Reduced Generation Time of Apple Seedlings to Within a Year by Means

Plant Biotechnology Journal (2013), pp. 1–9 doi: 10.1111/pbi.12116

Reduced generation time of apple seedlings to within a year by means of a plant virus vector: a new plant-breeding technique with no transmission of genetic modiﬁcation to the next generation

Noriko Yamagishi, Ryusuke Kishigami and Nobuyuki Yoshikawa

Faculty of Agriculture, Iwate University, Morioka, Japan

Received 30 May 2013; Summary revised 8 July 2013; Fruit trees have a long juvenile phase. For example, the juvenile phase of apple (Malus 9 accepted 11 July 2013. domestica) generally lasts for 5–12 years and is a serious constraint for genetic analysis and for Correspondence (Tel/fax +19-621-6150; creating new apple cultivars through cross-breeding. If modification of the genes involved in the email [email protected]) transition from the juvenile phase to the adult phase can enable apple to complete its life cycle within 1 year, as seen in herbaceous plants, a significant enhancement in apple breeding will be realized. Here, we report a novel technology that simultaneously promotes expression of Arabidopsis FLOWERING LOCUS T gene (AtFT) and silencing of apple TERMINAL FLOWER 1 gene (MdTFL1-1) using an Apple latent spherical virus (ALSV) vector (ALSV-AtFT/MdTFL1) to accelerate flowering time and life cycle in apple seedlings. When apple cotyledons were inoculated with ALSV-AtFT/MdTFL1 immediately after germination, more than 90% of infected seedlings started flowering within 1.5–3 months, and almost all early-flowering seedlings continuously produced flower buds on the lateral and axillary shoots. Cross-pollination between early-flowering apple plants produced fruits with seeds, indicating that ALSV-AtFT/MdTFL1 inoculation successfully Keywords: Apple latent spherical virus reduced the time required for completion of the apple life cycle to 1 year or less. Apple latent vector, early flowering, apple seedling, spherical virus was not transmitted via seeds to successive progenies in most cases, and thus, this reduction in generation time, new method will serve as a new breeding technique that does not pass genetic modification to the breeding technique. next generation.

Introduction Four signalling pathways (gibberellin, autonomous, vernalization and light-dependent pathways) determine the initiation of phase The life cycle of plants is divided into several phases. The transition, and a protein encoded by the FLOWERING LOCUS T vegetative phase, which comprises the juvenile and adult vege- (AtFT) gene, namely FT protein of the phosphatidylethanolamine- tative phases, starts after germination. Plants in the juvenile phase binding protein (PEBP) family, serves as a signal integrator. Pivotal are not competent to flower even under inductive conditions, roles of FT-like proteins in floral induction have been demon- while those in the adult vegetative phase can produce flowers in strated in various plant species including woody plants (Abe response to floral inductive signals under the appropriate condi- et al., 2005; Corbesier et al., 2007; Hecht et al., 2011; Imamura tions. Plants acquire reproductive competence during the adult et al., 2011; Kong et al., 2010; Lv et al., 2012; Notaguchi et al., vegetative phase and enter the adult phase (Baurle€ and Dean, 2008; Tamaki et al., 2007; Trankner€ et al., 2010), while a 2006; Huijser and Schmid, 2011; Mimida et al., 2009). different PEBP family protein encoded by Arabidopsis TERMINAL Apple (Malus 9 domestica) has a long juvenile phase (approx- FLOWER 1 (TFL1) gene was shown to control vegetative meristem imately 5–12 years) that is a constraint for genetic analysis and identity and to suppress floral induction (Bradlley et al., 1997; the creation of new apple cultivars through cross-breeding Ratcliffe et al., 1998, 1999). (Crosby et al., 1992, 1994). Both genetic and environmental Homologues of such genes, namely MdFT1 and MdFT2 factors are known to influence the duration of the juvenile phase (orthologues of AtFT) and MdTFL1-1 and MdTFL1-2 (orthologues in apple. Although several agrotechnical approaches, such as of TFL1) (Esumi et al., 2005; Kotoda and Wada, 2005; Kotoda grafting juvenile twigs onto mature rootstocks, have been used to et al., 2010; Mimida et al., 2009), were discovered in apple, and accelerate the phase transition in apple breeding, a period of at up-regulation of MdFT genes and down-regulation of MdTFL1 least a few years is still required for apple seedlings to produce genes during flower formation in apple have been reported flowers (Fischer, 1994; Flachowsky et al., 2009). (Hattach€ et al., 2008; Mimida et al., 2011). Arabidopsis thaliana is an annual plant, and its transition from It would be of great significance in apple breeding if the genes the vegetative phase to the adult phase has been well studied. involved in the transition from the juvenile phase to the adult

Please cite this article as: Yamagishi, N., Kishigami, R. and Yoshikawa, N. (2013) Reduced generation time of apple seedlings to within a year by means of a plant virus vector: a new plant-breeding technique with no transmission of genetic modiﬁcation to the next generation. Plant Biotechnol. J., doi: 10.1111/pbi.12116

ª 2013 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd 1 2 Noriko Yamagishi et al.

phase can be modified with the aim of floral induction the ALSV vector (Figure 1), and we inoculated apple seedlings (Flachowsky et al., 2011). Several studies have demonstrated with each construct to examine its inductive effect on flowering. that modification of the genes involved in floral induction by a All tested FT orthologues accelerated flowering when expressed transformation approach successfully shortens the juvenile in A. thaliana, albeit to different extents (Table S1 and Figure S1). period. For example, overexpression of AtFT-homologous genes When expressed in tobacco plants, constructs were classified into accelerates flowering time in apple, plum, poplar, citrus and pear four groups according to the extent of flowering induction (high, (Bohlenius€ et al., 2006; Endo et al., 2005; Hsu et al., 2006; moderate, low and none) (Table S1 and Figure S1). On the other Matsuda et al., 2009; Srinivasan et al., 2012; Trankner€ et al., hand, only four orthologues, namely, AtFT, A. thaliana TWIN 2010; Zhang et al., 2010), while repression of TFL1-like genes has SISTER OF FT (AtTSF), G. max (GmFT2a) and G. triflora ortho- a similar effect in apple and pear (Flachowsky et al., 2012; logue (GtFT1) orthologue, accelerated flowering when expressed Freiman et al., 2012; Kotoda et al., 2006). in apple (Table 1). Flowering of apple seedlings infected with an Other useful floral induction approaches include plant virus ALSV vector bearing AtTSF (ALSV-AtTSF) and GtFT1 (ALSV-GtFT1) vector-based methods, such as those that promote expression of were shown in Figure 2a,b. Expression of other orthologues, endogenous genes, and virus-induced gene silencing (VIGS). Plant including apple FT-like genes (MdFT1 and MdFT2) did not show virus vector system can be used to add new traits to plants floral induction (Table 1). Inoculation with ALSV-AtTSF or ALSV- without altering the host genome (Gleba et al., 2004; Purkayas- AtFT yielded a flowering rate (number of seedlings with flowers/ tha and Dasgupta, 2009). We previously reported that approx- number of infected specimens) of approximately 30%, while imately 30% of apple seedlings inoculated with an Apple latent inoculation with an ALSV vector bearing GmFT2a (ALSV-GmFT2a) spherical virus (ALSV) vector containing the AtFT produced or ALSV-GtFT1 yielded a flowering rate of approximately 10% flowers 1.5–2 months after inoculation (7–9 leaf stage) (Yamag- (Table 1). Seedlings inoculated with ALSV-AtTSF, ALSV-GmFT2a ishi et al., 2011) and that approximately 10% of apple seedlings or ALSV-GtFT1 (Figure 2b,c) developed only one terminal flower produced early flowers when MdTFL1-1 was silenced by VIGS at the 7–9 leaf stage before entering the vegetative growth stage. using an ALSV vector (Sasaki et al., 2011). In this study, we Flowering-associated characteristics in these seedlings were simultaneously expressed AtFT and silenced MdTFL1-1 in apple similar to those in ALSV-AtFT-infected early-flowering seedlings through an ALSV vector-based approach. We found that more (Table 2). than 90% of apple seedlings started flowering 1.5–3 months after inoculation with this ALSV vector and that almost all early- flowering seedlings continuously produced flower buds on the Table 1 Promotion of flowering in apple seedlings infected with lateral and axillary shoots. In addition, cross-pollination between Apple latent spherical virus (ALSV) vectors expressing a FT orthologue early-flowering apple plants produced seed-bearing fruit, indicat- from various plants ing that our approach can shorten the protracted life cycle FT Accession Flowering (sometimes longer than 10 years) of apple to 1 year or less. To Plant species orthologue No. ALSV vector rate (%) the best of our knowledge, this study is the first to demonstrate successful shortening of the life cycle in apple to 1 year or less Arabidopsis AtFT AF152096 ALSV-AtFT 29.3 (17/58)* without genome modification. We also examined seed transmis- thaliana sion of ALSV and confirmed the absence of ALSV in most A. thaliana AtTSF NM118156 ALSV-AtTSF 30.8 (8/26) progenies. Thus, despite utilization of a genetically modified virus, Citrus unshiu CiFT AB027456 ALSV-CiFT 0 (0/28) our technique does not pass genetic modification to the next Cucumis sativus CsFT AB383152 ALSV-CsFT 0 (0/9) generation and will serve as a new plant-breeding technique. C. moschata ComFT2 EF462212 ALSV-ComFT2 0 (0/9) Moreover, our technique can be expected to significantly reduce Glycine max GmFT2a AB550122 ALSV-GmFT2a 10 (1/10) the breeding time in both apple and other fruit-producing plants G. max GmFT5a AB550126 ALSV-GmFT5a 0 (0/8) and crops. Gentiana GtFT1 AB605176 ALSV-GtFT1 7.7 (1/13) triflora Results G. triflora GtFT2 AB605177 ALSV-GtFT2 0 (0/7) Expression of FT genes derived from various plant Ipomoea nil InFT1 EU178859 ALSV-InFT1 0 (0/11) species by means of an ALSV vector and the inductive I. nil InFT2 EU178860 ALSV-InFT2 0 (0/5) effect on flowering Solanum LeFT AY186735 ALSV-LeFT 0 (0/11) lycopersicum We previously showed that inoculation of apple cotyledons with Malus x MdFT1 AB161112 ALSV-MdFT1 0 (0/31) an ALSV vector bearing AtFT (ALSV-AtFT) immediately after domestica germination resulted in the formation of flower buds and early Malus x MdFT2 AB458504 ALSV-MdFT2 0 (0/11) flowering in approximately 30% of infected seedlings (Yamagishi domestica et al., 2011). Here, we tested 18 orthologues of FT found in the Prunus mume PmFT AM943979 ALSV-PmFT 0 (0/8) genomes of the following 13 plant species: Arabidopsis thaliana, Pisum sativum PsFTa1 HQ538822 ALSV-PsFTa1 0 (0/9) satsuma (Citrus unshiu), cucumber (Cucumis sativus), pumpkin P. sativum PsFTc HQ538826 ALSV-PsFTc 0 (0/7) (Cucurbita moschata), soybean (Glycine max), Japanese gentian Populus tremula PtFT1 DQ387859 ALSV-PtFT1 0 (0/10) (Gentiana triflora), white edge morning-glory (Ipomoea nil), Vitis vinifera VvFT EF157728 ALSV-VvFT 0 (0/9) tomato (Solanum lycopersicum), apple (Malus x domestica), –† None À wtALSV 0 (0/50) Japanese apricot (Prunus mume), pea (Pisum sativum), poplar (Populus tremula) and grapevine (Vitis vinifera). Briefly, we *Figures in parenthesis indicate number of flowered plants/Number of infected constructed ALSV vectors bearing an FT orthologue from the plants. above species by inserting each orthologue into the XSB site of †Effect of a wild-type (wt)ALSV vector with no FT gene.

ª 2013 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd, Plant Biotechnology Journal, 1–9 Reduced generation time of apple seedlings by ALSV vector 3

Table 2 Comparison of ﬂowering aspects in apple seedlings infected with ALSV-AtFT, ALSV-MdTFL1 or ALSV-AtFT/MdTFL1

ALSV vector Expression gene Suppression gene Flowering rate (%) Leaf stage of first flowering No. of flowers Growth after first flowering

ALSV-AtFT* AtFT – 30 7–9 1 Vegetative ALSV-MdTFL1† – MdTFL1-1 10 8–14 Multiple Continuous ﬂowering ALSV-AtFT/MdTFL1 AtFT MdTFL1-1 >90 7–22 Multiple Continuous ﬂowering

*Data from Yamagishi et al. (2011). †Data from Sasaki et al. (2011).

silenced simultaneously with the expression of AtFT, flowering Simultaneous expression of AtFT and silencing of was accelerated in only 1 of 7 infected seedlings (Table 3). MdTFL1 efficiently accelerated flowering in apple Simultaneous silencing of MdTFL1-1 and expression of an apple Only limited types of FT orthologues accelerated flowering with FT orthologue gene (MdFT1 or MdFT2) did not accelerate low efficiency (10%–30%) when expressed in apple seedlings. flowering in any of the infected seedlings (Table 3). We previously reported that silencing of MdTFL1-1 by the ALSV- ALSV-AtFT/MdTFL1-infected apple seedlings with an based method introduced early- and perpetual-flowering traits to early-flowering trait repeated the cycle of flowering and apple seedlings, albeit with low efficiency (Sasaki et al., 2011). In lateral branch extension this study, we constructed an ALSV vector to expresses the AtFT gene as well as to silence endogenous MdTFL1-1 in apple. Briefly, As shown earlier (Table 2 and Figure 2b,c) as well as in the the ALSV-RNA1 vector bearing a partial sequence of MdTFL1-1 previous study (Yamagishi et al., 2011), early-flowering seedlings (201-nt) in the 3′ untranslated region (SM site immediately infected with ALSV-AtFT, ALSV-AtTSF, ALSV-GmFT2a or ALSV- downstream of the end of open reading frame) and the RNA2 GtFT1 produced one terminal flower at the 7–9 leaf stage, vector bearing the full length of AtFT in the XSB site were followed by the growth of lateral shoots, but not by the combined (Figure 1). When the resulting ALSV-AtFT/MdTFL1 formation of additional flower buds in most cases. On the other were used for inoculation of seedlings immediately after germi- hand, many apple seedlings inoculated with ALSV-AtFT/MdTFL1 nation, more than 90% of infected seedlings developed their first showed perpetual-flowering traits and repeated the cycle of flower at the 7–22 leaf stage (1.5–3 months after inoculation), flowering and lateral branch extension over a 7-month period and most continued flowering (Table 2 and Figure 2d–f). Real- (Figure 4). Specifically, after the first terminal flower bud com- time polymerase chain reaction (PCR) analysis revealed that the pleted the flowering process, lateral shoots started growing until expression of MdTFL1 mRNA in the tip of the stems in ALSV-AtFT/ the formation of a new terminal bud: this cycle was repeated in MdTFL1-infected seedlings approximately 2 weeks after inocula- ALSV-AtFT/MdTFL1-infected apple seedlings. Marked growth tion was approximately 25% that of seedlings without inocula- impairment due to rapid flower formation on an axillary shoot, tion (Figure 3). Floral organs, such as petals, sepals and stamens, and/or before the completion of lateral shoot extension, was were morphologically normal in most of the early-flowering apple observed in approximately 20% of the infected seedlings (data seedlings, but an increase in the number of petals and a lack of not shown), and the remaining 80% (25/32) of infected seedling pistils were occasionally observed (data not shown). showed the continuous flowering phenotype. Following the findings that the simultaneous alteration of Upper leaves of ALSV-AtFT/MdTFL1-infected apple seedlings expression of two genes, more precisely, the expression of AtFT with an early-flowering trait were harvested 6 months after and silencing of MdTFL1-1, drastically accelerated flowering in inoculation to test for the presence of the AtFT gene and the apple seedlings, we examined whether apple FT orthologue exogenous MdTFL1-1 fragment introduced by the ALSV vector. genes (MdFT1 and MdFT2) and MdTFL1-2,aMdTFL1-1 homo- The AtFT gene was maintained in approximately 60% of tested logue, were useful in a similar strategy. When MdTFL1-2 was seedlings and absent in the remaining seedlings (Figure S2). On the other hand, the MdTFL1-1 fragment of ALSV-AtFT/MdTFL1 origin was confirmed in all seedlings tested (Figure S2). Seedlings wherein AtFT was not maintained showed gradual termination of new flower formation and exhibited continuous vegetative growth of branches (Figure S2). ALSV-based floral induction technique successfully shortened the apple life cycle to 1 year or less ALSV-AtFT-infected seedlings produced a single flower once at the 7–9 leaf stage and were unable to produce a seed-bearing fruit due to insufficient size (Yamagishi et al., 2011). On the other Figure 1 Schematic of the ALSV-RNA1 vector (pEALSR1-3′SM) with a hand, ALSV-AtFT/MdTFL1-infected apple seedlings repeated the cloning site (SalI-MluI) at the 3′ terminus and the ALSV-RNA2 vector cycle of flowering and vegetative growth over a period of at least (pEALSR2mL5mR5) with cloning sites (XhoI-SmaI-BamHI) between MP and 6 months (Table 2 and Figures 4 and 5). Artificial pollination Vp25. P35S, enhanced CaMV 35S promoter; Tnos, nopaline synthase between these early-flowering apple seedlings resulted in the terminator; HEL, NTP-binding helicase; C-PRO, cysteine protease; POL, development and subsequent maturation of fruits (Figure 5a,b). RNA polymerase; MP, 42K movement protein; Vp25, Vp20, and Vp24, These fruits ripened approximately 5 months after pollination and capsid proteins; Q/G, protease cleavage site. produced morphologically normal seeds (Figure 5c,d), indicating

ª 2013 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd, Plant Biotechnology Journal, 1–9 4 Noriko Yamagishi et al.

(a) (b) (c)

(d) (e) (f)

Figure 2 Promotion of flowering in apple seedlings infected with ALSV-AtTSF (a), ALSV-GtFT1 (b and c) and ALSV-AtFT/MdTFL1 (d, e and f, respectively) (b) and (c) show the same apple seedling on different days postinoculation. Yellow arrowheads in (b) and (c) indicate the same position of flowering. Apple seedlings infected with ALSV-AtTSF, or ALSV-GtFT1 usually developed only one flower, followed by vegetative growth of shoots, as shown in (c). Circles in (f) show continuous flowering in an apple seedling infected with ALSV-AtFT/MdTFL1.

Table 3 Effect of Apple latent spherical virus (ALSV) vectors expressing FT and suppressing TFL on the promotion of ﬂowering in apple seedlings

Flowering ALSV vector Expression gene Suppression gene rate (%)

ALSV-AtFT/MdTFL1 AtFT MdTFL1-1 90.6 (29/32)* ALSV-AtFT/MdTFL2 AtFT MdTFL1-2 14.2 (1/7) ALSV-MdFT/MdTFL1 MdFT1 MdTFL1-1 0 (0/11) ALSV-MdFT/MdTFL1 MdFT2 MdTFL1-1 0 (0/9)

*Figures in parenthesis indicate No. of ﬂowered plants/No. of infected plants.

Figure 3 Relative quantification of MdTFL1-1 mRNA levels by quantitative real-time RT-PCR analysis in apple seedlings infected with ALSV-AtFT/MdTFL1. The mRNA of Mdrbc S was used as a control. Taken together, these results provide evidence for possible harvesting of seeds within 8–10 months by inoculating apple cotyledons with ALSV-AtFT/MdTFL1 immediately after germina- that ALSV-AtFT/MdTFL1-infected apple seedlings produced tion. In other words, with the ALSV-AtFT/MdTFL1-utilizing tech- flowers with fertile pistils and pollens. After low-temperature nique, apple can complete one life cycle (from the seed of the first treatment at 4 °C, all 9 seeds shown in Figure 5c germinated generation to the production of seeds of the successive gener- (Figure 5e). ation) within 1 year.

ª 2013 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd, Plant Biotechnology Journal, 1–9 Reduced generation time of apple seedlings by ALSV vector 5

(a) (b) (c)

Figure 4 Continuous ﬂowering in an apple seedling infected with ALSV-AtFT/MdTFL1 at (a) 1.5 months postinoculation (mpi), (b) 3 mpi and (c) 7 mpi. Arrows in (c) show continuous ﬂowering, even after 7 mpi.

(a) (b) (c) (d)

(e)

Figure 5 Fruit production in apple seedlings infected with ALSV-AtFT/MdTFL1. Pollination was conducted between early-ﬂowering apple seedlings. (a) Fruit produced on the apple seedling (9 mpi) 5 months after pollination. (b) Seedling (11 mpi) with four fruits 5 months after pollination. (c and d) Ripe fruits on apple seedlings (a) and (b) with viable seeds, respectively. (e) Seedlings germinated from seeds in (c) after low-temperature treatment for 3 months.

Life cycle acceleration by means of a virus vector serves as a sensitivity was 10 000–100 000-fold higher than that of ELISA new breeding technique with no transmission of genetic and RT-PCR. When seed embryos were tested to determine levels modiﬁcation to successive progenies. of ALSV, 2% (2/100) of ‘Indo’ samples, as well as the positive Plant RNA virus genomes are generally not integrated into host control (ALSV-infected leaves), showed strong positive signals at genomes, but some plant viruses are seed-transmitted. For around 15 cycles, indicating the high content of ALSV. On the example, we previously reported a seed transmission rate of a other hand, the remaining ‘Indo’ samples and all of the 115 few per cent in ALSV-infected apple seedlings (‘Indo’ variety) ‘Golden delicious’ samples showed weaker signals at around 25– based on the results of enzyme-linked immunosorbent assay 35 cycles, indicating a low content of ALSV (Figure 6b). When (ELISA) and reverse transcription (RT)-PCR (Nakamura et al., cotyledons collected 3 weeks after germination and the third true 2011). In this study, we employed a more sensitive approach, leaves from the next-generation seedlings were tested, a high real-time quantitative RT-PCR (qRT-PCR), to test for the presence ALSV-RNA content was detected in 2.3% (2/87) of ‘Indo’ of ALSV in seed embryos (cotyledons before germination) samples, but not in any of the 137 ‘Golden delicious’ samples produced by ALSV-infected apple plants (‘Indo’ and ‘Golden (Figure 6c,d). In clear contrast to the results of seed embryo qRT- delicious’ varieties), in cotyledons (after germination) and in true PCR, weak signals at 25–35 cycles, indicative of very low ALSV- leaves grown from these seeds. The detection limit of qPCR was RNA content, were absent in all samples harvested from seedlings 500 attogram of the template per reaction, and thus, its 3 weeks after germination (Figure 6c,d). Thus, a trace amount of

ª 2013 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd, Plant Biotechnology Journal, 1–9 6 Noriko Yamagishi et al.

(a)

(b)

(c)

Figure 6 Detection by quantitative real-time RT-PCR analysis of ALSV-RNA1 from apple seeds (cotyledons) before germination (a and b), from uninfected (a) and ALSV-infected (b) trees, from (d) cotyledons (c), and from the third true leaves (d) of apple seedlings of ALSV-infected trees three weeks after germination. Samples in (a) from ‘Ourin’, and samples in (b), (c) and (d) from ‘Indo’ and ‘Golden delicious (GD)’. PC, positive control (samples from infected leaves); S, Examples of 20 samples of seeds and seedlings; Ct, cycle threshold; MRn, ﬂuorescent signal of ampliﬁed by PCR.

noninfectious virus RNA is likely to account for the weak positive apple orthologues of FT (MdFT1 and MdFT2). In addition, early signals detected in a small proportion of seed embryo samples. flowering was observed in only approximately 30% of apple Further, when samples collected 2 months after germination seedlings expressing AtFT and AtTSF. Thus, we concluded that the were tested by ELISA, the detection rate was 0.98% (2/205) in low rate of early flowering cannot be improved solely by ‘Indo’ seedlings and 0% (0/176) in ‘Golden delicious’ seedlings. expression of an FT gene (Table 1). The results of qPCR of samples collected from the corresponding Following these findings, we constructed a modified ALSV seedlings 4 months after germination showed no discrepancy vector (ALSV-AtFT/MdTFL1) that expresses AtFT while silencing with the ELISA results. Thus, seed transmission of ALSV appears to MdTFL1-1, and we examined its inductive effect on flowering. have occurred at a low rate (a few per cent) in ‘Indo’ apple, but The first flower was observed in more than 90% of infected not in ‘Golden delicious’ apple. Apple latent spherical virus seedlings at 1.5–3 months after inoculation with ALSV-AtFT/ transmitted by seeds was already detectable in the seed embryo MdTFL1 (Table 2 and Figure 2), and this induction was likely before germination, enabling definitive diagnosis of ALSV infec- attributed to the increased translation of AtFT combined with tion at an early stage. Taken together, ALSV was absent in most VIGS of MdTFL1-1 as a result of the proliferation of ALSV-AtFT/ of the progenies of infected maternal plants. In other words, the MdTFL1 in the stem tips of infected seedlings (Figure 3) (Yamag- genetic makeup was generally intact in the successive generation ishi et al., 2011). Hattach€ et al. (2008) examined the changes in of ALSV-infected plants—the products of the present breeding gene expression in the apple stem apex upon transition from technique. vegetative to reproductive growth states and found increases in MdFT expression and decreases in MdTFL1-1 expression during Discussion the formation of flower buds. Similarly, Mimida et al. (2011) examined shoot apical meristems by in situ hybridization and Perennial trees require a long juvenile phase before producing found increases in MdFT expression and decreases in MdTFL flowers. The juvenile period is 5–12 years in apple and is a serious 1-1/-2 expression in the stem apex during the phase transition. It constraint for apple breeding. We previously showed that is likely that similar changes were induced in the stem apex in approximately 30% of seedlings inoculated with ALSV-AtFT apple seedlings infected with ALSV-AtFT/MdTFL1. In other words, started flowering roughly 1.5 months after inoculation (Yamag- ALSV-AtFT/MdTFL1 induces changes in gene expression in the ishi et al., 2011). In this study, we first tested whether 18 FT stem apex of seedlings a few months after germination, and such orthologues found in various plant species, as well as AtFT, changes—which normally occur in the meristem of mature trees accelerate flowering by expressing each construct in apple —accelerate flowering. seedlings by means of an ALSV vector. AtFT and AtTSF induced In contrast, the same strategy did not work with apple FT flowering more potently than other FT orthologues, including orthologues (MdFT1 and MdFT2) (Table 3). An alignment of FT

ª 2013 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd, Plant Biotechnology Journal, 1–9 Reduced generation time of apple seedlings by ALSV vector 7 amino acid sequences showed that the functional domain and words, successive progenies cannot be distinguished from the amino acids important for AtFT function were conserved in genetically unmodified apple seedlings, and thus, we believe MdFT1 and MdFT2 (Figure S3). Probably, MdFT1 and/or MdFT2 the products of this technique (the successive progenies) are not need to be supplemented by other genetic factors. Indeed, subject to the regulations of genetically modified organisms. among the 18 FT genes tested, MdFT1 induced flowering more Our ALSV vector-based technique, which accelerates the plant weakly than other FT orthologues in both A. thaliana and life cycle, is distinguishable from conventional transgenic tobacco plants. It would be intriguing to know which genetic approaches and therefore needs to be evaluated from a new factors control flowering in apples. perspective. ALSV-AtFT/MdTFL1 introduced an early-flowering trait into a much larger proportion of apple seedlings while also introducing Experimental procedures a perpetual-flowering trait (Figure 2F and Figure 4b,c). The Construction of ALSV vectors expressing each of several perpetual-flowering trait was observed in pear when PcTFL1-1 FT orthologues from various plant species (TFL1-1 orthologue) and PcTFL1-2 (TFL1-2 orthologue) were silenced by a transformation approach (Freiman et al., 2012) Eighteen FT orthologues from 13 species (A. thaliana, Citrus and also in plum transformed with poplar FT1 (Srinivasan et al., unshiu, Cucumis sativus, Cucurbita moschata, Glycine max, 2012). It is likely that ALSV-AtFT/MdTFL1 creates conditions that Gentiana triflora, Ipomoea nil, Solanum lycopersicum, Malus x induce perpetual flowering in the stem apex through a domestica, Prunus mume, Pisum sativum, Populus tremula and mechanism involving both AtFT expression and MdTFL1 repres- Vitis vinifera) were synthesized and inserted into the XSB site of sion. It is noteworthy that AtFT was not maintained in pEALSR2mL5mR5 (Figure 1) (Li et al., 2004). Chenopodium approximately 40% of infected seedlings 6 months after inoc- quinoa was infected with each of the resulting FT-bearing vectors ulation with ALSV-AtFT/MdTFL1 and that the repetitive cycle of plus pEALSR1 to obtain ALSV vectors that promote expression of flowering and vegetative growth, characteristic of ALSV-AtFT/ their respective FT orthologue (Igarashi et al., 2009). MdTFL1-infected seedlings, was gradually replaced by continu- Construction of ALSV vectors that simultaneously ous vegetative growth in infected seedlings (Figure S2). This promote expression of AtFT and silencing of MdTFL1-1 suggests that the balance between AtFT expression and MdTFL1 repression is important for floral differentiation from the shoot A partial sequence of MdTFL1-1 (accession no. AB052994) (Sasaki apical meristem, an early-flowering trait is transient, and the et al., 2011) was inserted into the SM site of pEALSR1SM. transition to the reproductive phase is incomplete in ALSV-AtFT/ Chenopodium quinoa was infected with the resulting construct MdTFL1-infected seedlings. Recently, involvement of micro RNA plus AtFT-bearing pEALSR2mL5mR5 to obtain ALSV-AtFT/MdTFL1 (miRNA) in phase transition was reported in both annual and that simultaneously promotes the expression of AtFT and perennial plants (Huijser and Schmid, 2011; Wang et al., 2011). silencing of MdTFL1-1. Future advances in apple miRNA research may lead to develop- Plant materials and inocula ment of a new technique that enables the induction of phase transition. Arabidopsis thaliana (Col) plants were grown at 25 °C under ALSV-AtFT/MdTFL1-infected seedlings kept producing early short day condition (8 h : 16 h light/dark photoperiod) in a flowers while growing for at least 6 months, and thus, success- growth chamber. Tobacco plants were grown at 25 °C under the fully produced fruits (Figure 5). Although regulation of genes long day condition (18 h : 6 h light/dark photoperiod) in a related to flower bud formation through transformation was growth chamber. Homogenates of infected C. quinoa leaves shown to accelerate breeding of fruit trees within a 1-year cycle were used as inocula for mechanical inoculation of A. thaliana (Flachowsky et al., 2009, 2011; Freiman et al., 2012; Le Roux and tobacco plants (Igarashi et al., 2009). Apple seed embryos et al., 2012), the present study is to the best of our knowledge were inoculated with an ALSV vector according to the method the first to demonstrate a technique that enables harvesting of reported by Yamagishi et al. (2010). Briefly, total RNA extracted seeds for the next-generation progenies within 1 year without from ALSV vector-infected C. quinoa leaves was used as inocula genome modification. At present, ALSV vector techniques could for biolistic inoculation of apple cotyledons (seed embryos be effectively applied to only cotyledons from seedlings, not to immediately after germination). Apple seeds were kept at 4 °C apple varieties of well-known genotype. However, this method is before use. very useful for promotion of a breeding cycle that starts with RNA extraction and quantitative RT-real-time PCR apple seeds. The present study also showed that the rate of seed Total RNA was extracted from shoot apices according to a transmission of ALSV is extremely low and that the transmission previously reported method (Sasaki et al., 2011). After DNase I can be diagnosed in a definitive manner. We previously treatment and the following phenol/chloroform extraction, reported that ALSV had not spread from the infected apple ethanol precipitation was performed and the resulting RNA trees to the neighbouring apple trees as the virus was first pellets were dissolved in RNase-free water. First strand cDNA was detected in 1984, indicating that there is no vector(s) for synthesized using 500 ng of total RNA as a template, oligo (dT) transmission of ALSV in the orchard tested and that horizontal primers and Rever Tra Ace reverse transcriptase (Toyobo, Osaka transmission of ALSV via pollen has not occurred among these Japan). Quantitative real-time PCR was performed in a reaction apple trees (Nakamura et al., 2010). Thus, ALSV vector is easy volume of 20 lL using 2 lL of cDNA, SYBR Premix Ex Taq to manage safely in terms of biocontainment. Taken together, (Tli RNase H Plus) (TaKaRa, Kyoto, Japan) and the following our rapid breeding technique using an ALSV vector instills apple primer pairs (final concentrations of 0.2 lM): MdrbcS380(+) seedlings with an early-flowering trait that enables life cycle 5′atggaaggtactggacaatg3′ and MdrbcS500(À)5′cgatgatacggat- completion within 1 year, while eliminating transmission of the gaagg3′ (for amplification of MdrbcS); MdTFL1-1391(+)5′ ALSV vector to successive progenies in most cases. In other tcaatcaacacaccttcctc3′ and MdTFL1-1515(À)5′cgtcttctagctg

ª 2013 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd, Plant Biotechnology Journal, 1–9 8 Noriko Yamagishi et al.

cagtttc3′ (for amplification of MdTFL1-1). MdrbcS served as a Esumi, T., Tao, R. and Yonemori, K. (2005) Isolation of LEAFY and TERMINAL reference gene. The conditions of real-time PCR performed with FLOWER 1 homologues from six fruit tree species in the subfamily Maloideae the Eco Real-Time PCR system (Illmina, Inc., San Diego, CA) were of the Rosaceae. Sex. Plant Reprod. 17, 277–287. 95 °C for 30 s followed by 40 cycles at 95 °C for 5 s, annealing Fischer, C. (1994) Shortening of the juvenile period in apple breeding. In Developments in Plant Breeding: Progress in Temperate Fruit Breeding at 60 °C for 30 s, and a final melting step up to 95 °C for 15 s, (Schmidt, H. and Kellerhals, M., eds), pp. 161–164. London: Kluwer 55 °C for 15 s and 95 °C for 15 s. Data (5 seedlings/experiment) Academic Publishers. ΔΔ were analysed by 2- CT data analysis. Flachowsky, H., Hanke, M.-V., Peil, A., Strauss, S.H. and Fladung, M. (2009) Determination of ALSV by quantitative RT-real-time PCR A review on transgenic approaches to accelerate breeding of woody plants. Plant Breed. 128, 217–226. RNA was extracted from test specimens as described above to Flachowsky, H., Le Roux, P.M., Peil, A., Patocchi, A., Richter, K. and Hanke, make 100 lg/mL RNA solutions. First strand cDNA was synthe- M.-V. (2011) Application of a high-speed breeding technology to apple sized as described above but using 100 ng of total RNA as a (Malus x domestica) based on transgenic early flowering plants and template. Determination of ALSV infection in seed embryos was marker-assisted selection. New Phytol. 192, 364–377. € performed by the SYBR method. Briefly, quantitative real-time Flachowsky, H., Szankowski, I., Waidmann, S., Peil, A., Trankner, C. and Hanke, M.-V. (2012) The MdTFL1 gene of apple (Malus x domestica Borkh.) PCR was performed as described above, but using the following reduces vegetative growth and generation time. Tree Physiol. 32, 1288– primer pair (final concentrations of 0.15 lM): primer4F6150+ 1301. + ′ ′ À ′ ( )5 cgatgaatctccctgataga3 and primer4R6279( )5aga- Freiman, A., Shlizerman, L., Golobovitch, S., Yablovitz, Z., Korchinsky, R., gtagtggtctccagcaa3′. The conditions of real-time PCR performed Cohen, Y., Samach, A., Chevreau, E., Le Roux, P.-M., Patocchi, A. and with the Eco Real-Time PCR system were 95 °C for 30 s followed Flaishman, M.A. (2012) Development of transgenic early flowering pear by 35 cycles at 95 °C for 5 s, annealing at 60 °C for 30 s, and a (Pyrus communis L.) genotype by RNAi silencing of PcTFL1-1 and PcTFL1-2. final melting step up to 95 °C for 15 s, 55 °C for 15 s and 95 °C Planta, 235, 1239–1251. for 15 s. Tenfold serial dilutions of in vitro-transcribed ALSV RNA1 Gleba, Y., Marillonnet, S. and Klimyuk, V. (2004) Engineering viral expression (concentration range, 500 ng/lL-500 ag/lL) were used to make a vectors for plants: the ‘full virus’ and the ‘deconstructed virus’ strategies. – calibration curve. Curr. Opin. Plant Biol. 7, 182 188. Hattach,€ C., Flachowsky, H., Kapturska, D. and Hanke, M.-V. (2008) Isolation of Determination of ALSV by ELISA flowering genes and seasonal changes in their transcript levels related to flower induction and initiation in apple (Malus x domestica). Tree Physiol. 28, The levels of ALSV in apple leaves were determined by ELISA 1459–1466. according to the method reported by Nakamura et al. (2011). Hecht, V., Laurie, R.E., Vander Schoor, J.K., Ridge, S., Knowles, C.L., Liew, L.C., Sussmilch, F.C., Murfet, I.C., Macknight, R.C. and Weller, J.L. (2011) The pea Acknowledgements GIGAS gene is a FLOWERING LOCUS T homolog necessary for graft-transmissible specification of flowering but not for responsiveness to We thank Prof. H. Kamada for his helpful discussion and Mr. T. Ito photoperiod. Plant Cell, 23, 147–161. for supplying apple seeds. This work was supported by the Hsu, C.-Y., Liu, Y., Luthe, D.S. and Yuceer, C. (2006) Poplar FT2 shortens the – Programme for Promotion of Basic and Applied Researches for juvenile phase and promotes seasonal flowering. The Plant Cell, 18, 1846 1861 doi: 10.1105/tpc.106.041038. Innovations in Bio-oriented Industry from the Ministry of Agricul- Huijser, P. and Schmid, M. (2011) The control of developmental phase ture, Forestry and Fisheries. transitions in plants. Development, 138, 4117–4129. Igarashi, A., Yamagata, K., Sugai, T., Takahashi, Y., Sugawara, E., Tamura, A., References Yaegashi, H., Yamagishi, N., Takahashi, T., Isogai, M., Takahashi, H. and Yoshikawa, N. (2009) Apple latent spherical virus vectors for reliable and Abe, M., Kobayashi, Y., Yamamoto, S., Daimon, Y., Yamaguchi, A., Ikeda, Y., effective virus-induced gene silencing among a broad range of plants Ichinoki, H., Notaguchi, M., Goto, K. and Araki, T. (2005) FD, a bZIP protein including tobacco, tomato, Arabidopsis thaliana, cucurbits, and legumes. mediating signals from the floral pathway integrator FT at the shoot apex. Virology, 386, 407–416. Science, 309,1052–1056. Imamura, T., Nakatsuka, T., Higuchi, A., Nishihara, M. and Takahashi, H. (2011) Baurle,€ I. and Dean, C. (2006) The timing of developmental transitions in plants. The gentian orthorogs of the FT/TFL1 gene family control floral initiation in Cell, 125, 655–664. Gentiana. Plant Cell Physiol. 52, 1031–1041. Bohlenius,€ H., Huang, T., Charbonnel-Campaa, L., Brunner, A.M., Jansson, S., Kong, F., Liu, B., Xia, Z., Sato, S., Kim, B., Watanabe, S., Yamada, T., Tabata, S., Strauss, S.H. and Nilsson, O. (2006) CO/FT regulatory module controls timing Kanazawa, A., Harada, K. and Abe, J. (2010) Two coordinately regulated of flowering and seasonal growth cessation in trees. Science, 312, 1040–1043. homologs of FLOWERING LOCUS T are involved in the control of Bradlley, D., Ratcliffe, O., Vincent, C., Carpenter, R. and Coen, E. (1997) photoperiodic flowering in soybean. Plant Physiol. 154, 1220–1231. Inflorescence commitment and architecture in Arabidopsis. Science, 275, Kotoda, N. and Wada, M. (2005) MdTFL1,aTFL1-like gene of apple, retards the 80–83. transition from the vegetative to reproductive phase in transgenic Corbesier, L., Vincent, C., Jang, S., Fornara, F., Fan, Q., Searle, I., Giakountis, A., Arabidopsis. Plant Sci. 168,95–104. Farrona, S., Gissot, L., Turnbull, C. and Coupland, G. (2007) FT protein Kotoda, N., Iwanami, H., Takahashi, S. and Abe, K. (2006) Antisense expression movement contributes to long-distance signalling in floral induction of of MdTFL1,aTFL1-like gene, reduce the juvenile phase in apple. J. Am. Soc. Arabidopsis. Science, 316, 1030–1033. Hort. Sci. 131,74–81. Crosby, J.A., Janick, J., Pecknold, P.C., Korban, S.S., O’Connon, P.A., Ries, S.M., Kotoda, N., Hayashi, H., Suzuki, M., Igarashi, M., Hatsuyama, Y., Kidou, S.-I., Goffreda, J. and Voordeckers, A. (1992) Breeding apples for scab resistance: Igasaki, T., Nishiguchi, M., Yano, K., Shimizu, T., Takahashi, S., Iwanami, H., 1945–1990. Fruit Var. J. 46, 145–166. Moriya, S. and Abe, K. (2010) Molecular characterization of FLOWERING Crosby, J.A., Janick, J. and Pecknold, P.C. (1994) ‘GoldRush’ apple. HortSci. 29, LOCUS T-like genes of apple (Malus x domestica Borkh.). Plant Cell Physiol. 827–828. 51, 561–575. Endo, T., Shimada, T., Fujii, H., Kobayashi, Y., Araki, T. and Omura, M. (2005) Le Roux, P.-M., Flachowsky, H., Hanke, M.-V., Gesseler, C. and Patocchi, A. Ectopic expression of an FT homolog from Citrus confers an early flowering (2012) Use of transgenic early flowering approach in apple (Malus x phenotype on trifoliate orange (Poncirus trifoliate L. Raf). Transgenic Res. 14, domestica Borkh.) to introgress fire blight resistance from cultivar Evereste. 703–712. Mol. Breeding, 30, 857–874.

ª 2013 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd, Plant Biotechnology Journal, 1–9 Reduced generation time of apple seedlings by ALSV vector 9

Li, C., Sasaki, N., Isogai, M. and Yoshikawa, N. (2004) Stable expression of Flachowsky, H. (2010) Over-expression of an FT-homologous gene of foreign proteins in herbaceous and apple plants using Apple latent spherical apple induces early flowering in annual and perennial plants. Planta, 232, virus RNA2 vectors. Arch. Virol. 149, 1541–1558. 1309–1324. Lv, L., Duan, J., Xie, J.H., Wei, C.B., Liu, Y.G., Liu, S.H. and Sun, G.M. (2012) Wang, J.-W., Park, M.Y., Wang, L.-J., Koo, Y., Chen, X.-Y., Weigel, D. and Isolation and characterization of a FLOWERING LOCUS T homolog from Poethig, R.S. (2011) MiRNA control of vegetative phase change in trees. PLoS pineapple (Ananas comosus (L.) Merr). Gene, 505, 368–373. Genet. 7, e1002012. Matsuda, N., Ikeda, K., Kurosaka, M., Takashina, T., Isuzugawa, K., Endo, T. Yamagishi, N., Sasaki, S. and Yoshikawa, N. (2010) Highly efficient inoculation and Omura, M. (2009) Early flowering phenotype in transgenic pears (Pyrus method of apple viruses to apple seedlings. Julius-Kuhn-Archiv. 427, 226– communis L.) expressing the CiFT gene. J. Japan Soc. Hort. Sci. 78, 410–416. 229 (http://icvf.jki.bund.de). Mimida, N., Kotoda, N., Ueda, T., Igarashi, M., Hatsuyama, Y., Iwanami, H., Yamagishi, N., Sasaki, S., Yamagata, K., Komori, S., Nagase, M., Wada, M., Moriya, S. and Abe, K. (2009) Four TFL1/CEN-like genes on distinct linkage Yamamoto, T. and Yoshikawa, N. (2011) Promotion of flowering and groups show different expression patterns to regulate vegetative and reduction of a generation time in apple seedlings by ectopical expression of reproductive development in apple (Malus x domestica Borkh.). Plant Cell the Arabidopsis thaliana FT gene using the Apple latent spherical virus vector. Physiol. 50, 394–412. Plant Mol. Biol. 75, 193–204. Mimida, N., Ureshino, A., Tanaka, N., Shigeta, N., Sato, N., Moriya-Tanaka, Y., Zhang, H., Harry, D.E., Ma, C., Yuceer, C., Hsu, C.-Y., Vikram, V., Shevchenko, O., Iwanami, H., Honda, C., Suzuki, A., Komori, S. and Wada, M. (2011) Etherington, E. and Strauss, S.H. (2010) Precocious flowering in trees: the Expression patterns of several floral genes during flower initiation in the FLOWERING LOCUS T gene as a research and breeding tool in Populus. J. Expt. apical buds of apple (Malus x domestica Borkh.) revealed by in situ Botany, 61, 2549–2560. hybridization. Plant Cell Rep. 30, 1485–1492. Nakamura, K., Yamagishi, N., Isogai, M., Komori, S., Ito, T. and Yoshikawa, N. (2011) Seed and pollen transmission of Apple latent spherical virus in apple. Supporting information – J. Gen. Plant Pathol. 77,48 53. Additional Supporting information may be found in the online Notaguchi, M., Abe, M., Kimura, T., Daimon, Y., Kobayashi, T., Yamaguchi, A., version of this article: Tomita, Y., Dohi, K., Mori, M. and Araki, T. (2008) Long-distance, graft-transmissible action of Arabidopsis FLOWERING LOCUS T protein to Figure S1 Promotion of flowering in A. thaliana and tobacco promote flowering. Plant Cell Physiol. 49, 1645–1658. plants infected with the ALSV vector expressing FT orthologue Purkayastha, A. and Dasgupta, I. (2009) Virus-induced gene silencing: a genes presented in Table S1. versatile tool for discovery of gene function in plants. Plant Physiol. Biochem. Figure S2 (a) RT-PCR analysis of apple seedlings infected with 47, 967–976. ALSV-AtFT/MdTFL1 at 6 mpi MdTFL1 was detected in all 17 Ratcliffe, O.J., Amaya, I., Vincent, C.A., Rothstein, S., Carpenter, R., Coen, E.S. and Bradley, D.J. (1998) A common mechanism controls the life cycle and samples, but AtFT was not detected in 7 samples No. 2, 3, 6, 9, architecture of plants. Development, 125, 1609–1615. 11, 19, or 21, indicating that MdTFL1 was stably maintained, Ratcliffe, O.J., Bradley, D.J. and Coen, E.S. (1999) Separation of shoot and floral while AtFT was deleted in 40% of samples. (b) Apple seedlings identity in Arabidopsis. Development, 126, 1109–1120. infected with ALSV-AtFT/MdTFL1. Sample No. 9, which lost AtFT, Sasaki, S., Yamagishi, N. and Yoshikawa, N. (2011) Efficient virus-induced gene shows vegetative growth of the shoot (11 mpi). In contrast, silencing in apple, pear, and Japanese pear using Apple latent spherical virus sample No. A1 shows continuous flowering (7.5 mpi). vectors. Plant Methods, 7, 15. Figure S3 Multiple alignment of the amino acid sequences of Srinivasan, C., Dardick, C., Callahan, A. and Scorza, R. (2012) Plum (Prunus AtFT (A. thaliana, AAF03936), MdFT1 (apple, ACL98164), and domestica) trees transformed with poplar FT1 result in altered architecture, MdFT2 (apple, BAD08340). dormancy requirement, and continuous flowering. PLoS ONE, 7, e40715. Table S1 Effect of ALSV vectors expressing various FT ortho- Tamaki, S., Matsuo, S., Wong, H.L., Yokoi, S. and Shimamoto, K. (2007) Hd3a protein is a mobile flowering signal in rice. Science, 316, 1033–1036. logues on the promotion of flowering in A. thaliana and tobacco Trankner,€ C., Lehmann, S., Hoenicka, H., Hanke, M.-V., Fladung, M., plants. Lenhardt, D., Dunemann, F., Gau, A., Schlangen, K., Malony, M. and

ª 2013 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd, Plant Biotechnology Journal, 1–9