Frs2 Enhances Fibroblast Growth Factor-Mediated Survival And
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Localization of the Lens Intermediate Filament Switch by Imaging Mass Spectrometry
bioRxiv preprint doi: https://doi.org/10.1101/2020.04.21.053793; this version posted April 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Localization of the Lens Intermediate Filament Switch by Imaging Mass Spectrometry Zhen Wang, Daniel J. Ryan, and Kevin L Schey* Department of Biochemistry, Vanderbilt University, Nashville, TN 37232 * To whom correspondence should be addressed Current address: Mass Spectrometry Research Center Vanderbilt University 465 21st Ave. So., Suite 9160 MRB III Nashville, TN 37232-8575 E-mail: [email protected] Phone: 615.936.6861 Fax: 615.343.8372 bioRxiv preprint doi: https://doi.org/10.1101/2020.04.21.053793; this version posted April 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract Imaging mass spectrometry (IMS) enables targeted and untargeted visualization of the spatial localization of molecules in tissues with great specificity. The lens is a unique tissue that contains fiber cells corresponding to various stages of differentiation that are packed in a highly spatial order. The application of IMS to lens tissue localizes molecular features that are spatially related to the fiber cell organization. Such spatially resolved molecular information assists our understanding of lens structure and physiology; however, protein IMS studies are typically limited to abundant, soluble, low molecular weight proteins. In this study, a method was developed for imaging low solubility cytoskeletal proteins in the lens; a tissue that is filled with high concentrations of soluble crystallins. -
Src Activation Plays an Important Key Role in Lymphomagenesis Induced by FGFR1 Fusion Kinases
Published OnlineFirst September 21, 2011; DOI: 10.1158/0008-5472.CAN-11-1109 Cancer Tumor and Stem Cell Biology Research Src Activation Plays an Important Key Role in Lymphomagenesis Induced by FGFR1 Fusion Kinases Mingqiang Ren, Haiyan Qin, Ruizhe Ren, Josephine Tidwell, and John K. Cowell Abstract Chromosomal translocations and activation of the fibroblast growth factor (FGF) receptor 1 (FGFR1) are a feature of stem cell leukemia–lymphoma syndrome (SCLL), an aggressive malignancy characterized by rapid transformation to acute myeloid leukemia and lymphoblastic lymphoma. It has been suggested that FGFR1 proteins lose their ability to recruit Src kinase, an important mediator of FGFR1 signaling, as a result of the translocations that delete the extended FGFR substrate-2 (FRS2) interacting domain that Src binds. In this study, we report evidence that refutes this hypothesis and reinforces the notion that Src is a critical mediator of signaling from the FGFR1 chimeric fusion genes generated by translocation in SCLL. Src was constitutively active in BaF3 cells expressing exogenous FGFR1 chimeric kinases cultured in vitro as well as in T-cell or B-cell lymphomas they induced in vivo. Residual components of the FRS2-binding site retained in chimeric kinases that were generated by translocation were sufficient to interact with FRS2 and activate Src. The Src kinase inhibitor dasatinib killed transformed BaF3 cells and other established murine leukemia cell lines expressing chimeric FGFR1 kinases, significantly extending the survival of mice with SCLL syndrome. Our results indicated that Src kinase is pathogenically activated in lymphomagenesis induced by FGFR1 fusion genes, implying that Src kinase inhibitors may offer a useful option to treatment of FGFR1-associated myeloproliferative/lymphoma disorders. -
FGF Signaling Network in the Gastrointestinal Tract (Review)
163-168 1/6/06 16:12 Page 163 INTERNATIONAL JOURNAL OF ONCOLOGY 29: 163-168, 2006 163 FGF signaling network in the gastrointestinal tract (Review) MASUKO KATOH1 and MASARU KATOH2 1M&M Medical BioInformatics, Hongo 113-0033; 2Genetics and Cell Biology Section, National Cancer Center Research Institute, Tokyo 104-0045, Japan Received March 29, 2006; Accepted May 2, 2006 Abstract. Fibroblast growth factor (FGF) signals are trans- Contents duced through FGF receptors (FGFRs) and FRS2/FRS3- SHP2 (PTPN11)-GRB2 docking protein complex to SOS- 1. Introduction RAS-RAF-MAPKK-MAPK signaling cascade and GAB1/ 2. FGF family GAB2-PI3K-PDK-AKT/aPKC signaling cascade. The RAS~ 3. Regulation of FGF signaling by WNT MAPK signaling cascade is implicated in cell growth and 4. FGF signaling network in the stomach differentiation, the PI3K~AKT signaling cascade in cell 5. FGF signaling network in the colon survival and cell fate determination, and the PI3K~aPKC 6. Clinical application of FGF signaling cascade in cell polarity control. FGF18, FGF20 and 7. Clinical application of FGF signaling inhibitors SPRY4 are potent targets of the canonical WNT signaling 8. Perspectives pathway in the gastrointestinal tract. SPRY4 is the FGF signaling inhibitor functioning as negative feedback apparatus for the WNT/FGF-dependent epithelial proliferation. 1. Introduction Recombinant FGF7 and FGF20 proteins are applicable for treatment of chemotherapy/radiation-induced mucosal injury, Fibroblast growth factor (FGF) family proteins play key roles while recombinant FGF2 protein and FGF4 expression vector in growth and survival of stem cells during embryogenesis, are applicable for therapeutic angiogenesis. Helicobacter tissues regeneration, and carcinogenesis (1-4). -
Common Variants in SOX-2 and Congenital Cataract Genes Contribute to Age-Related Nuclear Cataract
ARTICLE https://doi.org/10.1038/s42003-020-01421-2 OPEN Common variants in SOX-2 and congenital cataract genes contribute to age-related nuclear cataract Ekaterina Yonova-Doing et al.# 1234567890():,; Nuclear cataract is the most common type of age-related cataract and a leading cause of blindness worldwide. Age-related nuclear cataract is heritable (h2 = 0.48), but little is known about specific genetic factors underlying this condition. Here we report findings from the largest to date multi-ethnic meta-analysis of genome-wide association studies (discovery cohort N = 14,151 and replication N = 5299) of the International Cataract Genetics Consortium. We confirmed the known genetic association of CRYAA (rs7278468, P = 2.8 × 10−16) with nuclear cataract and identified five new loci associated with this dis- ease: SOX2-OT (rs9842371, P = 1.7 × 10−19), TMPRSS5 (rs4936279, P = 2.5 × 10−10), LINC01412 (rs16823886, P = 1.3 × 10−9), GLTSCR1 (rs1005911, P = 9.8 × 10−9), and COMMD1 (rs62149908, P = 1.2 × 10−8). The results suggest a strong link of age-related nuclear cat- aract with congenital cataract and eye development genes, and the importance of common genetic variants in maintaining crystalline lens integrity in the aging eye. #A list of authors and their affiliations appears at the end of the paper. COMMUNICATIONS BIOLOGY | (2020) 3:755 | https://doi.org/10.1038/s42003-020-01421-2 | www.nature.com/commsbio 1 ARTICLE COMMUNICATIONS BIOLOGY | https://doi.org/10.1038/s42003-020-01421-2 ge-related cataract is the leading cause of blindness, structure (meta-analysis genomic inflation factor λ = 1.009, accounting for more than one-third of blindness Supplementary Table 4 and Supplementary Fig. -
Proteome Profiling of Developing Murine Lens Through Mass
Lens Proteome Profiling of Developing Murine Lens Through Mass Spectrometry Shahid Y. Khan,1 Muhammad Ali,1 Firoz Kabir,1 Santosh Renuse,2 Chan Hyun Na,2 C. Conover Talbot Jr,3 Sean F. Hackett,1 and S. Amer Riazuddin1 1The Wilmer Eye Institute, Johns Hopkins University School of Medicine, Baltimore, Maryland, United States 2Department of Biological Chemistry, Johns Hopkins University School of Medicine, Baltimore, Maryland, United States 3Institute for Basic Biomedical Sciences, Johns Hopkins University School of Medicine, Baltimore, Maryland, United States Correspondence: S. Amer Riazuddin, PURPOSE. We previously completed a comprehensive profile of the mouse lens transcriptome. The Wilmer Eye Institute, Johns Here, we investigate the proteome of the mouse lens through mass spectrometry–based Hopkins University School of Medi- protein sequencing at the same embryonic and postnatal time points. cine, 600 N. Wolfe Street; Maumenee 840, Baltimore, MD 21287, USA; METHODS. We extracted mouse lenses at embryonic day 15 (E15) and 18 (E18) and postnatal [email protected]. day 0 (P0), 3 (P3), 6 (P6), and 9 (P9). The lenses from each time point were preserved in three Submitted: February 2, 2017 distinct pools to serve as biological replicates for each developmental stage. The total cellular Accepted: October 13, 2017 protein was extracted from the lens, digested with trypsin, and labeled with isobaric tandem mass tags (TMT) for three independent TMT experiments. Citation: Khan SY, Ali M, Kabir F, et al. Proteome profiling of developing mu- RESULTS. A total of 5404 proteins were identified in the mouse ocular lens in at least one rine lens through mass spectrometry. -
Integrated Genetic and Epigenetic Analysis Defines Novel Molecular
ARTICLE Received 7 Jan 2015 | Accepted 20 May 2015 | Published 3 Jul 2015 DOI: 10.1038/ncomms8557 OPEN Integrated genetic and epigenetic analysis defines novel molecular subgroups in rhabdomyosarcoma Masafumi Seki1,*, Riki Nishimura1,*, Kenichi Yoshida2,3, Teppei Shimamura4,5, Yuichi Shiraishi4, Yusuke Sato2,3, Motohiro Kato1,6,7, Kenichi Chiba4, Hiroko Tanaka8, Noriko Hoshino9, Genta Nagae10, Yusuke Shiozawa2,3, Yusuke Okuno3,11, Hajime Hosoi12, Yukichi Tanaka13, Hajime Okita14, Mitsuru Miyachi12, Ryota Souzaki15, Tomoaki Taguchi15, Katsuyoshi Koh7, Ryoji Hanada7, Keisuke Kato16, Yuko Nomura17, Masaharu Akiyama18, Akira Oka1, Takashi Igarashi1,19, Satoru Miyano4,8, Hiroyuki Aburatani10, Yasuhide Hayashi20, Seishi Ogawa2,3 & Junko Takita1 Rhabdomyosarcoma (RMS) is the most common soft-tissue sarcoma in childhood. Here we studied 60 RMSs using whole-exome/-transcriptome sequencing, copy number (CN) and DNA methylome analyses to unravel the genetic/epigenetic basis of RMS. On the basis of methylation patterns, RMS is clustered into four distinct subtypes, which exhibits remarkable correlation with mutation/CN profiles, histological phenotypes and clinical behaviours. A1 and A2 subtypes, especially A1, largely correspond to alveolar histology with frequent PAX3/7 fusions and alterations in cell cycle regulators. In contrast, mostly showing embryonal histology, both E1 and E2 subtypes are characterized by high frequency of CN alterations and/ or allelic imbalances, FGFR4/RAS/AKT pathway mutations and PTEN mutations/methylation and in E2, also by p53 inactivation. Despite the better prognosis of embryonal RMS, patients in the E2 are likely to have a poor prognosis. Our results highlight the close relationships of the methylation status and gene mutations with the biological behaviour in RMS. -
Flotillins in Receptor Tyrosine Kinase Signaling and Cancer
Cells 2014, 3, 129-149; doi:10.3390/cells3010129 OPEN ACCESS cells ISSN 2073-4409 www.mdpi.com/journal/cells Review Flotillins in Receptor Tyrosine Kinase Signaling and Cancer Antje Banning, Nina Kurrle †, Melanie Meister and Ritva Tikkanen * Institute of Biochemistry, Medical faculty, University of Giessen, Friedrichstrasse 24, 35392 Giessen, Germany; E-Mails: [email protected] (A.B.); [email protected] (N.K.); [email protected] (M.M.) † Present address: Department of Molecular Haematology, Goethe University Medical School, 60590 Frankfurt, Germany. * Author to whom correspondence should be addressed; E-Mail: [email protected]; Tel.: +49-641-9947-420; Fax: +49-641-9947-429. Received: 11 December 2013; in revised form: 11 February 2014 / Accepted: 12 February 2014/ Published: 19 February 2014 Abstract: Flotillins are highly conserved proteins that localize into specific cholesterol rich microdomains in cellular membranes. They have been shown to be associated with, for example, various signaling pathways, cell adhesion, membrane trafficking and axonal growth. Recent findings have revealed that flotillins are frequently overexpressed in various types of human cancers. We here review the suggested functions of flotillins during receptor tyrosine kinase signaling and in cancer. Although flotillins have been implicated as putative cancer therapy targets, we here show that great caution is required since flotillin ablation may result in effects that increase instead of decrease the activity of specific signaling pathways. On the other hand, as flotillin overexpression appears to be related with metastasis formation in certain cancers, we also discuss the implications of these findings for future therapy aspects. -
Filensin (BFSP1) (NM 001195) Human Tagged ORF Clone Product Data
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC213412 Filensin (BFSP1) (NM_001195) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: Filensin (BFSP1) (NM_001195) Human Tagged ORF Clone Tag: Myc-DDK Symbol: BFSP1 Synonyms: CP94; CP115; CTRCT33; LIFL-H Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 6 Filensin (BFSP1) (NM_001195) Human Tagged ORF Clone – RC213412 ORF Nucleotide >RC213412 representing NM_001195 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTACCGGCGCAGCTACGTCTTCCAGACCCGCAAGGAGCAGTACGAGCACGCCGACGAGGCTTCGCGCG CCGCCGAGCCCGAGCGCCCGGCCGACGAGGGCTGGGCTGGGGCAACGAGCCTGGCGGCGCTGCAGGGGCT CGGCGAGCGCGTGGCCGCCCACGTCCAGCGGGCCCGCGCCCTCGAGCAGCGCCATGCCGGGCTCCGGAGG CAGCTGGATGCCTTCCAGCGCCTGGGCGAGCTGGCCGGGCCCGAGGACGCCCTCGCCCGCCAAGTCGAGA GCAACCGCCAGCGCGTCCGGGACCTGGAGGCCGAGCGCGCCCGGCTGGAGCGCCAGGGCACCGAGGCGCA GCGCGCGCTCGACGAGTTCCGAAGCAAGTATGAAAATGAGTGCGAATGTCAACTCCTGCTAAAAGAAATG CTTGAACGGCTTAACAAGGAAGCTGATGAAGCCTTGCTGCATAACCTACGCCTTCAGCTGGAAGCCCAAT TTCTGCAAGATGATATCAGTGCGGCAAAGGACAGGCACAAGAAGAATCTTCTGGAAGTTCAGACCTATAT CAGCATCCTGCAGCAGATCATCCACACCACTCCTCCAGCATCCATTGTGACGAGTGGGATGAGGGAGGAG -
Genetic Insights Into the Mechanisms of Fgf Signaling
Downloaded from genesdev.cshlp.org on September 25, 2021 - Published by Cold Spring Harbor Laboratory Press REVIEW Genetic insights into the mechanisms of Fgf signaling J. Richard Brewer, Pierre Mazot, and Philippe Soriano Department of Developmental and Regenerative Biology, Tisch Cancer Institute, Icahn School of Medicine at Mt. Sinai, New York, New York 10029, USA The fibroblast growth factor (Fgf) family of ligands and re- Fgf signaling is therefore important to appreciate many as- ceptor tyrosine kinases is required throughout embryonic pects of Fgf biology and disease. and postnatal development and also regulates multiple Many of the developmental functions of Fgf signaling homeostatic functions in the adult. Aberrant Fgf signaling seem to be conserved between mice and humans. This causes many congenital disorders and underlies multiple is evident by the striking phenotypic similarities between forms of cancer. Understanding the mechanisms that gov- human congenital disorders caused by alterations in ern Fgf signaling is therefore important to appreciate Fgf signaling and their corresponding mouse models. many aspects of Fgf biology and disease. Here we review Conserved developmental requirements have been dem- the mechanisms of Fgf signaling by focusing on genetic onstrated in skeletal growth, palate closure, limb pattern- strategies that enable in vivo analysis. These studies sup- ing, ear development, cranial suture ossification, neural port an important role for Erk1/2 as a mediator of Fgf sig- development, and the hair cycle (Hebert et al. 1994; Rous- naling in many biological processes but have also provided seau et al. 1994; Shiang et al. 1994; Wilkie et al. 1995; Par- strong evidence for additional signaling pathways in trans- tanen et al. -
Whole Exome Sequencing Reveals Novel and Recurrent Disease-Causing Variants in Lens Specific Gap Junctional Protein Encoding Genes Causing Congenital Cataract
G C A T T A C G G C A T genes Article Whole Exome Sequencing Reveals Novel and Recurrent Disease-Causing Variants in Lens Specific Gap Junctional Protein Encoding Genes Causing Congenital Cataract Vanita Berry 1,2,*, Alex Ionides 2, Nikolas Pontikos 1,2 , Ismail Moghul 3 , Anthony T. Moore 2,4, Roy A. Quinlan 5 and Michel Michaelides 1,2,* 1 UCL Institute of Ophthalmology, University College London, 11-43 Bath Street, London EC1V 9EL, UK; [email protected] 2 Moorfields Eye Hospital NHS Foundation Trust, London EC1V 2PD, UK; alex.Ionides@moorfields.nhs.uk (A.I.); [email protected] (A.T.M.) 3 UCL Cancer Institute, University College London, London WC1E 6BT, UK; [email protected] 4 Ophthalmology Department, University of California School of Medicine, San Francisco, CA 94158, USA 5 Department of Biosciences, University of Durham, Upper Mountjoy Science Site, Durham DH1 3LE, UK; [email protected] * Correspondence: [email protected] (V.B.); [email protected] (M.M.); Tel.: +44-207-608-4041 (V.B.); +44-207-608-6864 (M.M.); Fax: +44-207-608-6863 (V.B.); +44-207-608-6903 (M.M.) Received: 26 March 2020; Accepted: 4 May 2020; Published: 6 May 2020 Abstract: Pediatric cataract is clinically and genetically heterogeneous and is the most common cause of childhood blindness worldwide. In this study, we aimed to identify disease-causing variants in three large British families and one isolated case with autosomal dominant congenital cataract, using whole exome sequencing. We identified four different heterozygous variants, three in the large families and one in the isolated case. -
Epigenetic Regulation of Processes Related to High Level of Fibroblast Growth Factor 21 in Obese Subjects
G C A T T A C G G C A T genes Article Epigenetic Regulation of Processes Related to High Level of Fibroblast Growth Factor 21 in Obese Subjects Teresa Płatek 1,*, Anna Polus 1, Joanna Góralska 1, Urszula Ra´zny 1 , Agnieszka Dziewo ´nska 1, Agnieszka Micek 2 , Aldona Dembi ´nska-Kie´c 1, Bogdan Solnica 1 and Małgorzata Malczewska-Malec 1 1 Department of Clinical Biochemistry, Jagiellonian University Medical College, 15a Kopernika Street, 31-501 Krakow, Poland; [email protected] (A.P.); [email protected] (J.G.); [email protected] (U.R.); [email protected] (A.D.); [email protected] (A.D.-K.); [email protected] (B.S.); [email protected] (M.M.-M.) 2 Department of Nursing Management and Epidemiology Nursing, Faculty of Health Sciences, Jagiellonian University Medical College, 25 Kopernika Street, 31-501 Krakow, Poland; [email protected] * Correspondence: [email protected]; Tel.: +48-12-424-87-87 Abstract: We hypothesised that epigenetics may play an important role in mediating fibroblast growth factor 21 (FGF21) resistance in obesity. We aimed to evaluate DNA methylation changes and miRNA pattern in obese subjects associated with high serum FGF21 levels. The study included 136 participants with BMI 27–45 kg/m2. Fasting FGF21, glucose, insulin, GIP, lipids, adipokines, miokines and cytokines were measured and compared in high serum FGF21 (n = 68) group to low Citation: Płatek, T.; Polus, A.; FGF21 (n = 68) group. Human DNA Methylation Microarrays were analysed in leukocytes from Góralska, J.; Ra´zny, U.; each group (n = 16). -
Anaplastic Lymphoma Kinase Activates the Small Gtpase Rap1 Via the Rap1-Specific GEF C3G in Both Neuroblastoma and PC12 Cells
Oncogene (2010) 29, 2817–2830 & 2010 Macmillan Publishers Limited All rights reserved 0950-9232/10 $32.00 www.nature.com/onc ORIGINAL ARTICLE Anaplastic lymphoma kinase activates the small GTPase Rap1 via the Rap1-specific GEF C3G in both neuroblastoma and PC12 cells C Scho¨nherr1, H-L Yang2, M Vigny3, RH Palmer1 and B Hallberg1 1Department of Molecular Biology, Umea˚ University, Umea˚, Sweden; 2College of Biological Sciences and Biotechnology, Beijing Forestry University, Beijing, China and 3U839 INSERM/UPMC IFM, Paris, France Many different types of cancer originate from aberrant the result of a chromosomal translocation event that signaling from the anaplastic lymphoma kinase (ALK) places the C-terminal portion of ALK together with the receptor tyrosine kinase (RTK), arising through different N-terminal part of NPM (Morris et al., 1994; Shiota translocation events and overexpression. Further, activa- et al., 1994, 1995). A variety of ALK fusion proteins ting point mutations in the ALK domain have been recently have since been described in inflammatory myofibro- reported in neuroblastoma. To characterize signaling in the blastic tumors, non-small cell lung cancer, diffuse B-cell context of the full-length receptor, we have examined lymphomas and squamous cell carcinoma of the whether ALK is able to activate Rap1 and contribute esophagus (reviewed by Palmer et al., 2009). Together to differentiation/proliferation processes. We show that with the reported expression of ALK in a number of cell ALK activates Rap1 via the Rap1-specific guanine- lines and tumors, these findings suggest a function for nucleotide exchange factor C3G, which binds in a inappropriately activated ALK in oncogenic progres- constitutive complex with CrkL to activated ALK.