compound C108 followed by immunoprecipitation of proteins to compound C108. Interactive proteins were analyzed by mass spectroscopy. The construction of stable cell lines with repressed interacting proteins was followed by the detection of paclitaxel-sensitive cells. (B) MDA-MB-453 cells show a G3BP2-mediated rescue of the decrease in ALDEFLUOR phenotype induced by C108+paclitaxel. Cells were treated with vehicle or with 1 μM compound C108 plus 0.1 μM paclitaxel or with 1 μM compound C108 plus 0.1 μM paclitaxel plus endogenous G3BP2 and were analyzed by flow cytometry. Gupta et al. www.pnas.org/cgi/content/short/1525387114 3of11 Fig. S3. Correlations of G3BP2 expression and outcomes of breast cancer patients. (A–C) The Kaplan–Meier Plotter was used to analyze the correlation of G3BP2 with outcomes of breast cancer patients. Division by the median showed worse recurrence-free survival (A), distant metastasis-free survival (B), and overall survival (C). (D–H) Increased G3BP2 levels correlate with worse recurrence-free survival in different subtypes of breast cancer: basal type (D), + ER-negative (E), ER-positive (F), luminal A (G), and luminal B (H). (I) In patients with HER2 breast cancer, increased G3BP2 levels show improved survival. Gupta et al. www.pnas.org/cgi/content/short/1525387114 4of11 Fig. S4. Colocalization of G3BP2 and PABPC1. (A) Stable knockdowns of G3BP2 were created with shRNA in the MDA-MB-453, BT-474, and MDA-MB-231 cell lines. (B) MDA-MB-231 cells were treated with 1 μM of paclitaxel for 30–60 min and were stained with G3BP2 (red) and PABPC1 (green) antibodies. (C) BT-474 cells and BT-474 cells with G3BP2 down-regulation were treated with 1 μM of paclitaxel for 30–60 min, stained with G3BP2 (red) and PABPC1 (green) anti- bodies, and imaged by multispectral confocal imaging. Gupta et al. www.pnas.org/cgi/content/short/1525387114 5of11 A scr-shRNA shRNA G3BP2 scr-shRNA 50 cells 500 cells shRNA G3BP2 B scr-shRNA shRNA G3BP2 cells 4 10 cells 5 10 Fig. S5. G3BP2 knockdown has a pronounced effect on tumor cell self-renewal. (A) Significantly higher numbers of cells BT-474 cells with silenced G3BP2 expression were required to form tumors. (B) ELDA for the tumor-forming frequency of G3BP2 shRNA MDA-MB-453 cells and control scr-shRNA MDA-MB-453 cells in NOD-SCID mice. Fig. S6. Down-regulation of G3BP2 SG protein in human breast cancer cells leads to a decrease of SART3. (A) Fluorescent immunocytochemical staining was performed to determine the expression of SART3 in G3BP2-depleted and control cells. (Magnification: 200×) (Scale bars, 20 μm.) (B) Immunocytochemistry was performed to determine the expression of SART3 in G3BP2-depleted and control cells. (Magnification, 200×.) (Scale bar, 20 μm.) Gupta et al. www.pnas.org/cgi/content/short/1525387114 6of11 A MDA-MB-453 B scr-shRNA shRNA SART3 ) (µm spheres Number of S Sphere size BT-474 ) (µm spheres Number of Sphere size Fig. S7. G3BP2 regulates Oct-4, Nanog, and SART3 expression. (A) Western blot analysis was performed to detect OCT-4 and Nanog expression in SART3- knockdown breast cancer cell lines. (B) Representative images and analysis of mammosphere formation observed in SART3-silenced (white bars) and control (black bars) BT-474 and MDA-MB-453 cells. Data represent mean ± SD; *P < 0.05; **P < 0.005. (Magnification: 200×.) Fig. S8. No change in vimentin or E-cadherin levels is seen after repression of G3BP2 in BT-474 cells. The effect of G3BP2 silencing on EMT markers was assessed using Western blot analysis. No change in vimentin or E-cadherin was noted. TWIST1 and Slug protein levels were decreased after knockdown of G3BP2. Gupta et al. www.pnas.org/cgi/content/short/1525387114 7of11 Table S1. Proteins that bind to anticancer stem-cell compound C108 Protein coverage determined N Protein Protein name Matches by amino acid count, % 1 SNW1 SNW domain-containing protein 1 17 201/536 37.5 2 USP39 U4/U6-snRNP-associated protein 2 9 127/565 22.5 3 CSNK2A1 Casein kinase 2, alpha 1 polypeptide 9 65/397 16.4 4 IGF2BP1 Insulin-like growth factor 2 mRNA-binding protein 1 9 104/577 18.0 5 PPP2R1B Isoform 1 of Serine/threonine-protein phosphatase 2A 5 72/601 12.0 65 kDa regulatory subunit A beta isoforms. 6 PTPN9 Protein tyrosine phosphatase, nonreceptor type 9 6 73/593 12.8 7 CRKL Crk-like protein 12 120/303 39.6 8 TBRG4 TBRG4 cDNA FLJ56153 6 65/642 10.1 9 GNL3 Isoform 2 of Guanine nucleotide-binding protein-like 3 10 124/537 23.1 10 PLK1 Serine/threonine-protein kinase PLK1 6 65/603 10.8 11 SHOC2 Leucine-rich repeat protein SHOC-2 8 91/582 15.6 12 IGF2BP2 Insulin-like growth factor 2 mRNA-binding protein 2 6 73/599 12.2 13 CDKN2AIP CDKN2A interacting protein 8 108/580 18.6 14 METAP2 Methionine aminopeptidase 2 13 123/478 25.7 15 LYRIC MTDH Protein LYRIC 9 128/582 22.0 16 ARCN1 Coatomer subunit delta variant 2 8 84/552 15.2 17 GRK6 Isoform GRK6A of G protein-coupled receptor kinase 6 9 109/576 18.9 18 PABPC1 Isoform1 of Polyadenylate-binding protein1 15 161/636 25.3 19 IKIP Isoform 1 of Inhibitor
Recommended publications
  • Inhibition of Breast and Brain Cancer Cell Growth by Bccipα, An

    Inhibition of Breast and Brain Cancer Cell Growth by Bccipα, An

    Oncogene (2001) 20, 336 ± 345 ã 2001 Nature Publishing Group All rights reserved 0950 ± 9232/01 $15.00 www.nature.com/onc Inhibition of breast and brain cancer cell growth by BCCIPa,an evolutionarily conserved nuclear protein that interacts with BRCA2 Jingmei Liu1, Yuan Yuan1,2, Juan Huan2 and Zhiyuan Shen*,1 1Department of Molecular Genetics and Microbiology, University of New Mexico Health Sciences Center; 915 Camino de Salud, NE. Albuquerque, New Mexico, NM 87131, USA; 2Graduate Program of Molecular Genetics, College of Medicine, University of Illinois at Chicago, 900 S. Ashland Ave. Chicago, Illinois, IL 60607, USA BRCA2 is a tumor suppressor gene involved in mammary mouse BRCA2. It is expected that important functions tumorigenesis. Although important functions have been of BRCA2 reside in these conserved domains. Based on assigned to a few conserved domains of BRCA2, little is the functional analysis of the conserved BRCA2 known about the longest internal conserved domain domains, several models have been proposed for the encoded by exons 14 ± 24. We identi®ed a novel protein, role of BRCA2 in tumor suppression. designated BCCIPa, that interacts with part of the An N-terminus conserved domain in exon 3 (amino internal conserved region of human BRCA2. Human acids 48 ± 105) has been implicated in transcriptional BCCIP represents a family of proteins that are regulation of gene expression (Milner et al., 1997; evolutionarily conserved, and contain three distinct Nordling et al., 1998). Deletion of this region has been domains: an N-terminus acidic domain (NAD) of 30 ± identi®ed in breast cancers (Nordling et al., 1998).
  • TBXA2R Rsnps, Transcriptional Factor Binding Sites and Asthma in Asians

    TBXA2R Rsnps, Transcriptional Factor Binding Sites and Asthma in Asians

    Open Journal of Pediatrics, 2014, 4, 148-161 Published Online June 2014 in SciRes. http://www.scirp.org/journal/ojped http://dx.doi.org/10.4236/ojped.2014.42021 TBXA2R rSNPs, Transcriptional Factor Binding Sites and Asthma in Asians Norman E. Buroker Department of Pediatrics, University of Washington, Seattle, USA Email: [email protected] Received 25 January 2014; revised 20 February 2014; accepted 27 February 2014 Copyright © 2014 by author and Scientific Research Publishing Inc. This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/ Abstract Four regulatory single nucleotide polymorphisms (rSNPs) (rs2238631, rs2238632, rs2238633 and rs2238634) in intron one, two rSNPs (rs1131882 and rs4523) in exon 3 and one rSNP (rs5756) in the 3’UTR of the thromboxane A2 receptor (TBXA2R) gene have been associated with childhood- onset asthma in Asians. These rSNP alleles alter the DNA landscape for potential transcriptional factors (TFs) to attach resulting in changes in transcriptional factor binding sites (TFBS). These TFBS changes are examined with respect to asthma which has been found to be significantly asso- ciated with the rSNPs. Keywords TBXA2R, rSNPs, TFBS, Asthma 1. Introduction Asthma is a chronic inflammatory condition of the airways characterized by recurrent episodes of reversible air- way obstruction and increased bronchial hyper-responsiveness which results from the interactions between gen- es and environmental factors [1]-[3]. Asthma causes episodes of wheeze, cough, and shortness of breath [4]. Re- cent studies indicate that the genetic factors of childhood-onset asthma differ from those of adult-onset asthma [3] [5].
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”

    Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”

    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
  • A Reciprocal Effort Towards Better Approaches for Drug Discovery

    A Reciprocal Effort Towards Better Approaches for Drug Discovery

    Acta Pharmacologica Sinica (2013) 34: 765–776 npg © 2013 CPS and SIMM All rights reserved 1671-4083/13 $32.00 www.nature.com/aps Review iPSCs and small molecules: a reciprocal effort towards better approaches for drug discovery Ru ZHANG1, Li-hong ZHANG2, Xin XIE1, 2, * 1Laboratory of Receptor-based Bio-medicine, Shanghai Key Laboratory of Signaling and Disease Research, School of Life Sciences and Technology, Tongji University, Shanghai 200092, China; 2CAS Key Laboratory of Receptor Research, the National Center for Drug Screening, Shanghai Institute of Materia Medica, Chinese Academy of Sciences, Shanghai 201203, China The revolutionary induced pluripotent stem cell (iPSC) technology provides a new path for cell replacement therapies and drug screen- ing. Patient-specific iPSCs and subsequent differentiated cells manifesting disease phenotypes will finally position human disease pathology at the core of drug discovery. Cells used to test the toxic effects of drugs can also be generated from normal iPSCs and pro- vide a much more accurate and cost-effective system than many animal models. Here, we highlight the recent progress in iPSC-based cell therapy, disease modeling and drug evaluations. In addition, we discuss the use of small molecule drugs to improve the genera- tion of iPSCs and understand the reprogramming mechanism. It is foreseeable that the interplay between iPSC technology and small molecule compounds will push forward the applications of iPSC-based therapy and screening systems in the real world and eventually revolutionize the methods used to treat diseases. Keywords: induced pluripotent stem cells (iPSCs); disease modeling; drug screening; toxicity evaluation; cell replacement therapy; small molecules; drug development Acta Pharmacologica Sinica (2013) 34: 765–776; doi: 10.1038/aps.2013.21; published online 22 Apr 2013 Introduction his/her own iPSCs[1–3].
  • Analysis of Trans Esnps Infers Regulatory Network Architecture

    Analysis of Trans Esnps Infers Regulatory Network Architecture

    Analysis of trans eSNPs infers regulatory network architecture Anat Kreimer Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Graduate School of Arts and Sciences COLUMBIA UNIVERSITY 2014 © 2014 Anat Kreimer All rights reserved ABSTRACT Analysis of trans eSNPs infers regulatory network architecture Anat Kreimer eSNPs are genetic variants associated with transcript expression levels. The characteristics of such variants highlight their importance and present a unique opportunity for studying gene regulation. eSNPs affect most genes and their cell type specificity can shed light on different processes that are activated in each cell. They can identify functional variants by connecting SNPs that are implicated in disease to a molecular mechanism. Examining eSNPs that are associated with distal genes can provide insights regarding the inference of regulatory networks but also presents challenges due to the high statistical burden of multiple testing. Such association studies allow: simultaneous investigation of many gene expression phenotypes without assuming any prior knowledge and identification of unknown regulators of gene expression while uncovering directionality. This thesis will focus on such distal eSNPs to map regulatory interactions between different loci and expose the architecture of the regulatory network defined by such interactions. We develop novel computational approaches and apply them to genetics-genomics data in human. We go beyond pairwise interactions to define network motifs, including regulatory modules and bi-fan structures, showing them to be prevalent in real data and exposing distinct attributes of such arrangements. We project eSNP associations onto a protein-protein interaction network to expose topological properties of eSNPs and their targets and highlight different modes of distal regulation.
  • Defective Lymphocyte Chemotaxis in Я-Arrestin2- and GRK6-Deficient Mice

    Defective Lymphocyte Chemotaxis in Я-Arrestin2- and GRK6-Deficient Mice

    Defective lymphocyte chemotaxis in ␤-arrestin2- and GRK6-deficient mice Alan M. Fong*, Richard T. Premont*, Ricardo M. Richardson*, Yen-Rei A. Yu†, Robert J. Lefkowitz*‡§, and Dhavalkumar D. Patel*†¶ Departments of *Medicine, ‡Biochemistry, and †Immunology, and §Howard Hughes Medical Institute, Duke University Medical Center, Durham, NC 27710 Contributed by Robert J. Lefkowitz, April 4, 2002 Lymphocyte chemotaxis is a complex process by which cells move kinase, extracellular receptor kinase, and c-jun terminal kinase within tissues and across barriers such as vascular endothelium and activation (9–12), they might also act as positive regulators of is usually stimulated by chemokines such as stromal cell-derived chemotaxis. To evaluate the role of the GRK-arrestin pathway factor-1 (CXCL12) acting via G protein-coupled receptors. Because in chemotaxis, we studied the chemotactic responses of lym- members of this receptor family are regulated (‘‘desensitized’’) by phocytes from ␤-arrestin- and GRK-deficient mice toward G protein-coupled receptor kinase (GRK)-mediated receptor phos- gradients of stromal cell-derived factor 1 (CXCL12), a well ␤ phorylation and -arrestin binding, we examined signaling and characterized chemokine whose receptor is CXCR4, a core- chemotactic responses in splenocytes derived from knockout mice ceptor for HIV. deficient in various ␤-arrestins and GRKs, with the expectation that these responses might be enhanced. Knockouts of ␤-arrestin2, Materials and Methods GRK5, and GRK6 were examined because all three proteins are :expressed at high levels in purified mouse CD3؉ T and B220؉ B Mice. The following mouse strains were used in this study splenocytes. CXCL12 stimulation of membrane GTPase activity was ␤-arrestin2-deficient (back-crossed for six generations onto the unaffected in splenocytes derived from GRK5-deficient mice but C57͞BL6 background; ref.
  • Genotyping for Response to Physical Training

    Genotyping for Response to Physical Training

    Wright State University CORE Scholar Browse all Theses and Dissertations Theses and Dissertations 2019 Genotyping for Response to Physical Training Stacy Simmons Wright State University Follow this and additional works at: https://corescholar.libraries.wright.edu/etd_all Part of the Molecular Biology Commons Repository Citation Simmons, Stacy, "Genotyping for Response to Physical Training" (2019). Browse all Theses and Dissertations. 2109. https://corescholar.libraries.wright.edu/etd_all/2109 This Thesis is brought to you for free and open access by the Theses and Dissertations at CORE Scholar. It has been accepted for inclusion in Browse all Theses and Dissertations by an authorized administrator of CORE Scholar. For more information, please contact [email protected]. GENOTYPING FOR RESPONSE TO PHYSICAL TRAINING A thesis submitted in partial fulfillment of the requirements for the degree of Master of Science By STACY SIMMONS B.S., Wright State University, 2014 _________________________________________________________ 2019 Wright State University WRIGHT STATE UNIVERSITY GRADUATE SCHOOL July 29, 2019 I HEREBY RECOMMEND THAT THE THESIS PREPARED UNDER MY SUPERVISION BY Stacy Simmons ENTITLED Genotyping for Response to Physical Training BE ACCEPTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF Master of Science. ___________________________________ Michael Markey, Ph.D. Thesis Director ____________________________________ Madhavi P. Kadakia, Ph.D. Committee on Chair, Department of Biochemistry Final Examination and
  • Combined Integrin Phosphoproteomic Analyses and Small Interfering RNA–Based Functional Screening Identify Key Regulators for Cancer Cell Adhesion and Migration

    Combined Integrin Phosphoproteomic Analyses and Small Interfering RNA–Based Functional Screening Identify Key Regulators for Cancer Cell Adhesion and Migration

    Published OnlineFirst April 7, 2009; DOI: 10.1158/0008-5472.CAN-08-2515 Published Online First on April 7, 2009 as 10.1158/0008-5472.CAN-08-2515 Research Article Combined Integrin Phosphoproteomic Analyses and Small Interfering RNA–Based Functional Screening Identify Key Regulators for Cancer Cell Adhesion and Migration Yanling Chen,1 Bingwen Lu,2 Qingkai Yang,1 Colleen Fearns,3 John R. Yates III,2 and Jiing-Dwan Lee1 Departments of 1Immunology, 2Chemical Physiology, and 3Chemistry, The Scripps Research Institute, La Jolla, California Abstract cytoskeletal components (2, 7) and regulation of cell survival, Integrins interact with extracellular matrix (ECM) and deliver proliferation, differentiation, cell cycle, and migration (8, 9). Understanding the mechanism by which integrins modulate these intracellular signaling for cell proliferation, survival, and motility. During tumor metastasis, integrin-mediated cell cellular activities is of significant biological importance. adhesion to and migration on the ECM proteins are required The most common cancers in human include breast cancer, for cancer cell survival and adaptation to the new microen- prostate cancer, lung cancer, colon cancer, and ovarian cancer (10, 11), and their metastasis is the leading cause of mortality in vironment. Using stable isotope labeling by amino acids in cell cancer patients, causing 90% of deaths from solid tumors (11, 12). culture–mass spectrometry, we profiled the phosphoproteo- During the process of metastasis, tumor cells leave the primary mic changes induced by the interactions of cell integrins with site, travel via blood and/or lymphatic circulatory systems, attach type I collagen, the most common ECM substratum. Integrin- to the substratum of ECM at a distant site, and establish a ECM interactions modulate phosphorylation of 517 serine, secondary tumor, accompanied by angiogenesis of the newly threonine, or tyrosine residues in 513 peptides, corresponding formed neoplasm (12).
  • Katalog 2015 Cover Paul Lin *Hinweis Förderung.Indd

    Katalog 2015 Cover Paul Lin *Hinweis Förderung.Indd

    Product List 2015 WE LIVE SERVICE Certificates quartett owns two productions sites that are certified according to EN ISO 9001:2008 Quality management systems - Requirements EN ISO 13485:2012 + AC:2012 Medical devices - Quality management systems - Requirements for regulatory purposes GMP Conformity Our quality management guarantees products of highest quality! 2 Foreword to the quartett product list 2015 quartett Immunodiagnostika, Biotechnologie + Kosmetik Vertriebs GmbH welcomes you as one of our new business partners as well as all of our previous loyal clients. You are now member of quartett´s worldwide customers. First of all we would like to introduce ourselves to you. Founded as a family-run company in 1986, quartett ensures for more than a quarter of a century consistent quality of products. Service and support of our valued customers are our daily businesses. And we will continue! In the end 80´s quartett offered radioimmunoassay and enzyme immunoassay kits from different manufacturers in the USA. In the beginning 90´s the company changed its strategy from offering products for routine diagnostic to the increasing field of research and development. Setting up a production plant in 1997 and a second one in 2011 supported this decision. The company specialized its product profile in the field of manufacturing synthetic peptides for antibody production, peptides such as protease inhibitors, biochemical reagents and products for histology, cytology and immunohistology. All products are exclusively manufactured in Germany without outsourcing any production step. Nowadays, we expand into all other diagnostic and research fields and supply our customers in universities, government institutes, pharmaceutical and biotechnological companies, hospitals, and private doctor offices.
  • 1 Tumor Suppressor PLK2 May Serve As a Biomarker in Triple-Negative Breast Cancer for Improved Response to PLK1 Therapeutics

    1 Tumor Suppressor PLK2 May Serve As a Biomarker in Triple-Negative Breast Cancer for Improved Response to PLK1 Therapeutics

    bioRxiv preprint doi: https://doi.org/10.1101/2021.06.16.448722; this version posted June 16, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Tumor suppressor PLK2 may serve as a biomarker in triple-negative breast cancer for improved response to PLK1 therapeutics Yang Gao1, 2, 3, Elena B. Kabotyanski1, 2, Elizabeth Villegas7, Jonathan H. Shepherd8, Deanna Acosta1, 2, Clark Hamor1, 2, Tingting Sun2,4,5, Celina Montmeyor-Garcia9, Xiaping He8, Lacey E. Dobrolecki1, 2, 3, Thomas F. Westbrook2, 4, 5, Michael T. Lewis1, 2, 3, Susan G. Hilsenbeck2, 3, Xiang H.-F. Zhang1, 2, 3, 6, Charles M. Perou8 and Jeffrey M. Rosen1, 2 1Department of Molecular and Cellular Biology 2Dan L. Duncan Cancer Center 3Lester and Sue Smith Breast Center 4Department of Molecular and Human Genetics 5Verna & Marrs McLean Department of Biochemistry and Molecular Biology 6McNair Medical Institute Baylor College of Medicine, One Baylor Plaza, Houston, TX 77030, USA 7University of Houston-Downtown, Houston, TX 77002, USA 8The University of North Carolina at Chapel Hill, Chapel Hill, NC 27599, USA 9 Canadian Blood Services, Toronto, ON M5G 2M1, Canada Correspondence to Jeffrey M. Rosen (Mail Stop: BCM130, Room: BCM-M638a, Baylor College of Medicine, 1 Baylor Plaza, Houston, TX 77030. Office: 713-798-6210. Fax: 713-898-8012. Email: [email protected]) 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.16.448722; this version posted June 16, 2021.
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
  • Supplementary Table 1

    Supplementary Table 1

    Table S1. List of Genes Differentially Expressed in YB-1 siRNA-Transfected MCF-7 Cells Unigene Accession Symbol Description Mean fold change Hs.17466 NM_004585 RARRES3 retinoic acid receptor responder (tazarotene induced) 3 3.57 Hs.64746 NM_004669 CLIC3 chloride intracellular channel 3 3.33 Hs.516155 NM_001747 CAPG capping protein (actin filament), gelsolin-like 2.88 Hs.926 NM_002463 MX2 myxovirus (influenza virus) resistance 2 (mouse) 2.72 Hs.643494 NM_005410 SEPP1 selenoprotein P, plasma, 1 2.70 Hs.267038 BC017500 POF1B premature ovarian failure 1B 2.67 Hs.20961 U63917 GPR30 G protein- coupled receptor 30 2532.53 Hs.199877 BE645967 CPNE4 copine IV 2.49 Hs.632177 NM_017458 MVP major vault protein 2.48 Hs.528836 AA005023 NOD27 nucleotide-binding oligomerization domains 27 2.43 Hs.360940 AL589866 dJ222E13.1 kraken-like 2.40 Hs.515575 AI743780 PLAC2 placenta-specific 2 2.37 Hs.25674 AI827820 MBD2 methyl-CpG binding domain protein 2 2.36 Hs.12229 AA149594 TIEG2 TGFB inducible early growth response 2 2.33 Hs.482730 AA053711 EDIL3 EGF-like repeats and discoidin I-like domains 3 2.32 Hs. 370771 NM_000389 CDKN1A cyclin- depen dent kinase in hibitor 1A (p 21, Cip 1) 2282.28 Hs.469175 AI341537 JFC1 NADPH oxidase-related, C2 domain-containing protein 2.28 Hs.514821 AF043341 CCL5 chemokine (C-C motif) ligand 5 2.27 Hs.591292 NM_023915 GPR87 G protein-coupled receptor 87 2.26 Hs.500483 NM_001613 ACTA2 actin, alpha 2, smooth muscle, aorta 2.24 Hs.632824 NM_006729 DIAPH2 diaphanous homolog 2 (Drosophila) 2.22 Hs.369430 NM_000919 PAM peptidylglycine