The Pennsylvania State University

The Graduate School

Intercollege Graduate Program in Physiology

MECHANISM OF CLASS III MYOSIN MEDIATED REGULATION

OF ACTIN BUNDLE BASED PROTRUSIONS

A Dissertation in

Physiology

by

Manmeet H. Raval

 2016 Manmeet H. Raval Submitted in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy

December 2016

The dissertation of Manmeet H. Raval was reviewed and approved* by the following:

Christopher M. Yengo Associate Professor of Cellular and Molecular Physiology Dissertation Adviser Chair of Committee

Lisa Shantz Associate Professor of Cellular and Molecular Physiology

Scot R. Kimball Professor of Cellular and Molecular Physiology

Hui-Ling Chiang Professor of Biochemistry and Molecular Biology

Collin J. Barnstable Professor of Neural and Behavioral Sciences Professor of Psychiatry Research Director of Penn State Hershey Eye Center

Donna Korzick Professor of Physiology and Kinesiology Chair of the Intercollege Graduate Degree Program in Physiology

*Signatures are on file in the Graduate School.

iii

ABSTRACT

Class III myosins (MYO3A and MYO3B) are actin based motors which are proposed to function as transporters in parallel actin-bundle based protrusions such as stereocilia of inner ear and calycal processes of photoreceptors. The first member of the MYO3 family was identified in Drosophila photoreceptors and called

NINAC (Neither inactivation nor afterpotential C) based on its role in phototransduction. It was observed that NINAC null mutant flies undergo light and age dependent retinal degeneration. The first report describing deleterious recessive mutations in MYO3A associated with inherited human progressive hearing loss (DFNB30) was published in 2002. It is believed that MYO3 dependent transport of Espin (isoforms) from the base to the tips of the stereocilia plays a crucial role in stereocilia elongation. Previous reports have hypothesized that

MYO3A and MYO3B may have overlapping functions but MYO3B can only partially compensate for MYO3A. Thus, it is critically important to reveal functional differences between isoforms to determine how the loss of MYO3A leads to deafness. Using a wide-range of cell biological and biochemical approaches, this study investigated novel aspects of class III myosins and its binding partners associated with vertebrate hearing and vision. This study reports discovery of two novel MYO3 binding proteins- MORN4 and EspinL, and provide insights into the functional mechanism of each protein in association with MYO3. It was found that the tail of MYO3 has a conserved Espin1 and EspinL binding site, whereas the iv MORN4 binding site is distinct and present only in the MYO3A tail region. Based on structural data, a novel mechanism of motor (MYO3) mediated cargo (Espin1) activation is proposed. This work demonstrates that MYO3A is uniquely engineered to regulate formation and elongation of parallel actin bundle based protrusions which does not require rapid actin remodeling. The study also revealed a correlation between MYO3 motor activity and its ability to regulate actin protrusion formation and elongation. Interestingly, the intactness of the MYO3A extended tail region was found to be crucial for stabilizing actin protrusions. Finally, the study reports the characterization of two novel deafness causing MYO3A dominant mutations- G488E and L697W. The G488E mutation leads to an interesting phenotype of a 2-fold decrease in the maximum actin-activated ATPase rate and 2-fold increase in the actin sliding velocity. Whereas, the L697W mutation leads to a ~2-fold decreases in both the maximum actin-activated ATPase rate and actin sliding velocity. These results highlight the importance of MYO3 in vertebrate sensory structures and provides novel insights into its role in length and ultrastructure maintenance of parallel actin based protrusions.

v

TABLE OF CONTENTS

List of Figures ...... viii

List of Tables ...... x

List of Abbreviations………………………………………………………………..xi

Acknowledgements ...... xii

Chapter 1 Introduction ...... 1

Types of parallel actin bundle based protrusions and associated actin regulatory proteins...... 4

Filopodia ...... 5

Microvilli ...... 6

Stereocilia ...... 8

Discovery of Class III Myosins ...... 10

Class III myosins and implications in human hereditary hearing loss ...... 12

Vertebrate inner ear physiology ...... 12

Domain structure of vertebrate class III myosins ...... 13

Role of class III myosins in vertebrate stereocilia ...... 15

References ...... 18

Chapter 2 Vertebrate class III myosin interact with MORN-repeat containing adaptor proteins ...... 26

Introduction ...... 26

Materials and Methods ...... 28

Results ...... 31

Discussion ...... 35

Tables and Figures ...... 39

References ...... 47 vi Chapter 3 Impact of the motor and tail domains of class III myosins on regulating the formation and elongation of actin protrusions ...... 50

Introduction ...... 50

Materials and Methods ...... 54

Results ...... 61

Discussion ...... 66

Tables and Figures ...... 71

References ...... 84

Chapter 4 Characterization of a novel MYO3A missense mutation associated with a dominant form of late onset hearing loss ...... 89

Introduction ...... 89

Materials and Methods ...... 91

Results ...... 94

Discussion ...... 98

Tables and Figures ...... 102

References ...... 111

Chapter 5 Summary, conclusions and future directions ...... 114

Summary and conclusions ...... 114

Discovery of novel MYO3 binding partners ...... 115 Characterization of differences in the motor and tail domains of MYO3A and MYO3B ...... 118 Cell biological and biochemical characterization of novel MYO3A deafness causing mutations ...... 120

Future Directions ...... 121

MYO3 role in vertebrate photoreceptors ...... 121

Mechanism of MYO3A mediated actin protrusion regulation ...... 123

Characterization of MYO3A deafness causing mutations ...... 124 vii

References ...... 126

Appendix A Supplementary Figures-1 ...... 128

Appendix B Supplementary Figures-2 ...... 129

Appendix C Supplementary Figures-3 ...... 133

Appendix D Letters of Permission ...... 135

Proof of permission for Chapter 2 ...... 136

Proof of permission for Chapter 3 ...... 137

Proof of permission for Chapter 5 ...... 138

viii LIST OF FIGURES

Figure 1.1. An unrooted evolutionary tree of the myosin-superfamily...... 2

Figure 1.2. Types of cellular actin based protrusions...... 3

Figure 1.3. Unconventional myosins that are functional in actin bundle based protrusions...... 4

Figure 1.4. Diagram depicting cross-sectional view of a Drosophila photoreceptor cell...... 11

Figure 1.5. Structure of the organ of corti...... 12

Figure 1.6. Domain structure of vertebrate class III myosins...... 14

Figure 1.7. Model of MYO3 mediated ESPN1 (Espin1) transport in actin based protrusions...... 16

Figure 2.1. MYO3A tail binding MORN4 demonstrated by GST-pulldown assays...... 41

Figure 2.2. mChr-MORN4 co-expression with GFP-MYO3AΔK, but not GFP-MYO3BΔK.3THDII, in COS7 cells promotes filopodial localization of mChr-MORN4...... 42

Figure 2.3. MYO3A tail exons 30 and 31 are required for localization of MORN4 to filopodial tips...... 44

Figure 2.4. Identified and proposed motifs within the tail domain of human MYO3A...... 46

Figure 3.1. Diagrammatic representation of the domain structure of class III myosins and the COS7 cell expression of various constructs...... 74

Figure 3.2. Actin-activated ATPase and in vitro motility properties of MYO3A and MYO3B...... 76

Figure 3.3. Role of MYO3A motor domain and THD2 in actin protrusion formation and elongation...... 77

Figure 3.4. Impact of MYO3A on actin protrusion dynamics...... 79

Figure 3.5. Impact of MYO3A on microvilli formation and elongation in W4 cells...... 81 ix Figure 3.6. Villin immunostaining in MYO3A and MYO10 expressing W4 cells...... 83

Figure 4.1. Structural model of the L697W mutation, and the impact of the mutation on MYO3A ATPase and in vitro motility properties...... 103

Figure 4.2. Impact of L697W mutation on MYO3A properties in COS7 cells...... 106

Figure 4.3. Impact of L697W mutation on MYO3A properties in COS7 cells in the presence of Espin1. COS7 cells coexpressing...... 107

Figure 4.4. MYO3A L697W demonstrates dominant tipward localization when coexpressed with MYO3A WT and Espin1...... 109

Figure 5.1. Summary of the study...... 115

Figure 5.2. Proposed model for how MYO3A can enhance the formation and elongation of actin protrusions...... 119

Figure A1. EspinL binds myosin-III tail-homology domain 1 (THD1)...... 128

Figure B1. Characterization of MYO3A-Espin-1 interaction...... 129

Figure B2. Myo3-ARBs/Espin1 interaction is critical for the filopodia tip localizations of Espin1 and Myo3...... 130

Figure B3. ARBs are required for both Myo3b and Espin1 filopodia tip localization...... 132

Figure C1. Biochemical characterization and targeting in hair cells of p.Gly488Glu mutant MYO3A...... 133

x LIST OF TABLES

Table 2-1. List of plasmid constructs and associated primers...... 40

Table 3-1. Summary of actin-activated ATPase activity and in vitro motility results...... 71

Table 3-2. Summary of parameters used to quantify MYO3-associated actin protrusions...... 72

Table 3-3. List of primers used to generate novel constructs for this study. ... 73

Table 4-1. Actin activated ATPase and in vitro motility results- MYO3A 2IQ L697W c-GFP ...... 102

xi ABBREVIATIONS aa, amino acid

ADP, adenosine diphosphate

ATP, adenosine triphosphate

ATPase, adenosine triphosphatase

CaM, calmodulin

CLB, cold lysis buffer

DTT, dithiothreitol

EDTA, ethylene diamine tetraacetic acid

Espin, ectoplasmic specialization protein

EspinL, ectoplasmic specialization protein-like

GFP, green fluorescent protein

GST, glutathione S-transferase

MORN4, membrane occupation and recognition nexus protein 4

MYO3, myosin 3

NINAC, neither inactivation nor activation afterpotential protein-C

PBP’s, parallel actin bundle based protrusions

RTP, retinophilin

SDS-PAGE, sodium dodecyl sulfate-polyacrylamide gel electrophoresis

xii ACKNOWLEDGEMENTS

Firstly, I would like to truly thank God and my spiritual master Guruhari

Hariprasad Swamiji for helping me recognize my true potential and passion for research, and for giving me inspiration to complete a PhD degree. I cannot imagine my journey without Swamiji’s constant nurturing, motivation and academic guidance. My gratitude and appreciation for His blessings and involvement in my life cannot be expressed in words. I would also like to thank Tyag Swami, Bhakti

Swami and Kishanji for giving me the most practical spiritual and social guidance.

I would like to thank Dr. Christopher Yengo, who has been a spectacular mentor and advisor throughout this journey. Dr. Yengo’s tireless commitment to research has truly been an inspiration for me. I appreciate his advice for both research and preparing me for my next step in academia. I am thankful to Dr.

Yengo for giving me opportunity to thoroughly enjoy doing interdisciplinary and collaborative research, and achieving significant results. I am grateful that he reminded me to stay humble and perseverant in the most trying of circumstances.

I appreciate all his contributions of ideas, time and funding. I am also thankful for allowing me to attend national meetings from my first year and encouraging me to present our research work. This experience has undoubtedly enriched me tremendously and has left a significant impact on my career. xiii I am also grateful to my committee members Dr. Lisa Shantz, Dr. Scot

Kimball, Dr. Hui-Ling Chiang and Dr. Colin Barnstable for constant appreciation and providing insightful comments on my work. I thank all my teachers at the Penn

State College of Medicine who have supported and guided me to grow intellectually throughout this period. My friends in Yengo lab have made this a really memorable and enriching experience. I am thankful to Dr. Omar Quintero and William Unrath, for providing me scientific advice and technical expertise whenever I hit dead-ends. There were days when experiments failed repeatedly, but their assistance to provide new ideas helped me through. I thank Anja

Swenson, Lina Jamis and Wanjian Tang for their help with my project and making each day in the lab enjoyable. Support from all other current and past Yengo lab members is also appreciated.

Outside of the lab, I would like to thank my friends in Hershey who made this experience pleasurable. A big thank you to Darshan Trivedi, Sandip Savaliya,

Vijay Kale, Varun Prabhu, Ushma Doshi, Parag Sehgal, Chintan Patel, Hardik

Patel, Pinkesh Gandhi, Ankit Kapadia, Bharg Patel, Vrishin Shah, Parth Gala and all the members of Hershey Sabha for all the great times and outings. It is a gift from God to have these people as part of my life. All the members of Haridham,

Parsippany family have tremendously helped and motivated me in countless ways.

My sincere thanks to all the fellow grad students, friendly administrative staff of the

Physiology Department and graduate student office. Finally, and most importantly,

I would like to thank my mom and dad for their blessings, support and unending xiv encouragement. I dedicate this work to both of you. Support from all the members of Raval family is also appreciated. Special thanks to my brother, parents-in-law and brother-in-law for their constant support. I am thankful to my wife Urvi Mehta.

Her love, faith, and confidence in me is the driving force throughout this beautiful journey.

1

Chapter 1

Introduction

Movement has always been looked upon as an index of life. Most forms of movement that take place in the cellular world are powered by molecular motors.

Nature has ingeniously designed these molecular work-horses to generate piconewton forces and nanometer displacements. They do so by converting chemical energy into mechanical work for facilitating various cellular functions.

There are three major types of cytoskeletal motors: myosins, which use actin as tracks, and dyneins and kinesins, which move on microtubules. This study is focused on myosin motors, which by a cyclic interaction with actin performs a number of cellular functions like cargo or organelle transport, cell movement, muscle contraction, cytokinesis and cell polarization1-3. Thus, actin-myosin interactions play a central role in cell biology. The myosin superfamily is a large and diverse family of proteins comprised of at least 35 classes that are ubiquitously expressed in eukaryotic cells4, out of which ~12 classes are known to be expressed in humans5 (Fig. 1.1). Mutations in myosin have been reported to be associated with numerous genetic diseases such as non-syndromic deafness6-8, retinal degeneration9, cardiomyopathies10 and Griscelli’s syndrome (autosomal recessive disorder characterized by albinism or hypopigmentation)11. 2 Actin not only provides tracks for the movement of myosin motors, but it is also crucial for governing cell shape and size. Eukaryotic cells produce a variety of actin based protrusions which perform an array of functions depending upon the specific cell type in which these are present. Some of the common functions performed by actin based protrusions are cell locomotion, nutrient sensing and Figure 1.1. An unrooted evolutionary tree of the myosin- superfamily. The human genome encodes for ~40 myosin absorption, and genes that are divided in ~12 classes based on their motor and phagocytosis12. Actin tail domain structures. For some of the myosin sequences, homologs from rat (myr1, myr4, myr6, and myr8) or mouse based protrusions can (Myo1f) were used to generate the tree as indicated. (Adapted be broadly divided into from Berg et al., 20015). two major categories, branched actin based protrusions and bundled actin based protrusions (Fig. 1.2). Invadopodia13 or Lamelliopodia14 are categorized as branched actin based protrusions which consists of a dense meshwork of actin filaments that arise at fixed 70ᴼ angles towards the leading edge of the cell15. Actin- related protein-2/3 (Arp2/3) complex mediated actin nucleation is crucial for the 3 formation of branched actin based protrusions15. Filopodia, microvilli and stereocilia are categorized as bundled actin based protrusions. These are

Figure 1.2. Types of cellular actin based protrusions. Filopodia, microvilli and stereocilia are supported by parallel actin filament bundles, and lamellipodia are formed by a meshwork of branched actin filaments. EM images from left to right- Actin in filopodia observed using EM of platinum replicas (adapted from Revenu et al., 2004)12; brush border microvilli actin bundles revealed by Transmission EM (adapted from Revenu et al., 2004)12; SEM image of vertebrate inner ear hair bundle (stereocilia) (adapted from Rzadzinska et al., 2004)62; Lamellipodial actin revealed by EM of platinum replicas (adapted from Revenu et al., 200412). cylindrical shaped surface protrusions which consists of actin filaments that are bundled together by a variety of actin crosslinking proteins16-18. Several classes of 4 unconventional myosins are also known to be functional in bundled actin based protrusions19 (Fig. 1.3).

Figure 1.3. Unconventional myosins that are functional in actin bundle based protrusions. Bar diagrams of unconventional myosins along with an indication of the respective protrusion(s) in which each of the motor is functional. The conserved motor domain is shown in red and class specific c-terminal tail domains are shown in blue. (Adapted from Nambiar et al., 201019).

Types of parallel actin bundle based protrusions and associated actin regulatory proteins.

The ability of crosslinking proteins to orient actin filaments during bundle formation allows the production of parallel actin based protrusions (PBPs) - filopodia, microvilli and stereocilia12,17. The polarized actin tracks also enable myosin motors to perform directed movement and hence, transport of cellular 5 cargos. The supporting actin filaments of all three PBPs demonstrate varying retrograde flow rates. In the steady state, addition of actin monomers at plus-ends

(or barbed ends) of the filaments (polymerization), and removal from the base (or pointed end) of the filaments (depolymerization) is balanced by a critical concentration of actin monomers in the cytosol. This phenomenon of continuous actin filament assembly at barbed ends and disassembly at pointed end is called treadmilling.

Filopodia

Filopodia play an important role in cell migration, external environment probing and cell-cell interaction20. A range of actin cytoskeleton regulatory proteins including myosin motors are known to be present in filopodia and/or play a role in filopodia formation. Although many of these proteins are cell-type specific, the most common actin regulatory proteins crucial for filopodia formation are: Ena/Vasp21,22, myosin 10 (MYO10)23, fascin18, and formin24. Filopodia range from 1-5µm in length and are composed of 10-20 actin filaments bundled together by the crosslinker fascin18,20 (Fig. 1.2). Filopodial actin bundles undergo retrograde flow rates of

~1.2µm/min25. Lamellipodial branched actin can undergo Ena/Vasp mediated reorganization for filopodia formation26 (Fig. 1.2). Ena/Vasp localizes to the tips of filopodia and are believed to play a role in barbed-end protection from capping proteins (anti-capping activity), actin cross-linking, filament elongation and anti- branching21,27. Ena/Vasp are also known to recruit profilin to the barbed ends for 6 filopodia elongation28. MYO10 is an unconventional myosin motor which shows intrafilopodial motility and has the property to tip-localize in filopodia of various cell types23. MYO10 has been implicated in filopodia formation via several different mechanisms29. MYO10 is proposed to transport Ena/Vasp to the filopodia tips30 and crosslink actin filaments to facilitate filopodia formation by a mechanism similar to the convergent model29. Recent studies have shown that MYO10 requires an active motor domain and dimerization for filopodia formation29. Formins are known to play role in processive barbed end nucleation and elongation in filopodia24, whereas, fascin plays a role in tightly cross-linking the filopodia F-actin bundles18.

Microvilli

Microvilli and microvilli-like structures carry out specialized functions and are present in a variety of polarized cells like kidney cells, schwann cells, and intestinal epithelial (brush border) cells19. Microvilli are known to be supported by ~20-30 actin filaments of 1-5 µm in length12,31 and they are rooted in the dense actin network which is called the terminal web (Fig. 1.2). Actin filaments in microvilli treadmill at ~0.2 µm/sec17,32, which is slower than filopodia. Three major actin bundling proteins crucial for microvilli formation and regulation are villin33, fimbrin16 and Ectoplasmic specialization protein (Espin)34. Villin is a calcium dependent actin bundling and severing protein35-37, which along with fimbrin is thought to be one of the first actin bundlers to be recruited to the apical region of the intestinal epithelial cell protrusions38,39. Villin is proposed to play a role in the dynamic 7 turnover of the microvilli F-actin core by increasing the local concentration of free actin (by its F-actin severing activity), which is crucial for epithelial plasticity

(processes like wound repair and epithelial to mesenchymal transition)40,41.

Fimbrin is implicated in anchoring microvilli parallel actin bundles into the terminal web42, hence, promoting stability of the microvilli. Villin and fimbrin bind to F-actin only, whereas, Espin is unique in its ability to bind both F-actin and actin monomers43. Espin is known to bind F-actin in a calcium independent manner34, and it is thought to play a major role in regulating the elongation of microvilli17,44.

Brush border microvilli are built in close proximity to each other resulting in high density of these surface protrusions. The closely interspaced microvilli on the apical surface of epithelial cells of hollow organs like gut, kidney, and lung present a unique challenge of preventing the membrane tension from causing fusion of adjacent protrusions45. Unconventional myosins play a crucial role in cross-linking the plasma membrane to the underlying actin cytoskeleton, and thus preventing membrane tension from promoting fusion of the adjacent microvilli plasma membrane. Class I myosins (MYO1)32, myosin 6 (MYO6)46, and myosin 7B

(MYO7B)47 are the common unconventional myosins known to play a role in microvilli. Class I myosins are single-headed, slow motors that cross-link the plasma membrane to the actin core48,49. MYO1 isoforms are implicated in functions like endo and exocytosis50,51, and the maintenance of membrane tension52. Among all the class I myosin isoforms, MYO1A is highly expressed in intestinal brush borders. The lipid binding tail homology 1 domain (TH1) in the MYO1A tail region 8 allows the motor to interact with the plasm membrane53,54, whereas the motor head interacts with the actin core. MYO1A mutations are known to be associated with loss of apico-basal polarity in intestinal epithelial cells55. MYO6 is a unique class of unconventional myosin because of its minus-end directed motility on actin filaments56. MYO6 is known to regulate clathrin-dependent endocytosis57, and it is also known to facilitate membrane-cytoskeleton interactions. The homozygous recessive MYO6 mutant mouse model (Snell’s waltzer) shows structural defects in brush border microvilli as well as loss of hearing and vestibular functions58-59.

MYO7B along with several other extracellular adhesion molecules (like protocadherin-24 and mucin-like cadherin) plays a key role in microvilli organization47. The intermicrovillar adhesion complex is present in protruding microvilli during early points of differentiation, which further enables the addition of microvilli into existing clusters47. MYO7B is proposed to be crucial for targeting the intermicrovillar adhesion complex from the base to the tips of supporting actin bundles. It has been reported previously that microvilli formed on the apical surface of vertebrate inner ear hair cells during the early developmental stages are secondarily modified (by the lateral addition of filaments to the microvillar bundle as well as elongation of the filaments in the bundle) to form stereocilia60,61.

Stereocilia

Stereocilia are highly specialized PBPs that are present on the apical surface of inner ear hair cells which enables our auditory and vestibular functions. Each 9 stereocilium is composed of more than 200 actin filaments60 (Fig. 1.2), which reflects the physical forces (shear stress) it would have to endure from the surrounding environment. There are contrasting reports about the stereocilia core actin bundle treadmilling rate. Earlier studies which examined the actin turnover rate in hair cell explants expressing GFP β-actin, demonstrated that actin flux rates of ~0.9µm/24h in the short stereocilia and ~2.8µm/24h in the long stereocilia62,63.

However, some of the recent reports suggest that at the stereocilia tips the actin monomers are in a dynamic equilibrium with F-actin polymerizing ends, whereas remainder of the stereocilia actin core is static64,65. This model is called tip-turnover model66. Espin isoforms are the major cross-linkers present in the stereocilia44.

The ability of Espin to bundle actin filaments in a calcium-independent manner34 makes it more suitable for its function in stereocilia which undergoes large fluctuations in intracellular calcium levels in response to external stimuli (sound waves). Class III myosins (MYO3A and MYO3B)7,67, myosin 15A (MYO15A)68 and myosin 7A (MYO7A)69 are the major unconventional myosin motors which are functional in stereocilia. MYO3, MYO15A and MYO7A localize in different compartments at the tips of stereocilia70. MYO3A and MYO15A require an active motor domain for their tip-localization activity70. MYO3 isoforms are proposed to transport Espin171, whereas MYO15A is proposed to transport epidermal growth factor receptor kinase substrate 8 (EPS8)72 and the scaffolding protein whirlin68 from the base to the tips of stereocilia. Autosomal recessive mutations leading to non-syndromic hearing-loss in humans are denoted as DFNB. Loss-of-function

MYO3A mutations are called DFNB307 and MYO15A are called DFNB36. MYO3A 10 mutant mouse models show a similar phenotype to human DFNB3073. A recent study demonstrated severe defects in the stereocilia structure and functions in a

MYO3A/MYO3B double knock out mice61. The MYO15 mutant mouse model called shaker2 demonstrated abnormally short stereocilia leading to hearing and vestibular defects6,74. MYO7A is present at the tips of stereocilia in the shorter rows75 and it is proposed to interact with Twinfillin-2, an actin binding protein which inhibits actin polymerization at the tips of stereocilia76. It is hypothesized that the

MYO7A-Twinfilin-2 interaction may be responsible for maintenance of slower actin turnover rates in shorter stereocilia. Consistent with this hypothesis, mice lacking

MYO7A show abnormally long stereocilia75. However, the precise mechanism for stereocilia staircase pattern formation, length regulation and ultrastructure maintenance is still unclear.

Discovery of Class III Myosins

The first member of class III myosins called NINAC (neither inactivation nor afterpotential C) was discovered in a Drosophila mutant screen77. NINAC null mutant flies demonstrated an altered electroretinogram phenotype78. In

Drosophila, a differentially spliced transcript leads to two NINAC proteins; a short form called NINACp132, and a long form called NINACp17479. The Drosophila photoreceptor consists of two compartments; a cell body (equivalent to vertebrate photoreceptor inner segment) which consists of all the internal organelles, and a rhabdomere (equivalent to vertebrate photoreceptor outer segment) which 11 contains actin filled microvilli-like protrusions that contain the molecular machinery for phototransduction80,81 (Fig. 1.4). NINACp132 localizes in the photoreceptor cell body and NINACp174 is predominantly found in the rhabdomeric region82. It is believed that many proteins of the Drosophila phototransduction form a core signaling protein complex called the ‘signalplex’. NINAC is known to interact with at least one of the core proteins of the signalplex, and this interaction is required for proper subcellular localization of the signalplex in the rhabdomeres78,83.

NINAC is implicated in the subcellular distribution of calmodulin (CaM) in Figure 1.4. Diagram depicting cross- sectional view of a Drosophila Drosophila photoreceptor cells84, which is photoreceptor cell. Each Drosophila crucial for termination of photoreceptor cell consists of a cell body phototransduction cascade. NINAC has which contains all the internal organelles, and a microvillar structure called also been shown to regulate arrestin (a rhabdomere, which is the site of protein which terminates the phototransduction. NINACp132 and NINACp174 are predominantly localized photoresponse by binding to in cell body and rhabdomere respectively metarhodopsin) translocation from the (adapted from Wang and Montell, 200781). cell body to rhabdomeres in a Ca2+ dependent manner85. Recent reports have shown that a small 23kD protein called retinophilin interacts with NINACp174 and the stability of retinophilin is dependent on NINACp17486,87. Retinophilin contains a motif called membrane occupation and recognition nexus (MORN)88 and it is known to undergo reversible phosphorylation in a light dependent manner, 12 suggesting that it plays a regulatory role in the phototransduction process86. It remains to be seen how NINAC and retinophilin and its mammalian homologs interact and, what are its implications in vertebrate sensory systems. Despite considerable efforts by several groups NINAC motor activity is yet to be demonstrated.

Class III myosins and implications in human hereditary hearing loss

Vertebrate inner ear physiology

The acoustic waves collected by the external ear are converted to mechanical vibration by the middle ear. The stapes bone connects the middle ear to the cochlea, the end organ for sound detection. In the cochlea or inner ear (Fig. 1.5) the mechanical waves are converted to fluid pressure waves. The cochlea is a

Figure 1.5. Structure of the organ of corti. A, Cross-section through the cochlea or inner ear showing the major features; organ of corti, tectorial membrane, and basilar membrane supporting the inner and outer hair cells. B, Enlarged schematic diagram of the hair bundle and associated tip links. When stimulated, the stereocilia are deflected towards the tallest row defining the positive direction of stimulation (adapted from Ref. Peng et al., 201189 and Fettiplace et al., 200693). 13 highly specialized compartment capable of separating the pressure wave into frequency components that vibrate the basilar membrane in a tonotopic manner, which in turn stimulates the sensory hair cells by deflecting the specialized organelle called hair bundle or stereocilia89 (Fig. 1.5). Information from the acoustic environment (music, speech or other sounds) is predominantly replayed by the electrical signals of inner hair cells, whereas the outer hair cells act as a stimulus that feeds back to or alters the basilar membrane vibrations90. The stereocilia are arranged in a staircase pattern with the shorter rows towards the inside and longer rows towards the outside. Upon stimulation the stereocilia deflect towards the taller rows which opens the mechanically gated ion channels present at the tips89,91, whereas, deflection away from the longer rows leads to closure of the ion channels

(Fig. 1.5). It is believed that hair bundle deflection towards the taller row would exert a force onto a filamentous tip link that attaches the tip of the shorter stereocilia to the side of the next taller row92. This integrated mechanical coupling ensures that sound waves are detected over a wide frequency range93. Thus, maintenance of stereocilia shape and size is critical for normal auditory and vestibular functions89,91,94.

Domain structure of vertebrate class III myosins

Class III myosins are a unique class of unconventional myosins containing a conserved N-terminal kinase domain, central motor domain, as well as a class specific tail region which varies in sequence between isoforms (Fig. 1.6)95. In 14 vertebrates, there are two separate genes encoding for MYO3 isoforms- MYO3A and MYO3B95. Both isoforms contain an N-terminal kinase domain, which allows the motor to be autophosphorylated at specific sites within the motor domain96. It

Figure 1.6. Domain structure of vertebrate class III myosins. Both MYO3A and MYO3B contain N-terminal kinase domain, the central motor domains, neck region, and isoform specific tail region. MYO3A tail domain is encoded by six different exons (exon 30-35), and contains two known domains; tail homology I motif (THD1) and tail homology II motif (THD2). MYO3B contains a relatively short tail consisting of THD1. In the MYO3A tail sequence there is overlap in the sequence at the junctions of exon 31-32, 33-34 and 34-35 which are underlined. The vertical solid lines represent IQ motifs. Diagrams are drawn to scale. has been previously shown that the phosphorylation of two threonine residues

(Thr-178 and Thr-184) in MYO3A kinase domain activation loop enhances kinase activity leading to phosphorylation of MYO3A motor domain96. Once the motor is phosphorylated, its ATPase activity and actin affinity decreases96-98. Thus, it is proposed that through a intermolecular autophosphorylation mechanism MYO3 autoregulates its motor activity99. The precise mechanism of MYO3 15 dephosphorylation is not known. Both the MYO3 isoforms consist of a neck region containing two isoleucine-glutamine rich IQ motifs, which are binding sites for calmodulin95. Structurally, the major difference between the two isoforms is in the tail domains. MYO3A tail domain is encoded by six different exons (exon 30-35), and it consists of a conserved cargo binding domain called tail homology I motif

(THD1) and an F-actin binding domain called tail homology II motif (THD2). The

MYO3B tail region is relatively shorter and only contains THD167,95.

Role of class III myosins in vertebrate stereocilia

Class III myosins are plus-end directed motors which are expressed in inner ear cochlea, retina, intestine, brain and testis95. In the inner ear, both MYO3A and

MYO3B localize at the tips of actin-rich stereocilia. The THD1 mediates binding of

MYO3 to the Ankyrin rich domain (ARD) of its cargo Espin1 (Fig. 1.6 and 1.7)67,100.

It is proposed that MYO3 targets and transports Espin1 from the base to the tips of vertebrate inner ear hair cell stereocilia. Once Espin1 is localized at the tips, it gets incorporated into the actin bundles, while its WH2 domain facilitates elongation and stabilization of actin protrusions67,100. Lack of MYO3A leads to non- syndromic hearing loss in humans (DFNB30)7. Whereas, lack of Espin1 expression during early development in a mouse model leads to unusually short stereocilia which degenerate shortly after birth101. Previous studies demonstrated that co-expression of MYO3A and Espin1 can stimulate stereocilia elongation in cultured hair cells100. MYO3A also has a property to tip localize in filopodia and 16 induce filopodia formation independent of Espin1 when expressed in heterologous cells70,99,100,102.

It is believed that the presence of THD2 allows MYO3A to translocate along actin filaments using an inchworm-like mode of motility, whereas, MYO3B relies on binding to Espin1 and using its actin binding domain (ABM) as a “crutch” or actin binding replacement to translocate along the actin filaments (Fig. 1.7). Thus, theoretically,

MYO3B could compensate for the loss of

MYO3A in vertebrate stereocilia. However, it is intriguing that despite a proposed compensatory role by MYO3B, patients with mutations in MYO3A develop deafness. Figure 1.7. Model of MYO3 mediated ESPN1 (Espin1) transport To uncover the molecular basis of deafness- in actin based protrusions. MYO3A causing mutations in MYO3A it is critically could use its motor domain and THDII (THD2) to translocate along actin important to dissect the structural and filaments. MYO3B, which lacks THD2, functional differences between MYO3 binds to Espin1 (or ESPN1) via its THD1, allowing it to use the ABM of isoforms and investigate its impact on actin Espin1 as a crutch to translocate protrusions. There are several important along the actin filaments. (Ref. Merritt et al., 200967). aspects of class III myosin function which are not well understood. First, it will be crucial to investigate if there are any cargo proteins in addition to Espin1 which are associated with MYO3 mediated transport 17 in stereocilia. Secondly, it is important to examine the differences between the motor and tail domains of MYO3A and MYO3B, and how those differences impact their function in actin protrusions. This information will be specifically important to understand the late onset hearing-loss observed in patients with mutations in

MYO3A. Third, since MYO3A can translocate along actin bundles independently, it will be crucial to investigate the impact of MYO3A on actin protrusion dynamics independent of Espin1. Lastly, it is important to perform a complete biochemical and cell-biological characterization of deafness causing novel MYO3A mutations.

Examining the impact of deafness associated MYO3A mutations may provide novel insights into the native role of MYO3A in stereocilia structure and function. It may further be useful for developing therapeutic approaches for treating or preventing progressive hearing loss that results from stereocilia degeneration.

Altogether, addressing these questions will greatly enhance our understanding of the role of class III myosins in actin protrusions, and provide novel insights into the mechanism of stereocilia ultrastructure maintenance.

18 References

1 Mooseker, M. S. F., B. J. in Myosins Vol. 7 1-34 (Springer Netherlands, 2008). 2 Hartman, M. A., Finan, D., Sivaramakrishnan, S. & Spudich, J. A. Principles of unconventional myosin function and targeting. Annual review of cell and developmental biology 27, 133-155, doi:10.1146/annurev-cellbio-100809- 151502 (2011). 3 Hartman, M. A. & Spudich, J. A. The myosin superfamily at a glance. Journal of cell science 125, 1627-1632, doi:10.1242/jcs.094300 (2012). 4 Odronitz, F. & Kollmar, M. Drawing the tree of eukaryotic life based on the analysis of 2,269 manually annotated myosins from 328 species. Genome biology 8, R196, doi:10.1186/gb-2007-8-9-r196 (2007). 5 Berg, J. S., Powell, B. C. & Cheney, R. E. A millennial myosin census. Molecular biology of the cell 12, 780-794 (2001). 6 Wang, A. et al. Association of unconventional myosin MYO15 mutations with human nonsyndromic deafness DFNB3. Science 280, 1447-1451 (1998). 7 Walsh, T. et al. From flies' eyes to our ears: mutations in a human class III myosin cause progressive nonsyndromic hearing loss DFNB30. Proceedings of the National Academy of Sciences of the United States of America 99, 7518-7523, doi:10.1073/pnas.102091699 (2002). 8 Friedman, T. B., Sellers, J. R. & Avraham, K. B. Unconventional myosins and the genetics of hearing loss. American journal of medical genetics 89, 147-157 (1999). 9 Lin-Jones, J. et al. Identification and localization of myosin superfamily members in fish retina and retinal pigmented epithelium. The Journal of comparative neurology 513, 209-223, doi:10.1002/cne.21958 (2009). 10 Rayment, I., Holden, H. M., Sellers, J. R., Fananapazir, L. & Epstein, N. D. Structural interpretation of the mutations in the beta-cardiac myosin that have been implicated in familial hypertrophic cardiomyopathy. Proceedings of the National Academy of Sciences of the United States of America 92, 3864-3868 (1995). 11 Sokac, A. M. & Bement, W. M. Regulation and expression of metazoan unconventional myosins. International review of cytology 200, 197-304 (2000). 12 Revenu, C., Athman, R., Robine, S. & Louvard, D. The co-workers of actin filaments: from cell structures to signals. Nature reviews. Molecular cell biology 5, 635-646, doi:10.1038/nrm1437 (2004). 13 Weaver, A. M. Invadopodia. Current biology : CB 18, R362-364, doi:10.1016/j.cub.2008.02.028 (2008). 14 Pollard, T. D. & Borisy, G. G. Cellular motility driven by assembly and disassembly of actin filaments. Cell 112, 453-465 (2003). 19 15 Svitkina, T. M. & Borisy, G. G. Arp2/3 complex and actin depolymerizing factor/cofilin in dendritic organization and treadmilling of actin filament array in lamellipodia. The Journal of cell biology 145, 1009-1026 (1999). 16 Bretscher, A. & Weber, K. Fimbrin, a new microfilament-associated protein present in microvilli and other cell surface structures. The Journal of cell biology 86, 335-340 (1980). 17 Loomis, P. A. et al. Espin cross-links cause the elongation of microvillus- type parallel actin bundles in vivo. The Journal of cell biology 163, 1045- 1055, doi:10.1083/jcb.200309093 (2003). 18 Vignjevic, D. et al. Role of fascin in filopodial protrusion. The Journal of cell biology 174, 863-875, doi:10.1083/jcb.200603013 (2006). 19 Nambiar, R., McConnell, R. E. & Tyska, M. J. Myosin motor function: the ins and outs of actin-based membrane protrusions. Cellular and molecular life sciences : CMLS 67, 1239-1254, doi:10.1007/s00018-009-0254-5 (2010). 20 Mattila, P. K. & Lappalainen, P. Filopodia: molecular architecture and cellular functions. Nature reviews. Molecular cell biology 9, 446-454, doi:10.1038/nrm2406 (2008). 21 Bachmann, C., Fischer, L., Walter, U. & Reinhard, M. The EVH2 domain of the vasodilator-stimulated phosphoprotein mediates tetramerization, F- actin binding, and actin bundle formation. The Journal of biological chemistry 274, 23549-23557 (1999). 22 Applewhite, D. A. et al. Ena/VASP proteins have an anti-capping independent function in filopodia formation. Molecular biology of the cell 18, 2579-2591, doi:10.1091/mbc.E06-11-0990 (2007). 23 Berg, J. S. & Cheney, R. E. Myosin-X is an unconventional myosin that undergoes intrafilopodial motility. Nature cell biology 4, 246-250, doi:10.1038/ncb762 (2002). 24 Kovar, D. R. & Pollard, T. D. Progressing actin: Formin as a processive elongation machine. Nature cell biology 6, 1158-1159, doi:10.1038/ncb1204-1158 (2004). 25 Kerber, M. L. et al. A novel form of motility in filopodia revealed by imaging myosin-X at the single-molecule level. Current biology : CB 19, 967-973, doi:10.1016/j.cub.2009.03.067 (2009). 26 Svitkina, T. M. et al. Mechanism of filopodia initiation by reorganization of a dendritic network. The Journal of cell biology 160, 409-421, doi:10.1083/jcb.200210174 (2003). 27 Bear, J. E. et al. Antagonism between Ena/VASP proteins and actin filament capping regulates fibroblast motility. Cell 109, 509-521 (2002). 28 Ferron, F., Rebowski, G., Lee, S. H. & Dominguez, R. Structural basis for the recruitment of profilin-actin complexes during filament elongation by Ena/VASP. The EMBO journal 26, 4597-4606, doi:10.1038/sj.emboj.7601874 (2007). 29 Tokuo, H., Mabuchi, K. & Ikebe, M. The motor activity of myosin-X promotes actin fiber convergence at the cell periphery to initiate filopodia formation. 20 The Journal of cell biology 179, 229-238, doi:10.1083/jcb.200703178 (2007). 30 Tokuo, H. & Ikebe, M. Myosin X transports Mena/VASP to the tip of filopodia. Biochemical and biophysical research communications 319, 214- 220, doi:10.1016/j.bbrc.2004.04.167 (2004). 31 Revenu, C. et al. A new role for the architecture of microvillar actin bundles in apical retention of membrane proteins. Molecular biology of the cell 23, 324-336, doi:10.1091/mbc.E11-09-0765 (2012). 32 Tyska, M. J. & Mooseker, M. S. MYO1A (brush border myosin I) dynamics in the brush border of LLC-PK1-CL4 cells. Biophysical journal 82, 1869- 1883, doi:10.1016/S0006-3495(02)75537-9 (2002). 33 Bretscher, A. & Weber, K. Villin: the major microfilament-associated protein of the intestinal microvillus. Proceedings of the National Academy of Sciences of the United States of America 76, 2321-2325 (1979). 34 Bartles, J. R., Zheng, L., Li, A., Wierda, A. & Chen, B. Small espin: a third actin-bundling protein and potential forked protein ortholog in brush border microvilli. The Journal of cell biology 143, 107-119 (1998). 35 Glenney, J. R., Jr. & Weber, K. Calcium control of microfilaments: uncoupling of the F-actin-severing and -bundling activity of villin by limited proteolysis in vitro. Proceedings of the National Academy of Sciences of the United States of America 78, 2810-2814 (1981). 36 Walsh, T. P., Weber, A., Davis, K., Bonder, E. & Mooseker, M. Calcium dependence of villin-induced actin depolymerization. Biochemistry 23, 6099-6102 (1984). 37 Bretscher, A. & Weber, K. Villin is a major protein of the microvillus cytoskeleton which binds both G and F actin in a calcium-dependent manner. Cell 20, 839-847 (1980). 38 Ezzell, R. M., Chafel, M. M. & Matsudaira, P. T. Differential localization of villin and fimbrin during development of the mouse visceral endoderm and intestinal epithelium. Development 106, 407-419 (1989). 39 Heintzelman, M. B. & Mooseker, M. S. Assembly of the brush border cytoskeleton: changes in the distribution of microvillar core proteins during enterocyte differentiation in adult chicken intestine. Cell motility and the cytoskeleton 15, 12-22, doi:10.1002/cm.970150104 (1990). 40 Ubelmann, F. et al. Enterocyte loss of polarity and gut wound healing rely upon the F-actin-severing function of villin. Proceedings of the National Academy of Sciences of the United States of America 110, E1380-1389, doi:10.1073/pnas.1218446110 (2013). 41 Patnaik, S. et al. By moonlighting in the nucleus, villin regulates epithelial plasticity. Molecular biology of the cell 27, 535-548, doi:10.1091/mbc.E15- 06-0453 (2016). 42 Grimm-Gunter, E. M. et al. Plastin 1 binds to keratin and is required for terminal web assembly in the intestinal epithelium. Molecular biology of the cell 20, 2549-2562, doi:10.1091/mbc.E08-10-1030 (2009). 21 43 Loomis, P. A. et al. Targeted wild-type and jerker espins reveal a novel, WH2-domain-dependent way to make actin bundles in cells. Journal of cell science 119, 1655-1665, doi:10.1242/jcs.02869 (2006). 44 Sekerkova, G., Zheng, L., Loomis, P. A., Mugnaini, E. & Bartles, J. R. Espins and the actin cytoskeleton of hair cell stereocilia and sensory cell microvilli. Cellular and molecular life sciences : CMLS 63, 2329-2341, doi:10.1007/s00018-006-6148-x (2006). 45 Atilgan, E., Wirtz, D. & Sun, S. X. Mechanics and dynamics of actin-driven thin membrane protrusions. Biophysical journal 90, 65-76, doi:10.1529/biophysj.105.071480 (2006). 46 Yang, L. E., Maunsbach, A. B., Leong, P. K. & McDonough, A. A. Redistribution of myosin VI from top to base of proximal tubule microvilli during acute hypertension. Journal of the American Society of Nephrology : JASN 16, 2890-2896, doi:10.1681/ASN.2005040366 (2005). 47 Crawley, S. W. et al. Intestinal brush border assembly driven by protocadherin-based intermicrovillar adhesion. Cell 157, 433-446, doi:10.1016/j.cell.2014.01.067 (2014). 48 Jontes, J. D., Milligan, R. A., Pollard, T. D. & Ostap, E. M. Kinetic characterization of brush border myosin-I ATPase. Proceedings of the National Academy of Sciences of the United States of America 94, 14332- 14337 (1997). 49 Wolenski, J. S., Cheney, R. E., Forscher, P. & Mooseker, M. S. In vitro motilities of the unconventional myosins, brush border myosin-I, and chick brain myosin-V exhibit assay-dependent differences in velocity. The Journal of experimental zoology 267, 33-39, doi:10.1002/jez.1402670106 (1993). 50 Novak, K. D., Peterson, M. D., Reedy, M. C. & Titus, M. A. Dictyostelium myosin I double mutants exhibit conditional defects in pinocytosis. The Journal of cell biology 131, 1205-1221 (1995). 51 Bose, A. et al. Unconventional myosin Myo1c promotes membrane fusion in a regulated exocytic pathway. Molecular and cellular biology 24, 5447- 5458, doi:10.1128/MCB.24.12.5447-5458.2004 (2004). 52 Nambiar, R., McConnell, R. E. & Tyska, M. J. Control of cell membrane tension by myosin-I. Proceedings of the National Academy of Sciences of the United States of America 106, 11972-11977, doi:10.1073/pnas.0901641106 (2009). 53 Hayden, S. M., Wolenski, J. S. & Mooseker, M. S. Binding of brush border myosin I to phospholipid vesicles. The Journal of cell biology 111, 443-451 (1990). 54 Mazerik, J. N. & Tyska, M. J. Myosin-1A targets to microvilli using multiple membrane binding motifs in the tail homology 1 (TH1) domain. The Journal of biological chemistry 287, 13104-13115, doi:10.1074/jbc.M111.336313 (2012). 55 Mazzolini, R. et al. Brush border myosin Ia has tumor suppressor activity in the intestine. Proceedings of the National Academy of Sciences of the 22 United States of America 109, 1530-1535, doi:10.1073/pnas.1108411109 (2012). 56 Wells, A. L. et al. Myosin VI is an actin-based motor that moves backwards. Nature 401, 505-508, doi:10.1038/46835 (1999). 57 Ameen, N. & Apodaca, G. Defective CFTR apical endocytosis and enterocyte brush border in myosin VI-deficient mice. Traffic 8, 998-1006, doi:10.1111/j.1600-0854.2007.00587.x (2007). 58 Avraham, K. B. et al. The mouse Snell's waltzer deafness gene encodes an unconventional myosin required for structural integrity of inner ear hair cells. Nature genetics 11, 369-375, doi:10.1038/ng1295-369 (1995). 59 Hegan, P. S., Lanahan, A. A., Simons, M. & Mooseker, M. S. Myosin VI and cardiomyopathy: Left ventricular hypertrophy, fibrosis, and both cardiac and pulmonary vascular endothelial cell defects in the Snell's waltzer mouse. Cytoskeleton (Hoboken) 72, 373-387, doi:10.1002/cm.21236 (2015). 60 Tilney, L. G. & DeRosier, D. J. Actin filaments, stereocilia, and hair cells of the bird cochlea. IV. How the actin filaments become organized in developing stereocilia and in the cuticular plate. Developmental biology 116, 119-129 (1986). 61 Lelli, A. et al. Class III myosins shape the auditory hair bundles by limiting microvilli and stereocilia growth. The Journal of cell biology, doi:10.1083/jcb.201509017 (2016). 62 Rzadzinska, A. K., Schneider, M. E., Davies, C., Riordan, G. P. & Kachar, B. An actin molecular treadmill and myosins maintain stereocilia functional architecture and self-renewal. The Journal of cell biology 164, 887-897, doi:10.1083/jcb.200310055 (2004). 63 Schneider, M. E., Belyantseva, I. A., Azevedo, R. B. & Kachar, B. Rapid renewal of auditory hair bundles. Nature 418, 837-838, doi:10.1038/418837a (2002). 64 Zhang, D. S. et al. Multi-isotope imaging mass spectrometry reveals slow protein turnover in hair-cell stereocilia. Nature 481, 520-524, doi:10.1038/nature10745 (2012). 65 Drummond, M. C. et al. Live-cell imaging of actin dynamics reveals mechanisms of stereocilia length regulation in the inner ear. Nature communications 6, 6873, doi:10.1038/ncomms7873 (2015). 66 McGrath, J., Roy, P. & Perrin, B. J. Stereocilia morphogenesis and maintenance through regulation of actin stability. Seminars in cell & developmental biology, doi:10.1016/j.semcdb.2016.08.017 (2016). 67 Merritt, R. C. et al. Myosin IIIB uses an actin-binding motif in its espin-1 cargo to reach the tips of actin protrusions. Current biology : CB 22, 320- 325, doi:10.1016/j.cub.2011.12.053 (2012). 68 Belyantseva, I. A. et al. Myosin-XVa is required for tip localization of whirlin and differential elongation of hair-cell stereocilia. Nature cell biology 7, 148- 156, doi:10.1038/ncb1219 (2005). 23 69 Boeda, B. et al. Myosin VIIa, harmonin and cadherin 23, three Usher I gene products that cooperate to shape the sensory hair cell bundle. The EMBO journal 21, 6689-6699 (2002). 70 Schneider, M. E. et al. A new compartment at stereocilia tips defined by spatial and temporal patterns of myosin IIIa expression. The Journal of neuroscience : the official journal of the Society for Neuroscience 26, 10243-10252, doi:10.1523/JNEUROSCI.2812-06.2006 (2006). 71 Salles, F. T. et al. Myosin IIIa boosts elongation of stereocilia by transporting espin 1 to the plus ends of actin filaments. Nature cell biology 11, 443-450, doi:10.1038/ncb1851 (2009). 72 Manor, U. et al. Regulation of stereocilia length by myosin XVa and whirlin depends on the actin-regulatory protein Eps8. Current biology : CB 21, 167- 172, doi:10.1016/j.cub.2010.12.046 (2011). 73 Walsh, V. L. et al. A mouse model for human hearing loss DFNB30 due to loss of function of myosin IIIA. Mammalian genome : official journal of the International Mammalian Genome Society 22, 170-177, doi:10.1007/s00335-010-9310-6 (2011). 74 Anniko, M., Sobin, A. & Wersall, J. Vestibular hair cell pathology in the Shaker-2 mouse. Archives of oto-rhino-laryngology 226, 45-50 (1980). 75 Prosser, H. M., Rzadzinska, A. K., Steel, K. P. & Bradley, A. Mosaic complementation demonstrates a regulatory role for myosin VIIa in actin dynamics of stereocilia. Molecular and cellular biology 28, 1702-1712, doi:10.1128/MCB.01282-07 (2008). 76 Rzadzinska, A. K., Nevalainen, E. M., Prosser, H. M., Lappalainen, P. & Steel, K. P. MyosinVIIa interacts with Twinfilin-2 at the tips of mechanosensory stereocilia in the inner ear. PloS one 4, e7097, doi:10.1371/journal.pone.0007097 (2009). 77 Matsumoto, H., Isono, K., Pye, Q. & Pak, W. L. Gene encoding cytoskeletal proteins in Drosophila rhabdomeres. Proceedings of the National Academy of Sciences of the United States of America 84, 985-989 (1987). 78 Wes, P. D. et al. Termination of phototransduction requires binding of the NINAC myosin III and the PDZ protein INAD. Nature neuroscience 2, 447- 453, doi:10.1038/8116 (1999). 79 Montell, C. & Rubin, G. M. The Drosophila ninaC locus encodes two photoreceptor cell specific proteins with domains homologous to protein kinases and the myosin heavy chain head. Cell 52, 757-772, doi:0092- 8674(88)90413-8 [pii] (1988). 80 Montell, C. Drosophila visual transduction. Trends in neurosciences 35, 356-363, doi:10.1016/j.tins.2012.03.004 (2012). 81 Wang, T. & Montell, C. Phototransduction and retinal degeneration in Drosophila. Pflugers Archiv : European journal of physiology 454, 821-847, doi:10.1007/s00424-007-0251-1 (2007). 82 Porter, J. A., Hicks, J. L., Williams, D. S. & Montell, C. Differential localizations of and requirements for the two Drosophila ninaC 24 kinase/myosins in photoreceptor cells. The Journal of cell biology 116, 683- 693 (1992). 83 Mazzotta, G. et al. Fly cryptochrome and the visual system. Proceedings of the National Academy of Sciences of the United States of America 110, 6163-6168, doi:10.1073/pnas.1212317110 (2013). 84 Porter, J. A., Minke, B. & Montell, C. Calmodulin binding to Drosophila NinaC required for termination of phototransduction. The EMBO journal 14, 4450-4459 (1995). 85 Hardie, R. C., Satoh, A. K. & Liu, C. H. Regulation of arrestin translocation by Ca2+ and myosin III in Drosophila photoreceptors. The Journal of neuroscience : the official journal of the Society for Neuroscience 32, 9205- 9216, doi:10.1523/JNEUROSCI.0924-12.2012 (2012). 86 Mecklenburg, K. L. et al. Retinophilin is a light-regulated phosphoprotein required to suppress photoreceptor dark noise in Drosophila. The Journal of neuroscience : the official journal of the Society for Neuroscience 30, 1238-1249, doi:10.1523/JNEUROSCI.4464-09.2010 (2010). 87 Venkatachalam, K. et al. Dependence on a retinophilin/myosin complex for stability of PKC and INAD and termination of phototransduction. The Journal of neuroscience : the official journal of the Society for Neuroscience 30, 11337-11345, doi:10.1523/JNEUROSCI.2709-10.2010 (2010). 88 Mecklenburg, K. L. Drosophila retinophilin contains MORN repeats and is conserved in humans. Molecular genetics and genomics : MGG 277, 481- 489, doi:10.1007/s00438-007-0211-7 (2007). 89 Peng, A. W., Salles, F. T., Pan, B. & Ricci, A. J. Integrating the biophysical and molecular mechanisms of auditory hair cell mechanotransduction. Nature communications 2, 523, doi:10.1038/ncomms1533 (2011). 90 Dallos, P. The active cochlea. The Journal of neuroscience : the official journal of the Society for Neuroscience 12, 4575-4585 (1992). 91 Hudspeth, A. J. The cellular basis of hearing: the biophysics of hair cells. Science 230, 745-752 (1985). 92 Pickles, J. O., Comis, S. D. & Osborne, M. P. Cross-links between stereocilia in the guinea pig organ of Corti, and their possible relation to sensory transduction. Hearing research 15, 103-112 (1984). 93 Fettiplace, R. & Hackney, C. M. The sensory and motor roles of auditory hair cells. Nature reviews. Neuroscience 7, 19-29, doi:10.1038/nrn1828 (2006). 94 Petit, C. & Richardson, G. P. Linking genes underlying deafness to hair- bundle development and function. Nature neuroscience 12, 703-710, doi:10.1038/nn.2330 (2009). 95 Erickson, F. L., Corsa, A. C., Dose, A. C. & Burnside, B. Localization of a class III myosin to filopodia tips in transfected HeLa cells requires an actin- binding site in its tail domain. Molecular biology of the cell 14, 4173-4180, doi:10.1091/mbc.E02-10-0656 (2003). 96 Quintero, O. A. et al. Myosin 3A kinase activity is regulated by phosphorylation of the kinase domain activation loop. The Journal of 25 biological chemistry 288, 37126-37137, doi:10.1074/jbc.M113.511014 (2013). 97 Dose, A. C., Ananthanarayanan, S., Moore, J. E., Burnside, B. & Yengo, C. M. Kinetic mechanism of human myosin IIIA. The Journal of biological chemistry 282, 216-231, doi:10.1074/jbc.M605964200 (2007). 98 Dose, A. C. et al. The kinase domain alters the kinetic properties of the myosin IIIA motor. Biochemistry 47, 2485-2496, doi:10.1021/bi7021574 (2008). 99 Quintero, O. A. et al. Intermolecular autophosphorylation regulates myosin IIIa activity and localization in parallel actin bundles. The Journal of biological chemistry 285, 35770-35782, doi:10.1074/jbc.M110.144360 (2010). 100 Salles, F. T. et al. Myosin IIIa boosts elongation of stereocilia by transporting espin 1 to the plus ends of actin filaments. Nature cell biology 11, 443-450, doi:10.1038/ncb1851 (2009). 101 Sekerkova, G., Richter, C. P. & Bartles, J. R. Roles of the espin actin- bundling proteins in the morphogenesis and stabilization of hair cell stereocilia revealed in CBA/CaJ congenic jerker mice. PLoS genetics 7, e1002032, doi:10.1371/journal.pgen.1002032 (2011). 102 Les Erickson, F., Corsa, A. C., Dose, A. C. & Burnside, B. Localization of a class III myosin to filopodia tips in transfected HeLa cells requires an actin- binding site in its tail domain. Molecular biology of the cell 14, 4173-4180, doi:10.1091/mbc.E02-10-0656 (2003).

26

Chapter 2

Vertebrate class III myosin interact with MORN-repeat containing adaptor proteins

Introduction

Myosins are a diverse family of actin binding proteins that function as molecular motors. Myosins have an amino-terminal motor domain, a short neck with one or more IQ repeats that serve as calmodulin or light chain binding regions, and a C- terminal tail containing protein interacting motifs1,2. While much is known about the mechanism by which motors transduce chemical energy into movement, the mechanisms controlling cellular localization and regulation of cargo attachment are not well understood3.

MYO3 are novel in that they contain an amino-terminal kinase domain connected to the canonical myosin motor domain4,5. Recently, two reports showed that a small

23 kD protein named RTP interacts with one of the Drosophila MYO3 isoform called NINACp174. RTP exhibits reversible light dependent phosphorylation suggesting it plays a regulatory role within the photoreceptor6. The stability of RTP is dependent on NINACp1747,8. Further, RTP and NINACp174 co-localize to the rhabdomere and are identified as binding partners in co-immunoprecipitation studies7. RTP contains a motif known as a MORN. In other proteins, MORN 27 repeats are responsible for membrane association and stabilization of protein complexes9,10.

While Drosophila retains the single MYO3 gene ninaC, expressed in photoreceptors, vertebrates possess two MYO3 genes- MYO3A and MYO3B, expressed in multiple tissues with highest expression levels in the inner ear and the retina5. Vertebrate retina has a unique highly compartmentalized structure which allows for the initial light capture and rapid processing of visual signals. The actin cytoskeleton within the inner segment of photoreceptors plays important roles including intracellular transport11. Whereas, the outer segment contains tightly packed membrane discs and all the machinery required for phototransduction. The humans, frogs, pigs and macaque photoreceptors consists of actin filaments originating from the inner segment which terminates into microvillus like projections called calycal processes12,13 (Fig. 2.1A). The calycal processes are structurally similar to stereocilia and are believed to aid in rod outer segment disk morphogenesis12,13. In vertebrate photoreceptors, MYO3A localizes to the calycal process5. A single vertebrate ortholog of RTP called MORN4, has not been studied.

In this study, we characterized the interaction of MYO3A with MORN4 and demonstrated that these proteins are found in protein complexes. We found that

MYO3A, but not MYO3B, contains a MORN4 binding site located within the carboxy tail. Our results demonstrate that MORN4 binds and enhances MYO3A 28 tip localization, thus establishing a novel mechanism of MORN4 mediated MYO3A regulation.

Materials and Methods

Molecular constructs. Human MORN4 was cut with EcoR1/BamH1 and ligated into a pmCherry expression vector14. For generating GST-MORN4 recombinant protein, MORN4 was inserted into the BamHI and NotI restriction sites of pGEX-1 vector (gifted by Bechara Kachar, NIH). The GFP-tagged expression constructs

MYO3AΔK and 3A Tail FL constructs were developed previously15,16 for cell biological analysis. GFP-MYO3AΔK construct lacks the kinase domain (aa340-

1616 of NM_017433.4), whereas, the GFP-MYO3A Tail construct lacks the kinase and motor domains (aa1133-1616 of NM_017433.4). GFP-MYO3A Tail deletion constructs were generated by performing site-directed mutagenesis on the GFP-

MYO3AΔK construct and the primers listed in Table 2.1, thus they also lack the kinase domain. The GFP-MYO3AΔK,34 tail deletion construct was described previously17. Full-length human MYO3B (NM_138995) construct was developed in our laboratory from the template DNA gifted by Bechara Kachar, NIH. MYO3B full length was inserted into the BamHI and NotI restriction sites of pEGFP vector. The

GFP-MYO3BΔK.3THDII chimeric construct encoding for human MYO3B with its

N-terminal kinase domain deleted (aa 345-1314 of NM_138995.4) and fused to 63

C-terminal amino acids (aa 1554-1616 of NM_017433.4) human MYO3A sequence corresponding to its 3THDII domain was generated by two step 29 megaprimer PCR method. The 3THDII domain sequence containing megaprimer was PCR cloned using GFP-MYO3AΔK construct as the template in the first step.

The megaprimer was then used for the second step PCR using GFP-MYO3BΔK construct as the template to insert 3THDII at the C-terminal end of the MYO3BΔK sequence.

Protein Interaction Analysis. Recombinant GST-MORN4 protein was expressed in Rosetta cells and purified from bacterial lysates by using Immobilized

Glutathione-agarose beads (Thermo Scientific). GFP- 3ATail FL fusion protein containing COS7 lysates were prepared as described previously15. Briefly, COS7 cells were transfected with various constructs and cell lysates containing fusion proteins were extracted from COS7 cells after 24-hr of transfection by brief sonication in ice cold lysis buffer (CLB) (5mM DTT, 150mM NaCl, 1% Triton X -

100, 50mM Tris pH 7.4, 2mM EDTA, 1mM PMSF, Aprotenin, Leupeptin) and 20 min ultracentrifugation at 58,000 rpm using a Beckman Optima MAX ultracentrifuge with a TLA 120.2 rotor. To test for MYO3A interactions, the GST-

MORN4 or GST alone was bound to the Glutathione agarose beads for 1hr at 4oC followed by incubation with GFP-tagged MYO3A tail fragments in CLB for 2hr. The agarose beads were then washed 3 times with 1X cold PBS and the final pellet was resuspended in SDS-PAGE buffer. The co-precipitates were separated on

NuPAGE Bis-Tris 4-12% gels and transferred to nitrocellulose membrane for analysis by western blotting using rabbit polyclonal anti-GST (CALBIOCHEM)

(Cat. # PC53) and anti-GFP antibodies (Invitrogen) (Cat. # G10362). 30 Cell culture and transient transfection. COS7 cell cultures were propagated in

DMEM (Invitrogen) supplemented with 4mM L-glutamine, 4.5g/L D-Glucose, 1mM sodium pyruvate, 10% fetal bovine serum, and 100 units of penicillin-streptomycin.

Cultured cells were maintained at 37°C with 5% CO2 in air. For transfection,

30,000-40,000 cells were plated on acid washed 22mm square glass coverslips and allowed to adhere overnight. Cells were transiently transfected using FUGENE

HD transfection reagent (Promega) and imaged after ~20-30 hours. For transient transfection, 0.4µg of the GFP-MYO3 plasmids and/or 0.1µg of mchr-MORN4 plasmid (0.5µg total for co-transfections) were used.

Live- and fixed-cell imaging of COS-7 cells and data analysis. Fixed cell imaging of COS-7 cells was used to visualize localization of actin, GFP-MYO3AΔK, and/or mchr-MORN4. Cells were fixed 24 hours after transient transfection.

Samples were fixed for 20 min in 4% paraformaldehyde in phosphate buffered saline (PBS), permeabilized for 30 min in 0.5% Triton X-100 in PBS and then counterstained with 2ml of 0.0001 units/µl Alexa Fluor-647 Phalloidin (Molecular

Probes) to label actin. Fluorescence images were obtained using Olympus IX71 with 100X 1.40 oil immersion objective and deconvolved using DeltaVison

SoftWoRx software (Applied Precision). Live cell imaging of transfected cells was used for quantification of tip/cell body ratio. Coverslips were placed in Rose chambers filled with Opti-MEM without phenol red and supplemented with 5% fetal bovine serum and 100 units of Penicillin-streptomycin. Images were acquired using a Nikon TE2000-PFS fluorescence microscope with a 60x/1.4 N.A. phase 31 objective. NIS-Elements AR (Nikon) and ImageJ were used to analyze the images and to quantify tip to cell body intensity ratio, as described previously14. Data were analyzed by one-way analysis of variance (ANOVA) with subsequent Tukey post- hoc analysis using GraphPad Prism 6 software. Data are expressed as means ±

SE to establish significant differences between two different conditions.

Results

MYO3A and MORN4 are binding partners. Mammals possess two NINAC homologs, MYO3A and MYO3B, and the RTP-like protein MORN4. To determine if the MYO3A and MORN4 proteins recapitulate the NINACp174/ RTP interaction18, we examined if they were binding partners, and if they colocalized when expressed in COS-7 cells. To purify MORN4 protein for binding studies we created a GST-MORN4 plasmid, and to express the putative MORN4 binding partner, we used a GFP-MYO3A Tail FL construct19. These proteins are diagrammed in Fig. 2.1 B. The GST-MORN4 protein, and the control GST only protein were purified by binding to glutathione-agarose beads (Fig. 2.1C, lanes 1,

2). MYO3A full-length tail protein was expressed in COS-7 cells (Fig. 2.1C, lane

3). This MYO3A full length tail protein bound to the GST-MORN4 loaded agarose beads (Fig. 2.1C, lane 4) but not the GST only loaded agarose beads (Fig. 2.1C, lane 5). These results establish that the MYO3A tail domain contains a MORN4- binding motif. 32 Fluorescently tagged MYO3A and MORN4 colocalizes at the filopodia tips of transfected COS7 cells. We investigated the cellular interactions between

MYO3A and MORN4 by expressing fluorescently tagged versions of both proteins

(Fig. 2.2A) in COS-7 cells. We and others have successfully used COS7 cells in previous studies to perform cell biological and biochemical assays for investigating

MYO3A function, regulation and its interaction with its known cargo protein

Espin119-22. COS7 cells are an adherent cell-line that are easy to culture and transfect which makes them an ideal choice for live cell imaging of fluorescently tagged proteins. COS7 cells have the property to form actin based filopodial structures similar to vertebrate actin rich stereocilia and calycal processes, where

MYO3A is found to be expressed endogenously5,13,15. We used the GFP-

MYO3AΔK construct lacking the kinase domain because the kinase domain of

MYO3 down-regulates myosin motor activity. The increased activity of the myosin motor provides for dynamic localization to filopodia tips (Fig. 2.2B) as expected from prior studies optical section showing GFP-NINAC only (G) or GFP-NINAC and RTP15,21-23. In the absence of GFP-MYO3AΔK, mChr-MORN4 is broadly distributed, being found within the nucleus and cytoplasm but absent from the filopodia or other actin-based structures (Fig. 2.2C and 2.2H). We reasoned that in the presence of GFP-MYO3AΔK, mChr-MORN4 would be brought to the filopodial tips if these two proteins are binding partners. Consistent with this expectation, when mChr-MORN4 was expressed in the presence of GFP-

MYO3AΔK, mChr-MORN4 colocalized with the GFP-MYO3AΔK protein at the filopodia tips, (Fig. 2.2D–F). 33 MORN4 specifically binds MYO3A and enhances its tip localization in COS7 cells. To further define the binding specificity of MORN4 with MYO3A, we examined if the closely related MYO3B could also serve as a binding template.

MYO3A and MYO3B contain distinct tail regions, though retain sequence identity within tail homology domain I (THDI)19,20. Since MYO3B lacks the actin binding motif in tail homology domain II (THDII), MYO3B does not localize to the filopodia tips of COS-7 cells. However a chimera of MYO3BΔK containing THDII at the C- terminus (GFP-MYO3BΔK.THDII) will localize to the filopodia tips (Fig. 2.2G). We find that the GFP-MYO3BΔK.THDII construct does not direct MORN4 to the filopodia tips when these two proteins are co-transfected (Fig. 2.2H and 2.2I).

We quantified the distribution of mChr-MORN4, GFP-MYO3AΔK and GFP-

MYO3BΔK. THDII in COS7 cells by examining the filopodia tip/cell body ratio as done previously22. We observed a statistically significant 3-fold increase in the tip/cell body ratio of mChr- MORN4 in the presence, compared to the absence, of

GFP-MYO3AΔK (Fig. 2.2J), (mChr-MORN4 expressed with MYO3AΔK- 0.905 ±

0.071, mChr-MORN4 expressed with MYO3BΔK.3THDII- 0.369 ± 0.044, mChr-

MORN4 only- 0.267 ± 0.011). These results show that mchr-MORN4 is more concentrated at filopodia tips relative to the cytoplasm in cells expressing GFP-

MYO3AΔK. In contrast, MYO3BΔK.3THDII expression did not appreciably alter

MORN4 distribution.

Our analysis (Fig. 2.2J) also revealed an increased GFP-MYO3AΔK tip localization when GFP-MYO3AΔK was co-expressed with mChr-MORN4 as compared to that 34 in the absence of mChr-MORN4 (GFP-MYO3AΔK expressed with mChr-MORN4-

3.59 ± 0.302, GFP-MYO3AΔK only- 1.78 ± 0.113). We speculate that when

MYO3A is co-expressed with MORN4, the MYO3A-MORN4 complex gets tethered at the filopodia tips in a MORN4 dependent manner.

To map the MORN4 binding site within the MYO3A tail, we used derivatives of

GFP-MYO3AΔK, in which one of the 6 exons (exons 30–35) encoding its tail domain were deleted. Exon 35 contains THDII, which is required for filopodia tip localization, and thus could not be examined. Each of the other MYO3A exon deletion constructs were capable of localizing to the filopodia tips when transfected into COS-7 cells. We found that the deletion of either exon 30 or 31 prevented colocalization of MYO3A and MORN4 at the protrusion tips (Fig. 2.3A-B). Deletion of exons 32, 33, and 34 did not prevent colocalization (Fig. 2.3C–E). We quantified the distribution of mChr-MORN4 in these cells by examining the filopodia tip/cell body ratio as done earlier22. The results (Fig. 2.3F) indicate that deletion of MYO3A exons 30 or 31 result in a statistically significant reduction of MORN4 localization to filopodia tips relative to other MYO3A tail exons. This level of MORN4 localization is similar to that observed in cells lacking MYO3A, indicating that the sequence encoded by MYO3A tail exons 30 and 31 is essential for MORN4 binding.

We conclude that MORN4 interacts to MYO3A but not MYO3B and that MORN4 may form a link between the plasma membrane and MYO3A leading to an increased MYO3A tip localization. On the basis of the GST pulldown assay and 35 MORN4-MYO3A tail deletion constructs coexpression results it is likely that the direct MORN4 binding site is within carboxy tail sequences found in MYO3A but absent in MYO3B.

Sequence Conservation within the MORN4 binding regions. Functional MYO3 tail domains were originally identified on the basis of sequence similarities in divergent species and subsequently shown to promote binding of specific proteins5,20,24. We carried out a comparative analysis seeking a MORN4 binding site within the MYO3A tail. Fig. 2.4 shows the exon deletions used to establish that both exons 30 and 31 were required for MORN4 binding. The bar graphs below these constructs identify a highly conserved sequence spanning the exon 30/31 boundary. Thus, this comparative approach identified a putative vertebrate

MORN4 binding domain. However, we find little sequence identity between the invertebrate and vertebrate domains18, and functional tests will be necessary to establish their role in both systems.

Discussion

Prior studies showed that a Drosophila photoreceptor specific myosin, NINAC, interacts with and stabilizes a small phosphoprotein RTP6. Here we extend this analysis to show that RTP vertebrate ortholog MORN4 is a novel MYO3A binding protein. We mapped the binding sites of MORN4 to the tail domain of MYO3A. The carboxy tail domains of myosin family members possess the greatest sequence divergence and play key roles in their cellular control3,25. 36 MYO3A and MORN4 are protein partners. Our collaborators (Dr. Mecklenburg and Dr. Joseph O’Tousa) characterized RTP-NINAC interactions in Drosophila7,18, which led us to ask if a similar situation exists for the vertebrate orthologs. We used an in vitro protein affinity pull down assay to show that MORN4 directly binds to the tail domain of MYO3A. Further, in cultured COS7 cells, MORN4 is a cytoplasmic protein in the absence of MYO3A, but is colocalized with MYO3A at filopodial tips in the presence of MYO3A. The closely related protein MYO3B does not bring MORN4 to the filopodia tips, showing the importance of MYO3A specific motifs in promoting this interaction. Deletion constructs of the MYO3A tail show that both exons 30 and 31 are necessary for MORN4 tip localization, suggesting that MYO3A binds MORN4 and transports it to the filopodia tips. Interestingly, the exon 30-31 junctional sequence is highly conserved among vertebrate MYO3 orthologs, which further strengthens our hypothesis that this region could be a conserved MORN4 binding site in the MYO3A tail.

Our analysis revealed some key differences between the MYO3A/MORN4 interaction in vertebrate systems and the NINAC/RTP interaction in Drosophila.

For example, RTP stability is dependent on NINAC7,18, but MORN4 stability in

COS-7 cells is not dependent on MYO3A. In Drosophila photoreceptors, degradation of excess RTP may provide a regulatory mechanism that is not in play in the vertebrate system. Another difference between systems involves the behavior of NINACp174 and MYO3A in the absence of their RTP/MORN4 binding partners. NINAC forms discrete puncta when expressed on its own in Drosophila 37 neurons or salivary gland cells18, but we found that MYO3A localization in COS-7 cells is not dependent on MORN4. Interestingly, we observed an enhanced

MYO3A filopodia tip localization in the presence of MORN4. Based on the previous reports suggesting that MORN repeat containing proteins act by linking proteins to the plasma membrane10, we propose that MORN4 stabilizes MYO3A at the filopodia tips by tethering it to the membrane. The MYO3A anchoring affect in the presence of MORN4 may be a crucial aspect of MYO3A dependent actin bundle stabilization in vertebrate photoreceptor calycal processes where MYO3A is expressed5. In Drosophila, NINAC is only found in photoreceptors, and it’s localization is not dependent on RTP18. In contrast, vertebrates express MYO3A in many tissues5. Thus multiple control elements are likely, and all may not be shared, in the invertebrate and vertebrate systems.

Here we have identified MORN4 as a binding partner and a potential control element of MYO3A. Binding occurs within the tail domain (conserved with RTP binding to NINACp 174 tail domain18), the region associated with control of myosin motor cellular localization. MORN4 possess a tandem set of 4 MORN repeats, a motif found in other proteins and implicated in protein-protein interactions and protein binding to membranes9,10. These considerations show that MORN4 serves as an adaptor protein, binding to MYO3A. We speculate that MYO3A-MORN4 interaction may be crucial for maintenance of shape and size of actin based protrusions, like calycal processes. Their binding may enhance the association of 38 the complex with membranes, or facilitate association with scaffolding and actin based structures.

39 Tables and Figures

40

Table 2-1. List of plasmid constructs and associated primers. Gene/Species Plasmid Primers used, (Accession Vector (aa Forward (F) and Reverse (R) no.) deleted) GFP-M3A F:CGACTACAAGAAAAACTTTGAAAATACAGGT ∆K,30 ATCAAAGTTATCTGAAGAATATTTCAT (1134- R:ATGAAATATTCTTCAGATAACTTTGATATCCT 1431) TGTATTTTCAAAGTTTTTCTTGTAGG GFP-M3A F:TTTGGCAATTTTTTCAAAACAGGGTGTCTGTA ∆K,31 AAGGAGAGGAG (1432- R:CTCCTCTCCTTTACAGACACCCTGTTTTGAA 1479) AAAATTGCCAAA GFP-M3A F:CAGCAGTGCCTCTCAGGTAAGTCAATCCAAG ∆K,32 AAG Myo3A/Human (NM_017433) (1480- R:CTTCTTGGATTGACTTACCTGAGAGGCACTG 1515) CTG pEGFP- N1 GFP-M3A F:CTGAAGACTCCACATACTATTATCTACTTCAT ∆K,33 AGTCAGGGAAAATTATTAG (1516- R:CTAATAATTTTCCCTACTATGAAGTAGATAAT 1528) AGTATGTGGAGTCTTCAG GFP-M3A ∆K,34 F: see Schneider et al., 2006 (1529- R: see Schneider et al., 2006 1576) GFP- F:CCTCAAAAGGAGACCTTTTGCTCAACATTAA M3B CATAGCCCTAGTTTAAGAGAACGAAAC Myo3B/Human (NM_138995) ∆K.3THD R:TATCTAGATGCATGCTCGAGCGGCCGCTAG II GACTGCTGGACGAGGCG GST- F: GCGGATCCGGCATGACCCTGACAAAAG pGEX-1 MORN4 R: GCGGCCGCTCAGGCAGTGAGATTTC MORN4/Human F:AAAGAATTCTATGACCCTGACAAAAGGTTCC (NM_00109883 mCherry T 1) Pm Cherry MORN4 R:TTTGGATCCTCAGGCAGTGAGATTTCTGGCT GACTTG

41 Figures

Figure 2.1. MYO3A tail binding MORN4 demonstrated by GST-pulldown assays. (A) Diagrammatic illustration of the compartments of monkey cone photoreceptors. IS, inner segment; OS, outer segment. Adapted from Sahly et al., 201213. (B) Schematic map of the constructs used for analysis of the MYO3A and MORN4 protein interaction. (C) Protein blots show GST-MORN4 (lane 1) and GST-only (lane 2) proteins were expressed and purified from bacterial lysates. Protein blots confirmed that lysates from transfected COS- 7 cells express the GFP-MYO3A tail FL protein (lane 3), and this protein could be pulled out of the lysate with GST-MORN4-glutathione-agarose beads (lane 4) but not with GST- only glutathione-agarose beads (lane 5). Anti-MYO3A tail tip primary antibodies (PB638) were used to detect the GFP-MYO3A tail FL protein in the lysate and pull down fractions.

42

Figure 2.2. mChr-MORN4 co-expression with GFP-MYO3AΔK, but not GFP- MYO3BΔK.3THDII, in COS7 cells promotes filopodial localization of mChr-MORN4. (A) Schematic map of the constructs used for transfections. The Myosin constructs are tagged with GFP, and the MORN4 construct with RFP. The MYO3AΔK and MYO3BΔK constructs consist of the motor and the tail domains but they are deleted for kinase domain to enhance tip localization. The MYO3A 3THDII domain has been added to the MYO3BΔK.THDII construct to promote actin binding. (B) COS7 cells transfected with the GFP-MYO3AΔK (green) shows GFP-MYO3AΔK localization to filopodial tips at the cell membrane (arrow). (C) When expressed in absence of GFP-MYO3AΔK, mChr-MORN4 protein (green) is found within the cell body and not concentrated at the filopodial tip at the cell membrane (arrow). (D-F) Coexpression of GFP-MYO3AΔK (green, D, F) with mChr-MORN4 (Red, E, F) results in filopodial tip localization of mChr-MORN4 (arrow). In panel (F), actin is shown in blue. In (D-F), the arrow identifies one filopodial tip with mChr- MORN4 and GFP-MYO3AΔK colocalization. GFP-MYO3BΔK.THDII fails to localize mChr-MORN4 to the filopodial tips in COS7 cells. (G-I) Coexpression of GFP- MYO3BΔK.THDII (G, I, green) with mChr-MORN4 (H, I, red) fails to localize mChr-MORN4 to filopodial tips. The GFP-MYO3BΔK.THDII protein (green) is localized to filopodial tips (arrow in I). (J) Tip to cell body ratio measurements of GFP-MYO3AΔK and mChr-MORN4 in COS7 cells under different conditions. mChr-MORN4 tip localization was significantly 43 higher in COS7 cells co-expressing mChr-MORN4 and GFP-MYO3AΔK (n= 317 filopodia from 24 cells) as compared to mChr-MORN4 alone (P<0.0001; T-test) (n= 175 filopodia from 20 cells). Similarly, COS7 cells co-expressing GFP-MYO3AΔK and mChr-MORN4 show significantly higher GFP-MYO3AΔK at the filopodial tips as compared to GFP- MYO3AΔK alone (p<0.0001) (n= 206 filopodia from 19 cells).

44

Figure 2.3. MYO3A tail exons 30 and 31 are required for localization of MORN4 to filopodial tips. (A-E) Representative COS7 cell images of mChr-MORN4 co-transfected with GFP-labeled MYO3A tail deletion constructs. The upper panel shows localization of each of the GFP-MYO3A tail deletion constructs and lower panel shows mChr-MORN4 localization. Scale bars, 5 μm. (F) Graph summarizing the tip to cell body ratio analysis of mChr-MORN4 cellular localization in presence of GFP-MYO3A constructs. When co- 45 transfected with GFP-MYO3A constructs lacking tail exon 30 (p<0.0001) (n= 85 filopodia from 15 cells) and exon 31 (p<0.0001) (n= 65 filopodia from 13 cells) respectively, mChr- MORN4 has low tip to cell body ratio, while GFP-MYO3AΔK constructs lacking exon 32- 34 respectively (GFP-MYO3AΔK,32 + mChr-MORN4: n= 57 filopodia from 12 cells; GFP- MYO3AΔK,33 + mChr-MORN4: n=54 filopodia from 10 cells; GFP-MYO3AΔK,34 + mChr- MORN4: n=96 filopodia from 11 cells) support mChr-MORN4 localization at the filopodial tips. Scale bars, 5 μm.

46

Figure 2.4. Identified and proposed motifs within the tail domain of human MYO3A. The top diagram shows recognized and proposed tail motifs of human MYO3A: IQ1, IQ2 and IQ3 (green), 3THDI and 3THDII (tail homology domains, blue), and the MORN4/MYO3A interaction domain (red). Displayed below this diagram are the modifications to the tail structure (modified MYO3B tail and deletions of MYO3A) that were used to map of the MORN4 interaction domain. The lower part of the figure summarizes amino acid sequence identities of human MYO3A with MYO3 proteins of other vertebrate species (chimpanzee, mouse, cow, chicken) highlighting the level of sequence identity within the proposed MORN4 interaction domain. Identical and functionally similar amino acids are coded as in (A). At bottom, the region containing the proposed MORN binding site is expanded to show the amino acid sequence within the MORN4 interaction domain. Identical amino acids are shown as black bars and functionally similar amino acids as two shades of grey bars as specified by Clustalx parameters26.

47 References

1 Krendel, M. & Mooseker, M. S. Myosins: tails (and heads) of functional diversity. Physiology (Bethesda) 20, 239-251, doi:10.1152/physiol.00014.2005 (2005). 2 Lin-Jones, J., Parker, E., Wu, M., Dose, A. & Burnside, B. Myosin 3A transgene expression produces abnormal actin filament bundles in transgenic Xenopus laevis rod photoreceptors. Journal of cell science 117, 5825-5834, doi:10.1242/jcs.01512 (2004). 3 Hartman, M. A., Finan, D., Sivaramakrishnan, S. & Spudich, J. A. Principles of unconventional myosin function and targeting. Annual review of cell and developmental biology 27, 133-155, doi:10.1146/annurev-cellbio-100809- 151502 (2011). 4 Montell, C. & Rubin, G. M. The Drosophila ninaC locus encodes two photoreceptor cell specific proteins with domains homologous to protein kinases and the myosin heavy chain head. Cell 52, 757-772 (1988). 5 Dose, A. C. et al. Myo3A, one of two class III myosin genes expressed in vertebrate retina, is localized to the calycal processes of rod and cone photoreceptors and is expressed in the sacculus. Molecular biology of the cell 14, 1058-1073, doi:10.1091/mbc.E02-06-0317 (2003). 6 Mecklenburg, K. L. et al. Retinophilin is a light-regulated phosphoprotein required to suppress photoreceptor dark noise in Drosophila. J. Neurosci. 30, 1238-1249, doi:30/4/1238 [pii] 10.1523/JNEUROSCI.4464-09.2010 (2010). 7 Venkatachalam, K. et al. Dependence on a retinophilin/myosin complex for stability of PKC and INAD and termination of phototransduction. The Journal of neuroscience : the official journal of the Society for Neuroscience 30, 11337-11345, doi:10.1523/JNEUROSCI.2709-10.2010 (2010). 8 Mecklenburg, K. L. et al. Retinophilin is a light-regulated phosphoprotein required to suppress photoreceptor dark noise in Drosophila. The Journal of neuroscience : the official journal of the Society for Neuroscience 30, 1238-1249, doi:10.1523/JNEUROSCI.4464-09.2010 (2010). 9 Takeshima, H., Komazaki, S., Nishi, M., Iino, M. & Kangawa, K. Junctophilins: a novel family of junctional membrane complex proteins. Molecular Cell 6, 11-22, doi:S1097-2765(05)00005-5 [pii] (2000). 10 Ma, H., Lou, Y., Lin, W. H. & Xue, H. W. MORN motifs in plant PIPKs are involved in the regulation of subcellular localization and phospholipid binding. Cell Research 16, 466-478, doi:7310058 [pii] 10.1038/sj.cr.7310058 (2006). 11 Reidel, B., Goldmann, T., Giessl, A. & Wolfrum, U. The translocation of signaling molecules in dark adapting mammalian rod photoreceptor cells is dependent on the cytoskeleton. Cell motility and the cytoskeleton 65, 785- 800, doi:10.1002/cm.20300 (2008). 48 12 O'Connor, P. & Burnside, B. Actin-dependent cell elongation in teleost retinal rods: requirement for actin filament assembly. The Journal of Cell Biology 89, 517-524 (1981). 13 Sahly, I. et al. Localization of Usher 1 proteins to the photoreceptor calyceal processes, which are absent from mice. The Journal of Cell Biology 199, 381-399, doi:jcb.201202012 [pii] 10.1083/jcb.201202012. 14 Quintero, O. A. et al. Intermolecular autophosphorylation regulates myosin IIIa activity and localization in parallel actin bundles. The Journal of biological chemistry 285, 35770-35782, doi:10.1074/jbc.M110.144360 (2010). 15 Salles, F. T. et al. Myosin IIIa boosts elongation of stereocilia by transporting espin 1 to the plus ends of actin filaments. Nature cell biology 11, 443-450, doi:10.1038/ncb1851 (2009). 16 Merritt, R. C. et al. Myosin IIIB uses an actin-binding motif in its espin-1 cargo to reach the tips of actin protrusions. Current biology : CB 22, 320- 325, doi:10.1016/j.cub.2011.12.053 (2012). 17 Schneider, M. E. et al. A new compartment at stereocilia tips defined by spatial and temporal patterns of myosin IIIa expression. The Journal of Neuroscience. 26, 10243-10252, doi:10.1523/JNEUROSCI.2812-06.2006 (2006). 18 Mecklenburg, K. L. et al. Invertebrate and Vertebrate Class III Myosins Interact with MORN Repeat-Containing Adaptor Proteins. PloS one 10, e0122502, doi:10.1371/journal.pone.0122502 (2015). 19 Merritt, R. C. et al. Myosin IIIB uses an actin-binding motif in its espin-1 cargo to reach the tips of actin protrusions. Current biology : CB 22, 320- 325, doi:10.1016/j.cub.2011.12.053 (2012). 20 Salles, F. T. et al. Myosin IIIa boosts elongation of stereocilia by transporting espin 1 to the plus ends of actin filaments. Nature cell biology 11, 443-450, doi:10.1038/ncb1851 (2009). 21 Schneider, M. E. et al. A new compartment at stereocilia tips defined by spatial and temporal patterns of myosin IIIa expression. The Journal of neuroscience : the official journal of the Society for Neuroscience 26, 10243-10252, doi:10.1523/JNEUROSCI.2812-06.2006 (2006). 22 Quintero, O. A. et al. Intermolecular autophosphorylation regulates myosin IIIa activity and localization in parallel actin bundles. The Journal of biological chemistry 285, 35770-35782, doi:10.1074/jbc.M110.144360 (2010). 23 Manor, U., Grati, M., Yengo, C. M., Kachar, B. & Gov, N. S. Competition and compensation: dissecting the biophysical and functional differences between the class 3 myosin paralogs, myosins 3a and 3b. Bioarchitecture 2, 171-174, doi:10.4161/bioa.21733 (2012). 24 Les Erickson, F., Corsa, A. C., Dose, A. C. & Burnside, B. Localization of a class III myosin to filopodia tips in transfected HeLa cells requires an actin- binding site in its tail domain. Molecular biology of the cell 14, 4173-4180, doi:10.1091/mbc.E02-10-0656 (2003). 49 25 Greenberg, M. J. & Ostap, E. M. Regulation and control of myosin-I by the motor and light chain-binding domains. Trends in cell biology, doi:10.1016/j.tcb.2012.10.008 (2012). 26 Chenna, R. et al. Multiple sequence alignment with the Clustal series of programs. Nucleic acids research 31, 3497-3500 (2003). 50

Chapter 3

Impact of the motor and tail domains of class III myosins on regulating the formation and elongation of actin protrusions

Introduction

Several classes of vertebrate sensory cells detect chemical or mechanical stimuli through actin bundle based protrusions1,2. The vertebrate inner ear sensory hair cells consist of parallel actin bundle based mechanoreceptive structures on their apical surfaces called stereocilia. These structures are critical for allowing hair cells to respond to the sound-evoked mechanical stimuli3-6. Myosin 1C, myosin 15A, myosin 7A, myosin 6, and myosin 3 are some of the myosin superfamily members which are involved in various aspects of stereocilia structure-function maintenance and when mutated cause hearing loss7-15. The role that these myosins play in formation and elongation of parallel actin bundle-based protrusions is still unclear.

Class III myosins MYO3 were discovered in Drosophila and named NINAC, because of the defect in the electroretinogram of the null mutant flies16-19. There are two vertebrate MYO3 isoforms, MYO3A and MYO3B, which are encoded by two separate genes20. In addition to the inner ear hair cells, MYO3 are also expressed in vertebrate photoreceptor calycal processes, brain, testis and intestine21-23. Calycal processes are parallel actin based microvillus-like protrusions in vertebrate photoreceptors. Mutations in human MYO3A are 51 associated with hearing loss that is not associated with other signs and symptoms

(non-syndromic) (DFNB30)24,25.

MYO3 contains an N-terminal kinase domain, a conserved motor domain, a neck region, and a class specific C-terminal tail domain20 (Fig. 3.1A). Our earlier reports have shown the differences in the motor ATPase activity of human MYO3A and mouse MYO3B26, however no studies have directly compared the ATPase properties of human MYO3A and 3B, or compared their in vitro motility properties.

The MYO3A tail domain is encoded by 6 different exons (482 amino acids (aa)) and contains two conserved domains, THD1 and THD221. MYO3B contains a much shorter tail which includes THD1, but lacks THD2 as well as a large portion of the MYO3A tail with unknown function. Previous reports have hypothesized that

MYO3A and MYO3B may have overlapping functions but MYO3B can only partially compensate for MYO3A26,27. Thus it is critically important to reveal functional differences between the human isoforms to determine how the loss of MYO3A leads to deafness.

MYO3A motor activity is reduced by a proposed concentration dependent autophosphorylation mechanism26,28-31. To avoid the autophosphorylation induced reduction in motor activity many studies have focused on kinase deleted or kinase dead MYO3 constructs6,26,30. Using kinase deleted MYO3 constructs allowed us to examine the activity/function of the motor in its fully active state.

MYO3 is proposed to bind Espin1 and EspinL (ectoplasmic specialization protein), and transport it along actin bundles from the base to the tips6,32. Once the Espin1 52 is transported to the barbed-ends, it is thought that the Espin1 WH2 domain stimulates elongation of actin bundles6,26. Interestingly, recent papers identifying novel MYO3 binding partners highlight the complex nature of combined MYO3 isoform specificity and its cargos in stereocilia formation and length regulation26,32.

There is a strong rational for understanding the role of MYO3 in actin bundle based protrusions in the absence of Espin isoforms. During mouse embryonic development, the emergence and maturation of the outer and inner ear hair cells overlaps well with the MYO3A expression and its proposed functions. MYO3A expression begins at post-natal day 0 and reaches its peak during post-natal day

6-10 as it progresses into adult stages7. The Jerker mouse lacking all Espin isoforms had short and thin stereocilia from P0 onwards, however the first phase of stereocilia elongation appeared to be normal33.

Examining the properties of the tail domain of MYO3 has improved our understanding of MYO3 motor based transport and its interactions with cargo. We demonstrated that the conserved THD1 of MYO3 binds to both Espin1 and

EspinL6,26,32,34. We also found that the membrane occupation recognition nexus

(MORN4) protein interacts with a region of the MYO3A tail upstream of THD1 and may allow tethering of MYO3A to the membrane (Chapter 2)35. The THD2 is known to bind F-actin and it is required for MYO3A to tip localize in actin protrusions independent of Espin isoforms22,26,36. MYO3B lacks THD2, hence it cannot tip localize in the absence of Espin1 or Espin26,37. In addition, fusing THD2 to the C- terminus of MYO3B enhances its tip localization26. Interestingly, there has been no 53 detailed examination of the role of THD2 and other regions of the MYO3A tail in actin protrusion formation and elongation.

In the current study we compared the properties of the motor and tail domains of human MYO3A and MYO3B to determine their role in actin protrusion formation and elongation. We hypothesized that the unique extended tail of MYO3A containing THD2, is critical to promote the formation, elongation and stabilization of actin protrusions. We also predicted that the MYO3 motor activity would correlate with the ability to enhance the formation and elongation of actin protrusions. To determine the impact of differing motor properties we examined the motile and ATPase properties of human MYO3A and MYO3B. To characterize

MYO3-based functions in actin protrusions we examined tip localization, and actin protrusion formation and elongation activity of a range of fluorescently tagged

MYO3A and MYO3B deletion, mutation and chimeric constructs. We also examined the filopodia dynamics in MYO3A and MYO10 expressing cells. MYO10 is a known filopodia inducer, and it is implicated in Ena/VASP transport as well as actin filament crosslinking functions within filopodia protrusions38-40. In addition to the frequently used (filopodia forming) COS7 cell model we also used microvilli forming W4 cells, providing a model more similar to stereocilia. We argued that examining the role of MYO3 in self-supported actin based protrusions like microvilli will help us gain a better understanding of the role of MYO3 in stereocilia. Based on our biochemical, biophysical and cell biological results, we suggest that the 54 motor activity and extended tail of MYO3A are precisely engineered to regulate stable actin protrusion formation and elongation.

Materials and Methods

Expression plasmids. GFP-tagged human MYO3A (aa 340-1616 of

NM_017433.4 – kinase deleted) and MYO3AKIN (full-length, kinase active) were constructed as described previously6,30. The following naturally occurring variants exist in the MYO3A sequence (I348V, V369I, S956N, R1313S)41.

All the GFP-MYO3A tail exon deletion constructs were designed to avoid insertion of a premature stop codon as described previously35, with the following amino acids deleted in: 1) MYO3A,Δ30- deleted aa 1134-1431; 2) MYO3A,Δ31- deleted aa 1432-1479; 3) MYO3A,Δ32- deleted aa 1481-1515; 4) MYO3A,Δ33- deleted aa

1515-1528); 5) MYO3A,Δ34- deleted aa 1529-1576.

GFP-MYO3A was used as template to generate the GFP-MYO3A.MtD (motor dead) construct by introducing a point mutation (G720A) (Table 3.3). GFP-MYO3A lacking THD2 (GFP-MYO3A.ΔTHD2) was generated by deleting THD2 (deleted aa1595-1616) (Table 3.3). GFP-MYO3BKIN (full-length, kinase active) and GFP-

MYO3B (kinase deleted) (NM_138995) constructs were developed from the template DNA provided by the Kachar lab. Briefly, MYO3BKIN was inserted into the pEGFP vector and this construct was further modified to remove the N-terminal 55 kinase domain (aa 345-1314) (Table 3). A GFP-MYO3B.3A Tail chimeric construct encoding MYO3B motor-neck (aa 346-1148 of NM_138995) and c-terminal

MYO3A tail (aa1146-1616 of NM_017433.4) was also generated (Table 3.3). The

GFP-MYO10 (bovine) construct used in the current study was gifted by Richard

Cheney38.

Both pFBMYO3A 2IQ and pFBMYO3B 2IQ constructs (for biochemical examination) were without the kinase domain, truncated after the second IQ domain29 and contain a C-terminal GFP tag (Table 3.3).

Protein expression and purification. The FastBac system (Invitrogen) was used to generate the recombinant baculoviruses26,30,31. Recombinant MYO3A 2IQ and

MYO3B 2IQ c-GFP with c-terminal FLAG tag were expressed in the baculovirus

SF9 insect cell system and purified with anti-FLAG affinity chromatography as described previously26,30. The affinity purified MYO3A and MYO3B 2IQ c-GFP constructs were also purified by actin co-sedimentation and release with ATP to ensure 100% active myosin heads.

COS7 cell culture, transfection, imaging, and analysis. COS7 cells were cultured as described in Chapter 230,35. For live cell imaging, coverslips with transfected cells were placed in rose chambers42 filled with Opti-Mem media supplemented with 100 units of Penicillin- streptomycin and 5% fetal bovine serum

(Gemini). Single and time-lapse images were acquired at room temperature using a Nikon TE2000-PFS fluorescence microscope with a 60X 1.4 N.A. phase 56 objective and equipped with CoolSnap HQ2 cooled charge-coupled device digital camera (Photometrics).

For fixed cell imaging, transfected cells were fixed for 20 min in 4% formaldehyde in 1X PBS, permeabilized for 30 min in 0.5% Triton X-100 in 1X PBS, counterstained with Alexa Fluor-568 phalloidin (Life Technologies), and mounted using ProLong Gold Antifade reagent (Invitrogen). Fixed and live cell confocal imaging was accomplished using a TiE inverted fluorescence microscope (Nikon

Instruments) equipped with either (1) a swept-field confocal scan head (Prairie

Technologies), DU-897 EMCCD (Andor), and 100X Plan Apo 1.45NA objective, or

(2) a spinning disk confocal head (Perkin-Elmer), DU-888 (Andor), and Apo TIRF

1.49 NA objective. Image acquisition was managed through NIS-Elements software (Nikon Instruments) and ImageJ (with ND2 reader plugin) was used to analyze the images and to quantify tip to cell body ratio, and filopodia length and density (number of filopodia per micron), as described previously30.

ImageJ (with MtrackJ plugin) was used to measure the filopodia extension and retraction velocities. Retracting and stationary filopodia were excluded from extension velocity measurements. Extending and stationary filopodia were excluded from retraction velocity measurements. Five minute live cell time lapse videos were used to analyze filopodia lifetime. An extending protrusion reaching

1µm length was categorized as an initiation event, which marked the beginning of the lifetime. The same extending protrusion was then followed over time until it retracted back to 1µm length, which is then categorized as end of lifetime. 57 Stationary protrusions were included for filopodia lifetime measurements.

Protrusions <1µm were excluded from all the measurements. The Data were compared by using one-way analysis of variance (ANOVA) with the subsequent

Tukey post-hoc analysis tool of GraphPad Prism 6 software.

COS7 fluorescence intensity measurement. Uniformity in expression levels of our experimental constructs was confirmed by examining the mean fluorescence intensity (brightness per cell area) from cell body (excluding protrusions) of >10 cells per condition from which the data were reported. No significant difference was observed in the fluorescence intensity among different conditions, except

MYO3B and MYO3A,Δ32 which demonstrated ~1.2 fold higher intensity compared to the mean of the rest of the constructs. However, neither of the constructs showed higher tip localization or filopodia formation and elongation activity compared to the wild type constructs.

COS7 lysate preparation and western blotting. COS7 cell lysates were prepared as described previously6. Briefly, 24-30 hours after transfection of COS7 cells with various constructs, cell were treated with 300µl of ice cold lysis buffer

(50mM Tris pH 7.4, 5mM DTT, 2mM EDTA, 150mM NaCl, 1% Triton X-100, 1mM

PMSF, aprotinin, and leupeptin). To prepare the lysate, cells were scrapped off the surface using a cell-scraper and the lysates were homogenized by pipetting.

Lysates were examined using NuPAGE Bis-Tris 4-12% gels (Invitrogen) and transferred to a nitrocellulose membrane for analysis by western blotting. Anti

MYO3A tail tip antibody21 was used to detect various MYO3 fusion proteins. HRP 58 linked goat anti-rabbit secondary antibodies (Cell signaling) and LumiGLO chemiluminescent substrate (Cell Signaling) were used to visualize the blots.

W4 cell transfection. Ls174T-W4 cells (generously provided by Dr. Hans Clevers) were cultured in DMEM with high glucose and 2mM L-glutamine supplemented with 10% tetracycline-free FBS, G418 (1 mg/ml), blasticidin (10 g/ml), and phleomycin (20 g/ml). Cells were grown at 37°C and 5% CO2. One day before transfection, cells were plated in a T-25 flask such that on the next day, cells were at ~80% confluency. Transient transfections were performed using Lipofectamine

2000 (Invitrogen) according to the manufacturer’s instructions. The following day, cells were plated onto coverslips in the presence of 1 g/ml doxycycline and allowed to adhere and induce for 8 hours. Doxycycline activates STRAD (STE20-

Related Kinase Adaptor), which in turn activates LKB1 (liver kinase B1). Upon activation of LKB1, the W4 cell actin cytoskeleton rapidly remodels to form an apical brush border (microvilli), thus completely polarizing the cells43.

Fixing, staining, and imaging of W4 cells. Cells were first washed once with warm PBS and then fixed with 4% PFA in PBS for 15 minutes at 37°C. Following fixation, cells were washed three times with PBS and permeabilized with 0.1%

Triton X-100/PBS for 15 minutes at room temperature. Cells were then washed

3X with PBS and blocked overnight at 4°C in 5% BSA/PBS. Cells were washed once with PBS and incubated with anti-GFP (1:200, Aves, GFP-1020) or anti-villin

(1:50, Santa Cruz, BDID2C3) in PBS for 2 hours at RT, followed by 4 five-minute washes with PBS. Alexa Fluor 488 goat anti-chicken (1:200) and Alexa Fluor 568 59 phalloidin (1:200) or Alexa Fluor 568 donkey anti-mouse (1:200) and Alexa Fluor

647 phalloidin (1:100) (Life Technologies) were diluted in PBS and incubated with the cells at 37°C for 1 hour, followed by 4 five-minute washes with PBS. Coverslips were mounted using ProLong Gold Antifade Mountant (Life Technologies).

Structured Illumination Microscopy was performed using an Applied Precision

DeltaVision OMX (GE Healthcare) located in the Vanderbilt Cell Imaging Shared

Resource equipped with a 60x Plan-Apochromat N/1.42 NA objective, and processed using softWorx software (GE Healthcare). Confocal imaging was performed using a Nikon A1R laser-scanning confocal microscope with a 100x Apo

TIRF 1.49 NA objective. Percent microvillar coverage was calculated by dividing the percentage of total W4 cell margin by the percentage of the margin covered by microvilli. Microvillar actin bundles were traced from the projected SIM images (z- stacks) and lengths were measured using ImageJ (length tool)44. Edges of microvilli actin bundles were visualized and defined with phalloidin staining.

Individual microvilli actin bundles (base to tips) were first identified from max intensity projection images. The base and tips of the microvilli were further traced and confirmed from the projected F-actin z-stacks (visualized with phalloidin staining). Microvilli whose base and tips could not be traced clearly from both max intensity and z-stacks projection were excluded from the analysis.

Myosin ATPase Assay. The steady state nicotinamide adenine dinucleotide

(NADH)-linked ATPase assay was used to examine MYO3A 2IQ and MYO3B 2IQ c-GFP actin-activated ATPase activity in modified KMg50 Buffer (10 mM Imidazole 60 pH 7.0, 50 mM KCl, 1 mM EGTA, 1 mM MgCl2, 1 mM DTT) with additional KCl

(final 72 mM) and ATP (1.85 mM) at 25°C28,30,31. Briefly, the motor ATPase was examined in the presence of a range of actin concentrations in an Applied

Photophysics stopped-flow. The Michaelis-Menten equation was used to determine the kcat (maximal actin-activated ATPase rate) and KATPase (actin concentration at which the ATPase activity is one-half maximal) using a hyperbolic fit of the ATPase rates as a function of actin concentration.

In Vitro Motility Assay. In vitro motility assay45 was performed as described previously46,47. Briefly, C-terminal GFP tagged MYO3A 2IQ or MYO3B 2IQ were attached to the nitrocellulose-coated glass coverslip surface using an anti-GFP antibody (Invitrogen) and the surface was then blocked with 1mg ml-1 BSA solution in KMg50 buffer. The activation buffer consisted of KMg50 supplemented with

0.35% methylcellulose, 10 µM calmodulin, 1mg ml-1 BSA, 2 mM ATP, and 20 units ml-1 pyruvate kinase and 2.5mM phosphoenol pyruvate. To reduce photobleaching

1mg ml-1 glucose, 0.1mg ml-1 glucose oxidase and catalase were also added.

Finally, after the addition of activation buffer, the motility of the rhodamine- phalloidin labeled F-actin filaments was observed using a Nikon TE2000 microscope47. The time-lapse images were acquired at 5s intervals for a period of

10 minutes. The velocity of moving actin filaments was measured using ImageJ

(MtrackJ plugin)48. 61 Results

MYO3A is a faster motor with enhanced actin-affinity compared to MYO3B.

We performed biochemical analysis of MYO3A 2IQ and MYO3B 2IQ (kinase domain deleted, truncated after second IQ domain and contain a C-terminal GFP).

The maximal ATPase activity (kcat) of MYO3A 2IQ was approximately 3- to 4-fold higher than MYO3B 2IQ (Fig. 3.2A) (Table 3.1). MYO3A 2IQ also contains a 20- fold higher actin affinity compared to MYO3B 2IQ as assessed by the KATPase

(Table 3.1). However, the determined ATPase parameters for MYO3B 2IQ are subject to large uncertainties because the ATPase activity did not saturate at higher actin concentrations. The kcat values for human MYO3A 2IQ without the c- terminal GFP tag and in KMg50 buffer were previously reported to be slightly lower29 than the current results (1.5 and 1.8 sec-1, respectively). The sliding velocity of MYO3A 2IQ was approximately 2-fold higher compared to MYO3B 2IQ

(Fig. 3.2B) (Table 3.1).

MYO3A requires enhanced motor activity and THD2 to induce and elongate actin protrusions. MYO3A (kinase domain deleted) demonstrated the highest tip localization, as well as filopodia formation (density) and elongation (length) activity compared to the rest of the constructs (Fig. 3.3A-L). It has been shown previously that the motor activity is required for MYO3A tip localization, however its impact on actin protrusion formation and elongation has never been examined before. Our results demonstrate that MYO3A motor dead (MYO3A.MtD) lost actin protrusion formation (Fig. 3.3L) and elongation activity (Fig 3.3K) in addition to the loss of tip 62 localization activity. Our MYO3A.MtD construct carried a point mutation (G720A) in the motor domain which was expected to result in a loss of motor activity as was found in the corresponding mutation in Dictyostelium MYO2 (aa 457)49 and

Chicken MYO5A (aa 440)50,51. We found that MYO3A.MtD 2IQ resulted in loss of

ATPase activity (~0.05 sec-1) in the presence and absence of 20 µM actin and it was able to bind actin in an ATP dependent manner based on co-sedimentation assays (data not shown). It is unclear why the MYO3A.MtD did not co-localize with actin in COS7 cells, but similar results were obtained with other MYO3A motor dead mutant constructs7,36.

Removal of THD2 from MYO3A (MYO3A.ΔTHD2) abolished its tip localization (Fig.

3.3J) as shown previously26. Interestingly, we observed that its filopodia formation and elongation activity were also abolished compared to MYO3A expressing cells

(Fig. 3.3K-L). MYO3B (kinase domain deleted) did not tip localize as it lacks

THD226, whereas the MYO3B.3ATail (MYO3B motor with entire MYO3A Tail) chimeric construct demonstrated enhanced filopodia tip localization, formation, and elongation activity compared to MYO3B (Fig. 3.3G-L). However, the tip localization, and filopodia formation and elongation activity of MYO3B.3ATail construct was significantly reduced compared to MYO3A (Fig. 3.3G-L).

MYO3B.3ATail is a unique chimeric construct which allowed us to compare the motor activity of MYO3A and MYO3B while keeping the tail domains identical.

Overall, our results support our hypothesis that the more robust motor activity of 63 MYO3A correlates with its enhanced ability to function in actin protrusion formation and elongation.

MYO3A extended tail domain is crucial for formation and elongation of stable actin protrusions. Apart from higher motor activity, the MYO3A extended tail domain is a structurally distinct feature compared to MYO3B. MYO3A tail exons

32-34 encode for THD16,34 and exon 35 encodes for THD236. It is known that

MYO3A requires THD2 to tip localize36, however, the functional role of other regions of the extended tail in actin protrusion formation or elongation is not known.

Walsh et al. (2002) have reported one naturally occurring alternative splice variant of mouse MYO3A24 which lacks complete tail exon 32, providing further rationale for examining the function of individual MYO3A tail exons.

Deletion of MYO3A tail exons demonstrated minimal impact on tip localization

(Table 3.2). However, all the tail exon deletion constructs lost the ability to induce and elongate actin protrusions (Table 3.2). We confirmed by western blotting that the expressed MYO3A tail exon deletion constructs were the correct size (Fig.

3.1B), and fluorescence intensity levels demonstrated similar expression levels.

We have successfully used these constructs in our previous study (Chapter 2)35 to determine the binding site of a novel MYO3A cargo- MORN4. Finally, the ability of these constructs to tip localize suggests that the structure of tail region in each of the constructs was unperturbed except for the removal of specific regions.

Interestingly, our live cell imaging data revealed that the actin protrusions formed by MYO3A expressing cells were longer and more stable compared to the 64 protrusions formed by MYO3A,Δ(tail exon) constructs expressing cells. Our results indicate that the integrity of the MYO3A tail may be critical for its ability to induce, elongate and stabilize the protrusions.

MYO3A enhances actin protrusion lifetime. We examined the filopodia dynamics of MYO3A, MYO10 and GFP only expressing cells. MYO10 expressing cells and GFP only expressing cells (control cells) demonstrated ~6-fold and ~3- fold greater filopodia extension velocities, respectively, compared to MYO3A (Fig.

3.4A). MYO10 and control cells also demonstrated greater retraction velocity compared to MYO3A (Fig. 3.4B). Interestingly, we did not observe any protrusions in MYO3A expressing cells with a lifetime less than 5 min. Whereas, MYO10 expressing cells displayed 44% protrusions with a lifetime < 3min, 36% protrusions with a 3-5min lifetime and only 20% protrusions with a lifetime > 5min. Control cells showed 22% protrusions with a lifetime <3min, 31% protrusions with 3-5 min lifetime and 47% protrusions with a lifetime > 5min (Fig. 3.4C). These data also reinforce our proposal that MYO3A can impact actin-protrusion dynamics in the absence of Espin16.

Role of MYO3A in inducing and elongating stable actin bundle based microvilli in cultured W4 cells. To demonstrate if MYO3A can function as an inducer and elongator of self-supporting actin-based protrusions, we turned to W4 epithelial cells, which build a microvillus-rich brush border during differentiation43.

W4 cells expressing GFP tagged MYO3AKIN (full length, kinase active), MYO3A,

MYO3BKIN (full length, kinase active), MYO3B, MYO10, or GFP only were imaged 65 using Structured Illumination Microscopy (Fig. 3.5A-T). MYO10 expression in W4 cells led to a profuse microvilli generation on the cell surface (Fig. 3.5A-C). We hypothesized that MYO3A transfection in W4 cells would also lead to generation of microvilli along the cell surface if it is capable of enhancing parallel actin bundle based protrusions. Average microvillar length was the highest in MYO3AKIN expressing cells and the lowest in GFP only expressing cells (Fig. 3.5S). MYO3A expressing cells formed shorter microvilli compared to MYO10 expressing cells

(Fig. 3.5S) and longer microvilli compared to MYO3BKIN, MYO3B and GFP only expressing cells, respectively (Fig. 3.5S). MYO3B expressing cells demonstrated longer microvilli compared to GFP only (Fig. 3.5S). Average microvillar coverage was the highest in MYO10 expressing cells (Fig. 3.5T) and lowest in GFP only expressing cells. MYO3AKIN and MYO3A induced greater microvillar formation compared to MYO3B, MYO3BKIN and GFP only expressing cells (Fig. 3.5T).

Whereas, MYO3B induced greater microvilli formation compared to GFP only (Fig.

3.5T). Overall, MYO3A expressing cells demonstrated significantly longer and higher numbers of microvilli compared to MYO3B and GFP only expressing W4 cells. Villin is a major actin crosslinking protein present in the actin core of the brush border microvilli52. The presence of villin in the actin protrusions of MYO10 and MYO3A expressing W4 cells (Fig. 3.6) confirmed that the protrusions are indeed microvilli-like and not filopodia. 66 Discussion

The findings from recent MYO3 studies25,27,32,34 and an overall growing interest in the function of myosins in actin based protrusions8,39,53 demanded a systematic study of the functional differences of MYO3 motor and tail domains. Our results highlight the enhanced motor activity of human MYO3A compared to MYO3B, which correlates with its enhanced ability to localize to actin protrusion tips as well as induce the formation and elongation of actin protrusions. In addition, the extended tail domain of MYO3A, which contains an actin binding motif, is required for the formation, elongation and stabilization of actin protrusions. Thus, we propose that MYO3A is uniquely engineered to function as a motorized actin cross- linker that can control the dynamics of actin protrusions even in the absence of its binding partners Espin1 and EspinL. We demonstrate that MYO3A can enhance the formation and elongation of more stable actin protrusions such as the microvilli of W4 cells. Our results shed light on the crucial role that MYO3 play in controlling the lengths and dynamics of the stereocilia of inner ear hair cells.

Role of MYO3 motor domain in regulating actin protrusion dynamics. Our results demonstrate that MYO3A is a faster motor compared to MYO3B (Fig. 3.2)

(Table 3.1) and an active motor domain is absolutely required for allowing MYO3A to induce and elongate actin protrusions (Fig. 3.3K-L). To examine the role of the motor domain in class III myosins we compared MYO3A and MYO3B.3ATail constructs, which were designed to have an identical tail domain but differing motor 67 domains. The results (Fig. 3.3J-L) support our hypothesis that motor activity correlates with protrusion formation and elongation activity.

The correlation between MYO3 motor activity and actin protrusion formation and elongation was consistently observed in microvilli forming W4 cells. Greater microvilli formation and elongation activity of MYO3A constructs compared to

MYO3B constructs (Fig. 3.5) suggested that MYO3A can induce and elongate stable actin protrusions as well. Based on our observation of MYO3B distribution along the microvilli in W4 cells, it is likely that some form of Espin is expressed in these cells54, since MYO3B is known to localize to actin bundles only in the presence of Espin1 or EspinL26. MYO3AKIN exhibited greater microvilli elongation activity compared to MYO3A (Fig. 3.5S), suggesting that the presence of the kinase domain may further enhance elongation activity. Interestingly, no such difference was observed between the elongation activity of MYO3BKIN and

MYO3B. These results suggest that the presence of kinase domain may impact the ability of MYO3 to alter actin protrusion dynamics. MYO10 demonstrated higher elongation activity compared to MYO3A in W4 cells (Fig. 3.5S), which is consistent with the proposed higher motor activity of MYO1039,55 compared with

MYO3A.

Role of the MYO3A tail domain in regulating actin protrusion dynamics. Our results demonstrate that THD2 is not only critical for tip localization, as previously demonstrated in fish and mouse MYO3A22,36, but also for the actin protrusion formation and elongation activity of MYO3A (Fig. 3.3G-L). In addition, analysis of 68 the exon deletion constructs demonstrated that the extended tail is also required for actin protrusion formation and elongation. We propose that MYO3A may be involved in actin protrusion initiation via a mechanism similar to the convergent elongation model56,57 in which actin protrusion formation occurs by a gradual organization of branched actin filaments in the cell cortex. Although microvilli do not form via a convergent elongation mechanism58,59, MYO3A likely stabilizes actin based structures important for the early stages of microvilli formation. MYO3A may be able to stabilize actin based structures utilizing its motor and tail domain to crosslink actin filaments. MYO3 are not anticipated to function as dimers as they lack a predicted coiled-coil domain, and thus MYO3A is the first monomeric myosin determined to be capable of enhancing the formation of protrusions. The deafness- associated G488E MYO3A mutant, which does not tip localize in filopodia (COS7 cells), is not rescued in the presence of WT MYO3A and Espin125, supporting the idea that MYO3A is monomeric.

Our investigation of the actin protrusion dynamics in control cells compared to

MYO10 and MYO3A expressing cells (Fig. 3.4) revealed interesting differences that suggest potential mechanisms for how these two motors influence actin protrusion dynamics. The changes in actin protrusion length are thought to be dependent upon the balance between cytoskeletal assembly at the tips and the rate of actin retrograde flow, with assembly being a dominant influence60-65. Our results demonstrate that MYO3A dramatically increases protrusion lifetime while slowing protrusion dynamics (extension and retraction velocity) (Fig. 3.4). MYO10 69 can enhance the filopodia extension velocity by increasing the actin polymerization rate through mechanisms which have been previously proposed, such as transporting the anti-capping protein Ena/VASP to the tips55. Interestingly, MYO3A may be able to stabilize actin bundles by cross-linking actin filaments at the tips of protrusions. It is also possible that the MYO3A mediated slow extension velocity may provide a greater opportunity for incorporation of actin bundling proteins in the growing actin bundle, thus further stabilizing the protrusions. The tip localized

MYO3A may slow elongation if it interferes with the addition of monomers at the barbed ends. Interestingly, all the tail exon deletion construct expressing cells displayed shorter (Table 3.2) and less stable protrusions compared to MYO3A.

These results suggest that disrupting the tail domain structure abolishes its ability to stabilize the actin protrusions. It was previously reported that the rearward intrafilopodial movement of MYO3A is similar to MYO10 and VASP30,31,38,55, suggesting that the retrograde flow rate is unaffected by MYO3A. Thus, we propose that MYO3A is precisely engineered to maintain stable actin protrusions that demonstrate slow elongation rates.

A recent study demonstrated severe defects in stereocilia shape and size in

MYO3A-/-MYO3B-/- double knockout mice27. On embryonic stage 16.5 of the double knockout mice, the cochlear hair bundles showed abnormal shape and exaggerated elongation. Interestingly, a mouse model of DFNB30, which lacks functional MYO3A, demonstrated changes in stereocilia ultrastructure and inner ear hair cell degeneration as the animals aged66. Since our work suggests MYO3A 70 can enhance protrusion elongation by stabilizing the tips, the double knockout phenotype may seem to contradict our results. However, a possible interpretation is that, in the absence of MYO3A the stereocilia may elongate at a faster rate while there may be a reduction in its stability. Thus, in the absence of MYO3A the stereocilia elongate abnormally in early development and since the ultrastructure is perturbed they are more likely to degenerate as an adult. It should be noted that length regulation in stereocilia is a highly complex process which involves many different players including multiple unconventional myosins and their binding partners7,8,27. Indeed, a recent study has shown that MYO3 isoforms are capable of elongating or restricting actin protrusion length depending upon the presence of its specific cargo (Espin1 or EspinL)32.

71 Tables and Figures

Tables

Table 3-1. Summary of actin-activated ATPase activity and in vitro motility results. ATPase (represented as mean + SD) and in vitro motility (represented as mean + SEM; n= 177 filaments) were reported from at least two protein preparations and 2-3 independent experiments.

-1 -1 Construct V0 (sec ) kcat (sec ) KATPase (µM) Velocity (nm/sec)

MYO3A 2IQ cGFP 0.04 ± 0.05 1.83 ± 0.02 3.3 ± 0.2 70.62 ± 0.48

MYO3B 2IQ cGFP 0.02 ± 0.01 0.50 ± 0.13 66.8 ± 31.0 31.20 ± 0.38

72

Table 3-2. Summary of parameters used to quantify MYO3-associated actin protrusions. Filopodia tip to cell body ratio and filopodia length values are presented as mean + SEM. Filopodia density values are presented as mean + SD. Filopodia data were collected from > 60 filopodia from > 10 cells for each condition in three independent experiments. Microvillar length and coverage data are presented as mean + SEM. Microvilli data were collected from > 54 microvilli from > 9 cells in two independent sets of experiments. Statistical comparisons are shown in respective data figures. Filopodia density Filopodia tip to Filopodia (number of Constructs cell body ratio length (µm) filopodia per µm) GFP-MYO3A 1.77+0.11 3.39+0.19 0.18+0.05 GFP-MYO3A.MtD 0.25+0.02 1.24+0.05 0.03+0.02 GFP-MYO3B 0.22+0.01 1.40+0.07 0.03+0.02 GFP-MYO3A.ΔTHD2 0.22+0.02 1.47+0.06 0.01+0.02 GFP-MYO3B.3A Tail 1.29+0.12 2.71+0.13 0.09+0.02 GFP-MYO3A,Δ30 1.24+0.09 1.48+0.08 0.06+0.07 GFP-MYO3A,Δ31 1.81+0.11 1.54+0.05 0.11+0.05 GFP-MYO3A,Δ32 1.27+0.11 1.54+0.07 0.05+0.04 GFP-MYO3A,Δ33 1.89+0.13 1.44+0.04 0.08+0.05 GFP-MYO3A,Δ34 2.02+0.10 1.27+0.05 0.10+0.04 GFP only 0.21+0.01 1.36+0.07 0.02+0.02 GFP-MYO10 - 3.51+0.10 -

W4 cells W4 cells Microvillar Microvillar coverage (% cell length (µm) periphery covered with microvilli) GFP-MYO10 1.95+0.06 0.91+0.04 GFP-MYO3AKIN 2.32+0.05 0.60+0.04 GFP-MYO3A 1.74+0.05 0.71+0.05 GFP-MYO3BKIN 1.51+0.03 0.33+0.02 GFP-MYO3B 1.49+0.04 0.39+0.02 GFP only 1.36+0.02 0.30+0.01

73

Table 3-3. List of primers used to generate novel constructs for this study. Gene/Species Plasmid Primers used (5’ to 3’) (Accession no.) (Template Forward (F) and Reverse (R) vector)

F:GCATTGGCATTCTTGATATATTTGCCTTTG MYO3A.MtD AAAATTTCAAAAAAAATT (pEGFP-C1) R:AATTTTTTTTGAAATTTTCAAAGGCAAATA TATCAAGAATGCCAATGC

F:AGAGAGCCAGCAGCCGGCGGCCGCAAC MYO3A.ΔTHD2 CCCTACGACTTC (pEGFP-C1) R:GAAGTCGTAGGGGTTGCGGCCGCCGGC MYO3A/Human TGCTGGCTCTCT (NM_017433) F: TCGGGCGCGGATCCCATGGTAGATG MYO3A 2IQ ATTTAGC (pFastBac) R: GCTAAATCATCTACCATGGGATCCG CGCCCGA F:TTTCGTGAAGAAACAAGCAGAAAATGGAT CCTCTGCTAATGAAAGATTCA MYO3B.3A Tail TTTCAG (pEGFP-C1) R:CTGAAATGAATCTTTCATTAGCAGAGGAT CCATTTTCTGCTTGTTTCTTCACGAAA F: TAGGATCCAAACATCTGTATGGA MYO3BKIN R:TAGCGGCCGCTTAATGTTGAGCAAAAGA (pEGFP-C1) GTC MYO3B F:TAGGATCCAAACATCTGTATGGA (pEGFP-C1) R:TAGGATCCGATGATTTGGTCAACCTAGA F:TAGGATCCATGGATGATTTGGTCAACCTA MYO3B/Human MYO3B 2IQ GA (NM_138995) (pFastBac) R:TAGCGGCCGCGTCCCCTGCTTGATT F:AGTGCCGAGGTTCAAGGATCCAGCGAGC MYO3B.3A Tail CTGGTGAC (pEGFP-C1) R:GTCACCAGGCTCGCTGGATCCTTGA ACCTCGGCACT

74 Figures

Figure 3.1. Diagrammatic representation of the domain structure of class III myosins and the COS7 cell expression of various constructs. (A) Schematic map including kinase domain, motor domain, IQ motifs, THD1 and THD2 of various MYO3A and MYO3B constructs used in the current study. The amino acid (aa) residue number is shown at the start and end of each domain. The vertical black lines represent IQ motifs. MYO3A tail magnified diagram shows that the exon 30 amino acid sequence length is greater than 75 that of combined sequences of exons 31-34. In order to represent the diagram to scale and to highlight all the features, complete exon 30 is not shown. Overlapping residues between exons 31-32, 33-34 and 34-35 in the MYO3A tail sequence are underlined. Diagrams are drawn to scale. (B) Western blot of COS7 lysates expressing various MYO3 constructs probed with anti MYO3A tail tip antibody. Predicted molecular weights (in Da) of MYO3A- 182,230; MYO3A,Δ30- 148,080; MYO3A,Δ31- 176,370; MYO3A,Δ32- 177,910; MYO3A,Δ33- 180,350; MYO3A,Δ34- 176,480; and MYO3B.3A Tail- 176,290.

76

Figure 3.2. Actin-activated ATPase and in vitro motility properties of MYO3A and MYO3B. (A) The steady state actin-activated ATPase rate was measured and plotted as a function of actin concentration and fit to the Michaelis-Menten equation to determine kcat and KATPase. Error bars represent standard deviation. (B) The in vitro motility assay was performed with the same constructs and the actin filament sliding velocity was determined (n = 177 filaments). ATPase and in vitro motility data were reported from at least two protein preparations and 2-3 independent experiments. The velocities for each construct were fit to a Gaussian distribution and the mean velocity determined. See Table 3.1 for summary of ATPase and motility values.

77

Figure 3.3. Role of MYO3A motor domain and THD2 in actin protrusion formation and elongation. Representative confocal images of paraformaldehyde-fixed and phalloidin-stained COS7 cells transfected with (A-C) GFP-MYO3A, (D-F) GFP- MYO3A.MtD, and (G-I) GFP-MYO3B.3A Tail (left panel- merged GFP-MYO3 (red) and 568-phalloidin actin actin (blue); middle panel- phalloidin-568 actin; right panel- GFP- MYO3). Scale bar is 5µm. (J) MYO3A exhibited significantly higher tip localization (*p<0.01) compared to all the other constructs. MYO3B.3ATail demonstrated tip localization greater than MYO3A.MtD, MYO3A.ΔTHD2, MYO3B and GFP only (^p<0.0001). A similar trend was observed in (K) filopodia length and (L) filopodia density measurements. MYO3A expressing cells demonstrated the highest filopodia length (K, **p<0.0001) and density (L, ***p<0.0001). Whereas, MYO3B.3ATail expressing cells exhibited enhanced filopodia length (K, ^^p<0.001) and density (L, ^^^p<0.0001) compared to MYO3A.MtD, MYO3A.ΔTHD2, MYO3B and GFP only. (J) Filopodia tip to cell body ratio plot and (K) filopodia length plot error bars indicate mean + SEM. Error bars in the (L) filopodia density plot indicates mean + SD. For all the parameters, data were 78 collected from > 60 filopodia from > 10 cells for each condition in three independent experiments. Numerical data are shown in Table 3.2.

79

Figure 3.4. Impact of MYO3A on actin protrusion dynamics. (A) Scattered dot plots showing the filopodia extension velocities of MYO3A, MYO10 and GFP only expressing COS7 cells. MYO10 expressing cells exhibited the highest filopodia extension velocity (*p<0.0001). GFP only expressing cells had a filopodia extension velocity greater than 80

MYO3A (¶p<0.0001) (extension velocity (nm/sec): MYO3A- 8.78 + 3.39; MYO10- 58.97 + 11.91; GFP only- 21.46 + 15.10). (B) Scattered dot plot showing the filopodia retraction velocity of MYO3A, MYO10 and GFP only expressing COS7 cells. MYO10 and GFP only exhibited significantly greater retraction velocity compared to MYO3A (**p<0.01 and ¶¶p<0.001, respectively) (retraction velocity (nm/sec): MYO3A- 9.76 + 6.38; MYO10- 16.59 + 8.00; GFP only- 18.51 + 10.76). Extension and retraction velocity data were collected from > 31 filopodia from > 10 cells for each condition in three independent experiments. Scattered dot plots are shown as mean + SD and the mean is represented by a red line. (C) Quantification of filopodia lifetimes by live-cell imaging of COS7 cells expressing the indicated GFP-tagged constructs. MYO3A expressing cells exhibited protrusions with a longer lifetime (>5min) compared to MYO10 and GFP only expressing cells. Data were collected from 45 filopodia from > 7 cells for each condition in three independent experiments.

81

Figure 3.5. Impact of MYO3A on microvilli formation and elongation in W4 cells. (A- R) A range of GFP tagged MYO3 and MYO10 constructs were transfected in induced W4 cells and imaged using superresolution SIM to examine their microvilli formation and elongation activity. The zoomed in image of the surface features are shown at the bottom of each panel. In the merged image actin is shown in magenta and MYO3/MYO10 shown in green. Scale bar is 3µm. (S) MYO3AKIN exhibited the highest microvilli length compared to the other constructs (*p<0.001). MYO10 demonstrated longer microvilli compared to MYO3A, MYO3B and GFP only constructs (^p<0.01). MYO3A demonstrated longer microvilli length compared to MYO3B constructs and GFP only (#p<0.001), whereas 82

MYO3B constructs showed longer microvilli length compared to GFP only (**p<0.02). (T) MYO10 expression resulted in the highest microvillar coverage (*p<0.01). Expression of MYO3A constructs resulted in microvillar coverage greater than MYO3B constructs and GFP only, whereas MYO3B constructs induced microvillar coverage greater than GFP only (^p<0.05). Data were collected from > 54 microvilli from > 9 cells in two independent sets of experiments. Error bars in both the plots indicate mean + SEM. Numerical data are shown in Table 3.2.

83

Figure 3.6. Villin immunostaining in MYO3A and MYO10 expressing W4 cells. Confocal images of paraformaldehyde-fixed and phalloidin-stained (A-D) GFP-MYO3A and (E-H) GFP-MYO10 expressing W4 cells immunostained for villin, a microvilli specific actin crosslinking protein. (merged image: GFP-MYO3A or GFP-MYO10 (green), actin (magenta) and villin (red)). Scale bar is 5µm.

84 References

1 Bartles, J. R. Parallel actin bundles and their multiple actin-bundling proteins. Current opinion in cell biology 12, 72-78 (2000). 2 Sekerkova, G., Zheng, L., Loomis, P. A., Mugnaini, E. & Bartles, J. R. Espins and the actin cytoskeleton of hair cell stereocilia and sensory cell microvilli. Cellular and molecular life sciences : CMLS 63, 2329-2341, doi:10.1007/s00018-006-6148-x (2006). 3 Lin, H. W., Schneider, M. E. & Kachar, B. When size matters: the dynamic regulation of stereocilia lengths. Current opinion in cell biology 17, 55-61, doi:10.1016/j.ceb.2004.12.005 (2005). 4 Rzadzinska, A. K., Schneider, M. E., Davies, C., Riordan, G. P. & Kachar, B. An actin molecular treadmill and myosins maintain stereocilia functional architecture and self-renewal. The Journal of Cell Biology 164, 887-897, doi:10.1083/jcb.200310055 (2004). 5 Schneider, M. E., Belyantseva, I. A., Azevedo, R. B. & Kachar, B. Rapid renewal of auditory hair bundles. Nature 418, 837-838, doi:10.1038/418837a (2002). 6 Salles, F. T. et al. Myosin IIIa boosts elongation of stereocilia by transporting espin 1 to the plus ends of actin filaments. Nature cell biology 11, 443-450, doi:10.1038/ncb1851 (2009). 7 Schneider, M. E. et al. A new compartment at stereocilia tips defined by spatial and temporal patterns of myosin IIIa expression. The Journal of neuroscience : the official journal of the Society for Neuroscience 26, 10243-10252, doi:10.1523/JNEUROSCI.2812-06.2006 (2006). 8 Belyantseva, I. A. et al. Myosin-XVa is required for tip localization of whirlin and differential elongation of hair-cell stereocilia. Nature cell biology 7, 148- 156, doi:10.1038/ncb1219 (2005). 9 Nal, N. et al. Mutational spectrum of MYO15A: the large N-terminal extension of myosin XVA is required for hearing. Human mutation 28, 1014- 1019, doi:10.1002/humu.20556 (2007). 10 Grati, M. & Kachar, B. Myosin VIIa and sans localization at stereocilia upper tip-link density implicates these Usher syndrome proteins in mechanotransduction. Proceedings of the National Academy of Sciences of the United States of America 108, 11476-11481, doi:10.1073/pnas.1104161108 (2011). 11 Boeda, B. et al. Myosin VIIa, harmonin and cadherin 23, three Usher I gene products that cooperate to shape the sensory hair cell bundle. The EMBO journal 21, 6689-6699 (2002). 12 Seiler, C. et al. Myosin VI is required for structural integrity of the apical surface of sensory hair cells in zebrafish. Developmental biology 272, 328- 338, doi:10.1016/j.ydbio.2004.05.004 (2004). 13 Sakaguchi, H. et al. Dynamic compartmentalization of protein tyrosine phosphatase receptor Q at the proximal end of stereocilia: implication of 85 myosin VI-based transport. Cell motility and the cytoskeleton 65, 528-538, doi:10.1002/cm.20275 (2008). 14 Batters, C. et al. Myo1c is designed for the adaptation response in the inner ear. The EMBO journal 23, 1433-1440, doi:10.1038/sj.emboj.7600169 (2004). 15 Gillespie, P. G. & Cyr, J. L. Myosin-1c, the hair cell's adaptation motor. Annual review of physiology 66, 521-545, doi:10.1146/annurev.physiol.66.032102.112842 (2004). 16 Lee, S. J. & Montell, C. Light-dependent translocation of visual arrestin regulated by the NINAC myosin III. Neuron 43, 95-103, doi:10.1016/j.neuron.2004.06.014 (2004). 17 Porter, J. A., Hicks, J. L., Williams, D. S. & Montell, C. Differential localizations of and requirements for the two Drosophila ninaC kinase/myosins in photoreceptor cells. The Journal of cell biology 116, 683- 693 (1992). 18 Porter, J. A. & Montell, C. Distinct roles of the Drosophila ninaC kinase and myosin domains revealed by systematic mutagenesis. The Journal of cell biology 122, 601-612 (1993). 19 Wes, P. D. et al. Termination of phototransduction requires binding of the NINAC myosin III and the PDZ protein INAD. Nature neuroscience 2, 447- 453, doi:10.1038/8116 (1999). 20 Dose, A. C. & Burnside, B. Cloning and chromosomal localization of a human class III myosin. Genomics 67, 333-342, doi:10.1006/geno.2000.6256 (2000). 21 Dose, A. C. et al. Myo3A, one of two class III myosin genes expressed in vertebrate retina, is localized to the calycal processes of rod and cone photoreceptors and is expressed in the sacculus. Molecular biology of the cell 14, 1058-1073, doi:10.1091/mbc.E02-06-0317 (2003). 22 Lin-Jones, J., Parker, E., Wu, M., Dose, A. & Burnside, B. Myosin 3A transgene expression produces abnormal actin filament bundles in transgenic Xenopus laevis rod photoreceptors. Journal of cell science 117, 5825-5834, doi:10.1242/jcs.01512 (2004). 23 Sahly, I. et al. Localization of Usher 1 proteins to the photoreceptor calyceal processes, which are absent from mice. The Journal of cell biology 199, 381-399, doi:10.1083/jcb.201202012 (2012). 24 Walsh, T. et al. From flies' eyes to our ears: mutations in a human class III myosin cause progressive nonsyndromic hearing loss DFNB30. Proceedings of the National Academy of Sciences of the United States of America 99, 7518-7523, doi:10.1073/pnas.102091699 (2002). 25 Grati, M. et al. Myo3a Causes Human Dominant Deafness And Interacts With Protocadherin 15-Cd2 Isoform. Human mutation, doi:10.1002/humu.22961 (2016). 26 Merritt, R. C. et al. Myosin IIIB uses an actin-binding motif in its espin-1 cargo to reach the tips of actin protrusions. Current biology : CB 22, 320- 325, doi:10.1016/j.cub.2011.12.053 (2012). 86 27 Lelli, A. et al. Class III myosins shape the auditory hair bundles by limiting microvilli and stereocilia growth. The Journal of cell biology, doi:10.1083/jcb.201509017 (2016). 28 Dose, A. C., Ananthanarayanan, S., Moore, J. E., Burnside, B. & Yengo, C. M. Kinetic mechanism of human myosin IIIA. The Journal of biological chemistry 282, 216-231, doi:10.1074/jbc.M605964200 (2007). 29 Dose, A. C. et al. The kinase domain alters the kinetic properties of the myosin IIIA motor. Biochemistry 47, 2485-2496, doi:10.1021/bi7021574 (2008). 30 Quintero, O. A. et al. Intermolecular autophosphorylation regulates myosin IIIa activity and localization in parallel actin bundles. The Journal of biological chemistry 285, 35770-35782, doi:10.1074/jbc.M110.144360 (2010). 31 Quintero, O. A. et al. Myosin 3A kinase activity is regulated by phosphorylation of the kinase domain activation loop. The Journal of biological chemistry 288, 37126-37137, doi:10.1074/jbc.M113.511014 (2013). 32 Ebrahim, S. et al. Stereocilia-staircase spacing is influenced by myosin III motors and their cargos espin-1 and espin-like. Nature communications 7, 10833, doi:10.1038/ncomms10833 (2016). 33 Sekerkova, G., Richter, C. P. & Bartles, J. R. Roles of the espin actin- bundling proteins in the morphogenesis and stabilization of hair cell stereocilia revealed in CBA/CaJ congenic jerker mice. PLoS genetics 7, e1002032, doi:10.1371/journal.pgen.1002032 (2011). 34 Liu, H. et al. Myosin III-mediated cross-linking and stimulation of actin bundling activity of Espin. eLife 5, doi:10.7554/eLife.12856 (2016). 35 Mecklenburg, K. L. et al. Invertebrate and Vertebrate Class III Myosins Interact with MORN Repeat-Containing Adaptor Proteins. PloS one 10, e0122502, doi:10.1371/journal.pone.0122502 (2015). 36 Les Erickson, F., Corsa, A. C., Dose, A. C. & Burnside, B. Localization of a class III myosin to filopodia tips in transfected HeLa cells requires an actin- binding site in its tail domain. Molecular biology of the cell 14, 4173-4180, doi:10.1091/mbc.E02-10-0656 (2003). 37 Manor, U., Grati, M., Yengo, C. M., Kachar, B. & Gov, N. S. Competition and compensation: dissecting the biophysical and functional differences between the class 3 myosin paralogs, myosins 3a and 3b. Bioarchitecture 2, 171-174, doi:10.4161/bioa.21733 (2012). 38 Berg, J. S. & Cheney, R. E. Myosin-X is an unconventional myosin that undergoes intrafilopodial motility. Nature cell biology 4, 246-250, doi:10.1038/ncb762 (2002). 39 Tokuo, H., Mabuchi, K. & Ikebe, M. The motor activity of myosin-X promotes actin fiber convergence at the cell periphery to initiate filopodia formation. The Journal of cell biology 179, 229-238, doi:10.1083/jcb.200703178 (2007). 87 40 Bohil, A. B., Robertson, B. W. & Cheney, R. E. Myosin-X is a molecular motor that functions in filopodia formation. Proceedings of the National Academy of Sciences of the United States of America 103, 12411-12416, doi:10.1073/pnas.0602443103 (2006). 41 Greenman, C. et al. Patterns of somatic mutation in human cancer genomes. Nature 446, 153-158, doi:10.1038/nature05610 (2007). 42 Rose, G. G., Pomerat, C. M., Shindler, T. O. & Trunnell, J. B. A cellophane- strip technique for culturing tissue in multipurpose culture chambers. The Journal of biophysical and biochemical cytology 4, 761-764 (1958). 43 Baas, A. F. et al. Complete polarization of single intestinal epithelial cells upon activation of LKB1 by STRAD. Cell 116, 457-466 (2004). 44 Grega-Larson, N. E., Crawley, S. W., Erwin, A. L. & Tyska, M. J. Cordon bleu promotes the assembly of brush border microvilli. Molecular biology of the cell 26, 3803-3815, doi:10.1091/mbc.E15-06-0443 (2015). 45 Kron, S. J., Toyoshima, Y. Y., Uyeda, T. Q. & Spudich, J. A. Assays for actin sliding movement over myosin-coated surfaces. Methods in enzymology 196, 399-416 (1991). 46 Yengo, C. M., Takagi, Y. & Sellers, J. R. Temperature dependent measurements reveal similarities between muscle and non-muscle myosin motility. Journal of muscle research and cell motility 33, 385-394, doi:10.1007/s10974-012-9316-7 (2012). 47 Trivedi, D. V., Muretta, J. M., Swenson, A. M., Thomas, D. D. & Yengo, C. M. Magnesium impacts myosin V motor activity by altering key conformational changes in the mechanochemical cycle. Biochemistry 52, 4710-4722, doi:10.1021/bi4004364 (2013). 48 Meijering, E., Dzyubachyk, O. & Smal, I. Methods for cell and particle tracking. Methods in enzymology 504, 183-200, doi:10.1016/B978-0-12- 391857-4.00009-4 (2012). 49 Sasaki, N., Shimada, T. & Sutoh, K. Mutational analysis of the switch II loop of Dictyostelium myosin II. The Journal of biological chemistry 273, 20334- 20340 (1998). 50 Trivedi, D. V., David, C., Jacobs, D. J. & Yengo, C. M. Switch II mutants reveal coupling between the nucleotide- and actin-binding regions in myosin V. Biophysical journal 102, 2545-2555, doi:10.1016/j.bpj.2012.04.025 (2012). 51 Yengo, C. M., De la Cruz, E. M., Safer, D., Ostap, E. M. & Sweeney, H. L. Kinetic characterization of the weak binding states of myosin V. Biochemistry 41, 8508-8517 (2002). 52 Bretscher, A. & Weber, K. Villin is a major protein of the microvillus cytoskeleton which binds both G and F actin in a calcium-dependent manner. Cell 20, 839-847 (1980). 53 Courson, D. S. & Cheney, R. E. Myosin-X and disease. Experimental cell research 334, 10-15, doi:10.1016/j.yexcr.2015.03.014 (2015). 88 54 Revenu, C. et al. A new role for the architecture of microvillar actin bundles in apical retention of membrane proteins. Molecular biology of the cell 23, 324-336, doi:10.1091/mbc.E11-09-0765 (2012). 55 Tokuo, H. & Ikebe, M. Myosin X transports Mena/VASP to the tip of filopodia. Biochemical and biophysical research communications 319, 214- 220, doi:10.1016/j.bbrc.2004.04.167 (2004). 56 Svitkina, T. M. et al. Mechanism of filopodia initiation by reorganization of a dendritic network. The Journal of cell biology 160, 409-421, doi:10.1083/jcb.200210174 (2003). 57 Gupton, S. L. & Gertler, F. B. Filopodia: the fingers that do the walking. Science's STKE : signal transduction knowledge environment 2007, re5, doi:10.1126/stke.4002007re5 (2007). 58 Tilney, L. G., Connelly, P. S. & Guild, G. M. Microvilli appear to represent the first step in actin bundle formation in Drosophila bristles. Journal of cell science 117, 3531-3538, doi:10.1242/jcs.01215 (2004). 59 Shifrin, D. A., Jr., Crawley, S. W., Grega-Larson, N. E. & Tyska, M. J. Dynamics of brush border remodeling induced by enteropathogenic E. coli. Gut microbes 5, 504-516, doi:10.4161/gmic.32084 (2014). 60 Mallavarapu, A. & Mitchison, T. Regulated actin cytoskeleton assembly at filopodium tips controls their extension and retraction. The Journal of cell biology 146, 1097-1106 (1999). 61 Faix, J. & Rottner, K. The making of filopodia. Current opinion in cell biology 18, 18-25, doi:10.1016/j.ceb.2005.11.002 (2006). 62 Waterman-Storer, C. M., Desai, A., Bulinski, J. C. & Salmon, E. D. Fluorescent speckle microscopy, a method to visualize the dynamics of protein assemblies in living cells. Current biology : CB 8, 1227-1230 (1998). 63 Pollard, T. D. & Borisy, G. G. Cellular motility driven by assembly and disassembly of actin filaments. Cell 112, 453-465 (2003). 64 Mogilner, A. & Rubinstein, B. The physics of filopodial protrusion. Biophysical journal 89, 782-795, doi:10.1529/biophysj.104.056515 (2005). 65 Vignjevic, D. et al. Formation of filopodia-like bundles in vitro from a dendritic network. The Journal of cell biology 160, 951-962, doi:10.1083/jcb.200208059 (2003). 66 Walsh, V. L. et al. A mouse model for human hearing loss DFNB30 due to loss of function of myosin IIIA. Mammalian genome : official journal of the International Mammalian Genome Society 22, 170-177, doi:10.1007/s00335-010-9310-6 (2011).

89 Chapter 4

Characterization of a novel MYO3A missense mutation associated with a dominant form of late onset hearing loss

Introduction

Hearing loss is the most frequent sensory disability, affecting almost 360 million people of different ages (World Health Organization, WHO, 2012). There is enormous heterogeneity associated with hearing loss, since it can be caused by environmental factors, genetic factors or a combination of both. According to Keats and Berlin et al., 1999, almost 70% of the cases lack additional clinical signs and are categorized as non-syndromic hearing loss1. The most frequent mechanism of inheritance is autosomal recessive hearing loss (DFNB) and it is present in 80% of the genetic cases (www.iro.es/cx26deaf.html), while only 10-20% of the cases correspond to an autosomal dominant (DFNA) mechanism2. Many loci have been mapped for non-syndromic hearing loss (to date, about 170 loci), but less than a half of the genes have been identified (about 75 genes, http://hereditaryhearingloss.org).

Vertebrate MYO3 consists of two isoforms encoded by separate genes- MYO3A and MYO3B. The MYO3A gene was first mapped to locus DFNB30 by Walsh et al., 20023 who investigated a three-generation Jewish family, with individuals affected by autosomal recessive nonsyndromic hearing loss. NINAC was the first member of MYO3 to be discovered in a Drosophila mutant screen4,5. NINAC null 90 mutant flies demonstrated a defective phototransduction cascade6. Class III myosins are a unique member of the unconventional myosins superfamily that have a kinase domain at their N-terminus, followed by a conserved motor domain, and a class specific C-terminal tail region7,8. Vertebrate MYO3 are actin-dependent motor proteins that are directed towards the plus end of actin filaments9-11. MYO3 dependent transport of Espin1 and EspinL (Espin-like) from the base to the tips of stereocilia is thought to be crucial for stereocilia length and ultrastructure maintenance12,13. Both MYO3A and MYO3B consists of a conserved Espin isoform binding site called THD1 in their tail domain12-14. However, MYO3A has an unique extended tail domain consisting of an actin binding site called THD210, and a binding site for Morn4 (Chapter 2)15. It was recently reported that MYO3A may also be involved in the transport of Protocadherin-15, an essential component of the mechano-electrical transduction (MET) complex16.

A mouse model harboring human MYO3A mutations (DFNB30) demonstrates significant hearing-loss at 2.5 months of age, beginning first at high frequencies and eventually at all frequencies17. Two recent studies reported novel MYO3A mutations associated with non-syndromic hearing loss. The first report revealed an autosomal recessive mutation in a highly conserved residue of the MYO3A motor domain (S614F) from a consanguineous Kazakh family with congenital hearing-loss phenotype18. The second report characterized an autosomal dominant mutation (G488E) in the MYO3A motor domain associated with progressive hearing loss in a Tunisian family16. The impact of the G488E mutation 91 on MYO3A was characterized by our lab in collaboration with Dr. Grati’s lab, and the results are discussed in Chapter 5. Interestingly, the mechanism of the impact of mutant MYO3A (S614F and G488E respectively) on stereocilia ultrastructure is unknown.

In the current study, we characterized a novel deafness associated MYO3A mutation which was originally identified by our collaborator Dr. Mingroni-Netto’s lab in a large Brazilian pedigree with autosomal dominant hearing-loss. Ours is the second report to implicate the MYO3A gene in autosomal dominant hearing loss, suggesting an essential role for this protein in hearing. Our results demonstrate that the mutation alters ATPase and in vitro motility activity, which would impact its localization and function in actin protrusions. We observed that the mutant MYO3A consistently displaced wild-type MYO3A at stereocilia tips. The autosomal dominant phenotype of the mutant MYO3A suggest that its predominant tipward localization in stereocilia may have an impact on MYO3A mediated cargo transport of Espin isoforms13,19 and Protocadherin-1516, which in turn may have severe implications on stereocilia length regulation. The functional characterization of the mutant protein allowed us to propose a model of how the mutation may alter

MYO3A function in stereocilia.

Materials and Methods

Protein expression and purification. The Baculovirus SF9 insect cell system was used to express recombinant MYO3A 2IQ c-GFP WT and MYO3A 2IQ c-GFP 92 L697W with a c-terminal FLAG tag and purified with anti-FLAG affinity chromatography as described previously20-22. The affinity purified MYO3A WT and

L697W recombinant proteins were further purified by actin co-sedimentation and released with ATP to ensure 100% active myosin heads.

Myosin ATPase Assay. The steady state enzyme-linked ATPase assay was used to examine MYO3A 2IQ WT c-GFP and MYO3A 2IQ L697W c-GFP actin-activated

ATPase activity in KMg50 buffer with additional KCl and ATP (72 mM KCl, 1 mM

EGTA, 1 mM MgCl2, 1.85 mM ATP, 10 mM Imidazole pH 7.0, 1 mM DTT) at

25°C9,20,21. Briefly, the mutant and WT MYO3A motor ATPase was examined in the presence of a range of actin concentrations in an Applied Photophysics stopped-flow. The Michaelis-Menten equation was used to determine the KATPase

(actin concentration at which the ATPase activity is one-half maximal) and kcat

(maximal actin-activated ATPase rate), using a hyperbolic fit of the ATPase rates as a function of actin concentration.

In Vitro Motility Assay. The in vitro motility assay23 was used to determine the actin filament motility of MYO3A 2IQ WT c-GFP and MYO3A 2IQ L697W c-GFP as described previously24,25. Briefly, the nitrocellulose-coated glass coverslip surface was coated with anti-GFP antibody (Life Technologies). The surface of the coverslip was then blocked with 1mg ml-1 BSA solution in KMg50 buffer, followed by addition of COOH-terminal GFP tagged MYO3A 2IQ WT and MYO3A 2IQ

L697W respectively. Rhodamine labelled F-actin was then added to the flow chamber which was followed by the addition of activation buffer, which consisted 93 of KMg50 supplemented with 0.35% methylcellulose, 1 mM DTT, 10 µM calmodulin, 2.5mM phosphoenol, 1mg ml-1 BSA, 2 mM ATP and an ATP regeneration system (20 units ml-1 pyruvate kinase, mM phosphoenolpyruvate). To reduce photobleaching 1mg ml-1 glucose, 0.1mg ml-1 glucose oxidase and catalase were included in the activation buffer. After the addition of activation buffer, the motility of the rhodamine-phalloidin labeled F-actin filaments was observed using

Nikon TE2000 microscope25. The time-lapse images were acquired at 5-10s intervals for a period of 10-15 minutes. The velocity of moving actin filaments was measured using ImageJ with MtrackJ plugin26.

MYO3A motor domain homology modeling. HHpred- Homology detection & structure prediction by HMM-HMM comparison27, HHblits: lightning-fast iterative protein sequence searching by HMM-HMM alignment28 were used to find the best template based on sequence homology. A structural model of the human MYO3A motor domain (amino acids 340-988) was generated using I-TASSER29 and the fast skeletal muscle myosin II x-ray protein structure was used as a template (PDB

ID: 1w9i). The motor domains of myosin II and MYO3A share a 37.4% of sequence identity and 58% of similarly for the 551 residues shown in the model. Residues

874-927 were not conserved or absent in myosin II and removed from the final model. The root-mean-square deviation between the model and template was of

3.07 Å for 599 alpha carbons as estimated by SuperPose V1.0 and 92.2% of residues were in the most favored regions of the Ramachandran plot30. The final figure was generated in UCSF Chimera 1.10.2. 94 Confocal microscopy analysis. COS7 cells (ATCC CRL-1651; http://www.atcc.org/Products/All/CRL-1651) were trypsinized, plated on coverslips and maintained at 37ºC in DMEM supplemented with 10% fetal bovine serum.

Cells were transfected using Lipofectamine transfection reagent (Invitrogen) according to manufacturer’s instructions and incubated for 24 h. Samples were then fixed for 20 min in 4% formaldehyde in PBS, permeabilized and counterstained with phalloidin-Alexa405 for 30 min in 0.5% Triton X-100 in PBS.

Finally, samples were mounted on glass slides and imaged in a Nikon microscope equipped with a Yokogawa spinning disk confocal unit. ImageJ (NIH) software was used to quantify the length and filopodia density (number of filopodia per 10 µm of cell perimeter), and to estimate the relative pixel intensity of fluorescently tagged proteins along filopodia. GraphPad Prism6 software was used to perform the statistical analysis and generate the final graphs. At least three independent experiments were included.

Results

Impact of the L697W mutation on MYO3A ATPase and in vitro motility. To localize the L697W mutation in the MYO3A motor domain (amino acids 340-988 of NM_017433.4) we generated a homology model for this domain using I-

TASSER29 and the MYOII protein structure as a template (PDB ID: 1w9i) (Fig.

4.1A-B). The impact of the L697W mutation on MYO3A biochemical and biophysical properties were examined using purified human MYO3A. The kinase 95 domain of MYO3A is known to autophosphorylate and reduce motor activity20, which may have an impact on its cellular localization and function. In order to examine the impact of mutation on MYO3A without any influence of autoregulation, we used MYO3A (kinase deleted) constructs for our biochemical and cell-biological experiments. We used the MYO3A 2IQ c-GFP construct lacking the kinase domain and containing the motor and 2IQ domains for ATPase and in vitro motility experiments. Our results show that the MYO3A 2IQ WT c-GFP has a ~3-4 fold higher maximal ATPase rate and ~2 fold lower actin affinity (Table 4.1) (Fig. 4.1C) compared to MYO3A 2IQ L697W c-GFP. The c-terminal GFP tag was used to attach the protein onto the surface of coverslips coated with anti-GFP antibody to perform the in vitro motility assay. We observed that the mutant protein resulted in a ~1.3 fold decrease in the actin sliding velocity compared to the WT protein (Table

4.1) (Fig. 4.1D). Overall, our results showed that the mutation alters the enzymatic and motile properties of MYO3A.

Characterization of the impact of the L697W mutation on MYO3A filopodia formation and elongation activity in COS7 cells. MYO3A has a property to tip localize, as well as induce and elongate actin bundle based protrusions12,20, which is proposed to be dependent upon its motor activity31. We examined the filopodia formation and elongation activity of the N-terminal GFP tagged MYO3A L697W

(L697W) and MYO3A WT (WT) constructs in COS7 cells. We observed that although L697W alone was able to tip localize efficiently (Fig. 4.2A-B), there was a significant reduction in its filopodia formation and elongation activity compared 96 to WT alone (Figure 4.2C-D). L697W retained tip localization when coexpressd with WT (WT + L697W) (Fig. 4.2E-F), however it demonstrated a significantly reduced filopodia elongation activity compared to WT + WT (GFP-MYO3A WT coexpressed with mCherry-MYO3A WT) (Fig. 4.2G) coexpressing cells. We did not observe any difference in the filopodia formation activity between WT + WT and WT + L697W coexpressing cells (Fig. 4.2H).

Impact of L697W mutation on MYO3A filopodia formation and elongation activity in COS7 cells in the presence of Espin1. MYO3A is proposed to transport Espin1 from the base to the tips of vertebrate inner ear hair cell stereocilia12. To examine the impact of the L697W mutation on MYO3A function in the presence of Espin1, we coexpressed WT and L697W constructs with Espin1 in COS7 cells. L697W efficiently tip localized when coexpressed with Espin1

(L697W + Espin1), however its filopodia elongation activity was significantly reduced compared to WT + Espin1 (MYO3A WT coexpressed with Espin1) (Fig.

4.3A). We observed no difference in the filopodia density of L697W + Espin1 and

WT + Espin1 (Fig. 4.3B) coexpressing cells. L697W retained tip localization when coexpressed with WT and Espin1 (WT + L697W + Espin1) (Fig. 4.3C-D). However,

WT + L697W + Espin1 consistently showed reduced filopodia elongation activity compared to WT + WT + Espin1 (GFP-MYO3A WT coexpression with mChr-

MYO3A WT and Espin1) (Fig. 4.3E). We did not observe any difference in the filopodia density between WT + L697W + Espin1 and WT + WT + Espin1 coexpressing cells (Fig. 4.3F). 97 Characterization of cargo specific tip localization behavior of MYO3A L697W.

To closely examine the impact of the mutation on MYO3A tip localization pattern in the presence of its cargo, we compared the localization profiles of coexpressed

WT + L697W in the presence and absence of Espin1 (a known MYO3A binding protein). Coexpression of WT + WT showed robust overlapping fluorescent profiles with a steep tip-to base gradient at the filopodia tips (Fig. 4.4A). WT + L697W coexpression also demonstrated overlapping fluorescent profiles, however with a weak distribution of the fluorescent profile peaks for each protein at the filopodia tips (Fig. 4.4B), such that L697W occupied a more tipward position followed by the

WT.

Interestingly, WT + WT + Espin1 coexpressing cells retained robust overlapping fluorescent profiles for both the WT proteins at the filopodia tips (Fig. 4.4C).

Whereas, coexpression of WT + L697W + Espin1 demonstrated a predominant tipward localization of L697W at the filopodia tips with a steep tip-to base gradient, while WT localized proximally to the mutant with relatively shallow tip-to base gradient (Fig. 4.4D).

Characterization of the impact of L697W mutation on MYO3A localization in hair cells. MYO3A has been previously shown to localize at the tips of vertebrate hair cell stereocilia in a tip to base gradient12,13. However, the differing tip localization pattern of WT and L697W when coexpressed in the presence and absence of Espin1 in COS7 cell filopodia intrigued us to examine their localization pattern in hair cell stereocilia. Exogenous coexpression of WT and L697W in rat 98 cochlear explants demonstrated preferential tipward localization of L697W and proximal localization of WT at the stereocilia tips (Fig. 4.4E). Strikingly, this localization pattern was identical to the localization pattern we observed in COS7 cells coexpressing WT + L697W + Espin1.

Discussion

Walsh et al., 20023 investigated a three- generation Jewish family with individuals presenting an onset of hearing loss near the second decade of life and affected by autosomal recessive nonsyndromic hearing loss. Three different mutations were identified in MYO3A (DFNB30) in this study and all the affected individuals carried at least two of these mutations, some individuals were homozygotes and some were compound heterozygotes3. Interestingly, the variant described in the current study has not been reported in any of the mutation databases (1000 genomes,

6500 Exomes, EXAc).

It is proposed that the ability of MYO3A to transport Espin1, EspinL and

Protocadherin-15 along parallel actin bundle-based protrusions is crucial for maintaining the ultrastructure and MET function of the vertebrate inner ear hair cell stereocilia12,13,16,32. Interestingly, EspinL has been shown to facilitate shorter actin protrusions in the presence of MYO3A and longer actin protrusions in the presence of MYO3B. The specificity of interaction between MYO3 isoforms and its proposed cargo leads to differential regulation of stereocilia length13. Finally, the ability of

MYO3A to tip localize has been shown to be dependent upon its motor activity20,31, 99 therefore motor activity is very crucial for MYO3A localization and function in actin protrusions.

The variant c. T2090G identified in this work leads to a substitution in the amino acid at position 697 in MYO3A motor domain, replacing Leucine with Tryptophan.

The leucine 697 is located in the upper 50 KDa domain (Fig. 4.1A), far from the

ATP binding pocket and the actin binding domain. The upper 50 KDa domain is a conserved region in myosin motors which is thought play an important role in communication between the nucleotide and actin binding domains33,34. However, when we introduced the mutation in the MYO3A model (Fig. 4.1A) we observed a clash between tryptophan 697 and isoleucine 587 that may disrupt the structural changes in the upper 50 kDa region associated with actin activated ADP release.

The slower ATPase and in vitro motility of MYO3A L697W observed in our experiments supports the predicted structural impairments in the motor domain.

Our results demonstrating reduced actin protrusion formation and elongation activity of L697W in the absence or presence of Espin1 (Fig. 4.4A-H) is consistent with previously published results demonstrating the correlation of MYO3A motor activity and its proposed functions20,31. Interestingly, coexpression of WT with

L697W rescued the filopodia formation activity but not filopodia elongation activity in the presence or absence of Espin1 (Fig. 4.2E-H and Fig. 4.3C-F), demonstrating the dominant negative impact of the mutant on actin protrusion length regulation.

Interestingly, we observed a difference in fluorescent profiles of WT and L697W when coexpressed in the presence and absence of Espin1. (Fig. 4.4B-D). These 100 results highlight the complexity of MYO3A regulation in the presence of its cargos within the vertebrate hair cell stereocilia. Our current results support previous work that shows that the combination of different Espin isoforms plays a crucial role in defining the MYO3A tip localization pattern in vertebrate stereocilia13. The consistent predominant tipward localization pattern demonstrated by L697W in both filopodia and stereocilia (in the presence of Espin1), strengthens our hypothesis that the dominant tipward localization phenotype may be a major factor that contributes to the gradual loss of hearing function. Our previous report demonstrates that MYO3A and MYO3B coexpression in the presence of Espin1 leads to pre-dominant MYO3A tipward localization, while MYO3B localizes proximally35. It is believed that the combination of higher motor activity and actin binding affinity of MYO3A compared to MYO3B is a major cause for the observed distribution pattern22,35. We speculate that enhanced duty ratio of L697W may allow it to predominantly occupy distal actin protrusion tips with a greater affinity than WT. Devoid of tipward localization, WT may not be able to efficiently transport and incorporate Espin isoforms (length regulation component)13 and

Protocadherin-15 (MET complex component)16 at the stereocilia tips, which in turn may lead to loss of control over stereocilia length and MET regulation.

It will be interesting to further characterize the impact of L697W mutation on the kinetic steps of MYO3A ATPase cycle. It will also be important to further examine the mechanism of L697W dominant tipward localization in the presence of Espin1.

In conclusion, our findings indicate the mutation c.T2090G (L697W) in MYO3A as 101 causing autosomal dominant hearing loss, revealing an essential role for MYO3A in hearing.

102 Tables and Figures

Tables

Table 4-1. Actin activated ATPase and in vitro motility results- MYO3A 2IQ L697W c-GFP

-1 -1 Construct V0 (sec ) kcat (sec ) KATPase Velocity (µM) (nm/s)

MYO3A 2IQ WT c-GFP 0.04 ± 0.05 1.83 ± 0.02 3.3 ± 0.2 70.62 + 0.48

MYO3A 2IQ L697W c-GFP 0.19 ± 0.06 0.45 ± 0.16 1.5 ± 3.1 54.7 + 0.6

103 Figures

Figure 4.1. Structural model of the L697W mutation, and the impact of the mutation on MYO3A ATPase and in vitro motility properties. (A) Homology model of the MYO3A motor domain is shown in ribbon representation with the alpha helix in orange, loops in gray and β-strands in blue. The ATP molecule bound to the nucleotide-binding site is 104 shown in stick representation and colored in green. The Trp 697 residue is labeled, colored in blue and showed in stick representation. The upper and lower 50KDa domains and the actin-binding pocket are also indicated. (B) Sequence alignment of MYO3A and MYOII used as a template to build the model. Secondary structure prediction (SSpred) for the motor domain of MYO3A and secondary structure (SS) of MYOII (PDBID: 1w9i) are also shown and included in the alignment. Leucine 697 is indicated with a red square. Conserved residues are highlighted in gray and the region missing in the template and final model is highlighted in dark red. (C) The steady state actin-activated ATPase activity was plotted as a function of actin concentration and the data were fit to to the Michaelis-

Menten equation to determine maximum ATPase activity (kcat) and actin concentration at which ATPase is one-half maximal (KATPase). (D) The in vitro motility activity of the WT and L697W MYO3A was compared (n= 159 filaments). The actin sliding velocities for each constructs were fit to a Gaussian distribution and the average velocity was determined. Table 4.1 shows the summary for ATPase and in vitro motility values.

105

106

Figure 4.2. Impact of L697W mutation on MYO3A properties in COS7 cells. COS7 cells expressing (A) GFP- MYO3A WT alone and (B) GFP- MYO3A L697W alone showed robust tip localization of labelled proteins. MYO3A WT showed greater (C) filopodia elongation (**P<0.01) and (D) filopodia formation activity compared to MYO3A L697W (*P<0.05). (E-F) MYO3A L697W retained tip localization when coexpressed with MYO3A WT in COS7 cells (WT + L697W). (I) GFP-MYO3AWT and mChr-MYO3A WT (WT + WT) coexpressing cells showed greater filopodia length compared to WT + L697W coexpressing cells (*P<0.05). (F) We did not observe any difference in filopodia formation activity of WT + WT and WT + L697W coexpressing cells.

107

Figure 4.3. Impact of L697W mutation on MYO3A properties in COS7 cells in the presence of Espin1. COS7 cells coexpressing. (A) GFP- MYO3A WT + Espin1 and (B) GFP- MYO3A L697W + Espin1 showed robust tip localization of MYO3 under both the conditions. MYO3A WT + Espin1 consistently showed greater (C) filopodia elongation activity (****P<0.0001), however their (D) filopodia formation activity were similar. (E-F) MYO3A L697W retained tip localization when coexpressed with MYO3A WT and Espin1 in COS7 cells. (I) WT + WT + Espin1 coexpressing cells showed greater filopodia length compared to WT + L697W + Espin1 coexpressing cells (**P<0.01). (F) We did not observe 108 any difference in filopodia formation activity of WT + WT + Espin1 and WT + L697W + Espin1 coexpressing cells.

109

Figure 4.4. MYO3A L697W demonstrates dominant tipward localization when coexpressed with MYO3A WT and Espin1. (A-B) Filopodia of COS7 cells coexpressing WT + WT and WT + L697W constructs respectively showed overlapping tip localization pattern for both WT and mutant MYO3A. However, (C-D) Filopodia of COS7 cells 110 coexpressing WT + WT + Espin1 and WT + L697W + Espin1 constructs respectively showed unique tip localization pattern of L697W relative to WT in each condition. Filopodia of WT + L697W + Espin1 coexpressing cells consistently displayed GFP-MYO3A L697W accumulation at their extreme tips, while mCherry-MYO3A WT trailed behind with a relatively longer tip-to base decay along the length. (E) GFP-MYO3A L697W consistently demonstrated dominant tipward localization when coexpressed with mChr-MYO3A WT in the rate inner ear hair cell stereocilia. Intensity profiles of L697W and WT along stereocilia of transfected hair cells is shown on right.

111 References

1 Keats, B. J. & Berlin, C. I. Genomics and hearing impairment. Genome research 9, 7-16 (1999). 2 Guilford, P. et al. A non-syndrome form of neurosensory, recessive deafness maps to the pericentromeric region of chromosome 13q. Nature genetics 6, 24-28, doi:10.1038/ng0194-24 (1994). 3 Walsh, T. et al. From flies' eyes to our ears: mutations in a human class III myosin cause progressive nonsyndromic hearing loss DFNB30. Proceedings of the National Academy of Sciences of the United States of America 99, 7518-7523, doi:10.1073/pnas.102091699 (2002). 4 Montell, C. & Rubin, G. M. The Drosophila ninaC locus encodes two photoreceptor cell specific proteins with domains homologous to protein kinases and the myosin heavy chain head. Cell 52, 757-772 (1988). 5 Porter, J. A., Hicks, J. L., Williams, D. S. & Montell, C. Differential localizations of and requirements for the two Drosophila ninaC kinase/myosins in photoreceptor cells. The Journal of cell biology 116, 683- 693 (1992). 6 Porter, J. A. & Montell, C. Distinct roles of the Drosophila ninaC kinase and myosin domains revealed by systematic mutagenesis. The Journal of cell biology 122, 601-612 (1993). 7 Dose, A. C. & Burnside, B. Cloning and chromosomal localization of a human class III myosin. Genomics 67, 333-342, doi:10.1006/geno.2000.6256 (2000). 8 Dose, A. C. et al. Myo3A, one of two class III myosin genes expressed in vertebrate retina, is localized to the calycal processes of rod and cone photoreceptors and is expressed in the sacculus. Molecular biology of the cell 14, 1058-1073, doi:10.1091/mbc.E02-06-0317 (2003). 9 Dose, A. C., Ananthanarayanan, S., Moore, J. E., Burnside, B. & Yengo, C. M. Kinetic mechanism of human myosin IIIA. The Journal of biological chemistry 282, 216-231, doi:10.1074/jbc.M605964200 (2007). 10 Les Erickson, F., Corsa, A. C., Dose, A. C. & Burnside, B. Localization of a class III myosin to filopodia tips in transfected HeLa cells requires an actin- binding site in its tail domain. Molecular biology of the cell 14, 4173-4180, doi:10.1091/mbc.E02-10-0656 (2003). 11 Komaba, S., Inoue, A., Maruta, S., Hosoya, H. & Ikebe, M. Determination of human myosin III as a motor protein having a protein kinase activity. The Journal of biological chemistry 278, 21352-21360, doi:10.1074/jbc.M300757200 (2003). 12 Salles, F. T. et al. Myosin IIIa boosts elongation of stereocilia by transporting espin 1 to the plus ends of actin filaments. Nature cell biology 11, 443-450, doi:10.1038/ncb1851 (2009). 112 13 Ebrahim, S. et al. Stereocilia-staircase spacing is influenced by myosin III motors and their cargos espin-1 and espin-like. Nature communications 7, 10833, doi:10.1038/ncomms10833 (2016). 14 Liu, H. et al. Myosin III-mediated cross-linking and stimulation of actin bundling activity of Espin. eLife 5, doi:10.7554/eLife.12856 (2016). 15 Mecklenburg, K. L. et al. Invertebrate and Vertebrate Class III Myosins Interact with MORN Repeat-Containing Adaptor Proteins. PloS one 10, e0122502, doi:10.1371/journal.pone.0122502 (2015). 16 Grati, M. et al. Myo3a Causes Human Dominant Deafness And Interacts With Protocadherin 15-Cd2 Isoform. Human mutation, doi:10.1002/humu.22961 (2016). 17 Walsh, V. L. et al. A mouse model for human hearing loss DFNB30 due to loss of function of myosin IIIA. Mammalian genome : official journal of the International Mammalian Genome Society 22, 170-177, doi:10.1007/s00335-010-9310-6 (2011). 18 Qu, R. et al. Identification of a novel homozygous mutation in MYO3A in a Chinese family with DFNB30 non-syndromic hearing impairment. International journal of pediatric otorhinolaryngology 84, 43-47, doi:10.1016/j.ijporl.2016.02.036 (2016). 19 Salles, F. T. et al. Myosin IIIa boosts elongation of stereocilia by transporting espin 1 to the plus ends of actin filaments. Nature cell biology 11, 443-450, doi:10.1038/ncb1851 (2009). 20 Quintero, O. A. et al. Intermolecular autophosphorylation regulates myosin IIIa activity and localization in parallel actin bundles. The Journal of biological chemistry 285, 35770-35782, doi:10.1074/jbc.M110.144360 (2010). 21 Quintero, O. A. et al. Myosin 3A kinase activity is regulated by phosphorylation of the kinase domain activation loop. The Journal of biological chemistry 288, 37126-37137, doi:10.1074/jbc.M113.511014 (2013). 22 Merritt, R. C. et al. Myosin IIIB uses an actin-binding motif in its espin-1 cargo to reach the tips of actin protrusions. Current biology : CB 22, 320- 325, doi:10.1016/j.cub.2011.12.053 (2012). 23 Kron, S. J., Toyoshima, Y. Y., Uyeda, T. Q. & Spudich, J. A. Assays for actin sliding movement over myosin-coated surfaces. Methods in enzymology 196, 399-416 (1991). 24 Yengo, C. M., Takagi, Y. & Sellers, J. R. Temperature dependent measurements reveal similarities between muscle and non-muscle myosin motility. Journal of muscle research and cell motility 33, 385-394, doi:10.1007/s10974-012-9316-7 (2012). 25 Trivedi, D. V., Muretta, J. M., Swenson, A. M., Thomas, D. D. & Yengo, C. M. Magnesium impacts myosin V motor activity by altering key conformational changes in the mechanochemical cycle. Biochemistry 52, 4710-4722, doi:10.1021/bi4004364 (2013). 113 26 Meijering, E., Dzyubachyk, O. & Smal, I. Methods for cell and particle tracking. Methods in enzymology 504, 183-200, doi:10.1016/B978-0-12- 391857-4.00009-4 (2012). 27 Hildebrand, A., Remmert, M., Biegert, A. & Soding, J. Fast and accurate automatic structure prediction with HHpred. Proteins 77 Suppl 9, 128-132, doi:10.1002/prot.22499 (2009). 28 Remmert, M., Biegert, A., Hauser, A. & Soding, J. HHblits: lightning-fast iterative protein sequence searching by HMM-HMM alignment. Nature methods 9, 173-175, doi:10.1038/nmeth.1818 (2012). 29 Yang, J. et al. The I-TASSER Suite: protein structure and function prediction. Nature methods 12, 7-8, doi:10.1038/nmeth.3213 (2015). 30 Maiti, R., Van Domselaar, G. H., Zhang, H. & Wishart, D. S. SuperPose: a simple server for sophisticated structural superposition. Nucleic acids research 32, W590-594, doi:10.1093/nar/gkh477 (2004). 31 Schneider, M. E. et al. A new compartment at stereocilia tips defined by spatial and temporal patterns of myosin IIIa expression. The Journal of neuroscience : the official journal of the Society for Neuroscience 26, 10243-10252, doi:10.1523/JNEUROSCI.2812-06.2006 (2006). 32 Lelli, A. et al. Class III myosins shape the auditory hair bundles by limiting microvilli and stereocilia growth. The Journal of cell biology, doi:10.1083/jcb.201509017 (2016). 33 Rayment, I. et al. Structure of the actin-myosin complex and its implications for muscle contraction. Science 261, 58-65 (1993). 34 Rayment, I. et al. Three-dimensional structure of myosin subfragment-1: a molecular motor. Science 261, 50-58 (1993). 35 Manor, U., Grati, M., Yengo, C. M., Kachar, B. & Gov, N. S. Competition and compensation: dissecting the biophysical and functional differences between the class 3 myosin paralogs, myosins 3a and 3b. Bioarchitecture 2, 171-174, doi:10.4161/bioa.21733 (2012).

114

Chapter 5

Summary, conclusions and future directions

Summary and conclusions

The motor-cargo system exerts an exquisite control over the architecture and functions of the PBPs. In recent years, new discoveries have led to knowledge about several key players (unconventional myosins and novel actin regulatory proteins) that function in PBPs. However, the precise mechanism of PBPs formation and ultrastructure maintenance still remains to be understood. The sensitivity and robustness of stereocilia in particular exemplifies the elegant design of their nature. Until 2012, MYO3A was believed to primarily function to transport

Espin1 from the base to the tips of vertebrate stereocilia1. However, there were many questions which needed to be investigated (Fig. 5.1). Firstly, it is believed that MYO3B can compensate for the loss of MYO3A, but the reason for deafness phenotype in DFNB30 patients is unknown2. Secondly, although MYO3A is known to be expressed in vertebrate photoreceptors3, its role in photoreceptors is unknown. Thirdly, Espin1 is known to be present in an auto-inhibited (folded) state, such that the ARD (MYO3 binding region) and xAB (N-terminal actin binding region) sites are masked4. The mechanism of Espin1 auto-inhibition release is also unclear. Our work has been instrumental in providing significant insights into these unknown aspects of class III myosin function and their role in vertebrate hearing 115 and visual functions. In addition, this work also led to a significant advance in understanding the mechanism of novel deafness caused by MYO3A mutations.

Figure 5.1. Summary of the study. Four major aspects of characterization of class III myosins (MYO3A and MYO3B) and its binding partners associated with regulation of parallel actin bundle based protrusions were investigated in this study: 1) discovery of novel MYO3 binding partners; 2) investigating differences in the motor and tail domain of MYO3 isoforms and its impact on cellular functions; 3) investigating the role of MYO3 alone in actin based protrusions; 4) biochemical and cell-biological characterization of deafness causing MYO3A mutations.

Discovery of novel MYO3 binding partners

The first part of this work deals with discovery of novel MYO3 binding partners. In collaboration with Dr. Mecklenburg (Indian University South Bend) and Dr.

O’Tousa (University of Notre Dame) we discovered a novel MYO3A binding protein called MORN4 (Chapter 2)5. Our work made a significant contribution by demonstrating that vertebrate and invertebrate class III myosins have an 116 evolutionary conserved binding partner called MORN4. Interestingly, both MYO3A and MORN4 are known to be expressed in the actin rich compartments of vertebrate (calycal processes)6-8 and invertebrate (rhabdomere)5,9 photoreceptors.

Our work demonstrated that unlike Espin1, MORN4 interacts only with MYO3A and not MYO3B. Importantly, we were also able to demonstrate that the MORN4 binding region in the MYO3A tail is unique and distinct from the Espin1 binding region. We proposed a novel mechanism of MORN4 mediated tethering of MYO3A at the tips of actin protrusions, leading to a greater accumulation of MYO3A, which in turn may be crucial for elongation and stabilization of actin protrusions.

Interestingly, recent studies have shown that MORN4 is also expressed in vertebrate stereocilia and localizes to the tips6. The presence of MYO3A and

MORN4 in two structurally similar but functionally distinct vertebrate sensory structures, stereocilia and calycal process, suggests a conserved role of these proteins across different sensory systems. Based on our results, we can speculate that the MYO3A-MORN4 interaction may be crucial for the length and ultrastructure maintenance of stereocilia and calycal processes. Overall, this was an important discovery which laid the foundation to explore the role of MYO3A and

MORN4 in vertebrate photoreceptors.

Our work has also led to the discovery of another novel MYO3 binding protein called Espin-like (EspinL)10. This work was done in collaboration with Dr. Kachar’s lab at National Institutes of Health. It was a comprehensive study involving multiple knock out mouse models which demonstrated that the specificity of the interaction 117 between MYO3 isoforms and Espin isoforms (Espin1 and EspinL) plays a crucial role in stereocilia length maintenance and staircase pattern formation.

Interestingly, our collaborators demonstrated that EspinL has been shown to facilitate shorter actin protrusions in the presence of MYO3A and longer actin protrusions in the presence of MYO3B. We designed and performed the GST-pull down experiments to show that MYO3 has a conserved binding site called THD1 for both Espin1 and EspinL (Appendix Fig. A1).

In collaboration with Dr. Zhang’s lab (Hong Kong University of Science and

Technology) we were able to uncover the structural basis of the MYO3-Espin1 binding interaction11. Dr. Zhang’s lab solved the crystal structure of the THD1

(MYO3)-ARD (Espin1) complex to demonstrate that THD1 contains a pair of repetitive sequences, each capable of independently and strongly binding to the

ARD of Espin1, revealing a novel MYO3-mediated cross-linking mechanism of

Espin1 (Appendix Fig. B1). Based on the high resolution crystal structures, a pair of tyrosine residues were identified in each of the ARD binding motifs of THD1 which were crucial for the interaction (Appendix Fig. B1). Dr. Zhang’s lab performed structural analysis, while we generated a range of MYO3 mutation and deletion constructs, and performed live cell fluorescence imaging to examine the impact of specific tyrosine point mutations and deletions on MYO3 mediated transport of Espin1 in actin based protrusions (Appendix Fig. B2 and B3). Most importantly, the structures of MYO3 in complex with Espin1 not only elucidated the mechanism of binding, but also revealed that MYO3 can release Espin1 from an 118 auto-inhibited state. It also demonstrated that MYO3-mediated cross-linking can further promote actin fiber bundling activity of Espin1. Our results led us to propose a novel mechanism of MYO3 associated regulation of cargo activity. Overall, these discoveries significantly advanced our knowledge about the role of MYO3 and its binding partners in PBP’s. Our data provided compelling evidence demonstrating that MYO3 isoforms and Espin isoforms work together to assemble and promote higher order parallel actin bundle formation in cellular protrusions such as stereocilia.

Characterization of differences in the motor and tail domains of MYO3A and MYO3B

The next part of this work deals with characterizing the differences between

MYO3A and MYO3B motor and tail domains, and its impact on their role in actin protrusions. Our goal was to examine MYO3A and MYO3B cellular functions in the absence of Espin1. We found that MYO3A is uniquely engineered to have enhanced motor activity and an extended tail domain (containing actin binding region THD2), which allows MYO3A to induce and elongate actin protrusions in the absence of Espin1 (Fig. 5.2), Interestingly, MYO3B cannot perform these functions independently. We found that MYO3A has a unique ability to slow down the actin protrusion dynamics, which correlates well with its proposed role in 119 stereocilia that have slow actin dynamics (Chapter 3)12. These results led us to propose a novel mechanism of MYO3A mediated actin protrusion formation and elongation. Based on our data, we suggest that

MYO3A can bring actin filaments together near the membrane to initiate the formation of actin Figure 5.2. Proposed model for how MYO3A can protrusions, a process enhance the formation and elongation of actin that is critical during protrusions. Our studies show that MYO3A utilizes its motor domain and extended tail domain with an actin stereocilia formation. We binding motif to enhance the formation, elongation, and suggest that in addition to stabilization of actin protrusions. the differences in the MYO3A and MYO3B motor activity, the difference in their tail domain may also be a contributing factor in the gradual degeneration of stereocilia in DFNB30 patients and the overall difference in their ability to maintain stable actin protrusions (detailed discussion in Chapter 3). Our results are crucial for establishing a functional mechanism of MYO3 in the generation and maintenance of various actin based protrusions in native vertebrate sensory and neuronal cell types. Thus, we were able to dissect the role of individual MYO3 domains and report important findings which demonstrated the role of each of the MYO3 domains in actin protrusions. 120 Cell biological and biochemical characterization of novel MYO3A deafness causing mutations

Since 20022 there was no report of MYO3A associated deafness mutations. Our work in two independent studies in collaboration with Dr. Grati (University of Miami

Miller School of Medicine) and Dr. Kachar, has led to the characterization of two novel deafness causing MYO3A autosomal dominant mutations- p.Gly488Glu

(G488E)13 and c.Leu697Trp (L697W) (Chapter 4). For both the projects, we performed ATPase and in vitro motility experiments with MYO3A WT and mutant proteins to examine the impact of mutations on MYO3A motor properties.

Interestingly, the first mutation (G488E) which is located near the switch I region

(a highly conserved region in myosins) appears to reduce the ATPase activity and increase in vitro actin sliding velocity compared to MYO3A WT (Appendix Fig. C1).

Our collaborators demonstrated that MYO3A G488E failed to tip localize in filopodia but retained tip localization activity in stereocilia13.

We examined another mutation in MYO3A (L697W) which we found leads to a reduction in ATPase activity and in vitro sliding velocity (Chapter 4) (Fig. 4.1C-D).

We also found that MYO3A L697W leads to inhibition of MYO3A actin protrusion formation and elongation activity. Interestingly, we observed that MYO3A L697W displaces MYO3A WT from tipward localization when coexpressed with Espin1 in

COS7 cells. Our collaborators observed a consistent dominant tipward phenotype of the mutant in inner ear cultured stereocilia as well. Displacement of MYO3A WT from the tips may disrupt its ability to efficiently transport and incorporate espin 121 isoforms at the tips of stereocilia, hence leading to deregulation of the stereocilia heights and ultrastructure maintenance. Overall, these were the first ever studies to report and characterize deafness causing dominant MYO3A mutations. These novel findings greatly advanced our knowledge about the mechanism of MYO3A dominant mutations and their impact on stereocilia ultrastructure.

Future Directions

MYO3 role in vertebrate photoreceptors

MYO3A, MYO3B and MORN4 are found to be expressed in vertebrate retina3,14.

MYO3A localizes within the calycal processes7,8 whereas, the cellular localization of MYO3B and MORN4 in photoreceptors is still unknown. It has also been found that the Usher syndrome type 1 (USH1) protein network is associated with calycal processes15 and mutation in any one of the four USH1 proteins is associated with structural defects leading to retinal degeneration. The Usher protein complex is also important for morphogenesis of the stereocilia. Usher syndrome is the most common form of deaf-blindness. In future, it will be interesting to investigate the significance of MYO3 and its binding partners in the maintenance of actin structures and actin based transport mechanisms within the photoreceptor ultrastructure. It will be interesting to investigate if MYO3 and its binding partners have a conserved role in stereocilia and photoreceptors similar to Usher proteins. 122 Specifically, it will be interesting to examine the MYO3A-MORN4 transport mechanism in photoreceptor cells. MYO3 are the only known kinase-motor hybrid proteins proposed to function as signaling molecules as well as molecular motors16. In rod and cone photoreceptors although the function of Ca2+ is highly compartmentalized, it is part of an intricate mechanism leading to detection and transduction of the light stimulus. Intracellular Ca2+ levels are thought to be in the range from ~300 to ~500nM in darkness and in the presence of a saturating light stimulation, Ca2+ drops to near zero values17. Interestingly, there is a putative third

IQ (IQ3) motif near the potential MORN4 binding site in MYO3A tail region. It will be vital to investigate calmodulin (CaM) binding to the IQ3 of the MYO3A tail and the calcium dependence of this binding. Subsequently, the impact of light stimulated changes in Ca2+ levels on MYO3A-MORN4 interaction in live transgenic

Xenopus rod photoreceptors expressing GFP-MYO3A and mCherry-MORN4 can also be investigated. The CaM dependence of MORN4 binding to MYO3A tail in

Ca2+ free and Ca2+ saturated conditions in vitro can also be examined. We expect that the overall mechanism of MYO3A-MORN4 interaction is dependent on Ca2+-

CaM and it is mediated via the exon 30-31 junctional sequence. In dark adapted

Xenopus photoreceptors there will be higher Ca2+ levels as compared to light adapted Xenopus, thus, we expect to observe a higher localization of MYO3 and

MORN4 at the tips of CP in dark adapted rods. This result would support our hypothesis that higher Ca2+ levels would lead to dissociation of CaM from MYO3A tail, providing a binding site for MORN4. We expect that the formation of the

MYO3A-MORN4 complex will allow MYO3A to generate membrane tension which 123 may contribute to the process of elongation of actin rich protrusions. Overall, it will be important to investigate light dependent changes in the localization of MYO3 and its binding partners using a vertebrate photoreceptor model. Such a study has the potential to yield critical information about direct physiological relevance of

MYO3 and associated binding partners in retinal degeneration and it may lead to novel therapeutic targets for treating retinal degeneration.

Mechanism of MYO3A mediated actin protrusion regulation

Based on our results we envision MYO3A as a unique motor which can transport multiple cargos (Espin1, EspinL and MORN4), and act as a motorized monomeric actin cross-linker which specifically localizes to the barbed ends of actin filaments and stabilizes growing actin filaments to facilitate length maintenance. Further experiments with the purified MYO3A full length protein or MYO3A tail protein need to be performed to examine the precise mechanism of MYO3A mediated actin protrusion regulation. The pyrene-labelled actin polymerization assay18,19 can be performed to determine the impact of MYO3A full-length or MYO3A tail on actin nucleation and elongation. The total internal reflection fluorescence microscopy

(TIRFM) based actin elongation assay20 can also be performed to examine

MYO3A induced actin elongation. Specifically, it will be important to investigate the actin regulatory properties of THD2 which is a known F-actin binding motif in the

MYO3A tail. We hypothesis that these experiments will demonstrate that the THD2 of MYO3A is essential for its ability to cross-link actin filaments, and thereby 124 enhance actin protrusion formation and elongation. In our preliminary experiments we found evidence of endogenous MYO3A expression in ARPE19 cells (human retinal pigment epithelial cell-line), thus it may serve as an ideal cell-line to knockdown MYO3A expression by siRNA or CRISPR/Cas9 to examine its impact on the formation of actin protrusions. Overall, compared to the other myosins that are tip localizers (MYO10, MYO7 and MYO15), it remains to be seen if MYO3A is unique in its ability to induce, elongate and stabilize actin protrusions.

Characterization of MYO3A deafness causing mutations

Mutations in several unconventional myosins cause human deafness21. They play crucial distinct roles in the development, maturation, maintenance, and operation of hair cell stereocilia-mediated MET. Each myosin is found in distinct subcellular compartments along the stereocilia22. The deafness causing MYO3A mutations

L697W (Chapter 4) and G488E can be further investigated. Although both the mutations are associated with dominant phenotypes, their impact on the structure- function of the motor is distinct. MYO3A G488E was found to be capable of reaching the tips of rat organotypic inner ear culture stereocilia, and showed a fluorescence pattern similar to that seen for wild-type MYO3A1,22. It will be interesting to investigate if the mutation severely impairs the ability of MYO3A to walk along actin bundles in a proposed inch worm mechanism23 (Fig. 1.6). It is unclear if the mutation impacts the duty ratio of the motor which in turn may lead to disruption of the walking mechanism of this motor. The duty ratio and motor-tail 125 coordination may be crucial for MYO3A movement in the filopodia of COS7 cells, while the movement in stereocilia may involve a complex of MYO3A and/or other actin-based motors. MYO3A L697W was found to be capable of predominantly displacing the MYO3A WT at the tips of actin protrusions. Further experiments need to be performed to identify the steps in the MYO3A ATPase cycle which are affected by the L697W mutation. Overall, understanding the impact of mutations on motor performance will be critical to the design of novel drugs that can normalize the dysfunctional motor activity. In addition, this information will also be crucial before utilizing gene therapy methods which have been successful in treating MYO7A associated blindness24.

126 References

1 Salles, F. T. et al. Myosin IIIa boosts elongation of stereocilia by transporting espin 1 to the plus ends of actin filaments. Nature cell biology 11, 443-450, doi:10.1038/ncb1851 (2009). 2 Walsh, T. et al. From flies' eyes to our ears: mutations in a human class III myosin cause progressive nonsyndromic hearing loss DFNB30. Proceedings of the National Academy of Sciences of the United States of America 99, 7518-7523, doi:10.1073/pnas.102091699 (2002). 3 Dose, A. C. et al. Myo3A, one of two class III myosin genes expressed in vertebrate retina, is localized to the calycal processes of rod and cone photoreceptors and is expressed in the sacculus. Molecular biology of the cell 14, 1058-1073, doi:10.1091/mbc.E02-06-0317 (2003). 4 Zheng, L., Beeler, D. M. & Bartles, J. R. Characterization and regulation of an additional actin-filament-binding site in large isoforms of the stereocilia actin-bundling protein espin. Journal of cell science 127, 1306-1317, doi:10.1242/jcs.143255 (2014). 5 Mecklenburg, K. L. et al. Invertebrate and Vertebrate Class III Myosins Interact with MORN Repeat-Containing Adaptor Proteins. PloS one 10, e0122502, doi:10.1371/journal.pone.0122502 (2015). 6 Lelli, A. et al. Class III myosins shape the auditory hair bundles by limiting microvilli and stereocilia growth. The Journal of cell biology, doi:10.1083/jcb.201509017 (2016). 7 Sahly, I. et al. Localization of Usher 1 proteins to the photoreceptor calyceal processes, which are absent from mice. The Journal of cell biology 199, 381-399, doi:10.1083/jcb.201202012 (2012). 8 Lin-Jones, J., Parker, E., Wu, M., Dose, A. & Burnside, B. Myosin 3A transgene expression produces abnormal actin filament bundles in transgenic Xenopus laevis rod photoreceptors. Journal of cell science 117, 5825-5834, doi:10.1242/jcs.01512 (2004). 9 Mecklenburg, K. L. et al. Retinophilin is a light-regulated phosphoprotein required to suppress photoreceptor dark noise in Drosophila. The Journal of neuroscience : the official journal of the Society for Neuroscience 30, 1238-1249, doi:10.1523/JNEUROSCI.4464-09.2010 (2010). 10 Ebrahim, S. et al. Stereocilia-staircase spacing is influenced by myosin III motors and their cargos espin-1 and espin-like. Nature communications 7, 10833, doi:10.1038/ncomms10833 (2016). 11 Liu, H. et al. Myosin III-mediated cross-linking and stimulation of actin bundling activity of Espin. eLife 5, doi:10.7554/eLife.12856 (2016). 12 Rzadzinska, A. K., Schneider, M. E., Davies, C., Riordan, G. P. & Kachar, B. An actin molecular treadmill and myosins maintain stereocilia functional architecture and self-renewal. The Journal of cell biology 164, 887-897, doi:10.1083/jcb.200310055 (2004). 127 13 Grati, M. et al. Myo3a Causes Human Dominant Deafness And Interacts With Protocadherin 15-Cd2 Isoform. Human mutation, doi:10.1002/humu.22961 (2016). 14 Mecklenburg, K. L. Drosophila retinophilin contains MORN repeats and is conserved in humans. Molecular genetics and genomics : MGG 277, 481- 489, doi:10.1007/s00438-007-0211-7 (2007). 15 Sahly, I. et al. Localization of Usher 1 proteins to the photoreceptor calyceal processes, which are absent from mice. J Cell Biol 199, 381-399, doi:jcb.201202012 [pii] 10.1083/jcb.201202012. 16 Bahler, M. Are class III and class IX myosins motorized signalling molecules? Biochimica et biophysica acta 1496, 52-59 (2000). 17 McCarthy, S. T., Younger, J. P. & Owen, W. G. Dynamic, spatially nonuniform calcium regulation in frog rods exposed to light. Journal of neurophysiology 76, 1991-2004 (1996). 18 Cooper, J. A., Walker, S. B. & Pollard, T. D. Pyrene actin: documentation of the validity of a sensitive assay for actin polymerization. Journal of muscle research and cell motility 4, 253-262 (1983). 19 Doyle, A., Crosby, S. R., Burton, D. R., Lilley, F. & Murphy, M. F. Actin bundling and polymerisation properties of eukaryotic elongation factor 1 alpha (eEF1A), histone H2A-H2B and lysozyme in vitro. Journal of structural biology 176, 370-378, doi:10.1016/j.jsb.2011.09.004 (2011). 20 Paul, A. S. & Pollard, T. D. The role of the FH1 domain and profilin in formin- mediated actin-filament elongation and nucleation. Current biology : CB 18, 9-19, doi:10.1016/j.cub.2007.11.062 (2008). 21 Duman, D. & Tekin, M. Autosomal recessive nonsyndromic deafness genes: a review. Front Biosci (Landmark Ed) 17, 2213-2236 (2012). 22 Schneider, M. E. et al. A new compartment at stereocilia tips defined by spatial and temporal patterns of myosin IIIa expression. The Journal of neuroscience : the official journal of the Society for Neuroscience 26, 10243-10252, doi:10.1523/JNEUROSCI.2812-06.2006 (2006). 23 Merritt, R. C. et al. Myosin IIIB uses an actin-binding motif in its espin-1 cargo to reach the tips of actin protrusions. Current biology : CB 22, 320- 325, doi:10.1016/j.cub.2011.12.053 (2012). 24 Lopes, V. S. et al. Retinal gene therapy with a large MYO7A cDNA using adeno-associated virus. Gene therapy 20, 824-833, doi:10.1038/gt.2013.3 (2013).

128

Appendix A

Supplementary Figures-1

Figure A1. EspinL binds myosin-III tail-homology domain 1 (THD1). (a) Domain structure of MYO3A and MYO3B. Light blue, motor domain. Magenta, calmodulin-binding IQ domains. Red, tail homology domain 1 (THD1). Grey, tail homology domain 2 (THD2). MYO3B lacks THD2. (b,c) EspinL ARD binds THD1 of MYO3A (b) and MYO3B (c) indicated by red arrows. GFP-tagged MYO3A-3THDI and MYO3B-THDI protein from the cell lysates bound to glutathione-agarose beads preloaded with GST-EspinL-ARD but not beads with GST only. Pre- and post-THDI MYO3A and MYO3B constructs did not bind to GST-EspinL-ARD beads (Ref. Ebrahim et al., 2016 (Chapter 5)10).

129

Appendix B

Supplementary Figures-2

Figure B1. Characterization of MYO3A-Espin-1 interaction. (A) Domain organization of Espin1 showing that the Espin1-AI in the middle may bind to Espin1-AR at the N- terminus. (B) Sequence alignment of THDI of MYO3A and MYO3B showing that there is a pair of repeating sequences within THDI, which we term as ARB1 and ARB2. Hs, human; Mm, mouse; Gg, chicken; Xt, Xenopus tropicalis; Dr, Danio rerio (Ref. Liu et al., 2016 (Chapter 5)11). 130

Figure B2. Myo3-ARBs/Espin1 interaction is critical for the filopodia tip localizations of Espin1 and Myo3. (A) Representative fluorescence images of COS7 cells co- expressing RFP-Espin1 and various GFP-Myo3a experimental constructs. A1, Myo3aΔKΔABM WT; A2, Myo3aΔKΔABM, mARB; A3, Myo3aΔKΔABM, ΔARB. Scale bar: 5 mm. (B) Quantifications of the tip to cell body ratios of GFP-Myo3a (or its mutants) and RFP-Espin1 based on the experiments shown in panel A. (C) Quantifications of the tip to cell body ratios of GFP-Myo3b (or its mutants) and RFP-Espin1 when expressed in COS7 cells. The representative images for this group of experiments are shown in Appendix Fig. 131

B3. Values are means ± SEM and analyzed with Two-tailed Student’s t test; *p<0.05, **p<0.01, ***p<0.001 (Ref. Liu et al., 2016 (Chapter 5)11).

132

Figure B3. ARBs are required for both Myo3b and Espin1 filopodia tip localization. Representative COS7 cells images of RFP-Espin1 co-transfected with different constructs of GFP-Myo3b. Row 1, Myo3bΔKΔABM WT; Row 2, Myo3bΔKΔABM, mARB; Row 3, Myo3bΔKΔABM, ΔARB. Scale bar: 5 µm. (Ref. Liu et al., 2016 (Chapter 5)11).

133

Appendix C

Supplementary Figures-3

Figure C1. Biochemical characterization and targeting in hair cells of p.Gly488Glu mutant MYO3A. (A) Actin-activated ATPase activity. The ATPase activity was plotted as a function of actin concentration and the data were fit to a hyperbolic function to determine maximum ATPase activity (kcat) and actin concentration at which ATPase is one-half maximal (KATPase). Error bars represent standard errors from three separate protein preparations. (B) In vitro motility assay. The ensemble based movement of actin filaments generated by wild-type and p.Gly488Glu MYO3A was compared. The average sliding velocities (n = 150 filaments) were fit to a Gaussian function demonstrating that p.Gly488Glu mutant MYO3A generates faster actin sliding velocities than wild-type

MYO3A. (C) Summary of kinetic parameters extrapolated from actin-activated ATPase 134 activity and in vitro motility assays on wild type and p.Gly488Glu mutant MYO3A. (D)

Expression of p.Gly488Glu mutant Ch-MYO3AΔK (red channel switched into green color for better visualization) in P2 inner ear organotypic culture vestibular hair cells showing stereocilia (red) tip localization; actin is labeled using phalloidin-Alexafluor. Organotypic transfection and imagining was done by Dr. Grati’s lab. Scale bar: 10 μm. (Ref. Grati et al., 2016 (Chapter 5)13)

135

Appendix D

Letters of Permission

Chapters 2, chapter 3, and Appendix A-C has material that has been extracted in part or fully from previously published manuscript which I have co-authored. This material is used with the permission from the respective journals. Following are the copies of the proof of permission.

136 Proof of permission for Chapter 2

137

Proof of permission for Chapter 3

138

Proof of permission for Chapter 5

139

140

141

VITA Manmeet H. Raval Education 2009 M.S. Molecular Biology, University of Skovde, Skovde, Sweden 2007 B.S. Biotechnology, Shree M. & N. Virani Science College, Rajkot, India

Selected Publications  Mecklenburg K, Freed S, Raval M, Quintero O, Yengo C, and O’Tousa J. (2015) Invertebrate and vertebrate class III myosins interact with MORN repeat-containing adaptor proteins. PLoS ONE 10(3): e0122502. doi: 10.1371/journal.pone.0122502  Ebrahim S, Avenarius MR, Grati M, Krey FJ, Windsor AM, Sousa AD, Ballesteros A, Cui R, Millis BA, Salles FT, Baird MA, Davidson MW, Jones SM, Choi D, Dong L, Raval MH, Yengo CM, Barr-Gillespie PG, and Kachar B. (2016) Stereocilia Staircase Regulation by the Motors Myosin-IIIa and –IIIb and their Cargos Espin-1 and Espin-like. Nature Communications 7, 10833. doi:10.1038/ncomms10833  Grati M, Yan D, Raval MH, Walsh T, Ma Q, Chakchouk I, Kannan-Sundhari A, Mittal R, Masmoudi S, Blanton SH, Tekin M, King MC, Yengo CM, and Liu XZ. (2016) MYO3A causes human dominant deafness and interacts with protocadherin 15-CD2 isoform. Human Mutation Journal. doi: 10.1002/humu.22961  Liu H, Li Jianchao, Raval MH, Yao N, Deng X, Lu Q, Nie S, Feng W, Wan J, Yengo CM, Liu W and Zhang M. (2016) Myosin III-mediated Dimerization and Stimulation of Actin Bundling Activity of Espin. eLife 5. doi: http://dx.doi.org/10.7554/eLife.12856  Raval MH, Quintero OA, Weck ML, Unrath WC, Gallagher J, Runjia C, Kachar B, Tyska MJ, and Yengo CM. (2016) Impact of the motor and tail domains of class III myosins on regulating the formation and elongation of actin protrusions. Journal of Biological Chemistry. doi: 10.1074/jbc.M116.733741  Dantas VGL*, Raval MH*, Ballesteros A, Cui R, Yamamoto GL, de Mello Auricchio MT, Mendes CAB, Yengo CM, Kachar B, and Mingroni-Netto RC. Characterization of a novel MYO3A missense mutation associated with deafness in humans. Sci Rep (*Co-first author) (In preparation)

Selected Internships, Workshops and Awards  2016- Penn State Hershey Alumni Society Award for excellence in research and academia  2016- Biophysical Society Travel Award  2015- Technology Transfer Fellow (Intern), Penn State Hershey Technology Development Office  2015- American Society for Cell Biology Graduate Student Travel Award  2014 Patrick G. Quinn Award for Outstanding Performance by a post-comprehensive Ph.D. Candidate for the year 2014  2013- Selected and awarded full stipend for QB3 Biological Light Microscopy course at UCSF, CA

Selected Professional Affiliations and Leadership Roles  Student Member of the American Society for Cell Biology, Bethesda, MD (2014-2016)  Co-founder and Co-President, Association of Indians at Hershey (AIH) (2014-2016)  Organizer, Graduate student & Postdoctoral Career Day, Penn State Hershey College of Medicine (2015-2016)