DOCSLIB.ORG

V12a173-Zhao Pgmkr

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
V12a173-Zhao Pgmkr Molecular Vision 2006; 12:1506-10 <http://www.molvis.org/molvis/v12/a172/> ©2006 Molecular Vision Received 20 June 2006 | Accepted 28 November 2006 | Published 5 December 2006 An autosomal dominant progressive congenital zonular nuclear cataract linked to chromosome 20p12.2-p11.23 Ningdong Li,1 Yongjia Yang,1,2 Juan Bu,1 Chen Zhao,1 Shasha Lu,1 Jun Zhao,1 Li Yan,1 Lihong Cui,1 Rongchang Zheng,1 Jianjun Li,3 Jinsheng Tang,4 Kanxing Zhao1 (The first two authors contributed equally to this publication) 1Tianjin Eye Hospital, Tianjin Medical University, Tianjin; 2School of Biosciences and Technologies of Central South University, Changsha; 3The People Hospital of Lintao county, Gansu province; 4The Second Affiliated Hospital, Central South University, Changsha, People’s Republic of China Purpose: To map and to identify the causal gene for autosomal dominant congenital cataract (ADCC) in a Chinese family. Methods: A four-generation family with a history of progressive congenital cataracts was investigated. Twenty-three members of the family were examined ophthalmologically. Blood samples were collected from twenty-nine family mem- bers for genetic linkage analysis. Two-point LOD scores were calculated. Multi-point linkage analysis and haplotype construction were performed to define the optimal cosegregating interval. Direct sequence analysis of the candidate gene, beaded filament structural protein 1, filensin (BFSP1) in the critical region was carried out. Results: Fifteen family members were affected with autosomal dominant progressive congenital zonular nuclear cataract (ADPCZNC). The maximum two-point LOD Score of 6.02 was obtained for marker D20S904 (θ=0). The cataract locus in this family was mapped to chromosome 20p12.2-p11.23, a 9.34 Mb (16.37 cM) interval between markers D20S186 and D20S912. Although BFSP1 was in this critical region, we found no evidence that the condition in the family was caused by a BFSP1 mutation. Conclusions: We have mapped the genetic locus of ADPCZNC to chromosome 20p12.2-p11.23 in an ADCC family. This is the first time ADPCZNC was linked to this region. Congenital cataract is one of the major causes of blind- METHODS ness in human beings. Although the visual acuity of the pa- A large four-generation family with ADCC from Gansu prov- tients can be improved dramatically by surgical intervention, ince of China was investigated (Figure 1). All adult-individu- the congenital cataract patients are usually accompanied with als and the parents of the minors in this family gave informed intractable complications after operation. In some cases, con- consent to the study protocol, which was approved by the Eth- genital cataracts are hereditary. To date, various inheritance ics committee of Tianjin Eye Hospital (Tianjin, China). patterns for congenital cataract have been reported [1], includ- Twenty-three members of the family were invited for a de- ing autosomal dominant, autosomal recessive, and X-linked tailed clinical examination including direct-flashlight test, dis- [2]. Among these types, autosomal dominant inheritance ap- tance visual acuity, examination with slit-lamp microscope and pears the most common [3]. Currently, a number of loci on examination of the fundus. Detailed medical and family his- different chromosomes associated with ADCC have been docu- tories were obtained from each available family member. mented [1], suggesting that ADCC is a highly heterogeneous Blood samples were collected from 29 family members. condition. In non-consanguineous families, clinically identi- Genomic DNA of all 29 members was isolated by standard cal cataracts have been mapped to inconsistent loci [4]. Con- procedures. All specimens were quantified by spectrophotom- versely, an identical defective gene or a same mutation has etry and diluted to 30 ng/µl for polymerase chain reaction resulted in different phenotypes [5-7]. In this report, we stud- (PCR) amplification. Genome-wide screening was performed ied a Chinese family with autosomal dominant progressive with 382 markers spaced an average of 10 cM apart (ABI congenital zonular nuclear cataract (ADPCZNC) and we have PRISM Linkage Mapping Set, Version 2.5, Applied Bio-sys- presented evidence of linkage to chromosome 20p. Haplotype tems, Foster City, CA). Fine mapping was accomplished us- construction and multiple linkage analysis assigned the cata- ing fluorescently labeled primers from the Decode linkage map ract locus to a 9.34 Mb (16.37 cM) interval between the mark- [8]. Multiplex PCR was carried out in a 5 µl reaction mixture ers D20S186 and D20S912. containing 50 ng of genomic DNA, 1X PCR buffer, 100 µM of each dNTP, 3.0 mM MgCl2, 60 pmol each of forward and Correspondence to: Kanxing Zhao, Tianjin Eye Hospital, Tianjin reverse primers, and 0.2 U of Ampli Taq Gold DNA poly- Medical University, Tianjin, 300040, People’s Republic of China; merase. The mixture including reaction products (1 µl), Liz Phone: +86-22-23542766; FAX: +86-22-23542524; email: Size Standard-500 (0.2 µl), and Hi-Di Formanmide (9 µl) were [email protected] electrophoresed and visualized on a 3130 Genetic Analyzer 1506 Molecular Vision 2006; 12:1506-10 <http://www.molvis.org/molvis/v12/a172/> ©2006 Molecular Vision (Applied Biosystems). Alleles were analyzed by Genescan RESULTS analysis software V3.7 and Genotyper V3.7 (Applied Clinical Findings: A four-generation Chinese family from Biosystems). Ganshu province was identified (Figure 1). After informed The MLINK program of the LINKAGE package (ver- consent, 23 individuals with a family history of cataract and sion 5.1) was used for calculating two-point LOD scores. The six spouses were included in this study. Fifteen of these 23 disease was assumed to be an autosomal dominant trait with family members were affected with ADPCZNC. None of the 99% penetrance. Equal male and female recombination rates spouses showed signs of the disease. Some parents of the af- were assumed. Marker allele frequencies were set at 1/n (where fected individuals recalled that the cataracts presented at birth n is the number of alleles observed). We assumed gene fre- and a progressive visual loss appeared during the first decade quencies of 0.0001. Multi-point linkage analysis was used to of life (most of them were 2-6 years old). There was no his- estimate the optimal position. For multi-point linkage calcu- tory of other ocular or systemic abnormalities in the family. lation, the genetic distances between loci were obtained from Autosomal dominant inheritance was supported by the results the Decode linkage map [8]. The haplotype was constructed of pedigree analysis, which presented affected individuals in using the Cyrillic program to define the borders of the each of four generations, about equal number of affected males cosegregating region. Direct cycle sequencing of beaded fila- and females and male to male transmission. Penetrance in this ment structural protein 1, filensin (BFSP1) was carried out on family appeared complete. three family members (two affected and one unaffected). Figure 1. Haplotype analysis of the ADPZNC family. Haplotype analysis of the ADPZNC family. Markers are listed from top to bottom: telomere- D20S186- D20S163- D20S915- D20S152- D20S98- D20S904- D20S875- D20S112- D20S1140- D20S432- D20S912- D20S54- D20S477- D20S101- centromere. The haplotype co-segregating with the ADPCZNC phenotype is dark-boxed. A question mark indicates that the genotype is not determined. 1507 Molecular Vision 2006; 12:1506-10 <http://www.molvis.org/molvis/v12/a172/> ©2006 Molecular Vision In this family, 15 affected members had bilateral zonular nuclear cataracts (typical features shown in Figure 2). The opacification was symmetrical, homogeneous, and of the same TABLE 1. TWO-POINT LOD SCORE WITH POLYMORPHIC DNA MARKERS ON CHROMOSOME 20P Figure 2. Multipoint linkage analysis. Multipoint LOD scores. The markers and intervals: D20S186-2.11 cM- D20S163-0.93 cM- D20S915-1.59 cM- D20S152-2.36 cM- D20S904-1.89 cM- D20S875-0.89 cM- D20S112-1.41 cM- D20S1140-2.78 cM- D20S432-0.41 cM- D20S912-0.43 cM- D20S54-0.52 cM-D20S477- 1.74 cM- D20S101. Multipoint LOD scores with the support inter- val narrow the ADPCZNC locus to a 16.37 cM region between mark- ers D20S186 and D20S912. Figure 3. Slit lamp photography. Slit lamp photography of a family member (III:15, 31 years old). A: Slit view of the lens and cornea. B: Figure 4. ADCC loci on chromosome 20. A shows the CPP3 locus Front view of the lens. [9] and B shows the ADPCZNC locus presented in this report. 1508 Molecular Vision 2006; 12:1506-10 <http://www.molvis.org/molvis/v12/a172/> ©2006 Molecular Vision density in both eyes. In some cases, cataracts occurred with Furthermore, BFSP1 has been mapped to chromosome the anterior Y suture and were central pulverant. The extent of 20p11.23-p12.1 [14]. Such a critical region has a high overlap opacification was variable among different individuals in this with the ADPCZNC locus. We believe that BFSP1 is a poten- family, so some of the affected members retained mild visual tial candidate gene in this family. In our study, we performed acuity, whereas other family member’s visual acuity had been direct cycle-sequencing at exons and exon-intron-boundaries damaged severely and required surgical intervention. of BFSP1 on two affected family members (and a control). Linkage analysis and sequence analysis: Initially, 71 However, no mutation was found, suggesting that there may microsatellite markers (commonly associated with ADCC) be a new cataract gene in this interval. It was also possible from candidate regions on chromosomes 1, 2, 3, 11, 12, 13, that the mutation occurred in introns or the promoter area of 16, 17, 21, and 22 were genotyped. No significant positive BFSP1. LOD score was found at these candidate loci (data not shown). In conclusion, our study assigned a locus for ADPCZNC Subsequently, a genome-wide scanning was performed.
Load more

Recommended publications
  • Localization of the Lens Intermediate Filament Switch by Imaging Mass Spectrometry
    bioRxiv preprint doi: https://doi.org/10.1101/2020.04.21.053793; this version posted April 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Localization of the Lens Intermediate Filament Switch by Imaging Mass Spectrometry Zhen Wang, Daniel J. Ryan, and Kevin L Schey* Department of Biochemistry, Vanderbilt University, Nashville, TN 37232 * To whom correspondence should be addressed Current address: Mass Spectrometry Research Center Vanderbilt University 465 21st Ave. So., Suite 9160 MRB III Nashville, TN 37232-8575 E-mail: [email protected] Phone: 615.936.6861 Fax: 615.343.8372 bioRxiv preprint doi: https://doi.org/10.1101/2020.04.21.053793; this version posted April 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract Imaging mass spectrometry (IMS) enables targeted and untargeted visualization of the spatial localization of molecules in tissues with great specificity. The lens is a unique tissue that contains fiber cells corresponding to various stages of differentiation that are packed in a highly spatial order. The application of IMS to lens tissue localizes molecular features that are spatially related to the fiber cell organization. Such spatially resolved molecular information assists our understanding of lens structure and physiology; however, protein IMS studies are typically limited to abundant, soluble, low molecular weight proteins. In this study, a method was developed for imaging low solubility cytoskeletal proteins in the lens; a tissue that is filled with high concentrations of soluble crystallins.
    [Show full text]
  • Common Variants in SOX-2 and Congenital Cataract Genes Contribute to Age-Related Nuclear Cataract
    ARTICLE https://doi.org/10.1038/s42003-020-01421-2 OPEN Common variants in SOX-2 and congenital cataract genes contribute to age-related nuclear cataract Ekaterina Yonova-Doing et al.# 1234567890():,; Nuclear cataract is the most common type of age-related cataract and a leading cause of blindness worldwide. Age-related nuclear cataract is heritable (h2 = 0.48), but little is known about specific genetic factors underlying this condition. Here we report findings from the largest to date multi-ethnic meta-analysis of genome-wide association studies (discovery cohort N = 14,151 and replication N = 5299) of the International Cataract Genetics Consortium. We confirmed the known genetic association of CRYAA (rs7278468, P = 2.8 × 10−16) with nuclear cataract and identified five new loci associated with this dis- ease: SOX2-OT (rs9842371, P = 1.7 × 10−19), TMPRSS5 (rs4936279, P = 2.5 × 10−10), LINC01412 (rs16823886, P = 1.3 × 10−9), GLTSCR1 (rs1005911, P = 9.8 × 10−9), and COMMD1 (rs62149908, P = 1.2 × 10−8). The results suggest a strong link of age-related nuclear cat- aract with congenital cataract and eye development genes, and the importance of common genetic variants in maintaining crystalline lens integrity in the aging eye. #A list of authors and their affiliations appears at the end of the paper. COMMUNICATIONS BIOLOGY | (2020) 3:755 | https://doi.org/10.1038/s42003-020-01421-2 | www.nature.com/commsbio 1 ARTICLE COMMUNICATIONS BIOLOGY | https://doi.org/10.1038/s42003-020-01421-2 ge-related cataract is the leading cause of blindness, structure (meta-analysis genomic inflation factor λ = 1.009, accounting for more than one-third of blindness Supplementary Table 4 and Supplementary Fig.
    [Show full text]
  • Proteome Profiling of Developing Murine Lens Through Mass
    Lens Proteome Profiling of Developing Murine Lens Through Mass Spectrometry Shahid Y. Khan,1 Muhammad Ali,1 Firoz Kabir,1 Santosh Renuse,2 Chan Hyun Na,2 C. Conover Talbot Jr,3 Sean F. Hackett,1 and S. Amer Riazuddin1 1The Wilmer Eye Institute, Johns Hopkins University School of Medicine, Baltimore, Maryland, United States 2Department of Biological Chemistry, Johns Hopkins University School of Medicine, Baltimore, Maryland, United States 3Institute for Basic Biomedical Sciences, Johns Hopkins University School of Medicine, Baltimore, Maryland, United States Correspondence: S. Amer Riazuddin, PURPOSE. We previously completed a comprehensive profile of the mouse lens transcriptome. The Wilmer Eye Institute, Johns Here, we investigate the proteome of the mouse lens through mass spectrometry–based Hopkins University School of Medi- protein sequencing at the same embryonic and postnatal time points. cine, 600 N. Wolfe Street; Maumenee 840, Baltimore, MD 21287, USA; METHODS. We extracted mouse lenses at embryonic day 15 (E15) and 18 (E18) and postnatal [email protected]. day 0 (P0), 3 (P3), 6 (P6), and 9 (P9). The lenses from each time point were preserved in three Submitted: February 2, 2017 distinct pools to serve as biological replicates for each developmental stage. The total cellular Accepted: October 13, 2017 protein was extracted from the lens, digested with trypsin, and labeled with isobaric tandem mass tags (TMT) for three independent TMT experiments. Citation: Khan SY, Ali M, Kabir F, et al. Proteome profiling of developing mu- RESULTS. A total of 5404 proteins were identified in the mouse ocular lens in at least one rine lens through mass spectrometry.
    [Show full text]
  • Filensin (BFSP1) (NM 001195) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC213412 Filensin (BFSP1) (NM_001195) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: Filensin (BFSP1) (NM_001195) Human Tagged ORF Clone Tag: Myc-DDK Symbol: BFSP1 Synonyms: CP94; CP115; CTRCT33; LIFL-H Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 6 Filensin (BFSP1) (NM_001195) Human Tagged ORF Clone – RC213412 ORF Nucleotide >RC213412 representing NM_001195 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTACCGGCGCAGCTACGTCTTCCAGACCCGCAAGGAGCAGTACGAGCACGCCGACGAGGCTTCGCGCG CCGCCGAGCCCGAGCGCCCGGCCGACGAGGGCTGGGCTGGGGCAACGAGCCTGGCGGCGCTGCAGGGGCT CGGCGAGCGCGTGGCCGCCCACGTCCAGCGGGCCCGCGCCCTCGAGCAGCGCCATGCCGGGCTCCGGAGG CAGCTGGATGCCTTCCAGCGCCTGGGCGAGCTGGCCGGGCCCGAGGACGCCCTCGCCCGCCAAGTCGAGA GCAACCGCCAGCGCGTCCGGGACCTGGAGGCCGAGCGCGCCCGGCTGGAGCGCCAGGGCACCGAGGCGCA GCGCGCGCTCGACGAGTTCCGAAGCAAGTATGAAAATGAGTGCGAATGTCAACTCCTGCTAAAAGAAATG CTTGAACGGCTTAACAAGGAAGCTGATGAAGCCTTGCTGCATAACCTACGCCTTCAGCTGGAAGCCCAAT TTCTGCAAGATGATATCAGTGCGGCAAAGGACAGGCACAAGAAGAATCTTCTGGAAGTTCAGACCTATAT CAGCATCCTGCAGCAGATCATCCACACCACTCCTCCAGCATCCATTGTGACGAGTGGGATGAGGGAGGAG
    [Show full text]
  • Frs2 Enhances Fibroblast Growth Factor-Mediated Survival And
    RESEARCH ARTICLE 4601 Development 139, 4601-4612 (2012) doi:10.1242/dev.081737 © 2012. Published by The Company of Biologists Ltd Frs2 enhances fibroblast growth factor-mediated survival and differentiation in lens development Bhavani P. Madakashira1, Daniel A. Kobrinski1, Andrew D. Hancher1, Elizabeth C. Arneman1, Brad D. Wagner1, Fen Wang2, Hailey Shin3, Frank J. Lovicu3, Lixing W. Reneker4 and Michael L. Robinson1,* SUMMARY Most growth factor receptor tyrosine kinases (RTKs) signal through similar intracellular pathways, but they often have divergent biological effects. Therefore, elucidating the mechanism of channeling the intracellular effect of RTK stimulation to facilitate specific biological responses represents a fundamental biological challenge. Lens epithelial cells express numerous RTKs with the ability to initiate the phosphorylation (activation) of Erk1/2 and PI3-K/Akt signaling. However, only Fgfr stimulation leads to lens fiber cell differentiation in the developing mammalian embryo. Additionally, within the lens, only Fgfrs activate the signal transduction molecule Frs2. Loss of Frs2 in the lens significantly increases apoptosis and decreases phosphorylation of both Erk1/2 and Akt. Also, Frs2 deficiency decreases the expression of several proteins characteristic of lens fiber cell differentiation, including Prox1, p57KIP2, aquaporin 0 and -crystallins. Although not normally expressed in the lens, the RTK TrkC phosphorylates Frs2 in response to binding the ligand NT3. Transgenic lens epithelial cells expressing both TrkC and NT3 exhibit several features characteristic of lens fiber cells. These include elongation, increased Erk1/2 and Akt phosphorylation, and the expression of -crystallins. All these characteristics of NT3-TrkC transgenic lens epithelial cells depend on Frs2. Therefore, tyrosine phosphorylation of Frs2 mediates Fgfr-dependent lens cell survival and provides a mechanistic basis for the unique fiber-differentiating capacity of Fgfs on mammalian lens epithelial cells.
    [Show full text]
  • Whole Exome Sequencing Reveals Novel and Recurrent Disease-Causing Variants in Lens Specific Gap Junctional Protein Encoding Genes Causing Congenital Cataract
    G C A T T A C G G C A T genes Article Whole Exome Sequencing Reveals Novel and Recurrent Disease-Causing Variants in Lens Specific Gap Junctional Protein Encoding Genes Causing Congenital Cataract Vanita Berry 1,2,*, Alex Ionides 2, Nikolas Pontikos 1,2 , Ismail Moghul 3 , Anthony T. Moore 2,4, Roy A. Quinlan 5 and Michel Michaelides 1,2,* 1 UCL Institute of Ophthalmology, University College London, 11-43 Bath Street, London EC1V 9EL, UK; [email protected] 2 Moorfields Eye Hospital NHS Foundation Trust, London EC1V 2PD, UK; alex.Ionides@moorfields.nhs.uk (A.I.); [email protected] (A.T.M.) 3 UCL Cancer Institute, University College London, London WC1E 6BT, UK; [email protected] 4 Ophthalmology Department, University of California School of Medicine, San Francisco, CA 94158, USA 5 Department of Biosciences, University of Durham, Upper Mountjoy Science Site, Durham DH1 3LE, UK; [email protected] * Correspondence: [email protected] (V.B.); [email protected] (M.M.); Tel.: +44-207-608-4041 (V.B.); +44-207-608-6864 (M.M.); Fax: +44-207-608-6863 (V.B.); +44-207-608-6903 (M.M.) Received: 26 March 2020; Accepted: 4 May 2020; Published: 6 May 2020 Abstract: Pediatric cataract is clinically and genetically heterogeneous and is the most common cause of childhood blindness worldwide. In this study, we aimed to identify disease-causing variants in three large British families and one isolated case with autosomal dominant congenital cataract, using whole exome sequencing. We identified four different heterozygous variants, three in the large families and one in the isolated case.
    [Show full text]
  • Novel Recessive BFSP2 and PITX3 Mutations: Insights Into Mutational Mechanisms from Consanguineous Populations Mohammed A
    BRIEF REPORT Novel recessive BFSP2 and PITX3 mutations: Insights into mutational mechanisms from consanguineous populations Mohammed A. Aldahmesh, BSc, MSc, PhD1, Arif O. Khan, MD1,2, Jawahir Mohamed, BSc1, and Fowzan S. Alkuraya, MD1,3,4 Purpose: Designating mutations as recessive or dominant is a function of mutations often provide new insights into the molecular patho- 1 the effect of the mutant allele on the phenotype. Genes in which both genesis of the mutation and the associated phenotype. classes of mutations are known to exist are particularly interesting to study We have shown that for genetically heterogeneous disorders because these mutations typically define distinct pathogenic mechanisms at that can be caused by both dominant and recessive mutations, the molecular level. Methods: We studied two consanguineous families recessive mutations are typically overrepresented in consan- 2 with different eye phenotypes and used a combination of candidate gene guineous populations. However, we share here an emerging analysis and homozygosity mapping to identify the underlying genetic theme wherein even for genes in which only dominant muta- defects. Results: In one family, a novel BFSP2 mutation causes autosomal tions are known to exist, consanguineous populations can reveal recessive diffuse cortical cataract with scattered lens opacities, and in the presence of recessively acting mutations which adds a new another, a novel PITX3 mutation causes an autosomal recessive severe dimension to the mechanistic characterization of the molecular form of anterior segment dysgenesis and microphthalmia. Conclusion: We phenotype associated with these genes. show that BFSP2 and PITX3, hitherto known to cause eye defects only in a dominant fashion, can also present recessively.
    [Show full text]
  • Foraging Shifts and Visual Pre Adaptation in Ecologically Diverse Bats
    See discussions, stats, and author profiles for this publication at: https://www.researchgate.net/publication/340654059 Foraging shifts and visual preadaptation in ecologically diverse bats Article in Molecular Ecology · April 2020 DOI: 10.1111/mec.15445 CITATIONS READS 0 153 9 authors, including: Kalina T. J. Davies Laurel R Yohe Queen Mary, University of London Yale University 40 PUBLICATIONS 254 CITATIONS 24 PUBLICATIONS 93 CITATIONS SEE PROFILE SEE PROFILE Edgardo M. Rengifo Elizabeth R Dumont University of São Paulo University of California, Merced 13 PUBLICATIONS 28 CITATIONS 115 PUBLICATIONS 3,143 CITATIONS SEE PROFILE SEE PROFILE Some of the authors of this publication are also working on these related projects: Ecology of the Greater horseshoe bat View project BAT 1K View project All content following this page was uploaded by Liliana M. Davalos on 14 May 2020. The user has requested enhancement of the downloaded file. Received: 17 October 2019 | Revised: 28 February 2020 | Accepted: 31 March 2020 DOI: 10.1111/mec.15445 ORIGINAL ARTICLE Foraging shifts and visual pre adaptation in ecologically diverse bats Kalina T. J. Davies1 | Laurel R. Yohe2,3 | Jesus Almonte4 | Miluska K. R. Sánchez5 | Edgardo M. Rengifo6,7 | Elizabeth R. Dumont8 | Karen E. Sears9 | Liliana M. Dávalos2,10 | Stephen J. Rossiter1 1School of Biological and Chemical Sciences, Queen Mary University of London, London, UK 2Department of Ecology and Evolution, State University of New York at Stony Brook, Stony Brook, USA 3Department of Geology & Geophysics, Yale University,
    [Show full text]
  • Novel Mutations Identified in Chinese Families with Autosomal Dominant
    Li et al. BMC Medical Genetics (2019) 20:196 https://doi.org/10.1186/s12881-019-0933-5 RESEARCH ARTICLE Open Access Novel mutations identified in Chinese families with autosomal dominant congenital cataracts by targeted next- generation sequencing Shan Li1†, Jianfei Zhang2†, Yixuan Cao1, Yi You1 and Xiuli Zhao1* Abstract Background: Congenital cataract is a clinically and genetically heterogeneous visual impairment. The aim of this study was to identify causative mutations in five unrelated Chinese families diagnosed with congenital cataracts. Methods: Detailed family history and clinical data were collected, and ophthalmological examinations were performed using slit-lamp photography. Genomic DNA was extracted from peripheral blood of all available members. Thirty-eight genes associated with cataract were captured and sequenced in 5 typical nonsyndromic congenital cataract probands by targeted next-generation sequencing (NGS), and the results were confirmed by Sanger sequencing. Bioinformatics analysis was performed to predict the functional effect of mutant genes. Results: Results from the DNA sequencing revealed five potential causative mutations: c.154 T > C(p.F52 L) in GJA8 of Family 1, c.1152_1153insG(p.S385Efs*83) in GJA3 of Family 2, c.1804 G > C(p.G602R) in BFSP1 of Family 3, c.1532C > T(p.T511 M) in EPHA2 of Family 4 and c.356G > A(p.R119H) in HSF4 of Family 5. These mutations co-segregated with all affected individuals in the families and were not found in unaffected family members nor in 50 controls. Bioinformatics analysis from several prediction tools supported the possible pathogenicity of these mutations. Conclusions: In this study, we identified five novel mutations (c.154 T > C in GJA8, c.1152_1153insG in GJA3, c.1804G > CinBFSP1, c.1532C > T in EPHA2,c.356G>AinHSF4) in five Chinese families with hereditary cataracts, respectively.
    [Show full text]
  • (BFSP1) Gene Mutation Associated with Autosomal Dominant
    Molecular Vision 2013; 19:2590-2595 <http://www.molvis.org/molvis/v19/2590> © 2013 Molecular Vision Received 19 October 2013 | Accepted 23 December 2013 | Published 27 December 2013 A novel beaded filament structural protein 1 BFSP1( ) gene mutation associated with autosomal dominant congenital cataract in a Chinese family Han Wang, Tianxiao Zhang, Di Wu, Jinsong Zhang Department of Ophthalmology, the Fourth Affiliated Hospital of China Medical University, Key Laboratory of Lens Research Liaoning Province, Eye Hospital of China Medical University, Liaoning Province, China Purpose: To identify the disease-causing mutation in a five-generation Chinese family affected with bilateral congenital nuclear cataract. Methods: Linkage analysis was performed for the known candidate genes and whole-exome sequencing was used in two affected family members to screen for potential genetic mutations; Sanger sequencing was used to verify the mutations throughout family. Results: A novel beaded filament structural protein 1 BFSP1( ) gene missense mutation was identified. Direct sequenc- ing revealed a heterozygous G>A transversion at c.1042 of the coding sequence in exon 7 of BFSP1 (c.1042G>A) in all affected members, which resulted in the substitution of a wild-type aspartate to an asparagine (D348N). This mutation was neither seen in unaffected family members nor in 200 unrelated people as controls. Conclusions: A novel mutation (c.1042G>A) at exon 7 of BFSP1, which creates a substitution of an aspartate to an asparagine (p.D348N) was identified to be associated with autosomal dominant congenital cataract in a Chinese family. This is the first report of autosomal dominant congenital cataract being associated with a mutation inBFSP1 , highlighting the important role of BFSP1 for physiological lens function and optical properties.
    [Show full text]
  • Lens Differentiation Is Characterized by Stage-Specific Changes In
    Developmental Biology 453 (2019) 86–104 Contents lists available at ScienceDirect Developmental Biology journal homepage: www.elsevier.com/locate/developmentalbiology Lens differentiation is characterized by stage-specific changes in chromatin ☆ accessibility correlating with differentiation state-specific gene expression Joshua Disatham a, Daniel Chauss b, Rifah Gheyas c, Lisa Brennan a, David Blanco a, Lauren Daley a, A. Sue Menko c, Marc Kantorow a,* a Department of Biomedical Science, Charles E. Schmidt College of Medicine, Florida Atlantic University, Boca Raton, FL, USA b National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health, Bethesda, MD, USA c Department of Pathology, Anatomy and Cell Biology, Thomas Jefferson University, Philadelphia, PA, USA ABSTRACT Changes in chromatin accessibility regulate the expression of multiple genes by controlling transcription factor access to key gene regulatory sequences. Here, we sought to establish a potential function for altered chromatin accessibility in control of key gene expression events during lens cell differentiation by establishing genome-wide chromatin accessibility maps specific for four distinct stages of lens cell differentiation and correlating specific changes in chromatin accessibility with genome-wide changes in gene expression. ATAC sequencing was employed to generate chromatin accessibility profiles that were correlated with the expression profiles of over 10,000 lens genes obtained by high-throughput RNA sequencing at the same stages of lens cell differentiation. Approximately 90,000 regions of the lens genome exhibited distinct changes in chromatin accessibility at one or more stages of lens differentiation. Over 1000 genes exhibited high Pearson correlation coefficients (r > 0.7) between altered expression levels at specific stages of lens cell differentiation and changes in chromatin accessibility in potential promoter (À7.5kbp/þ2.5kbp of the transcriptional start site) and/or other potential cis-regulatory regions ( Æ10 kb of the gene body).
    [Show full text]
  • A Robust Transcriptional Program in Newts 5 Undergoing Multiple Events of Lens Regeneration 6 Throughout Their Lifespan
    1 2 3 4 A Robust Transcriptional Program in Newts 5 Undergoing Multiple Events of Lens Regeneration 6 throughout their Lifespan 7 8 9 Konstantinos Sousounis1, Feng Qi2, Manisha C. Yadav3, José Luis Millán3, Fubito 10 Toyama4, Chikafumi Chiba5, Yukiko Eguchi6+, Goro Eguchi6* & Panagiotis A. Tsonis1,3* 11 1Department of Biology, University of Dayton, Dayton, OH 45469-2320 12 2Sanford-Burnham-Prebys Medical Discovery Institute at Lake Nona, Orlando, FL 32827 13 3Sanford-Burnham-Prebys Medical Discovery Institute, La Jolla, CA 92037 14 4Graduate School of Engineering, Utsunomiya University, Yoto 7-1-2, Utsunomiya, Tochigi 321- 15 8585, Japan 16 5Faculty of Life and Environmental Sciences, Tsukuba University, Tennoudai 1-1-1, Tsukuba 17 Ibaraki 305-8572, Japan 18 6National Institute for Basic Biology, National Institutes for Natural Sciences, Nishigonaka 38, 19 Myodaiji, Okazaki, Aichi 444-8585, Japan 20 + Deceased 21 *Corresponding authors. Correspondence and requests for materials should be addressed to 22 G.E. ([email protected]) and P.A.T. ([email protected]) 23 1 24 Abstract 25 Newts have the ability to repeatedly regenerate their lens even during ageing. However, it is 26 unclear whether this regeneration reflects an undisturbed genetic activity. To answer this 27 question, we compared the transcriptomes of lenses, irises and tails from aged newts that had 28 undergone 19-times lens regeneration with the equivalent tissues from young newts that had 29 never experienced lens regeneration. Our analysis indicates that repeatedly regenerated lenses 30 showed a robust transcriptional program comparable to young never-regenerated lenses. In 31 contrast, the tail, that was never regenerated, showed gene expression signatures of ageing.
    [Show full text]