Florida State University Libraries
Electronic Theses, Treatises and Dissertations The Graduate School
2013 Characterization of Mechanisms Controlling Translational Regulation of Type I Collagen in Liver Fibrosis as Target for Novel Anti- Fibrotics and the Regulation of Neural Tube Closure during Embryonic Development Zarko Manojlovic
Follow this and additional works at the FSU Digital Library. For more information, please contact [email protected] THE FLORIDA STATE UNIVERSITY
COLLEGE OF MEDICINE
CHARACTERIZATION OF MECHANISMS CONTROLLING TRANSLATIONAL
REGULATION OF TYPE I COLLAGEN IN LIVER FIBROSIS AS TARGET FOR NOVEL
ANTI-FIBROTICS AND THE REGULATION OF NEURAL TUBE CLOSURE DURING
EMBRYONIC DEVELOPMENT
By
ZARKO MANOJLOVIC
A Dissertation submitted to the Department of Biomedical Sciences in partial fulfillment of the requirements for the degree of Doctor of Philosophy
Degree Awarded: Summer Semester, 2013 Zarko Manojlovic defended this dissertation on April 22, 2013. The members of the supervisory committee were:
Branko Stefanovic Professor Directing Dissertation
Zuoxin Wang University Representative
Myra Hurt Committee Member
Yoichi Kato Committee Member
James Olcese Committee Member
The Graduate School has verified and approved the above-named committee members, and certifies that the dissertation has been approved in accordance with university requirements.
ii
I dedicate this work to my loving family that had to endure many struggles for this opportunity
of a lifetime.
iii
ACKNOWLEDGEMENTS
In my opinion, the process of scientific discovery is a glorious expansion of our intellect and it is just as important as the discovery itself. This sensational quest for answers is ultimately an endless collaborative effort that leads to an integrated web of informatics. First and foremost, a simple thank you is not enough to express the gratitude and the greatest appreciation that I have for my major professor Dr. Branko Stefanovic whose virtuosity and the principle of a strong foundation allowed me to progress towards a successful scientific career. He is the mastermind behind this exciting project, and a great teacher not just of science, but also of life. With wit, Dr. Stefanovic eviscerates experimental issues leading to a very productive environment. He provided me with tools to become a critical thinker and a skilled scientist. His teachings on proficiency and emphasis on quality will be a skill that I will embrace for years to come. Special thanks to all members of my doctoral committee, Drs. Myra Hurt, James Olcese, Yoichi Kato and Zuoxin Wang for their dedication, guidance and professional advice throughout my graduate career. Many thanks to Lela Stefanovic “mother of the lab” for her brilliant technical support and for keeping the lab functional. It was a great pleasure to be working with an exceptional group of lab members, Hao Wang, Yujie Zhang, Drs. Le Cai, Azariyas Challa and Milica Vukmirovic. I would also like to thank Dr. Richard Nowakowski for his expertise and advise on professional development and leadership, Ruth Didier for all the help with the confocal and FACS, the entire administrational personnel for all the help with non-scientific matters, Lilly Lewis for excellent help with academic support in making not just my life, but also life of every graduate student much easier, Jennifer Sweetman for all the hard work and the endless uphill battle with the university in regards to my NIH-NRSA funds, Dr. Ewa Bienkiewicz for help with proteomics, Dr. John Blackmon for his expertise in histology analysis, Dr. Akash Gunjan for help and advice in ubiquitin studies, Dr. Timothy Megraw for the advice on cilia and confocal aspects of my FISH study, a very special thanks to Oscar Cabrera who is not only a true friend, but also a great colleague that shared his expertise on confocal software including FISH image acquisition. Special thanks to the entire Biomedical Sciences family.
iv
Furthermore, I would like to thank Dr. Kato and his laboratory members, Akiko Kato and Koichi Tanaka for a great experience working together closely on the LARP6 part of this dissertation. My thanks also to Dr. Chee-Gun Lee for the generous gift of RHA clone, to Dr. Kathleen Boris-Lawrie for generous information in regards to siRNAs (RHA) required for my RNA Helicase A study, the entire ACUC staff for making all my in-vivo experiments possible, Dr. Blaine Bartholomew that helped in shaping my early scientific career and Drs. Bryant Chase and Thomas Keller for their support with my NIH-F31 grant. It is without slightest doubt in my mind that this journey would have never been possible without the help of a former boss and a very special friend, Dr. Carlos Bolaṅos. I will always be grateful for his patience and guidance that opened doors for future advancements. It is in his lab that I was introduced to an excellent and exceptional student, Sergio Iniquez. Their influences and dedication to brilliance helped me flourish into a highly competitive and ambitious researcher. Even though my tenure in his lab was short, an eternal friendship was developed. A standing ovation to my father (Vlatko Manojlovic) and my sweetheart of a mother (Snjezana Manojlovic) for dedicating their lives for me and my brother (Marko Manojlovic). Despite the fact that we endured a past filled with cruelty, embraced with war, destruction, and endless refuge, they kept us together. They chose to come to this great country unselfishly, to give me and my little brother an opportunity for a better life and in the process sacrificed their professional careers, friends and everything they knew. They are all I have left and I love them. A very special thank you to my first teacher Vesna Vukancic, little did she know that I will be a student for life, to my wonderful aunt Jelena Manojlovic who I idolize greatly, Slavica Suljuzovic for her unconditional love and support and deceased Dr. Stambak, who I admired greatly and as a result initiated my scientific journey at age of 6. I do not know how this process would have been possible without my wonderful girlfriend, my loving future wife and most importantly my best friend, Heather Case. She is my better half and an escape from science. She is everything I could ever ask for, plus more. Thank you for keeping me sane and for loving me. This work was supported by the R01 NIH [5R01DK059466-08] to B.S, and F31 NIH/NIAAA NRSA [AA019845-01A1] to Z.M.
v
TABLE OF CONTENTS
List of Tables ...... viii List of Figures ...... ix Abstract ...... xi 1. INTRODUCTION ...... 1 1.1 - Abbreviations...... 1 1.2 - Pathological Process of Liver Fibrosis ...... 1 1.3 - Molecular Mechanism of Type I Collagen Expression ...... 3 1.4 - Anti-fibrotic Treatment Approaches and Future Directions...... 11 1.5 – Role of LARP6 in embryonic development...... 12 2. ROLE OF RNA HELICASE A IN TRANSLATION REGULATION OF TYPE I COLLAGEN MRNAS ...... 14 2.1 - Introduction ...... 14 2.2 - Results ...... 16 2.3 - Discussion ...... 31 2.4 - Materials and Methods ...... 36 3. A CRITICAL ROLE OF IMMUNOPHILIN FKBP3 IN TYPE I COLLAGEN SYNTHESIS ...... 42 3.1 - Introduction ...... 42 3.2 - Results ...... 43 3.3 - Discussion ...... 57 3.4 - Materials and Methods ...... 60 4. FK506 PREVENTS EARLY STAGES OF ETHANOL INDUCED HEPATIC FIBROSIS BY TARGETING LARP6 DEPENDENT MECHANISM OF COLLAGEN SYNTHESIS ...... 65 4.1 - Introduction ...... 65 4.2 - Results ...... 68 4.3 - Discussion ...... 83 4.4 - Materials and Methods ...... 87 5. LA RIBONUCLEOPROTEIN DOMAIN FAMILY MEMBER 6 (LARP6); A CRUCIAL FACTOR IN REGULATING CILIOGENESIS AND NEURAL TUBE FORMATION DURING VERTEBRATE ONTOGENY...... 92 5.1 - Introduction ...... 92 5.2 - Results ...... 95 5.3 - Discussion ...... 106 5.4 - Materials and Methods ...... 107 6. SUMMARY AND DEVELOPMENT OF NEW METHODOLOGY TO STUDY COORDINATED TRANSLATION OF COLLAGEN MRNAS ...... 111
vi
APPENDICES ...... 117
A. ACUC PROTOCOL 1123 ...... 117
B. ACUC PROTOCOL 1119 ...... 118
C. ACUC PROTOCOL 1213 ...... 119
D. RNA JOURNAL APPROVAL OF REPRODUCTION ...... 120
E. PLOS ONE JOURNAL APPROVAL OF REPRODUCTION ...... 121
REFERENCES ...... 122
BIOGRAPHICAL SKETCH ...... 139
vii
LIST OF TABLES
1 Primers used for RT-PCR and sequences of siRNAs in RHA study ...... 41
2 Primer Sets ...... 91
3 Morpholino Oligos and Primer Set sequences ...... 110
viii
LIST OF FIGURES
1 Molecular diagram of protein interactions at collagen mRNAs ...... 11
2 RHA interaction with collagen 5’ SL RNA ...... 18
3 LARP6 interacts with RHA ...... 20
4 Association of collagen mRNAs with RHA in human lung fibroblasts (HLFs) ...... 22
5 Association of RHA with collagen mRNAs is LARP6 dependent...... 24
6 RHA is required for efficient synthesis of collagen protein ...... 26
7 Collagen mRNAs are inefficiently translated in absence of RHA...... 28
8 Stimulation of translation by RHA depends on the presence of collagen 5’SL ...... 30
9 Temporal expression of RHA and type I collagen in activation of HSCs ...... 32
10 RHA is required for high level of type I collagen synthesis ...... 35
11 Expression of FKBP3 and type I collagen in activation of stellate cells ...... 44
12 Interaction of FKBP3 and LARP6 ...... 47
13 FKBP3 distribution in polysomal fractions of hLF cells ...... 48
14 FKBP3 regulates synthesis of collagen polypeptides by controlling steady state level of LARP6 ...... 50
15 FKBP3 knock-down results in degradation of LARP6...... 52
16 Stimulation of translation by FKBP3 depends on 5’SL and LARP6...... 54
17 FKBP3 causes LARP6 modifications ...... 55
18 Proteasomal degradation of LARP6 ...... 57
19 Schematic representation of the FKBP3 mechanism in collagen synthesis ...... 60
20 FK506 inhibits secretion of collagen polypeptides into cellular medium ...... 70
21 FK506 reduces collagen synthesis by precision cut liver slices ...... 72
22 Antifibrotic effect of FK506 in alcohol model of hepatic fibrosis ...... 74
ix
23 FK506 reduces expression of type I collagen and αSMA in hepatic fibrosis ...... 76
24 Expression of LPS-BP and CD64 mRNA in the livers of experimental animals ...... 78
25 Interaction of LARP6 with FK506 binding protein 3 (FKBP3) ...... 80
26 FK506 inhibits association of collagen mRNAs with FKBP3...... 82
27 LARP6 expression pattern in Xenopus laevis embryos ...... 96
28 LARP6-MO expression efficiency in X. laevis...... 97
29 Knockdown of LARP6 in X. laevis results in failure of neural tube closure ...... 98
30 Neural tube closure requires full size LARP6 ...... 100
31 LARP6-MO did not interfere with the convergent extension pathway...... 101
32 Sox2 expression is not affected by LARP6 knock-down ...... 102
33 Knock-down of LARP6 results in loss of cilia ...... 103
34 Expression profile of genes associated with ciliogenesis in LARP6 knock-down embryos ...... 105
35 Co-localization of collagen mRNAs ...... 115
x
ABSTRACT
Pathological hepatic fibrosis represents a worldwide medical problem with substantial mortality and the number of cases is increasing. Despite all medical advances, effective therapy to treat progressive liver fibrosis is still unavailable and is urgently needed, as the disorder results in organ death. The pathogenesis and the molecular mechanism underlying fibrosis are similar in most organs in human body, therefore, my work, which focused on liver fibrosis as the primary disease model, has broader implications. Liver fibrosis is categorized as an abnormal wound- healing response (excessive scarring), predominantly caused by increased production of type I collagen protein. Activation of a specialized cell type in the liver; hepatic stellate cells (HSC), is responsible for excessive collagen synthesis and pathogenesis of liver fibrosis. The dramatic up- regulation of collagen expression is primarily controlled at the level of initiation of protein production (post-transcriptional and translational level of regulation). The long-term goal of my work is to elucidate factors involved in translational regulation of type I collagen mRNAs and to target these factors as a potential anti-fibrotic therapy. This would lead to the first development of collagen specific drugs.
mRNAs encoding for type I collagen have a unique structure, the 5’ stem loop (5’SL), which regulates collagen synthesis. To understand this regulation, our lab has recently characterized a novel protein La ribonucleoprotein domain family member 6 (LARP6), as the key protein regulating translation of type I collagen mRNAs. LARP6 directly binds the 5’SL of collagen mRNAs and acts as a crucial adapter protein that recruits other factors required for collagen synthesis and progression of scarring.
My dissertation has three independent projects. The two projects of my proposal are to identify and characterize the role of novel factors that are recruited by LARP6 to enhance
xi collagen synthesis in fibrosis; these factors are RNA Helicase A (RHA) and FK506 Binding
Protein 3 (FKBP3). Detailed understanding of the mechanism by which these factors stimulate collagen synthesis was needed, as they may be potential targets for development of the specific antifibrotic treatment. In addition, in collaboration with Dr. Kato’s group I identified additional functions of LARP6 in neural tube development during embryogenesis. This complemented the work on the role of LARP6 in fibrosis.
Studies on RHA (published in RNA, PMID: 22190748) have indicated that RHA is tethered to the 5’SL of collagen mRNAs by interaction with LARP6. Knock-down of RHA prevented formation of polysomes on collagen mRNAs and dramatically reduced synthesis of collagen protein, without affecting the level of collagen mRNAs. During activation of quiescent
HSCs into collagen producing HSCs expression of RHA is highly upregulated. We postulated that RHA is recruited to the 5’UTR of collagen mRNAs by LARP6 to facilitate their translation.
Thus, RHA has been discovered as a critical factor for synthesis of type I collagen in fibrosis.
The second project on the role of FKBP3 (manuscript under preparation) has discovered that FKBP3 controls collagen synthesis prior to formation of polysomes, probably at the level of translation initiation. We determined that the FKBP3 regulation is in the cytoplasm where it] controls the amount of free LARP6 and thus affecting the next cycle of translation initiation on collagen mRNAs. I further extended these studies to animal model of liver fibrosis. I have used an alcoholic liver fibrosis model in rats and administered Tacrolimus (FK506), an immunosuppressive drug that binds FKBP3, in order to disrupt the LARP6/collagen mRNA complex. Our study showed that FK506 inhibited secretion of type I collagen by HSCs in vitro.
In vivo, administration of FK506 completely prevented development of liver fibrosis and activation of HSCs (PLOS One; PONE-D-13-06089). We postulate that FK506 inactivates
xii
FKBP3 and that lack of interaction of LARP6 and FKBP3 results in aberrant translation of collagen mRNAs and prevention of fibrosis in vivo and in defective secretion of type I collagen in vitro. This is the first report of such activity of FK506 and may renew the interest in using
FK506 to alleviate hepatic fibrosis. This work also validated my approach to discovery of novel antifibrotic drugs.
The third project, which focused on the functions of LARP6 other than collagen synthesis, discovered its role in neural tube development in the embryo. Neural tube defects are among the most common human congenital malformations, but very little is known about the factors that regulate the neural tube formation. Our results showed that LARP6 controls the formation of cilia, the structures that are required for proper neural tube development during embryogenesis. LARP6 knockdown prevented cilia formation and as a result the embryos failed to develop proper central nervous system. Understanding this mechanism and targets of LARP6 in this process may be used as in prenatal diagnosis and therapies for neural tube defects.
In conclusion, my dissertation work has characterized novel factors involved in synthesis of type I collagen and development of hepatic fibrosis. In addition, a mechanism of neural tube formation has been discovered. Overall, these findings will contribute to development of antifibrotic drugs and better understanding of congenital malformations of the nerve system.
xiii
CHAPTER ONE
INTRODUCTION
1.1- Abbreviations
LARP6-La ribonuclea family member 6; FKBP3–FK506 Binding Protein 3; HSC–hepatic stellate cell; hLF–human lung fibroblast; 5’SL-5’ stem loop; RHA–RNA Helicase A; PCE–Post- transcriptional Control Element; eIF4A–eukaryotic Translation Initiation Factor 4A; uORFs– upstream open reading frames; CIP–calf intestinal alkaline phosphatase; IP– immunoprecipitation; i.p.–intraperitoneal injection; PP–post-polysomal supinate fractions; RS – ribosomal subunits fractions; UTR-untranslated region; IL-interleukin; kb-kilobases; aa-amino acids; bp-base pair: I.P.-isometric point; HCC- Hepatocellular carcinomas
1.2 - Pathological Process of Liver Fibrosis
Liver fibrosis can be defined as disruption of normal wound healing process in response to chronic tissue damage that follows a highly regulated sequence of events [1, 2]. It starts with inflammation, followed by release of fibrogenic cytokines; these molecules in turn stimulate proliferation and migration of fibroblasts, which finally deposit extra cellular matrix (ECM) proteins [2]. Approximately 45% of all autopsies in the United States have reported some sort of fibroproliferative dysplasia [3]. Although commonly associated with liver disease, the pathogenesis of fibrosis may affect any major organ [4] and therefore, my work, which focuses on liver fibrosis as the primary disease model, has broader implications. Fibrosis of the liver is the most common proliferative disorder, that can be stimulated with verity of different causes such as viral hepatitis, obesity and chronic alcoholism [5]. In the United States alone, there are approximately 120,000 deaths annually directly related to hepatic fibrosis [2]. In addition, an estimated two million people in the United States (1% of population) suffer from chronic
1 alcoholic liver diseases [6, 7]. Worldwide, there are 200 million people being affected by
Hepatitis C related liver disease [8]. Obesity is another major cause of hepatic injury, and with the obesity rates tripling in the United States in the last decade, obesity-induced fibrosis is also a major public health concern. Obesity causes accumulation of fat in the liver (steatosis), which leads to hepatic inflammation and development of a syndrome termed non-alcoholic steatohepatitis (NASH). Approximately 20% of Americans have been diagnosed with fatty liver, most of which are asymptomatic. In 10-15% of those affected with hepatic steatosis inflammation will be activated by unknown mechanisms and will develop NASH. NASH is a progressive disease leading to fibrosis, liver cirrhosis and ultimately hepatic failure [9]. This obesity epidemic is the leading cause of an exponential increase in hepatic cirrhosis cases in the
United States [10]. Liver fibrosis of any etiology is almost always irreversible and leads to cirrhosis, liver failure and death [11]. Hepatocellular carcinomas (HCC) almost always appear in cirrhotic livers, thus cirrhosis can also be regarded as a per-cancerous state. HCC are among the most aggressive cancers and represent a further complication to the fibrosis patients.
During liver injury, the quiescent hepatic stellate cells (HSC), normally involved in vitamin A storage in the liver, are activated by cytokines and differentiate into α-smooth muscle actin (αSMA) producing myofibroblast-like cells [12-14]. Activated HSC proliferate and are the major cell type responsible for hepatic fibrogenesis, not only in humans, but also in animal models [2, 15-20]. Even though many different extracellular matrix proteins are produced by activated HSC, type I collagen is the major protein responsible for irreversible fibrosis [2, 21].
One of the key cell-signaling molecules involved in stimulation of collagen production is transforming growth factor beta (TGF-β) (25-28). There are three known isoforms of TGF-β (1-
3) that are made by almost every cell type [22]; however, fibrosis is predominantly stimulated by
2 the TGF-β1 pathway [4]. Activation of TGF-β1 receptor phosphorylates SMAD proteins, transducing the signal into the cell nucleus and resulting in an increase of type I collagen production, as well as production of other ECM proteins, such as fibronectin, elastin and laminin.
TGF-β1 also inhibits degradation of collagen by reducing synthesis of collagenases, resulting in a synergistic effect [4, 23]. In addition to the TGF-β1 pathway activation, there is evidence that a vasoconstriction inducing hormone, Angiotensin II, which is a major component of renin- angiotensin system, can also stimulate collagen production [24]. Angiotensin II is locally produced by the fibroblasts and can either directly stimulate TGF-β1 signaling, or indirectly stimulate production of Thrombospondin-1, which in turn converts inactive TGF-β from into its active form [25]. Furthermore, since inflammation is commonly associated with fibrosis, it is reported that most fibroblasts have receptors for inflammatory cytokines, such as interleukin IL-
1, IL-6 and TNFα, and that these cytokines stimulate transcription of the major ECM genes, including type I collagen [26]. As a result, the current anti-fibrotic therapy of autoimmune hepatitis, scleroderma and pulmonary fibrosis relies on immunosuppression.
1.3 - Molecular Mechanism of Type I Collagen Expression
Collagen protein is a heterotrimer composed of two α1 and one α2 polypeptides and is the most abundant protein in the human body [27]. During fibrogenesis the rate of synthesis surpasses its natural rate of degradation, resulting in a net accumulation of the insoluble heterotrimaric collagen [28].
Type I collagen is regulated at both transcriptional and translational levels during fibrogenesis [29-36]. At the transcriptional level, collagen polypeptides (COL1A1 and COL1A2) are transcribed from two different genes located on different chromosomes. Despite the fact that type I collagen is very abundant protein, it is predominantly synthesized only by few cell types,
3 including fibroblasts, osteoblasts, myofibroblasts and activated HSCs. This cell specific gene- regulation is partly due to the presence of enhancer elements in the promoter of collagen genes, which bind transcription factors in the cell specific manner [37]. Type I collagen gene transcription is driven by combinations of multiple transcription factors. These are common transcription factors, but it is believed that their combinations are determined by the cis-acting elements of collagen promoters and by selecting a proper combination the cell can specifically turn on collagen genes. For example, COL1A2 promoter region between -378 and -183 bp mediates transcription by recruitment of AP1, Sp1 and p300/CBP [38-40]. Studies in transgenic mice have shown that the DNA region between -2.3 and -1.7kb of COL1A1 gene is crucial for transcriptional activity in osteoblasts [37]. Transgenic mice harboring only 900 bp of the promoter region showed only cutaneous expression of COL1A1, however, by extending the promoter to 2.3 kb the expression was stimulated in osteoblasts and even a longer promoter, up to 3.2 kb, is required for predominant expression in tendons [41, 42].
More recent studies showed that transcriptional regulation is not sufficient to account for the dramatic increase in expression seen in fibrosis and that post-transcriptional regulation is superimposed to the transcriptional regulation. Posttranscriptional regulation includes increase in the stability of collagen mRNAs and increase in their translation. In HSCs that undergo activation there is a 100 fold up-regulation of type I collagen expression that is primarily due to a
16-fold increase in collagen α1 and α2 mRNA stability, coupled to a 2-fold increase in the rate of transcription [33-35, 43-45]. This was the first observation that post-transcriptional regulation of collagen mRNAs is the predominant mechanism of collagen synthesis and this finding was further verified in other collagen producing cells.
4
There are two specific cis-acting elements identified in collagen mRNAs that regulate collagen’s half-life. One was identified in the 3’ un-translated region (3’UTR) of collagen α1(I) mRNA and this sequence binds protein α-CP. The other is present in both collagen mRNAs in the 5’ UTR and binds protein LARP6 [46]. α-CP is an RNA binding protein that binds C-rich sequences with high affinity. One such C-rich sequence is found 30 nt 3’ to the stop codon in collagen α1(I) mRNA. αCP binds this sequence in collagen α1(I) mRNAs only in extracts of activated HSCs, but not in the extracts of quiescent HSCs. It was proposed that binding of αCP protects collagen α1(I) mRNA from degradation and contributes to its long half-life and high collagen synthesis by activated HSCs [29, 34, 35, 43, 47, 48]. There is no C-rich sequence in the
3’ UTR of collagen α2(I) mRNA. However, αCP binds C-rich sequences in the 3’ UTR of tyrosin hydroxylase, α-globin and lipoxygense mRNAs and stabilizes these messages, suggesting that this is a more general mechanism of mRNA stabilization.
On the other end of the message, at the 5’ UTR, in both α1(I) and α2(I) collagen mRNAs there is a discrete stem-loop structure containing start codon. This sequence has been termed of the 5’ stem-loop (5’SL) and it is evolutionary conserved in all vertebrate type I collagen mRNAs.
Evolutionary conservation suggests important function. 5’SL vaguely resembles structural elements seen in some cellular and viral mRNAs that have been termed PCE-like regions [33,
35, 45, 49]. A PCE-like region has been characterized in retroviral mRNAs and just recently in
JunD mRNA [50]. This region consists of 50-120 nts long structured sequence in the 5’ UTR that interacts with RNA Helicase A (RHA) and is necessary for efficient translation of the target mRNAs [50, 51]. The collagen 5’SL, although unique for collagen mRNAs, may be a functional equivalent of a PCE, because it is required for high level of collagen synthesis [33, 35]. The
5 absence of 5’SL results in aberrant collagen synthesis in vitro [45] and transgenic mice with a mutation in the 5’SL of collagen α1(I) gene are resistant to induction of liver fibrosis [52].
Our laboratory has cloned La ribonucleoprotein domain member 6 (LARP6) as the protein which specifically binds 5’SL and which mediates its regulatory effects [53]. Cai et al. described that LARP6 binds to the conserved 5’SL of collagen α1(I) and α2(I) mRNAs with high affinity and specificity and prevents their premature translation. When bound, LARP6 engulfs the start codon that is a part of the 5’SL and inhibits random polysomal loading. This inhibition prevents premature translation of collagen mRNAs, until both collagen mRNAs are targeted to the discrete subcellular regions of the endoplasmic reticulum membrane for their coordinated translation. This results in more efficient folding of collagen α1(I) and α2(I) polypeptides into triple helix of type I collagen. The knock-down of LARP6 results in uncoupling of the synthesis of collagen α1(I) and α2(I) polypeptides which are then translated randomly and cannot be folded into a heterotrimeric molecule, thus resulting in their rapid degradation. LARP6 contains multiple domains, including the well-defined 5’ SL RNA binding domain, and acts as an integral component for tethering of a larger protein complex on the 5’SL of collagen mRNAs. LARP6 also has additional functions not related to collagen synthesis, as will be described in chapter six.
To further characterize the collagen translational machinery and the role of LARP6, non- muscle myosin was identified as a protein that interacts with LARP6 [54]. Non-muscle myosin is a motor protein which forms filaments that interact with actin filaments and slide them. This generates force for cell motility and contractility [55]. Cell motility is an integral process of wound healing and fibrosis, as the collagen producing cells migrate to the site of the injury to deposit scar. Therefore, activated HSCs, activated fibroblasts and myofibroblasts have high expression of non-muscle myosin [56]. The discovery that LARP6 interacts with non-muscle
6 myosin, suggested that non-muscle myosin is needed, not only for motility, but also for collagen synthesis. Further analysis of the function of non-muscle myosin in post-transcriptional regulation of collagen expression has revealed that C-terminal domain of LAPR6 interacts with non-muscle myosin and that formation of non-muscle myosin filaments is crucial for co- localization of collagen mRNAs to the membrane of the endoplasmic reticulum (ER) [54]. Thus, non-muscle myosin coordinates synthesis of collagen α1(I) and α2(I) polypeptides and facilitates formation of the heterotrimer of type I collagen. Disulfide bonding and post-translational modifications of collagen polypeptides take place during the translational elongation phase and before procollagen is being released into the ER lumen [57]. Therefore, translation of collagen
α1 and α2 mRNAs must occur in a close proximity in the same ER compartment for proper synthesis of type I collagen [45].
In addition to the non-muscle myosin filaments, Challa et al. has identified vimentin as yet another cytoskeletal filament system that interacts with LARP6 through its La-domain [58].
La-domain is very well conserved in all LARPs, but the function of this domain has been elusive.
The finding that LARP6 interacts with vimentin through the La-domain identified the first function of the La domain. Vimentin forms intermediate filaments that are present in cells of mesenchymal origin [59]. Initial reports using vimentin knock-out mice have reported impaired wound healing in these animals [60]. Vimentin knock-out fibroblast have significantly reduced level of type I collagen mRNAs. This decrease is due to their accelerated degradation in the absence of vimentin filaments [58]. This implied that interaction of collagen mRNAs with vimentin filaments stabilizes collagen mRNAs and that it is required for high collagen synthesis.
This is consistent with the impaired healing response in vimentin knock-out mice.
The requirement of vimentin filaments for collagen synthesis led to a hypothesis that
7 disrupting vimentin filaments can be a potential antifibrotic therapy. Our laboratory has already validated one compound that can disrupt vimentin filaments (Withaferin-A) in animal model of cardiac fibrosis. Withaferin-A at doses of 10 mg/kg reduced cardiac fibrosis by 50%. The
Withaferin-A also inhibited HSCs activation and signaling through TGF-β1/SMAD pathway
[61], suggesting that Withaferin-A has a dual effect - inhibition of TGFβ signaling and destabilization of collagen mRNAs.
RNA Helicase A (RHA) has been studied for decades as a transcription factor. Just in recent years, it was revealed that RHA also has a role in translation initiation of highly structured mRNAs containing a PCE [50, 62, 63]. RHA is a well conserved Asp-Glu-Ala-His(DEAH) protein with both ATPase and helicase activities [63]. For translation initiation by ribosomal scanning towards the start codon, numerous initiation factors cooperate to ensure the unwinding of the secondary structure in the 5’UTR. Initiation factor 4A (eIF4A) is a global translation factor with helicase activity that is also involved in housekeeping collagen synthesis, thus maintaining the basal level of collagen synthesis [64]. In the conditions of high collagen demand, it is likely that eIF4A needs collaboration of other factors with helicase activity for efficient translation of type I collagen mRNAs that contain the 5’ SL. RHA and other RNA helicases, such as DDX3 and Ded1, show higher processivity and activity compared to the general RNA helicase eIF4A and, if recruited, can enhance translation of the target mRNAs [65-67]. The PCE elements were proposed to tether these helicases to some viral and cellular mRNAs [50, 51, 68], while our hypothesis was that 5’ stem-loop and LARP6 serve this function for collagen mRNAs.
In addition to 5’SL, collagen mRNAs also contain two short upstream open reading frames
(uORFs) [69]. The 5’ SL and uORFs are impediment for translation [68], making collagen mRNAs naturally poor substrates for translation [43]. We hypothesized that RHA may enhance
8 translation of collagen mRNAs in activated HSCs and that RHA is an important regulatory molecule in stimulating fibrogenesis.
FK506 Binding Protein 3 (FKBP3), also known as FKBP25, is both, cytosolic and nuclear protein [70] with well characterized structure, but its physiological significance is still not well defined [71]. There is growing evidence that FKBP3 may function as a protein folding chaperone [72, 73]. Its co-association with nucleolin suggests that it may also be involved in ribosome biogenesis or in formation of other ribonucleoprotein complexes [70]. Studies on tumor suppressor p53 showed that FKBP3 stimulates auto-ubiquitylation of MDM2 that stimulates degradation of p53 [71]. There have been no reports of the involvement of FKBP3 in collagen synthesis. Recently, I discovered that FKBP3 interacts directly with LARP6. This finding raises an interesting possibility as to how this protein can regulate collagen expression.
FKBP3 has cis-trans prolyl isomerase activity and binds immunosuppressive drugs, such as
FK506 (Tacrolimus), with high affinity [70]. Thus, a goal of this dissertation is to delineate detailed mechanism(s) of FKBP3 interaction in collagen regulation.
In conclusion, the cloning of LARP6 represents a significant step forward in the understanding of the post-transcriptional regulation of type I collagen within the scope of fibrogenesis. This has resulted in the emergence of novel factors involved in LARP6-dependent regulation. As the process is being better understood and the complexity of the mechanism worked out, the efforts towards development of the first collagen specific anti-fibrotic drug will likely become available. The post-transcriptional regulation of type I collagen, related to the role of proteins - RHA and FKBP3, are the main focus of my dissertation. Post-transcriptional regulation is the key mechanism of excessive collagen synthesis in fibrosis of various organs.
The control of activation of hepatic stellate cells and collagen synthesis is the prime target for
9 possible drug development in fibrosis. Therefore, my work provides a significant contribution to our understanding of this process, as well as validation of the targets for development of antifibrotis drugs.
The molecular diagram in figure 1 as shown below summarizes the molecular interactions governing translation of type I collagen mRNAs. The work in this dissertation will focus on the events presented in figure 1A and D. Figure 1A shows the initial interaction of
LARP6 and 5’SL, after binding 5’SL LARP6 recruits RHA into a mRNP complex. These events take place in the nucleus and the mRNP complex is exported into the cytoplasm. In the cytoplasm the complex associates with non-muscle myosin filaments (MYOIIb), this is required to coordinate translation of collagen mRNAs (Fig 1B). Alternatively, the complex can associate with vimentin filaments, which stabilizes collagen mRNAs (Fig. 1C). For translation to enter the elongation phase LARP6 has to be removed from the 5’SL and RHA has to remodel the secondary structure of collagen mRNAs (Fig. 1D). FKBP3 interacts with the free LARP6 and protects LARP6 from degradation, allowing for the next round of the cycle to proceed.
10
Figure 1. Molecular diagram of protein interactions at collagen mRNA. A. Initial nuclear interactions and the mRNP complex containing collagen mRNA, LARP6 and RHA formation. B. Cytoplasmic binding of the mRNP complex to the non-muscle myosin (MYOIIb) filament. The small lighting symbol indicates that drugs that can depolimerize the filaments may inhibit collagen synthesis. C. Interaction of the mRNP complex with vimentin, as an alternative fate. D. Translation elongation phase. Removal of LARP6 and its stabilization by interaction with FKBP3.
1.4 - Anti-fibrotic Treatment Approaches and Future Directions
Specific anti-fibrotic therapeutics are urgently needed, because it is the scarring response that is the cause associated with organ failure and not the primary pro-fibrotic stimulus [3]. Currently, the only available course of treatment is the removal of the underlying stimulus, like inflammation or hepatotoxins [74-76]. Unfortunately, fibrosis is asymptomatic for a long time and, once diagnosed, its progression is very aggressive and the removal of stimuli, if it all possible, is not sufficient. Thus the reversal to the normal organ architecture in advanced fibrosis cannot be achieved, so the prevention of further scarring is the therapeutic goal [77].
This suggests that specific treatments targeting synthesis of type I collagen are highly desirable.
11
Recent experimental efforts in validation of anti-fibrotic therapy have consisted of targeting HSCs activation and anti-inflammatory treatment, with the hypothesis that inflammation is the driving force of fibrogenesis (see chapter 4), and the development of TGF-β pathway inhibitors [77-79]. Some of the major reasons that have hindered the success of these approaches are the high cost, lack of specificity and highly detrimental side effects. In addition, because oxidative tissue damage has been reported in fibrosis, many antioxidants have been suggested and examined in large studies, but their effect on fibrosis have been insignificant [80-
82].
Despite all the medical advancements up-to-date, fibrosis still provides a challenge in clinical settings. Discovery of new molecules that control type I collagen synthesis and elucidation of their role in fibrosis will have tremendous implications in the development of specific, effective and affordable anti-fibrotic compounds. This dissertation identified and characterized RHA and FKBP3 as potential targets to reduce fibrosis.
1.5 – Role of LARP6 in embryonic development
LARP6 has been discovered as an RNA binding protein that specifically binds the 5’SL of collagen mRNAs. No other RNAs have been identified that LARP6 can bind. Therefore, it has been studied as a regulator of type I collagen biosynthesis and there are no reports of the role of
LARP6 in any other cellular function. Finding additional LARP6 functions is critical to identifying potential reverse reactions if LARP6 is to be targeted with drugs. The search for other roles of LARP6 is an important addition to this dissertation and is described in chapter six. The work was a product of strong collaborative efforts and expertise of Dr. Yoichi Kato and his postdoctoral fellow, Dr. Koichi Tanaka. This work resulted in the discovery of a completely novel function of LARP6 during neural tube closure in the embryonic development in Xenopus
12 laevis (X. laevis). This function is unrelated to regulation of type I collagen in the embryo, because temporally its expression takes place much earlier. During X. laevis embryo development, the expression of type I collagen gene is initially detected at the late neurula stage and is associated with the initiation of organogenesis, which takes place after the closure of the neural tube [83]. The discovery that LARP6 has a role early in embryonic development opened a new research of the mechanism of congenital defects of the neural system. This exciting work is described in greater details in chapter 6.
13
CHAPTER TWO
ROLE OF RNA HELICASE A IN TRANSLATION
REGULATION OF TYPE I COLLAGEN MRNAS
Adapted from:
Zarko Manojlovic & Branko Stefanovic. “A novel role of RNA Helicase A in regulation of translation of type I collagen mRNAs”. RNA, February 2012, 18 (2): 321-334
2.1 - Introduction
Type I collagen is a heterotrimer composed of two α1(I) and one α2(I) polypeptides and is the most abundant protein in the human body [27]. It is expressed at high levels in skin, bones and tendons, with a low expression in parenchymal organs. During fibrosis of soft tissues, type I collagen expression is highly up-regulated at both transcriptional and posttranscriptional levels
[33, 36, 43]. mRNAs encoding type I collagen have cis-acting elements controlling mRNA stability in both, the 3’ and the 5’ untranslated regions (UTRs). In the 3’ UTR of α1(I) mRNA there is a cytosine rich region that interacts with αCP protein that is shown to stabilize the message [34, 35, 43, 47, 48]. In the 5’UTR, 75 nucleotides (nt) from the 5’-terminal 7- methylguanine cap, there is a discrete 5’ stem-loop structure (5’SL). This 5’SL is found only in three collagen mRNAs, α1(I), α2(I) and α1(III), the latter encodes for type III collagen. We have cloned La ribonucleoprotein domain family member 6 (LARP6) as the protein which binds 5’SL with high affinity and specificity. Binding of LARP6 prevents premature and random translation of type I collagen mRNAs [53]. Previous work established that the LARP6 dependent mechanism is critical for high level of collagen synthesis, as seen in wound healing and fibrosis
[53, 54, 58, 84].
14
DEIH motif DHX9 helicase, also known as RNA Helicase A (RHA), is an essential well conserved RNA binding protein with ATPase, and RNA helicase activities [50, 63, 85].
Recently, it was demonstrated that RHA is a necessary cofactor to promote translation initiation of highly structured mRNAs containing the post-transcriptional control element (PCE) [50, 62,
63]. PCE is a highly structured, orientation-dependent motif present in the 5’UTRs of some retroviral mRNAs [86-88]. The 5’PCE activity is positively regulated by RHA and is essential for translation efficiency of viral mRNAs [86, 87]. In addition, Harman et al. demonstrated that
PCE-like element in the 5’UTR of human JunD mRNA interacts with RHA and regulates translation [50]. JunD protein regulates cell growth in response to a stress, so tightly controlled translational regulation provides means to rapidly alter protein expression [89, 90]. During cap dependant translation initiation, RHA ensures unwinding of the secondary structures in the
5’UTR to facilitate ribosomal scanning [91-93]. Initiation factor 4A (eIF4A) is a global translation DEAD-box factor with helicase activity [64]. For highly structured 5’ UTR, it is likely that eIF4A needs activity of additional factors with helicase activity for efficient ribosomal scanning [94]. RHA may be specifically recruited by the PCE elements to provide such activity [43].
Collagen 5’UTR may functionally resemble a PCE-like region [33, 35, 49]. The start codon of collagen mRNAs is located in the 5’ stem-loop [33, 35], thus the RNA helicase A activity may be crucial in the unwinding of the 5’UTR and translation initiation. In this chapter we describe that RHA interacts with LARP6, which recruits RHA to the 5’UTR of collagen mRNAs. There, RHA activity is necessary for efficient formation of polysomes and high level of collagen protein synthesis.
15
2.2 - Results
LARP6 interacts with RNA helicase A
LARP6 was cloned as the protein which directly binds the 5’SL of collagen mRNAs [53].
To identify additional proteins that may be associated in a complex with LARP6 and 5’SL, we performed pull down experiments using biotin labeled collagen α1(I) 5’SL RNA (Fig. 2A).
Inverted 5’SL RNA was used for control pull down. Several proteins were pulled down with
5’SL RNA (indicated in Fig. 2A). RNA helicase A (RHA) was identified by LC/MS/MS as the
140 kD protein band (indicated in Fig. 2A). This result was further confirmed by MALDI/TOF in a separately repeated experiment.
To test if RHA interacted with the 5’SL of collagen mRNAs with high affinity, we performed a gel mobility shift assay using 5’SL RNA as a probe. This assay is very stringent because only RNA/protein complexes that are stable and formed by high affinity interactions can endure gel electrophoresis. To increase the read-out of these experiments, we overexpressed
RHA together with LARP6 or with LARP6 mutant lacking the C-terminal domain (LARP6ΔC) as our positive control or with a control protein (TRIM45) as a negative control in HEK293 cells.
Fig. 1B shows the expression of the transfected proteins. Overexpression of LARP6 resulted in formation of 5’SL/protein complex in gel mobility shift assay (Fig. 2C, lane 2). Co-transfection of LARP6 and RHA yielded two-fold higher expression of LARP6 (Fig. 2B, lane 2 compare to lane 1). Therefore, the RNA/protein complex in gel mobility shift experiment using this extract is stronger (Fig. 2C, lane 3). However, the electrophoretic mobility of this complex was identical to that of LARP6 alone, suggesting that RHA has no effect on binding of LARP6 to 5’SL.
Overexpression of RHA with control protein (lane 4) failed to produce RNA/protein complex, only the background binding was seen, which was identical to the background in the
16 nontransfected cells (lane 7). This suggests that binding of RHA to 5’SL cannot be detected by gel mobility shift experiments. LARP6ΔC was used as additional control, this protein cannot interact with RHA (see later), but can bind 5’ SL [53]. When LARP6ΔC was co-expressed with
RHA or control protein (lanes 5 and 6), the identical shift was seen.
Binding of LARP6 to 5’SL is strictly sequence specific and when a single U nucleotide in the bulge of the 5’SL is changed into an A, LARP6 cannot bind [53]. When this mutant 5’SL probe was used in gel mobility shift experiments (lanes 8-12), no binding of LARP6 was detected, while binding of RHA was at the background level seen in the non-transfected cells.
This verified that LARP6 binds 5’SL in the sequence specific manner and that RHA cannot bind
5’SL with high affinity to withstand the electrophoresis. Therefore, it is likely that RHA had been recruited to 5’SL in the pull down experiments by a protein-protein interaction with
LARP6.
17
Figure 2. RHA interaction with collagen 5’ SL RNA. A. Pull down of RHA with biotinylated 5’ SL RNA. Biotin tagged 5’SL RNA (5’SL, lane 3) and inverted 5’ SL RNA (CON, lane 2) were used to pull down proteins from cytosolic extracts of HLF. Proteins were analyzed by SDS- PAGE and Coomassie staining. The protein bands identified by MALDI-TOF are indicated. RNA helicase A (RHA), ATP citrate lysate isoform 1 (ACLY1), ATP-dependent DNA helicase 2 subunit 1(XRCC6), eukaryotic initiation factor 4 H (eIF4H). B. Expression of proteins (immunoblot) used in gel mobility shift experiments. HA-tagged LARP6 and LARP6ΔC, His- tagged RHA and FLAG-tagged control protein TRIM45 (CON) were transfected into HEK293 cells and their expression in cytosolic extract analyzed by western blot. – indicates nontranfected cells. Actin (ACT) is shown as loading control. C. RHA does not bind 5’SL in the gel mobility shift essay with high affinity. Gel mobility shift assay with wt 5’SL RNA (lanes 1-7) and mutant 5’ SL RNA with a single point mutation that abolishes interaction with LARP6 (lanes 8-12) and extracts shown in B. Migration of RNA/protein complex and free probe is indicated. Lane 1 is the wt probe alone (P).
Since it is likely that LARP6 and RHA interact by protein-protein interactions, we tested the RHA-LARP6 interaction by co-immunoprecipitation experiments in the presence and absence of intact RNA. We have designed adenoviruses expressing different mutants of the HA-
18 tagged LARP6 protein, as shown in Fig. 3A, and analyzed these constructs for their ability to interact with the endogenous RHA. After expression of HA-tagged LARP6 constructs and immunoprecipitation with anti-HA antibody, RHA was analyzed by Western blot. Fig. 3B shows that RHA precipitated with the full size LARP6 (Fig. 3B, lane 1), while the LARP6 lacking the
C-terminus failed to pull down RHA (lane 2). To assess if the C-terminal domain of LARP6 is sufficient to pull down RHA we expressed HA-tagged C-terminal domain (LARP6ΔC) and performed immunoprecipitation (Fig. 3B, lane 4). The C-terminal domain (C-TER) pulled down
RHA as efficiently as full size LARP6 (compare lanes 1 and 4). As control in this experiment,
LARP6(ΔC/RRM) construct showed no interaction with RHA. These results suggested that the
C-terminal domain of LARP6 is necessary and sufficient for the interaction of LARP6 with
RHA.
It is still possible that LARP6/RHA interaction requires intact collagen mRNA. To test this we treated the lysate with RNase A prior to immunoprecipitation. Fig. 3C shows that RHA is able to bind to LARP6 even after digestion of the total RNA (Fig. 3C, lane 1), although the interaction was stronger without RNase A treatment (Fig. 3C compare lanes 1 and 2). The C- terminus truncated LARP6 (ΔC/RRM) did not show any interaction with RHA, as before (Fig.
3C, lanes 3 and 4). The right panel in Fig. 3C shows that the RNase A treatment completely degraded RNA in the lysate (lane 3). This indicated that the interaction of RHA and LARP6 is not mRNA dependent.
LARP6 is found in the nucleus and cytoplasm of collagen producing cells [53]. To test if
RHA and LARP6 can form complex in nuclear extracts, we fractionated cellular extracts into nuclear and cytosolic fractions and performed the immunoprecipitation experiments (Fig. 3D).
The association between LARP6 and RHA was found in both nuclear and cytosolic extracts (Fig.
19
3D, lanes 1 and 2). Control immunoprecipitations using protein A/G beads only (lanes 3 and 4) or anti-fibronectin antibody (lanes 5 and 6) did not pull down RHA, suggesting the specific interaction between LARP6 and RHA. As a control to show that there was no cross- contamination of the fractions, we probed the cytosolic and nuclear extracts for presence of tubulin, which is strictly cytosolic protein. The absence of tubulin in nuclear fraction suggested that there was no contamination of the nuclear extract with cytosolic proteins (Fig. 3D, bottom panel). These results show that LARP6 can associate with RHA in the nucleus and, thus, prior to the onset of translation initiation on collagen mRNAs.
Figure 3. LARP6 interacts with RHA. A. Schematic representation of LARP6 constructs used in immunoprecipitations (IP). All constructs had HA-tag at the N-terminus. FS, full size LARP6 with the domains indicated. The ability of the constructs to bind 5’ SL RNA is indicated as + or - . B. IP of RHA with LARP6. Constructs shown in A were transfected into HEK293 cells and IP was done using anti-HA antibody. IP material was analyzed by western blot with anti-RHA antibody (RHA) and anti-HA antibody (FS, ΔC, ΔC/RRM and C-TER). Expression of proteins in the input material is shown in the bottom panels. – indicates nontransfected cells. C. Intact RNA is not required for LARP6/RHA interaction. Left top panel; IP of RHA with FS and ΔC/RRM LARP6 constructs after digestion of the samples with RNase A (lanes 1 and 3) or without RNase A digestion (lanes 2 and 4). Left bottom panel; expression of proteins in the input material. Right panel; RNA from untreated extracts (lane 2) and extracts treated with RNase A (lane 3) was analyzed by agarose gel electrophoresis. Lane 1; size marker. D. Interaction of LARP6 and RHA in the nuclear extract. HEK293 cells were transfected with full size HA- tagged LARP6 and cytosolic (CYT) and nuclear (NUC) extract was used for IP with anti-HA antibody (lanes 1 and 2), protein A/G beads without antibody (*, lanes 3 and 4) and anti- fibronectin antibody (lanes 5 and 6). Top panel; analysis of RHA in the IP samples. Bottom panel; analysis of the proteins in the input material.
20
LARP6 mediates RHA associates with collagen α1(I) and α2(I) mRNAs in vivo.
Next, we wanted to test if RHA is associated with collagen mRNAs in vivo. LARP6 interacts with 5’ SL of collagen α1(I) and α2(I) mRNAs with high affinity and immunoprecipitation experiments using LARP6 always pull down both collagen mRNAs from the cytosolic extracts [53]. Since LARP6 binds RHA, we tested if antibodies against RHA can also pull down both collagen mRNAs in human lung fibroblasts (HLFs), which express detectable level of endogenous LARP6. After immunoprecipitation with anti-RHA antibody we analyzed the immunoprecipitated material by RT-PCR using primers specific for collagen α1(I) and α2(I) mRNA and with radiolabeling of the PCR products (radiolabeled RT-PCR) (Fig. 4A).
Collagen α1(I) and α2(I) mRNAs were strongly immunoprecipitated with anti-RHA antibody
(lane 1), while the immunoprecipitation reaction with the nonspecific antibody (anti-fibronectin antibody) was negative (Fig. 4A, lane 3). Actin mRNA was not pulled down with any antibody, suggesting that the interaction of collagen mRNAs with RHA is specific. When LARP6 was overexpressed in HLFs, there was no increase in the amount of collagen α1(I) mRNAs co- immunoprecipitated with RHA, but collagen α2(I) mRNA was co-immunoprecipitated more efficiently (Fig. 4A, compare lanes 1 and 2). Overexpression of LARP6 did not change the input levels of collagen mRNAs, which are shown in the bottom panel of Fig. 4A. Fig. 3B shows more quantitative determination of collagen mRNAs in the immunoprecipitate by real time PCR. This analysis verified the specific immunoprecipitation of collagen mRNAs with RHA and that overexpression of LARP6 increased the pull down of collagen α2(I) mRNA two-fold. The input levels of proteins are shown in Fig. 4C.
21
Figure 4. Association of collagen mRNAs with RHA in human lung fibroblasts (HLFs). A. HLFs (lanes 1 and 3) and HLFs transduced with adenovirus expressing LARP6 (lane 2) were used for IP with anti-RHA antibody (lanes 1 and 2) or anti-fibronectin antibody (lane 3). The IP material was analyzed for presence of collagen α1(I), collagen α2(I) and actin (ACT) mRNAs by radiolabeled RT-PCR. Bottom panel; expression of the mRNAs in the input material. B. Analysis of collagen mRNAs in the IP by real time PCR. The amount of immunoprecipitated mRNAs is presented as the percentage of the amount in the input. The standard error of the mean bars are indicated. C. Preotein expression of endogenous RHA and transduced LARP6 from the input material. Loading control; actin (ACT).
To further determine if LARP6 is mediating the interaction of RHA with collagen mRNAs we knocked down LARP6 by siRNA in human lung fibroblasts (HLFs) using LARP6 specific siRNA, that was expressed from an adenovirus as shRNA [53]. Adenoviral delivery of
LARP6 shRNA reduced LARP6 protein expression to less than 50%, and did not affect RHA expression or tubulin expression (Fig. 5A, compare lanes 1 and 2). Using the LARP6 knockdown cells, we performed the pull down with antibodies against RHA and analyzed the
22 immunoprecipitation of collagen α1(I) and α2(I) mRNAs by radiolabeled RT-PCR. The amount of collagen mRNAs in the input was similar in cells expressing LARP6 shRNA and scrambled shRNA and is shown at the bottom of Fig. 5B. Fig. 5B, top panel, shows that the pull down of
RHA with both, collagen α1(I) and α2(I) mRNAs, was reduced when LARP6 was knocked down, compared to the cells expressing scrambled shRNA (Fig. 5B, compare lanes 1 and 2). The control immunopercipitation reaction with anti-fibronectin antibody was negative (Fig. 5B, lane
3) and actin mRNA was not immunoprecipitated with any antibody. To provide more quantitative assessment of the amount of collagen mRNAs in the immunoprecipitate we analyzed the samples by real time PCR (Fig. 5C). This analysis showed that knock-down of LARP6 decreased the fraction of collagen α1(I) mRNA associated with RHA 2-fold and that of α2(I) mRNA 2.5-fold. Thus, our data suggests that RHA binding to the type I collagen mRNAs may be LARP6 dependent.
To asses if overexpression of LARP6 could increase association of collagen mRNAs with
RHA, we used HEK293 cells, which express low levels of LARP6 [53]. These cells also express much less of collagen mRNAs. Nevertheless, RHA was able to pull down small amount of collagen α1(I) and α2(I) mRNAs (Fig. 5D, lane 2). However, when LARP6 was overexpressed in
HEK293 cells, more collagen mRNAs were found in complex with RHA (lane 1).
Overexpression of a RNA binding protein, RBMS3, as a control [95] with presence of minimal amount of endogenous LARP6, had no effect on the association of collagen mRNAs when pulled down with fibronectin (FIB) (compare lane 2 and lane 3). The input levels of collagen mRNAs are shown in the bottom panel of Fig. 5D. Real time PCR analysis of the collagen mRNAs in the immunoprecipitate verified that overexpression of LARP6 can increase the association of collagen mRNAs with RHA two-fold (Fig. 5E). The levels of the relevant proteins in the input
23 material are shown in Fig. 5F. These results further supported our hypothesis that LARP6 is involved in tethering RHA to collagen mRNAs.
Figure 5. Association of RHA with collagen mRNAs is LARP6 dependent. A. Knock-down of LARP6 in HLFs. HLFs were transduced with adenovirus expressing control shRNA (SC, lane 1) or LARP6 specific shRNA (LARP6, lane 2). Expression of endogenous RHA, LARP6 and tubulin was analyzed by Western blot. B. Knock-down of LARP6 decreases association of RHA with collagen mRNAs. Top panel; control shRNA (Sc, lanes 1 and 3) or LARP6 specific shRNA (LARP6, lane 2) were expressed in HLFs and IP was done with anti-RHA antibody (lanes 1 and 2) or anti-fibronectin antibody (lane 3). The IP samples were analyzed for pull down of collagen α1(I), collagen α2(I) and actin mRNA by radiolabeled RT-PCR. Bottom panel; analysis of mRNAs in the input material. C. Analysis of collagen mRNA in the IP by real time PCR. The data . Data presented as means and standard errors of the mean from 3 independent experiments. D. LARP6 enhances association of RHA with collagen mRNAs. HEK293 cells were transfected with LARP6 (lane 1) or control protein RBMS3 (lanes 2 and 3). IP was done with anti-RHA antibody and the IP material was analyzed by RT-PCR for presence of collagen α1(I) and collagen α2(I) mRNAs by radiolabeled RT-PCR. Bottom panel; analysis of mRNAs in the input material. E. Analysis of collagen mRNA in the IP by real time PCR. Error bars: ±1 standard error of the mean (SEM). F. Analysis of proteins in the input material. Endogenous RHA and loading control actin (ACT), HA blot with transfected LARP6 and RBMS3 (CON).
24
RHA is required for efficient synthesis of type I collagen
The interaction of RHA with LARP6 and collagen mRNAs suggests that there is a functional role of RHA in expression of type I collagen. To assess this role we knocked down
RHA by transfecting two RHA specific siRNAs and used scrambled siRNA as control (for sequences see Table 1) into HEK293 cells. HEK293 cells were used because they express low but detectable levels of type I collagen and can be efficiently transfected with siRNAs. By using a mixture of two RHA specific siRNAs its level was constantly reduced by ~80%, as presented by western blot (Fig. 6A, lane 2). The samples were then analyzed for expression of collagen
α1(I) polypeptide. Depletion of RHA resulted in several fold decrease in the collagen α1(I) polypeptide steady state level, while the control protein tubulin (TUB) was unaffected (Fig. 6A, compare lanes 1 and 2). Collagen α2(I) polypeptide could not be detected in HEK293 cells with the available antibodies. To verify that this phenotype was specific to the depletion of RHA, we rescued RHA expression by transfecting the cells with RHA construct that could not be targeted by the siRNAs used (RHA*). In cells where RHA was knocked down collagen α1(I) polypeptide was again greatly reduced (Fig. 6B, lane1). When RHA* was transfected into the RHA knock- down cells, the expression of RHA was restored to the level two fold higher than in control cells and collagen expression was rescued to the level seen in the control cells (Fig. 6B, compare lanes
2 and 3). Tubulin expression was not affected by any treatment. This indicates that the effect of
RHA knock-down on collagen expression is specific and that RHA is required to maintain high expression of type I collagen.
We also analyzed the expression of collagen mRNAs in RHA depleted cells as seen in the Fig. 6C. Real time RT-PCR showed no change in the steady state level of collagen α1(I) and
α2(I) mRNAs in the RHA knockdown samples compared to the scrambled (Sc) treated control
25 samples. The relative expression of collagen mRNAs was standardized to GAPDH. This result suggests that RHA regulates translation and not the stability of collagen mRNAs or transcription of collagen genes.
Figure 6. RHA is required for efficient synthesis of collagen protein. A. Knock-down of RHA decreases collagen expression. HEK293 cells were transfected with control siRNA (Sc, lane 1) or with two RHA specific siRNAs (RHA, lane 2) and the expression of RHA, collagen α1(I) polypeptide and tubulin was analyzed by Western blot. B. Rescue of collagen expression by siRNA resistant RHA gene (RHA*). RHA was knocked down by RHA specific siRNAs (RHA, lanes 1 and 2) or the cells were transfected with control siRNA (Sc, lane 3). siRNA resistant RHA construct (RHA*) was then transfected (lane 2) or the cells were untransfected (lanes 1 and 3). Collagen α1(I), RHA and tubulin expression was measured by Western blot. C. Knock-down of RHA does not affect expression of collagen mRNAs. Total RNA from experiment in A was analyzed for expression of collagen α1(I), collagen α2(I) and GAPDH mRNA by quantitative real time RT-PCR. Relative expression of collagen α1(I) and collagen α2(I) mRNAs was standardized by the internal control GAPDH. Error bars: ± 1 SEM.
Polysomal distribution of RHA
Experiments shown in Fig. 6 suggested that RHA may facilitate translation of collagen mRNAs. To assess in which step of translation of collagen mRNAs is RHA involved, we first analyzed if RHA is found on polysomes. We examined the distribution of RHA in polysomal fractions prepared from HEK293 cells by western blot. Fig. 7A, top panel, shows the OD260 profile of the sucrose fractions of HEK293 cells and the distribution of ribosomal RNA in the fractions is shown in the bottom panel. From this analysis we estimated that fractions 1-9
26 contained polysomes, fractions 10-14 contained ribosomal subunits and fractions 16 and17 were ribosome free cytosolic fractions. This overall polysomal profile did not significantly change when RHA was knocked down by siRNAs, suggesting that the overall distribution of polysomes was not greatly affected. Fig. 7B shows the knock-down of RHA protein in these experiments.
When RHA was analyzed in the polysomal fractions of HEK293 cells (Fig. 7C, top panel), it was found in fractions representing polysomes, but also in fractions 10-14, representing free ribosomes and ribosomal subunits, as well as in postpolysomal supernatant (fractions 16 and
17). LARP6 was analyzed in the same fractions and was found predominantly in the lightest fractions (14 and 15) and in postpolysomal supernatant (Fig. 7C, bottom panel). The long exposure of this western blot, as shown in Fig. 7C, indicates that only tracing amounts of LARP6 can be seen in polysomal fractions. Such distribution of LARP6 is consistent with its role in translation initiation but not elongation. Based on distribution of LARP6 and RHA in sucrose gradients, it is likely that LARP6 and RHA interact free in the cytosol and before formation of polysomes. This is further supported by the fact that RHA and LARP6 can also interact in nuclear extracts (Fig. 3D).
RHA is necessary for polysomal loading of collagen mRNAs
Since knock-down of RHA does not appear to dramatically change general formation of polysomes (Fig. 7A), we tested if RHA is specifically needed for formation of polysomes on collagen mRNAs. To test this, we knocked down RHA by siRNAs and compared the polysomal distribution of collagen mRNAs to that of control siRNA. As control, we analyzed the distribution of GAPDH mRNA. In control cells collagen α(I)1 (Fig. 7D, top panel) and α2(I) mRNAs (Fig. 7E, top panel) were found in the polysomal fractions (fractions 1-9). Compared to the amount found in the non-polysomal fractions, it appears that about 50% of these mRNAs
27 were actively translated. When RHA was knocked down collagen α1(I) and α2(I) mRNAs were not found on polysomes, except in fraction 9 representing the smallest polysomes, and accumulated in fractions containing ribosomal subunits (fractions 10-13, bottom panels in Fig.
7D and E). The polysomal loading of GAPDH mRNA was not affected by knock-down of RHA
(Fig. 7F). This clearly indicated that RHA is needed for efficient formation of polysomes on collagen mRNAs, suggesting that RHA is an essential and specific factor for translation of collagen mRNAs.
Figure 7. Collagen mRNAs are inefficiently translated in absence of RHA. A. Polysomal profile of HEK293 cells with and without RHA. Top panel; cells were transfected with RHA specific siRNA or control siRNA and polysomes fractionated on linear sucrose gradients (fraction 1, 45% sucrose, fraction 16, 15% sucrose, fraction 16 and 17, postpolysomal supernatant). Top panel; the OD260 of the fractions from cells transfected with siRNAs (RHA) [dotted line] and control siRNA(Sc) [full line] is shown. Bottom panel; distribution of ribosomal RNA in the fractions. Fractions containing polysomes are indicated. B. Knock-down of RHA by siRNA. Control siRNA (Sc, lane 1) and RHA specific siRNA (RHA, lane 2) were transfected into HEK293 cells and expression of RHA was analyzed by western blot. Lading control: tubulin (TUB). C. RHA distribution in polysomal fractions of HEK293 cells. Top panel; sucrose fractions as in A were probed for presence of RHA by Western blot. Bottom panel; the fractions were analyzed by Western blot for LARP6. D. Polysomal loading of collagen α1(I) mRNA is RHA dependent. Polysomes were fractionated from HEK293 cells transfected with control siRNAs (Sc, top panel) or RHA specific siRNA (RHA, bottom panel) and the fractions were analyzed for collagen α1(I) mRNA by radiolabeled RT-PCR. E. Polysomal loading of collagen α2(I) mRNA is RHA dependent. Same experiment as in C, except collagen α2(I) was analyzed. F. Knock-down of RHA does not affect polysomal loading of GAPDH mRNA. Same experiment as in C, except GAPDH mRNA was analyzed.
28
RHA stimulates collagen translation in the 5’ SL dependent manner
It was reported that RHA stimulates translation of mRNAs containing a PCE [50, 62, 63,
96]. We hypothesized that 5’ stem-loop may serve as the collagen mRNA specific PCE. To test if collagen’s 5’ UTR can confer translational regulation onto a heterologous mRNA, thus act as a
PCE, we created a series of reporter genes encoding luciferase protein (Fig. 8A). One reporter gene had the 5’ UTR of human collagen α1(I) mRNA with the intact 5’ stem-loop (5’SLWT-
LUC), while the other had collagen α1(I) 5’ UTR but the 5’ stem-loop was abolished
(5’SLMUT-LUC). Otherwise, these genes were identical and were driven by the same promoter.
The third construct had the 5’ UTR of luciferase and was driven by a different promoter [16, 35,
97], this gene (LUC) did not have any collagen sequences in the 5’ UTR. The constructs were transfected into HEK293 cells, which had either normal level of RHA (pre-transfected with scrambled siRNA) or had the RHA knocked down by RHA specific siRNAs. Fig. 8B shows the level of RHA in control and knocked down cells. The luciferase protein was then measured by a standard assay and normalized to the total protein in the extract. Luciferase mRNA was analyzed by real time RT-PCR using primers specific for the luciferase sequence and normalized to the endogenous GAPDH mRNA, measured in the same experiment. Thus, the expression of both, luciferase protein and luciferase mRNA, was normalized to the endogenous protein or mRNA and the ratio of LUCprot/LUCmRNA was plotted in Fig. 8C. The reporter mRNA with WT collagen
5’SL produced high level of luciferase protein, but when RHA was knocked down there was a threefold reduction in luciferase protein synthesis per mRNA (p=0.005 Fig. 8C). There was no significant difference in luciferase expression with or without RHA from the reporter mRNA with the 5’ SL mutated (p=0.605). Likewise, the reporter mRNA with no collagen sequences produced luciferase protein in RHA independent manner (p=0.547). This indicates that RHA
29 stimulates translation of a heterologous mRNA having collagen 5’ stem-loop and that the other sequences in the collagen 5’ UTR cannot substitute for the lack of the 5’ stem-loop.
Figure 8. Stimulation of translation by RHA depends on the presence of collagen 5’ SL. A. Schematic representation of the collagen/luciferase reporter genes. Promoters are shown as dotted line, collagen 5’ UTR as black line and luciferase sequence as gray line. The transcription start site is marked by an arrow and positions of the start and stop codons are indicated. B. Immunoblot showing knock-down of RHA by siRNA. C. Knock-down of RHA affects protein expression from the mRNA with 5’ SL. RHA specific siRNA (RHA, black bars) and control siRNA (Sc, open bars) were transfected into HEK293 cells, followed by transfection of the reporter genes. Expression of luciferase protein was measured as the enzymatic activity and was normalized to the total protein in the extract. Luciferase mRNA was measured by real time RT- PCR and was normalized to GAPDH mRNA. The ratio of luciferase protein to mRNA was plotted on y-axis. The results of five independent experiments with error bars of ± 1 SEM and the p-values are shown.
RHA is up-regulated during Hepatic Stellate Cells (HSCs) activation
HSCs are liver cells responsible for excessive collagen synthesis in fibrosis [12, 14, 98].
When isolated from normal rat livers, HSCs are quiescent and do not synthesize large amount of type I collagen. However, when cultured in vitro they spontaneously activate into myofibroblasts and upregulate collagen synthesis 50-100 fold [12, 98]. The activation starts at day 4 in culture
30 and is maximal by day 8 and collagen level gradually increases during this time period. Thus,
HSCs are excellent model to follow the changes in gene expression from collagen nonproducing to collagen producing cells. We used these cells to assess if there is a temporal association between the RHA expression and type I collagen expression.
HSC were isolated from rat’s livers and cultured in vitro [99]. The samples were collected at days 2, 4, 6, and 8 in culture and analyzed by western blot for collagen α1(I) and
RHA protein expression (Fig. 9A). As controls, we analyzed expression of tubulin, which does not change during activation, and expression of α-smooth muscle actin (αSMA), which is a marker of activation and expression of which gradually increases [100]. At day 2, when the cells are still quiescent, there was no detectable expression of RHA by western blot (Fig. 9A, lane 1).
However, more sensitive detection of RHA mRNA by RT-PCR showed low level of expression
(Fig. 9B, lane 1), suggesting that RHA is expressed, but at low levels. Collagen and αSMA were also not expressed at day 2 (Fig. 9A, lane 1). At day 4, RHA protein was clearly detected by western blot (lane 2), that correlated with the increased level of its mRNA (Fig. 8B, lane 2).
Type I collagen protein was still undetectable at this time point (Fig. 9A, lane 2), suggesting that upregulation of RHA precedes the onset of collagen expression. Expression of RHA slightly increases at day 6 and 8 that coincides with large increase in collagen synthesis and increase in expression of the marker of myofibroblasts, αSMA. These results indicate that, in the cells which undergo transformation from collagen nonproducing into collagen producing cells, RHA is temporally expressed before type I collagen and that later its levels closely parallel that of collagen. This is consistent with the role of RHA in high level of collagen synthesis.
31
Figure 9. Temporal expression of RHA and type I collagen in activation of HSCs. A. Temporal expression of RHA protein. HSCs were isolated from rat livers and plated into uncoated plastic dishes. The cells were cultured for the indicated time periods, collected and analyzed for expression of RHA, collagen α1(I), α-smooth muscle actin and tubulin by Western blot. B. Temporal expression of RHA mRNA. Experiment as in A, except total RNA was analyzed by radiolabeled RT-PCR for RHA and actin (ACT) mRNAs.
2.3 - Discussion
Previous studies described the role of RNA helicase A in transcription [62, 63, 101], mRNA processing [51, 66, 102, 103], and translation of viral and cellular mRNAs with highly structured
5’UTRs containing a PCE [50, 63]. This study describes the role of RHA in translation of collagen mRNAs, which have only one clearly defined structural element in the 5’UTR, the 5’SL
[33, 35, 45]. We showed that 1) RHA interacts with LARP6 and is tethered to the collagen mRNAs in vivo. 2) RHA is required for high collagen synthesis; knock-down of RHA results in poor loading of polysomes on collagen mRNAs. 3) The effects of RHA on translation of collagen mRNAs are mediated by the 5’SL. 4) Expression of RHA is co-regulated with the expression of type I collagen in cells which differentiate from collagen nonproducing into collagen producing cells. These results suggest that RHA is a critical factor for high level of synthesis of type I collagen.
Although it has been described that RHA can bind RNA [50, 96], we could not demonstrate high affinity of binding of RHA to 5’SL using gel mobility shift experiments. This does not exclude that RHA can interact with the 5’ SL with low affinity or with some other
32 sequence in collagen α1(I) and α2(I) mRNAs. However, since LARP6 and RHA interact in RNA independent manner (Fig. 3C), it is likely that RHA is tethered to collagen mRNAs by interaction with LARP6. LARP6 is the only protein which binds the 5’SL of collagen mRNAs with high affinity and it was proposed that it regulates translation [53]. Collagen α1(I) and α2(I) mRNAs are designed to be poorly translated, because in their 5’ UTR there are two short uORF and the start codon is buried within the 5’ stem-loop and not in the optimal sequence context for the initiation codon [33, 35, 36, 45]. The recruitment of RHA may be necessary to increase their translational competitiveness. This is best evidenced by the fact that knock-down of RHA results in poor formation of polysomes on collagen mRNAs (Fig. 7) and low cellular level of collagen protein (Fig. 6). We found that RHA is associated with polysomes in HEK293 cells (Fig. 7C) and a similar finding was reported before [104]. Knock-down of RHA does not significantly change the polysomal profile of HEK293 cells (Fig. 7F), so it is not likely that RHA is required for translation elongation of majority of mRNAs. Its association with polysomes suggests a role in translation elongation of a selected subset of mRNAs, possibly including collagen mRNAs.
Significant amounts of RHA were found associated with ribosomal subunits and in postpolysomal supernatant. LARP6 is also found predominately in the postpolysomal supernatant (Fig. 7C) [53], suggesting that LARP6 and RHA form a complex prior to translation initiation on collagen mRNAs. In this way RHA may unwind the 5’ stem-loop during the translation initiation phase and promote ribosomal recognition of the collagen main reading frame.
RHA is also found in the nucleus and can interact with LARP6 in the nucleus (Fig. 3D), again indicating that it may be recruited to collagen mRNAs at early stages of their metabolism.
33
Since LARP6 interacts with RHA in the absence of intact RNA (Fig. 3), it is probably tethered to the 5’ stem-loop of collagen mRNAs by interaction with LARP6. This tethering seems to be the key to high level of collagen synthesis, as evidenced by using reporter genes (Fig. 8). When 5’ stem-loop was introduced into a reporter gene, the high protein expression from this gene was observed when RHA was present and was 3-fold lower when RHA was knocked down. Two reporter mRNAs without the 5’ stem-loop were translated in RHA independent manner. This again suggests that RHA is not a general stimulator of translation and that it must associate with a particular mRNA to exert its effect. RHA and other RNA helicases, such as DDX3 and Ded1, complement RNA helicase eIF4A and, if recruited, can enhance translation of the specific mRNAs [65-67]. The PCE elements were proposed to tether RHA to some viral and cellular mRNAs [50], while our results indicate that 5’SL and LARP6 serve this function for collagen mRNAs.
In conditions of high collagen synthesis, like in wound healing or fibrosis, there is activation of quiescent fibroblasts and stellate cells, which produce low level of type I collagen, into myofibroblasts, which upregulate expression of type I collagen 50-100 fold [19, 33, 34, 45,
47, 105]. Cultivation of HSC in vitro mimics this process [12, 14] and enabled us to compare the temporal profile of RHA and collagen expression (Fig. 9). In activation of HSCs RHA is expressed at low levels in quiescent HSCs. Its expression was undetectable by western blot (Fig.
9A), but RT-PCR analysis showed low expression (Fig. 9B). During activation, an increase in
RHA expression is observed before an increase of type I collagen expression, consistent with hypothesis that RHA activity is a prerequisite for high collagen synthesis. Activation of HSCs is associated with dramatic up-regulation and down-regulation of many genes [12]. Although RHA is required for type I collagen synthesis, it is possible that during this process other mRNAs may
34 also require activity of RHA. However, so far only junD mRNAs was reported to require RHA for translation [50].
In conclusion, we have identified one of the key interactions necessary for high level of collagen synthesis, the interaction of LARP6 and RHA. This interaction is needed to tether RHA to the 5’UTR of collagen mRNAs, which have the 5’SL as the high affinity docking site of
LARP6. When tethered to collagen mRNAs, RHA may help in unwinding the secondary structures and assembly of the ribosomes competent for translational elongation of the main reading frame. This is the first description of the role of RHA in synthesis of extracellular matrix proteins and may have profound implications for future development of antifibrotic drugs.
Figure 10. RHA is required for high level of type I collagen synthesis. A hypothetical model by which RHA may help unwinding the 5’SL of collagen mRNAs in hepatic stellate cells. In quiescent cells (top figure) RHA is expressed at low level and LARP6/5’SL complex is masking the start codon, resulting in inefficient translation initiation. Both ribosomal subunits (40S and 60s) are stalling and cannot join to form the 80S active unit. Bottom figure: activated hepatic stellate cells have increased levels of RHA that is tethered to the collagen 5’SL by LARP6. RHA melts the secondary structure of 5’SL and dissociates LARP6 to allow ribosomal access to the start codon and initiation of collagen synthesis. 35
2.4 - Materials and Methods
Plasmid and adenovirus construction
Full size LARP6 was cloned into pCDNA3 vector (Stratagene) with HA-tag at the N-terminus.
Deletion mutants were constructed using conventional restriction enzyme HindIII (ΔC/RRM), and XcmI (ΔC) [53], and by cloning of the PCR amplified C-terminal region. The identity of mutants was confirmed by western blot and sequencing.
Adenoviruses were constructed by re-cloning the constructs into pAdCMV-TRACK vector, followed by recombination with pAd-Easy vector, as described [106]. All adenoviruses also expressed GFP from a separate transcription unit to monitor transduction efficiency.
Adenoviruses were amplified and purified as described [106].
Luciferase reporter gene containing 5’UTR of mouse collagen α1 (I) gene (5’SLWT-LUC) was constructed by cloning 220nt of the promoter of mouse collagen α1 (I) gene together with the complete 5’UTR sequence and 5’ stem-loop into the Basic Luciferase vector (Promega).
Reporter gene with the mutated 5’ stem-loop (5’SLMUT-LUC) was made from the above construct by mutating sequences involved in formation of the 5’SL. The reporter gene containing no collagen 5’UTR was described before [16, 97]. It was driven by a hybrid promoter consisting of upstream collagen promoter and proximal SV40 promoter, followed by the luciferase open reading frame of the Basic Lucifirase vector (Promega) with 6000 nts of mouse collagen α1 (I) promoter.
Cells and Transfections
Human lung fibroblast (HLFs), hepatic stellate cells (HSC) and HEK 293 cells were grown under the standard conditions [107]. HEK293 cells and human fibroblasts were transfected with
1 μg of plasmid per 35mm culture dish using 293TransIT reagent (Mirus). The cells were
36 harvested 48 to 72 hours after the transfection. SiRNAs were transfected using Lipofectamine
2000 reagent (Invitrogen) at the final concentration of 125 nM per 100,000 cells. The sequence of siRNA is shown in Table 1. Adenoviruses were used as M0I of 500 which resulted in >95% transfection of HLFs [53].
HSCs were purified by perfusing rat livers with 0.5 mg of pronase and 0.04 mg of collagenase per gram of animal weight and centrifugation of the cell suspension over 20% nykodenz gradient
[99]. The purity of the cells was assessed by immunostaining with anti-desmin antibody. The cells were cultured on uncoated plastic dishes in DMEM with 10% FCS for the indicated time periods.
RT-PCR analysis:
Total RNA was isolated using RNA isolation kit (Sigma-Aldrich). The RNA was treated with
DNaseI to remove contaminating DNA and analyzed by two RT-PCR techniques. RT-PCR with radiolabeling of the PCR products was done as previously described [35, 53, 58, 95]. Briefly,
50ng of total RNA was reverse transcribed using rTth reverse transcriptase (Boca Scientific) and the primer specific for the mRNA under analysis. The PCR reactions were performed in the presence of α32P-dATP. PCR products were visualized by autoradiography. The identity of the
PCR bands was verified by sequencing and by their expected size.
Quantitative real time RT-PCR analysis:
Total RNA was isolated using RNA isolation kit (Sigma-Aldrich). The RNA was treated with
DNaseI to remove contaminating DNA. The cDNA for the quantitative real time polymerase chain reaction (qRT-PCR) was synthesized using SuperScript II RT (Invitrogen) following manufactures protocol. Five percent of the cDNA was used in qRT-PCR (BioRad-IQ5
Thermocycler) using specific primers with the sequences shown in Table 1. The qRT-PCR was
37 performed in triplicates of each RNA immunoprecipitation experiment. The threshold cycle (CT) was computed using IQ-5 software (BioRad) with standard curves constructed for each primer set with a stepwise dilution of input DNA with an efficiency of 100% (±15%). The analysis of the dissociation curve was performed at the end of 40 cycles. The enrichment values presented were acquired by the data calculated as percent input of IP-RNA as a percent of total immunopercipitated RNA to input fraction (Fig. 4B, and 5B, D). The total collagen mRNA (Fig.
7C) and the luciferase mRNA expression (Fig. 8C) was standardized to the GAPDH and the negative control (empty vector). The equation for the determination of error propagation
(Standard Error) for normalized expression and the graphics were computed using biostatistics comprehensive program GraphPad Prism 3.02. The statistical data was analyzed on Microsoft
Excel and GraphPad Prism 3.02. Values are obtain of three independent experiments ± standard error of the mean. One-way ANOVA followed by a Turkey’s multiple comparison test p<0.05 was used to determine significance of enrichment. P-values in Fig. 9C were determined by the
Student’s t-test.
Western blotting:
Cytosolic proteins were prepared by lysis in isotonic buffer containing 0.5% NP-40. The protein concentration was estimated using Bradford assay. The following antibodies were used: anti- collagen α1(I) polypeptide antibody from Rockland, anti-collagen α2 (I) polypeptide antibody from Santa Cruz Biotechnology, anti-fibronectin antibody from BD Transduction Laboratories, anti-tubulin antibody from Cell Signaling, anti-Larp6 antibody from Abnova, anti-RHA antibody from Abcam and anti-HA and anti-FLAG antibodies from Sigma.
Cytosolic cell extracts were prepared in isotonic buffer (140 mM NaCl, 1.5 mM MgCl2, 10 mM
Tris-HCl pH 7.6, 0.5% NP-40,) and after removal of the nuclei by centrifugation the supernatant
38 was used as cytosolic extract. The nuclei pellet was washed 3 times in the same lysis buffer and nuclear extracts were prepared as described by Dignam et al[108].
Biotin-RNA pull down:
For identification of 5’SL RNA interacting proteins, biotinylated 5’SL RNA or inverted 5’SL
RNA (CON) were incubated in cytosolyc extracts prepared from 3x107 human lung fibroblasts and pulled down with streptavidin agarose. After washing 5 times with PBS the pull down material was analyzed by SDS-PAGE and Coomassie staining. Proteins specifically pulled down with 5’SL RNA were excised from the gel and identified by MALDI-TOF (FSU) or LC/MS/MS
(Tufts University Core Facility).
Immunoprecipitation (IP):
Cells were lysed as for western blots and the nuclei were removed by centrifugation. Lysate containing 1mg of total protein was incubated with 1μg of the antibody for 1 hour at 4oC. 20 μL of equilibrated protein A/G beads (Santa Cruz Biotechnology) was added to the samples and incubated for 4 hours at 4oC. The beads were washed three times with PBS supplemented with
0.5% NP-40 and the samples were analyzed by western blotting or by RT-PCR when coprecipitation of collagen mRNAs was analyzed. In some experiment the lysate was treated with 1µg of RNase A prior to the IP.
Fractionation of polysomes:
Cells were treated with cycloheximide for 1 hour to stabilize the polysomes prior to harvesting.
Cell lysates were prepared from 3x107 cells, as described for immunoprecipitation. The lysate was laid on the top of a linear 15-45% sucrose gradient and centrifuged for 2h at 38 000 g at 4oC
[53, 109]. 500μL fractions were collected and OD260 of the fractions were measured. Total RNA was extracted from the fractions by phenol/chlorophorm followed by isopropanol precipitation.
39
The RNA was analyzed on 1% agarose gel to determine the distribution of ribosomal RNA and expression of collagen mRNAs and GAPDH mRNA in the fractions was estimated by RT-PCR.
Proteins were extracted from the fractions by precipitation with 6.5% TCA and 0.05%DOC, the protein pellets were dissolved in 0.1% SDS, 10mM Tris pH 6.8 and analyzed by western blot.
Gel Mobility Assay
RNA probe described in [53] was prepared by in-vitro transcription form the template cloned the pGEM3 vector (Promega). The mobility shift assay was done using 4 ng of labeled 5’SL RNA and 20 µg (total protein) of cytosolic extracts of cells transfected with various constructs by standard laboratory protocol as described [53]. The input of transfected proteins (Fig. 2B) were estimated by the Western blot. Quantification of the intensity of bands was done using phosphoimager.
Luciferase Assay
Lucifarese reporter constructs were transfected into HEK293 cells and luciferase activity was measured by the standard assay two days after transfection [16, 110]. The activity was normalized to total protein in the extract, as loading control. Lucefirase mRNA was analyzed by real time RT-PCR using primers specific for luciferase sequence (Table 1). The mRNA expression was normalized to the expression of GAPDH, as loading control. The normalized activity of luciferase protein was divided to the normalized expression of luciferase mRNA and the ratio is shown as arbitrary units on y-axis. The results plotted were from three independent experiments. One way ANOVE followed by student’s t-test was used to assess the statistical significance. The statistical significance was set at p<0.05 and the error bars represent ± 1 SD.
40
Statistical Analysis:
The equation for the determination of Standard Error was computed using biostatistics program
GraphPad Prism 3.0 or Microsoft Excel. The statistical significance between groups for the in- vivo study was determined by analysis of variance (ANOVA). Type I error (α) and type II error
(β) were set at 0.05 and 0.01 respectively.
Table 1
Primers used for RT-PCR and sequence of siRNAs in RHA study
h-collagen α1(I) (122 nt) F: TGAGCCAGCAGATCGAGAAC
R: TGATGGCATCCAGGTTGCAG
h-collagen α2(I) (160 nt) F: CAGCAGGAGGTTTCGGCTAA
R: CAACAAAGTCCGCGTATCCA
h-collagen α1(III) (120 nt) F: ATCTTGGTCAGTCCTATGCGG
R: GCAGTCTAATTCTTGATCGTCA
h-fibronectin (220 nt) F: ACCAACCTACGGATGACTCG
R: GCTCATCATCTGGCCATTTT
h-GAPDH (74 nt) F: ACCGGTTCCAGTAGGTACTG
R: CTCACCGTCACTACCGTACC
h-actin (213 nt) F: GTGCGTGACATTAAGGAGAAG
R: GAAGGTAGTTTCGTGGATGCC
Luciferase F: CCAGGGATTTCAGTCGATGT
R: AATCTCACGCAGGCAGTTCT
Larp6 siRNA (D2) 5′-UCCAACUCGTCCACGTCCU
RHA siRNA 1 5’ - GGCUAUAUCCAUCGAAAUU
RHA siRNA 2 5’ - CCAAAGUUCAGCUCAAAGA
Sc (Non-targeting) siRNA D-001210-01-05 (Dharmacon)
F, forward primer, R, reverse primer. The length of the expected PCR product in nucleotides (nts) is indicated in parentheses.
41
CHAPTER THREE
A CRITICAL ROLE OF IMMUNOPHILIN FKBP3 IN TYPE I
COLLAGEN SYNTHESIS
3.1 - Introduction
FK509 binding proteins (FKBPs) are poorly categorized, and their biological importance is not fully understood. The small immunophilin FKBP3 of 25 kDa (known also as FKBP25) is a peptidylprolyl cis-trans isomarase and is present in the cytosol and in the nucleus [70]. Prolyl isomerization is a step involved in protein folding defined as the cis to trans isomerisation of the peptide bond of amino acid proline [111]. FKBP3’s crystal structure has been solved, but its physiological role is still not well understood [71]. Its association with nucleolin suggests that it may be involved in ribosome biogenesis [70]. At its N-terminal region FKBP3 has a helix-loop- helix motif and is capable of binding DNA and it also associates with transcription factors, suggesting a role in transcription regulation [112]. Studies on tumor suppressor p53 showed that
FKBP3 stimulates auto-ubiquitylation and the MDM2 mediated degradation of p53 [71]. The C- terminal region of FKPB3 is a well-conserved among all family members of the FKBPs and is responsible for binding immunosuppressive drugs, with particularly high affinity to FK506
(Tacrolimus) and Rapamycin [73].
In search for other interacting partners of LARP6, we discovered that FKBP3 interacts with LARP6 in a yeast-two-hybrid screen. There are no previous reports of the involvement of any FKBPs in collagen synthesis. The discovery that FKBP3 interacts with LARP6 raised an interesting possibility that it is involved in collagen biosynthesis and that some immunosuppressant drugs may also have antifibrotic activity, unrelated to the immune response.
42
The findings described below indicate that the interaction of FKBP3 with LARP6 has an essential role in regulating translation of collagen mRNAs.
3.2 - Results
FKBP3 is upregulated during Hepatic Stellate Cells activation
To test if FKBP3 may have implications in hepatic fibrosis we examined its expression during HSCs activation. HSCs are liver cells responsible for excessive collagen synthesis in fibrosis [12, 113]. When isolated from normal rat livers, HSCs are quiescent and do not synthesize large amount of type I collagen. However, when cultured in vitro they spontaneously activate into myofibroblasts and up-regulate collagen synthesis 50-100 fold [2, 33, 35, 45]. The activation starts at day 4 in culture and is maximal by day 6-8. We used these cells to assess if there is a temporal association between the onset of FKBP3 expression and type I collagen expression. The samples were collected at days 2, 4 and 6 and analyzed for collagen α1(I),
αSMA and FKBP3 expression by Western blot (Fig.11). At day 2, when the cells are still quiescent, there is low but detectable expression of FKBP3 and αSMA, but type I collagen could not be detected. At day 4, FKBP3 becomes highly up-regulated and this precedes the increase in collagen expression, which takes place at day 6. This is consistent with the hypothesis that
FKBP3 is needed for high collagen expression. αSMA is a marker of differentiation of HSCs into myofibroblasts and its expression increases as activation of HSCs progresses. We were not able to analyze LARP6 expression in HSCs, as there are no antibodies available that recognize rodent LARP6.
43
1 2 3 FKBP3
COL1α1
αSMA TUB Days: 2 4 6
Figure 11. Expression of FKBP3 and type I collagen in activation of stellate cells. HSCs were isolated from rat livers and plated into uncoated plastic dishes. The cells were collected after the indicated time periods and analyzed for expression of FKBP3, collagen α1(I), α-smooth muscle actin and tubulin by Western blot.
LARP6 and FKBP3 interact in vitro
Identification of FKBP3 in a yeast two-hybrid screen suggested its direct interaction with
LARP6. To verify that FKPB3 interacts with LARP6 in the mammalian cells, we transfected
HEK293 cells with Flag-FKBP3 and the LARP6 constructs shown in Fig. 3A, as well as with an unrelated control protein RBMS3 [95], and performed immunoprecipitations. FKBP3 interacted only with the full size LARP6 but not with the other constructs (Fig. 12C). The experiments in
Fig. 12C were done with over-expressed proteins, so we wanted to verify the interaction between the endogenous proteins in human lung fibroblast (hLFs, cells responsible for lung fibrosis). In addition, we also wanted to determine if the interaction is nuclear or cytoplasmic, since FKBP3 and LARP6 are present in both sub-compartments (Fig. 12A). In line with this, we fractionated the cells into cytosolic and nuclear fractions. The fractions were analyzed by immunoprecipitatation (IP) using antibody against the endogenous LARP6, while anti- fibronectin antibody was used as a negative control. Immunoprecipitation of LARP6 was able to pull down endogenous FKBP3, but only in the cytosolic fraction (Fig. 12A, top panel). The interaction could not be reproduced in the nuclear fraction. To make sure that there was no cross- contamination of the fractions we analyzed for tubulin, as the predominantly cytosolic protein 44
(Fig. 12A, bottom panel). Tubulin was found only in the cytosolic extract, verifying that our fractionation was clean. The predominantly cytosolic binding of LARP6 to FKBP3 is in contrast to the nuclear association between LARP6 and RHA.
The discovery of FKBP3/LARP6 interaction by yeast two hybrid screen suggested that this interaction does not require the presence of collagen mRNAs. To further characterize the interaction of FKBP3 and LARP6, we tested if FKBP3 can bind LARP6 while LARP6 is bound to the 5’SL of collagen mRNAs or only when it is present in the unbound state. To test for the
RNA dependent binding we performed a gel mobility shift assay using 5’SL RNA as a probe.
We co-expressed LARP6 and FKBP3 and analyzed the cell extract for formation of a ternary,
LARP6/FKBP3/5’SL complex. The gel mobility shift is a rigorous assay, as only the stable
RNA/protein complexes can withstand gel electrophoresis process. In gel shift experiment we were not able to detect FKBP3 in the complex with 5’SL and LARP6. This indicated that either
FKBP3 is not recruited to the 5’SL or that the interaction is weak and that FKBP3 dissociates from the complex during electrophoresis. To further test if the interaction between LARP6 and
FKBP3 is RNA independent, we performed pull down experiments with and without treatment of the cellular extracts with RNase A. RNase A treatment degrades all RNA in the extract and the pull down of two proteins is therefore RNA independent (Fig. 12B). FKBP3 interacted with
LARP6 equally well, regardless if the RNA was degraded or not (Fig. 12B, top panel). Analysis of the input material by western blot showed that RNase A treatment did not affect expression of
LARP6 and FKBP3 (Fig. 12B, bottom panel). This verified the RNA independent interaction between these two proteins and suggested that FKBP3 can bind free LARP6. This binding can protect LARP6 from degradation or prevent its re-association with collagen mRNAs after the translation has initiated.
45
To map the domain of LARP6 needed for interaction with FKBP3 we over-expressed various LARP6 mutants (Fig. 12C) and performed immunoprecipitations. LARP6 has four major domains identified as the N-terminal domain with unknown function, the La domain that is homologous in all LARPs, the RNA recognition motif (RRM) and the C-terminal domain. The
La domain and the RRM are necessary for binding 5’SL and the La domain is also needed for interaction of LARP6 with vimentin filaments. The binding to vimentin filaments stabilizes collagen mRNAs [58]. The C-terminal domain is a coiled-coil and is utilized as a protein- docking site, as it interacts with multiple proteins, like non-muscle myosin, RHA and STRAP
[54, 84]. The requirement of La and RRM for binding 5’SL has been demonstrated before and here we were interested to identify the FKBP3 binding domain. However, only the full size
LARP6 was able to pull down FKBP3 (Fig. 12C). This indicated that either all domains of
LARP6 participate in binding of FKBP3, or that a specific confirmation of LARP6 that can be attained only in the full size protein exposes an epitope needed for FKBP3 recognition. At the present we cannot distinguish between these possibilities.
46
Figure 12. Interaction of FKBP3 and LARP6. A. Top panel; interaction of LARP6 and FKBP3 in the cytosolic extract. hLF were fractionated into cytosolic (CYTO) and nuclear (NUC) extract. The extracts were used for IP with anti-LARP6 antibody, followed by Western blot with anti-FKBP3 antibody. Negative control, anti-fibronectin antibody (FIBRO). Bottom panel; analysis of the proteins in the input material. B. Intact RNA is not required for the LARP6/FKBP3 interaction. Top panel; IP of LARP6 with FKBP3 after digestion of the samples with RNase A (+) or without RNase A digestion (-). Bottom panel; expression of proteins in the input material. C. Schematic representation of LARP6 constructs used in immunoprecipitations (IP). All constructs had HA-tag at the N-terminus. FS, full size LARP6 with the domains indicated. The ability of constructs to bind 5’ SL RNA and to interact with FKBP3 is indicated.
FKBP3 is excluded from polysomes and interacts with LARP6 in postpolysomal supernatant.
To assess if the FKBP3/LARP6 interaction is related to translation we tested the polysomal distribution of each protein by fractionation of polysomes on sucrose gradients, as described in chapter 2 (Fig. 7). From OD260 of the fractions we estimated that fractions 1-9
47 contained polysomes, fractions 10-17 contained ribosomal subunits and fractions 18 and19 were ribosome free postpolysomal supernatant. When FKBP3 was analyzed by Western blot in these fractions (Fig. 13A, top panel), it was found only in fractions representing free ribosomes, ribosomal subunits and postpolysomal supernatant (PS). LARP6 was analyzed in the same fractions and was found predominantly in the postpolysomal supernatant (Fig. 13A, bottom panel). Such distribution of LARP6 is consistent with its role in translation initiation but not elongation. Based on distribution of LARP6 and FKBP3 in sucrose gradients, it is likely that
LARP6 and FKBP3 interact free in the cytosol and independent on formation of polysomes. To directly test this, we pooled fractions 18-19, as the postpolysomal supernatant (PS), and pooled 3 ribosomal fractions (fractions 15-17) and used them for co-immunoprecipitations of LARP6 and
FKBP3. FKBP3 interacted with LARP6 only in the pooled PS fractions (Fig. 13B), further supporting the notion that LARP6 and FKBP3 interact when the proteins are free in the cytosol.
Figure 13. FKBP3 distribution in polysomal fractions of hLF cells. A. Sucrose fractions were probed for presence of FKBP3 and LARP6 by Western blot. The fractions representing polysomes, ribosomal subunits and postpolysomal supernatant (PS) are indicated. B. Post- polysomal supernatant (PS, fractions 18-19) and ribosomal fractions (RS, fractions 15-17) were used for immunoprecipitation with anti-LARP6 antibody or anti-fibronectin antibody (FIBRO), as negative control, and analyzed for pull down of FKBP3 by Western blot. Levels of LARP6 and FKBP3 in the input material is shown in the bottom panel.
FKBP3 stimulates synthesis of type I collagen by stabilizing LARP6
To gain insight how FKBP3 regulates collagens synthesis we knocked down FKBP3 in hLFs using siRNAs. This approach resulted in almost complete knock-down of FKBP3 in these
48 cells (Fig. 14A, left panel). To ensure that the knockdown was specific for FKBP3 we rescued the FKBP3 expression by transfecting the cells with FKBP3 construct that could not be targeted by the siRNAs used (FKBP3*). Then, we analyzed collagen expression in the knock-down and in rescued cells. Since type I collagen is secreted into the extracellular matrix, we analyzed the cell medium as a read-out of collagen synthesis. The FKBP3 knock-down reduced its expression to <20% of the normal levels (Fig. 14A, left panel) and the accumulation of collagen α1(I) polypeptide in the cellular medium by about 10 fold (Fig. 14A, right panel). Even more dramatic was the effect on the secretion of α2(I) polypeptide, it was almost completely absent from the medium. There was no effect of FKBP3 on secretion of fibronectin, suggesting that the general secretion machinery was not impaired. The co-transfection of FKBP3* was able to completely rescue the secretion of both collagen polypeptides. The control siRNA (Sc) had no effect, suggesting that the observed dramatic changes in collagen production were due to the lack of
FKBP3. The cellular level of collagen α2(I) and α1(I) polypeptides were also greatly reduced
(Fig. 14A, left top two panels). Even more intriguing was the finding that the steady state level of
LARP6 protein was reduced by 10 fold in the absence of FKBP3 (Fig. 14A, left panel). It was rescued to the normal levels by introducing FKBP3*, indicating that stabilization of LARP6 is a specific activity of FKBP3. The level of LARP6 mRNA was not changed with knockdown of
FKBP3 (Fig. 14B). This suggested that FKBP3 may indirectly control collagen synthesis by modulating the steady state level of LARP6 protein. Being a chaperone, we surmised that
FKBP3 prevents degradation of LARP6.
Since LARP6 is involved in translation of collagen mRNAs we also wanted to assess if knock-down of FKBP3 affected the expression collagen α1(I) and α2(I) mRNAs. Knock-down of FKBP3 did not change the expression of collagen mRNAs (Fig. 14B), although it dramatically
49 decreased the amount of collagen polypeptides. This is consistent with the hypothesis that
FKBP3 is involved in stimulating translation of collagen mRNAs by regulating the availability of LARP6.
Figure 14. FKBP3 regulates synthesis of collagen polypeptides by controlling steady state level of LARP6. A. Knock-down of FKBP3 decreases collagen expression. hLF were transfected with control siRNA (Sc) or with two FKBP3 specific siRNAs (FKBP3) or by FKBP3 siRNAs and the siRNA resistant FLAG-FKBP3 gene (FKBP3*). The expression of FKBP3, collagen α1(I), collagen α2(I), LARP6 and actin was analyzed by Western blot in cellular extracts (left panel). Collagen α1(I) and α2(I) polypeptides and fibronectin (loading control) were also analyzed in cellular medium (right panel). B. Knock-down of FKBP3 does not affect expression of collagen α1(I), α2(I) and LARP6 mRNAs. Total RNA from experiment in A was analyzed for expression of COL1A1, COL1A2, LARP6 and GAPDH mRNA by semi quantitative RT-PCR.
50
To analyze the effect of FKBP3 on LARP6 expression by an independent assay and to assess its subcellular distribution we employed immunostainig technique. This technique also allowed us to verify co-localization of LARP6 and FKBP3 using confocal imaging. LARP6 was stained with antibody coupled to Cy-2 (green) and FKBP3 with antibody coupled to Cy-5 (red), while cell nuclei are shown in blue (DAPI) (Fig. 15A-D). In the control cells LARP6 was predominantly cytoplasmic, with weak nuclear staining, while FKBP3 was equally stained in the cytoplasm and in the nucleus. Both proteins were distributed homogenously through the almost entire cytosol and showed a great degree of co-localization (yellow). Because of their uniform distribution throughout the cytoplasm, it was difficult to discern if this co-localization is random or represents specific protein-protein interactions. When FKBP3 was knocked down with siRNA the immunostaining of FKBP3 disappeared and immunostaining of LARP6 was greatly reduced, indicating that knock-down of FKBP3 results in decreased levels of LARP6 in the cells (Fig.
15A-D). This is in excellent agreement with the results of Western blots (Fig. 14A). The intensity of nuclear staining by DAPI showed no difference, meaning that the loss of signal was not due to a staining artifact. Since small amounts of LARP6 still persisted after knocking down
FKBP3, we estimated that LARP6 remained predominantly cytosolic, suggesting no change in its subcellular distribution, just reduction in the amount. This analysis further proved that the
FKBP3 can regulate LARP6 levels in the cell.
51
Figure 15. FKBP3 knock-down results in degradation of LARP6 in hLF cells. Immunostaining of control cells treated with sc siRNA (A-D) and cells treated with FKBP3 siRNA (E-H). LARP6, green, FKBP3, red, nuclei, blue.
52
FKBP3 stimulates collagen translation in the 5’ SL dependent manner.
To test if the interaction of FKBP3 with LARP6 regulates translation in the 5’SL dependent manner we engineered a series of reporter genes. These genes encode for luciferase protein but their 5’ UTR is derived from the human collagen α1(I) gene. The control reporter gene has wt 5’ UTR with wt 5’SL and in the test reporter gene we have mutated the 5’SL. This mutation completely disrupted the 5’SL and abolished binding of LARP6 (Fig. 16B). The constructs were co-transfected into hLFs with the β-Gal gene, which served to normalize for transfection efficiency. These experiments were conducted in the presence of endogenous
FKBP3, in the cells in which FKBP3 was knocked down by siRNA and in the cells in which the
FKBP3 knock-down was rescued by FKBP3* (FKBP3 siRNA +FKBP3*). The lysates were analyzed for LARP6, FKBP3 and actin (ACT) expression by western blot and luciferase expression was analyzed by measuring its enzymatic activity (Fig. 16A and C). The knock-down of FKBP3 reduced FKBP3 expression to 20% of control; this was associated with decreased expression of LARP6 (Fig. 16A) and with four fold reduced luciferase activity (p<0.001), but only when luciferase was encoded by the mRNA with the 5’ SL (Fig. 16C). There was no significant difference in the luciferase activity with or without FKBP3 when the protein was encoded by the mRNA without 5’ SL. Re-introducing the FKBP3 into the FKBP3 knock-down cells rescued the luciferase expression from the 5’SL reporter and had no effect on expression from the mutant reporter. This indicates that FKBP3 stimulates LARP6 dependent expression of a heterologous mRNA having the collagen 5’ stem-loop. Since the mutant reporter did not respond to the FKBP3 knock-down and it contained the collagen 5’UTR, but without 5’SL, the other sequences in the 5’ UTR cannot substitute for the lack of the 5’SL.
53
Figure 16. Stimulation of translation by FKBP3 depends on 5’ SL and LARP6. A. Knock-down of FKBP3 and LARP6. Western blot of cells transfected with FKBP3 specific siRNAs (FKBP3), control siRNA (Sc) and FKBP3 specific siRNAs plus the FKBP3* rescue plasmid (RESCUE). B. Schematic representation of the collagen/luciferase reporter genes. Promoters are shown as dotted line, collagen 5’ UTR as black line and luciferase sequence as gray line. The transcription start site is marked by an arrow and positions of the start and stop codons are indicated. C. Knock-down of FKBP3 decreases luciferase expression from the mRNA with 5’ SL. FKBP3 specific siRNA (FKBP3, white bars), control siRNA (Sc, black bars) and FKBP3 specific siRNAs plus the FKBP3* rescue plasmid (RESCUE, grey bars) were transfected into hLF cells, followed by transfection of the reporter genes. Expression of luciferase protein was measured as the enzymatic activity and was normalized to the co-transfected β-Gal plasmid. The results of three independent experiments with error bars of ± 1 SEM are shown. (*) p<0.01.
To assess if FKBP3 stabilizes LARP6 by changing posttranslational modifications of
LARP6 we knocked-down FKBP3 and checked for LARP6 modifications by 2D SDS-PAGE.
To be able to detect LARP6 on a 2D gel, we transfected HA-LARP6 construct into hLF. In the first dimension LARP6 was separated by its isoelectric point on pH gradient from 3 to 10. The isoelectric point of unmodified LARP6 is 7.2 and addition of each phosphate shifts its isoelectric point by 0.1-0.2 pH units towards the acidic region. [114-117]. In hLF LARP6 was resolved as 5 dots, representing non-phosphorylated LARP6 (arrow in Fig. 17) and LARP6 molecules 54 containing up to 4 phosphates. When FKBP3 was knocked down, there was a slight change in the phosphorylation pattern of LARP6, the molecular species representing mono- phosphorylation of LARP6 became more abundant and the relative abundance of non- phosphorylated LARP6 decreased. This indicates that in the absence of FKBP3 some kinase increased single phosphorylation of LARP6. How is this change related to increased stability of
LARP6 remains to be elucidated.
Figure 17 indicates that LARP6 is phosphorylated at 5 serines and/or threonines, so we wanted to know if the phosphorylation of LARP6 is required for its interaction with FKBP3.
Dephosphorylation of the cell extract with calf intestinal alkaline phosphatase (CIP) abolished the interaction of FKBP3 and LARP6. It did not change the level of FKBP3, suggesting that phosphorylation of either LARP6 or FKBP3 is needed for their interaction. CIP treatment is not specific and may also have altered other proteins that may stabilize the LARP6 and FKBP3 interaction.
Figure 17. FKBP3 causes LARP6 modifications. 2D gel analysis of LARP6 using a isoelectric focusing strip with pH 3-10. Arrows indicate isometric point (I.P.) of non-modified LARP6. FKBP3 siRNA (bottom panel), Sc siRNA (top panel). (*) indicate the I.P. change caused by a sample phosphorylation.
FKBP3 stimulates proteasome dependent degradation of LARP6
In the previous chapter we postulated that binding of FKBP3 protects LARP6 from degradation. To elaborate of this hypothesis we assessed if LARP6 degradation is mediated by
55 ubiquitin protaesomal pathway (Fig. 18A). To test that, knocked-down FKBP3 in hLFs and after
24 hours from the knock-down we exposed the cells to MG132, a reversible proteasome inhibitor. After treatment, the cells were analyzed by immunoblotting for expression of endogenous LARP6, actin (ACT) and FKBP3. In cells without MG132, the knock-down of
FKBP3 reduced its expression to undetectable levels and reduced LARP6 expression 10-fold
(Fig. 18A, compare lanes 1 and 3). Inhibiting proteasome with MG132 did not increase the level of LARP6 in FKBP3 containing cells (compare lanes 3 and 4). However, proteasome inhibition increased LARP6 expression in the FKBP3 knock-down cells to the normal levels (Fig. 18A, lanes 1 and 2). This suggested that in the absence of FKBP3 LARP6 is subjected to accelerated degradation by the proteasome.
To further corroborate this, the cells were treated with a more potent and irreversible proteasome inhibitor lactacystin and to show the existence of the polyubiquitinated LARP6 the cells were also treated with RP-619, an inhibitor of ubiquitin isopeptidases. This combination inhibits the proteasome and protects the ubiquitinated protein from degradation, allowing its accumulation (Fig. 18B). Again, knock-down of FKBP3 reduced the level of endogenous
LARP6 (Fig. 18B, lanes 2 and 4). However, in the presence of both inhibitors, higher molecular weight LARP6 isoforms were detected, presumably representing ubiquitinated forms of the protein and the total level of LARP6 was greatly increased (Fig. 18B lanes 1 and 3). This experiment supported the notion that LARP6 is degraded by ubiquitin-proteasome pathway and that FKBP3 can protect it from the degradation.
56
Figure 18. Proteasomal degradation of LARP6. A. Rescue of LARP6 expression in FKBP3 deficient cells by inhibiting proteosome. hLF cells were transfected by FKBP3 siRNA (FKBP3, lanes 1 and 2) or Sc siRNA (CON, lanes 3 and 4) and treated with 100 µM MG132 (+, lanes 2 and 4) or DMSO (-, lanes 1 and 3). Protein levels were analyzed by immunoblotting. B. Same as in A, but the cells were treated with lactacystin and Ub1 isopeptydase inhibitor PR-619.
3.3 - Discussion
Previous studies from our laboratory suggested that LARP6 is a critical factor in collagen synthesis and that it is the only factor which directly binds 5’SL of collagen mRNAs. LARP6 serves as an adapter protein for docking of other proteins, like RHA, none-muscle myosin and vimentin [53, 58, 84]. My work provided an insight into the functional significance of the interaction of LARP6 and a novel factor, FKBP3. In this study, we show that: 1) FKBP3 directly interacts with LARP6 in the cytoplasm, 2) binding of FKBP3 to LARP6 is independent of RNA and the interaction takes place independent of polysome formation, 3) FKBP3 increases the steady state level of LARP6 and 4) in the absence of FKBP3 LARP6 is subjected to accelerated proteasomal degradation.
We have postulated that LARP6 binds collagen mRNAs to prevent their random translation and to couple translation of α1(I) mRNA to that of α2(I) mRNA. After completing
57 this role, LARP6 must dissociate from the 5’SL to free the start codon and to allow translation elongation to proceed. It is not clear what causes dissociation of LARP6 from the 5’SL. FKBP3 is a prolyl cis-trans isomerase, so it can be envisioned that by interacting with LARP6 FKBP3 isomerizes of one or more prolyl bonds. This could cause a conformational change in LARP6 and its dissociation from the 5’ SL. However, FKBP3 interacts with LARP6 in the absence of
RNA, so if the prolyl isomerization takes place at all, it is probably not involved in regulating the dissociation of LARP6 from 5’ SL. Because there is no assay to analyze isomerization of prolyl bonds in LARP6 I could not address if prolyl isomerization takes place in LARP6. In search to identify potential proline targets we constructed LARP6 with point mutations of the selected prolines throughout the protein, however, none of our mutants showed a different response to knock-down of FKBP3 from the wild type LARP6. It may be that we have not identified the right proline targets or perhaps multiple prolines are involved. Alternatively, binding of FKBP3 may physically shield LARP6 from ubiquitinating enzymes or any other enzymes involved in degradation and sequester it from the pathway without changing the isomerization state.
The more likely explanation is that interaction of FKBP3 serves to stabilize LARP6 and divert it from the proteasome degradation pathway. This is supported by my data. In the absence of FKBP3 the steady state level of LARP6 is decreased, but when a proteasome inhibitor is added its level is restored to normal. This supports the notion that LARP6 is degraded by ubiquitin-proteasome pathway and that FKBP3 protects LARP6, which in turn stimulates collagen synthesis. Knock-down of FKBP3 decreases expression of collagen polypeptides, without affecting the expression of collagen mRNAs. This indicates that translation of collagen mRNAs is sensitive to FKBP3 and, because translation of collagen mRNAs depends on LARP6, is an indirect consequence of the accelerated degradation of LARP6 in the absence of FKBP3.
58
The experiments with reporter genes indicated that FKBP3 regulation can be executed on a heterologous mRNA if collagen 5’SL is introduced into this mRNA. Luciferase mRNA having collagen 5’ UTR with the wt 5’SL is translated well in the presence of normal levels of FKBP3 and LARP6. This was inferred from high luciferase enzymatic activity obtained from a given level of the mRNA. When FKBP3 was knocked down, LARP6 decreased and the same mRNA produced 4-fold less luciferase protein. This indicates that FKBP3 affects LARP6/5’SL mediated regulation. However, when the 5’SL was deleted from the reporter mRNA, this mRNA was translated less efficiently and did not respond to the knock-down of FKBP3. These results are consistent with the hypothesis that FKBP3 interaction with LARP6 positively regulates collagen synthesis. Knowing that FKBP3/LARP6 interaction is crucial for sustained collagen synthesis makes this interaction a good target for development of anti-fibrotic drugs. A proof of principle for this notion is presented in the next chapter.
In conclusion, the diagram in Fig. 19 illustrates the presumed mechanism of FKBP3 action. Inside the nucleus an mRNP complex composed of LARP6/RHA/collagen mRNAs and potentially other unidentified factors forms and is exported out of the nucleus into the cytoplasm.
In the cytoplasm LARP6 interaction with non-muscle myosin directs the complex to the site of translation. There LARP6 dissociates from the 5’SL for translation machinery to re-assemble into the elongation mode. After being released from 5’SL LARP6 is bound by FKBP3, the interaction may change the LARP6 confirmation or physically protect it from ubiquitination enzymes. This prevents LARP6 degradation and makes it available to re-enter the nucleus and initiate another round of collagen mRNAs metabolism.
59
Figure 19. Schematic representation of the FKBP3 mechanism in collagen synthesis. The binding of RHA/LARP6/5’SL takes place in the nucleus and once released into the cytoplasm the complex is transported by non-muscle myosin fibers to the site of translation (yellow box). 40s ribosomal subunit starts scanning the mRNA from the 5’ cap and when it reaches the 5’SL, LARP6 must dissociate and RHA unwinds the 5’SL. 60S ribosomal subunit joins the 40s subunit for translation elongation to commence. Released LARP6 is bound by FKBP3 and protected against degradation. This may allow LARP6 to re-enter the nucleus and start another round of collagen synthesis.
3.4 - Materials and Methods
Cells and Transfections:
Isolation of rat HSCs were performed by perfusion with pronase and collagenase, followed by centrifugation on Nykodenz gradient, as previously described [99]. The use of hLFs and
HEK293 cells were also described before [84, 107]. The cell cultures were grown under the standard conditions [53]. HEK293 cell line was transfected with 1 μg of LARP6 constructs per
35 mm dish using 293TransIT reagent (Mirus). hLFs were transfected using lipofectamine 2000
(Invitrogen). All cells were harvested between 48 to 72 hours after the transfection. LARP6 60 constructs were constructed as previously described [53, 84]. Cells were treated with 10 uM
MG132 (Sigma) for 10h. Lactacystin (Santa Cruz) was used at 5 uM concentration for 5h. PR-
619 (Sigma) was added at concentration of 10 uM for 5 hours.
Reverse Transcription-Polymerase Chain Reaction (RT-PCR) analysis:
Total RNA was extracted using RNA isolation kit (Sigma-Aldrich). The extraction of rat liver
RNA was done using TRI-Reagent (Sigma), as per manufacturer protocol. The RNA was treated with DNaseI to remove contaminating DNA. For semi-quantitative RT-PCR, 100 ng of total
RNA was reverse transcribed using rTth polymerase (Boca Scientific) and the gene specific primer (Table 1). The PCR amplification was done in presence of [α32P]-dATP and radiolabeled
PCR products were resolved on a sequencing gel and visualized by autoradiography, as previously described [53, 58]. The identity of the PCR products was confirmed by expected size or by sequencing.
Western blotting:
Cells and liver tissue were lysed in RIPA buffer (50 mM Tris pH 7.4, 150 mM NaCl, 0.5% sodium deoxycholate, 1% NP-40, 0.1% SDS and 1 mM EDTA), supplemented with protease inhibitor cocktail (Sigma). 50 µg of cellular extract or whole liver extract was typically analyzed.
For analysis of cellular medium, cells were placed in serum free medium and collagen accumulation was allowed to proceed for 3h. After that, 45 μL of the medium was directly loaded onto the SDS-PAGE gel. Antibodies used were: anti-collagen α1(I) antibody from
Rockland), anti-collagen α2 (I) from Santa Cruz Biotechnology, anti-fibronectin antibody from
BD Transduction Laboratories, anti-tubulin antibody from Cell Signaling, anti-LARP6 antibody from Abnova, anti-HA antibody from Sigma-Aldrich, anti-FKBP3 antibody from Abcam, anti- actin antibody and anti-αSMA antibody from Abnova.
61
Immunostaining:
Cells were transfected with siRNAs before splitting onto cover slips. Half of the cells were grown on a glass coverslip and the other half was analyzed for protein expression. 48h after growing of cover slips, the cells were processed for immunostainig under standard conditions, as described previously [58]. LARP6 was stained with Cy3 coupled and FKBP3 was stained by
Cy5 conjugated secondary antibody. The cells were then washed and mounted onto the microscope slide by Prolong mounting solution containg DAPI (Invitrogen). Images were taken using Leica TCS SP2 AOBS laser confocal microscope with the Chameleon Ti-Sapphire multiphoton lasers pre-set using negative control cells. Optical sections were processed by
LCSLite software with single-plane confocal images shown.
Fractionation of polysomes:
Prior to harvesting, cycloheximide was added to the cells for 1 hour to stabilize the polysomes.
The lysate was centrifuged over a linear 15-45% sucrose gradient for 2h at 38,000g at 4oC [53,
109]. 500 μL fractions were collected and OD260 of the fractions was measured. Proteins were extracted from the fractions by precipitation with 6.5% TCA and 0.05% DOC, the protein pellets were dissolved in 0.1% SDS, 10mM Tris pH 6.8 and analyzed by western blot.
Gel Mobility Assay
RNA probe comprising the 5’SL of human collagen α1(I) mRNA was described in [53] and was prepared by in-vitro transcription form the template cloned the pGEM3 vector in the presence of
32P-UTP. The mobility shift assay was done using 4 ng of labeled 5’SL RNA and 20 µg total cellular lysate and RNA protein complexes were resolved on a 6% native acrylamide gel [53].
The bands were quantified by phosphoimager.
Luciferase Assay
62
Lucifarese reporter constructs and beta-galactosidase plasmid were co-transfected twice into hLFs cells to ensure better transfection efficiency and luciferase activity was measured by the standard assay two days after the last transfection [16, 110]. The luciferase activity was normalized to the beta-galactosidase activity to normalize for transfection efficiency. The results plotted were from three independent experiments. One way ANOVA followed with student’s t- test was used to assess the statistical significance. The statistical significance was set at p<0.05 and the error bars represent ± 1 SD.
Immunoprecipitations (IP):
Cells were lysed in isotonic buffer for 1h at 4 oC and 1 mg of total protein was incubated with 1
μg of the specific antibody, followed by incubation for 4h with 20 μL of equilibrated protein A/G beads (Santa Cruz Biotechnology). The beads were washed three times with PBS supplemented with 0.5% NP-40 and analyzed by western blotting. Co-precipitation of collagen mRNAs was analyzed by extracting total RNA from the immunoprecipitation reactions and performing semi- quantitative RT-PCR and qRT-PCR reactions. All immunoprecipitations were repeated in two independent experiments.
Two-dimensional (2D) SDS PAGE:
Cells were lysed with standard methods using RIPA buffer. During the isoelectric focusing step the protein pallet was rehydrated in rehydration buffer (7M urea, 65mM DTT, 2%CHAPS, 2M thiourea, 0.8% ampholyte and 0.02% bromophenol blue). The Immunobiline DryStrip pH3-10,
7cm (GE Healthcare) were submerged with the rehydrated protein samples overnight. The first dimension and the protein containing strips were run using Ettan IPGphore3 (GE Helathcare) system. After the electrophoretic run the strips were incubated for 10 min in equilibration buffer
63
1 (.0375M Tris-HCl pH 8.8, 6M Urea, 20%(v/v) Glycerol, 2% (w/v) SDS, bromophenol blue,
2% DTT) followed with two 10 min equilibrations using equilibration buffer 2 ((.0375M Tris-
HCl pH 8.8, 6M Urea, 20%(v/v) Glycerol, 2% (w/v) SDS, bromophenol blue, 2.5% (w/v)
Iodoacetamide). Equilibrated strips were run on SDS PAGE for the second dimension and analyzed by western blot as described above.
Statistics:
The equation for the determination of Standard Error was computed using biostatistics program
GraphPad Prism 3.0 or Microsoft Excel. The statistical significance between groups for the in- vivo study was determined by analysis of variance (ANOVA). Type I error (α) and type II error
(β) were set at 0.05 and 0.01 respectively.
64
CHAPTER FOUR
FK506 PREVENTS EARLY STAGES OF ETHANOL INDUCED
HEPATIC FIBROSIS BY TARGETING LARP6 DEPENDENT
MECHANISM OF COLLAGEN SYNTHESIS
Adapted from:
Zarko Manojlovic, John Blackmon, Branko Stefanovic. “Tacrolimus (FK506) prevents early stages of ethanol induced hepatic fibrosis by targeting LARP6 dependent mechanism of collagen synthesis.” (PLOS ONE, PONE-D-13-06089).
4.1 - Introduction
Fibroprolifirative disorders can target any organ system, ultimately leading to organ failure, and are a major contributor to significant morbidity and mortality worldwide [75, 118].
Despite all the medical advances in the last several years, there are only supportive therapies, with no approved, effective and specific anti-fibrotic treatments available [119]. Normal wound healing is initiated by tissue injury and inflammation with release of fibrogenic cytokines, resulting in proliferation and activation of fibroblasts and deposition of extracellular matrix
(ECM) [2]. Liver fibrosis is an out of control wound healing response that is usually irreversible
[11]. During liver injury, quiescent hepatic stellate cells (HSC), which normally store vitamin A, are activated and differentiate into myofibroblast-like cells[12]. Activated HSC undergo proliferation and are the major cell type responsible for hepatic fibrogenesis[14].
Pathogenesis of alcoholic liver disease is mediated by free radicals and suppression of innate immunity [120, 121]. Alcohol metabolism in hepatocytes results in production of reactive oxygen species and acetaldehyde that can directly activate HSCs. In addition, alcohol causes 65 increased uptake of lipopolysaccharides (LPS) from the gut flora and LPS triggers Kupffer cells to release pro-inflammatory cytokines, such as tumor necrosis factor-alpha, IL-6 and IL-1, as well as pro-fibrotic cytokiness, such as TGFβ [122, 123]. Although several collagen types are secreted by activated HSC, type I collagen is the most abundant and responsible for clinical manifestations of liver fibrosis, as well as manifestations of other fibroprolifirative disorders [2,
21].
The excessive collagen deposition in hepatic fibrosis is primarily due to the dramatic up- regulation of type I collagen synthesis at the post-transcriptional level [34]. This includes stabilization of collagen mRNAs and their more efficient translation [33, 34, 45, 47]. Type I collagen is a heterotrimer composed of two α1(I) and one α2(I) polypeptides and is the most abundant protein in the human body [27]. The mRNAs encoding for type I collagen have an unique 5’ stem loop structure (5’SL) in their 5’ untranslated regions that contains the start codon
[33]. Our lab has cloned and characterized La ribonucleoprotein domain family member 6
(LARP6) as the protein which binds 5’SL and regulates translation of type I collagen mRNAs
[53]. LARP6 binds the 5’SL of collagen mRNAs with high affinity and specificity and is the central component of a ribonucleoprotein complex that assembles on the 5’SL [53]. LARP6 associates collagen mRNAs with two types of cytoskeletal filaments: with intermediate filaments composed of vimentin that prolonged the half-life of collagen mRNAs and with non-muscle myosin filaments required for synthesis of natural heterotrimer of type I collagen [54, 58].
Disulfide bonding and posttranslational modifications of collagen polypeptides take place during the translational elongation phase and before the heterotrimer is released into the lumen of the endoplasmic reticulum (ER) [124]. We postulated that non-muscle myosin filaments facilitate
66 translation of collagen α1(I) and α2(I) mRNAs within the sub-compartments of the ER to allow coordinated synthesis and folding of the heterotrimeric type I collagen [54].
In the past years great efforts have been made to understand the molecular mechanism of collagen synthesis [53, 54, 58, 84]. However, there has been no report on involvement of the
FK506 binding proteins (FKBPs) in this process. FKBPs represent a superfamily of proteins that are implicated in T-Cell activation, ribosome biogenesis, tumor suppression, and transcription regulation [70, 71, 112, 125]. All FKBPs have cis-trans prolyl isomerase (PPIase) activity and bind multiple immunosuppressant drugs, like rapamycin, FK506 (tacrolimus) and everolimus
[126].
Tacrolimus (FK506), a macrolide antibiotic with potent immunosuppressive effects was isolated from Streptomyces tsukubaensis and has been previously used to prevent allograft and for treatment of autoimmune disorders in humans [127-129]. Animal studies have indicated that
FK506 can inhibit neutrophil infiltration, reduce free radicals, decrease generation of reactive oxygen species and suppress pro-inflammatory cascade [130-134], thus, potentially affecting the factors which mediate alcoholic liver injury. A study on pulmonary fibrosis in mice suggested that FK506 can be a potent antifibrotic agent [135]. However, studies on liver fibrosis induced by bile duct ligation or by carbon tetrachloride (CCL4) administration gave conflicting results
[136, 137].
Here we show that FK506 can prevent the development of alcohol induced liver fibrosis in rats by directly targeting collagen synthesis. We provide evidence that FK506 affects the
LARP6 dependent mechanism of collagen synthesis, resulting in absence of fibrosis and minimal activation of HSCs. These results suggest a novel mechanism of action of FK506 in alcoholic liver fibrosis and may renew the interest of using FK506 as a potential antifibrotic drug.
67
4.2 Results
FK506 reduces synthesis of type I collagen protein without affecting expression of collagen mRNAs.
The initial discovery that FK506 can reduce collagen expression in vitro was observed in human lung fibroblasts (HLFs). When these cells were treated with 2 µM of FK506 the cellular level of collagen α1(I) and α2(I) polypeptides decreased slightly compared to the control cells
(Fig. 20A, top panel). However, secretion of collagen into cellular medium was profoundly affected. Fig. 20A, middle panel, shows a dramatic decrease in secretion of both collagen polypeptides from cells treated with 2 μM of FK506. At 1µM FK506 was ineffective. The analysis of fibronectin secretion showed no change, indicating that the FK506 did not affect the general protein secretion machinery. Since FK506/FKBP3 may play a role in transcription regulation [112], we tested the expression of collagen α1(I) (COL1A1) and α2(I) (COL1A2) mRNAs (Fig. 20A, lower panel). We extracted the RNA from the same cells shown in the top and middle panels of Fig. 1A and analyzed collagen mRNAs by a semi-quantitative RT-PCR.
There was no change in expression of collagen mRNAs with FK506 treatment, suggesting that
FK506 had not altered transcription of collagen genes or stability of collagen mRNAs.
To extend these findings to hepatic stellate cells (HSCs), we isolated primary HSCs from rat livers and cultured them in vitro [99]. HSCs spontaneously activate after 2 days in culture and differentiate into activated HSCs by day 8, when they upregulate collagen synthesis by 100 fold
[12, 98]. At day 8 after isolation we treated rHSCs with 75 nM FK506 overnight. Then, we collected the cells and analyzed collagen protein expression in cellular extracts (Fig. 20B, top panel) and the medium (Fig. 20B, middle panel). The cellular level of collagen α1(I) polypeptide remained unchanged with the FK506 treatment. As control for loading we analyzed tubulin,
68 because its expression does not change during HSCs activation, and α-smooth muscle actin
(αSMA), which is the maker of HSC activation [98]. Expression of both these proteins was also not changed by FK506 treatment. We could not analyze the α2(I) polypeptide in these experiments, because there is no antibody available that can specifically recognize rodent α2(I) polypeptide. However, when we analyzed collagen excreted in the medium, FK506 treatment significantly decreased the secretion of collagen α1(I) polypeptide (Fig. 20B, middle panel). The secretion of fibronectin was not affected, again indicating that general excretion machinery was intact. When the steady state level of collagen mRNAs was analyzed (Fig. 20B, lower panel), no changes in expression was seen, suggesting that FK506 affects the ability of rHSCs to excrete type I collagen.
To verify this result in fully activated human hepatic stellate cells (hHSC) we cultured immortal human hepatic cell line [138] and treated the cells with 75 nM and 2 μM FK506 for
24h. The cells were analyzed as above for the cellular and medium levels of type I collagen.
Even at high FK506 concentration of 2 μM, the cellular level of collagen and αSMA was unchanged (Fig. 20C, upper panel). At 2 μM FK506 significantly inhibited excretion of collagen
α1(I) polypeptides into the medium, while at 75 nM FK506 was ineffective (Fig. 20C, middle panel). Analysis of collagen mRNAs showed no change in expression (Fig. 20C, lower panel), again suggesting a defect in secretion of collagen polypeptides and not in collagen gene expression.
69
Figure 20. FK506 inhibits secretion of collagen polypeptides into cellular medium. A. Western blot analysis of collagen α1(I) and α2(I) polypetides in cellular extracts and in the medium of human lung fibroblasts (HLF) treated with the indicated concentrations of FK506. Top panel: western blot of cellular collagen. Loading control: tubulin. Middle panel: Western blot of collagen secreted into the cellular medium. Loading control, fibronectin (FIB). Lower panel: RT-PCR analysis of the collagen mRNAs level in HLFs. Actin mRNA (ACT) is shown as loading control. B. Western blot analysis of collagen α1(I) polypeptide in cellular extracts and in the medium of primary activated rat HSCs (rHSCs) treated with the indicated concentrations of FK506. Top panel: Collagen α1(I) polypeptide in cellular extracts. α-smooth musle actin (αSMA) was analyzed as a marker of HSCs activation and tubulin as loading control. Middle panel: secretion of collagen α1(I) polypeptide into the medium of rHSCs. Lower panel: RT-PCR analysis of the collagen mRNAs level in rHSCs. C. Same analysis as in B, except activated human hepatic stellate cell line (hHSC) was used.
From these experiments we concluded that FK506 at doses of 2 µM in HLF and hHSCs and at 75 nM in rat HSCs significantly reduces the secretion of type I collagen. Since secreted type I collagen is relevant for fibrilogenesis, this result justified further evaluation of the antifibrotic potential of FK506.
FK506 reduces type I collagen synthesis in liver slices cultured in vitro.
Precision cut liver slices have been used before as in vitro model of fibrosis in the whole liver [139, 140]. When cut 250-350 microns thick and incubated in vitro for 2-3 days, liver slices
70 initiate fibrosis by upregulating type I collagen expression. We employed this model to further test the FK506 effects on collagen synthesis, in a setting more relevant to hepatic fibrosis. The experiments were done using three separate slices treated independently for 3 days. Immediately after slicing (day 0), three slices were collected for analysis of the starting level of collagen expression. Other slices were incubated for 3 days in the presence of 2 µM and 4 µM of FK506 or vehicle (DMSO). The medium was changes daily and the drug was freshly added. At day 3, the slices were homogenized and total protein was extracted and analyzed by western blot for expression of collagen α1(I) polypeptide (Fig. 21). Freshly prepared slices (day 0) contained only the already existing type I collagen in the liver, which was detected as 120 kDa, mature, processed α1(I) polypeptide (Fig. 21, lanes 1-3). No active fibrilogenesis was detected, based on the absence of the newly synthesized pro-collagen of 180 kDa. After 3 days of culturing, the control slices contained high levels of pro-collagen molecular species, indicating active, de novo collagen synthesis (lanes 4-6). When treated with 2 µM of FK506 these slices had a similar level of pro-collagen (lanes 7-9) as control slices. However, the slices incubated in presence of 4 µM of FK506 had about 2-fold reduced levels of pro-collagen (lanes 10-12). RNA analysis of the slices showed no changes in collagen α1(I) and α2(I) mRNA expression (data not shown). As control for protein loading in Western blots we analyzed the actin levels. The absence of actin signal in slices at day 0 is an artifact of extraction, because actin filaments became insoluble and cannot be extracted when the liver and the slices are kept on ice (a necessary procedure in preparation of slices). However, the actin signal in other samples showed comparable loading.
We also measured αSMA expression, as an indicator of activation of HSCs. It was highly increased in control slices after 3 days of incubation (lanes 4-6), compared to slices at day 0, suggesting rapid activation of HSCs in this model. FK506 at both concentrations slightly reduced
71 the αSMA expression (lanes 7-12). However, it reduced collagen expression only at the higher concentration. These results suggested that FK506 can suppress activation of collagen synthesis in the liver and may be protective against hepatic fibrosis in vivo. Therefore, we proceeded to verify this in an animal model.
Figure 21. FK506 reduces collagen synthesis by precision cut liver slices. The 350 μm thick rat liver slices were analyzed immediately after the preparation (day 0, lanes 1-3) or after culturing for 3 days without FK506 (day 3, lanes 4-6) or with two different concentrations of FK506 (day 3, lanes 7-12). Expression of collagen α1(I) polypeptide, αSMA and actin, as a loading control, was analyzed by western blot. α1(I) collagen polypeptide is resolved as processed, mature, polypeptide of 120 kDa (mature collagen) and as freshly synthesized unprocessed α1(I) pro- peptide of 180 kDa (pro-collagen). A nonspecific band is indicated by asterisk.
Antifibrotic effect of FK506 in an alcohol model of hepatic fibrosis.
Feeding 5% ethanol to Wistar rats for 4 weeks in combination with low doses of carbon tetrachloride (CCl4) injections is a well-established model of alcoholic fibrosis in rodents [141].
The use of CCl4 in combination with ethanol is necessary to achieve well developed fibrosis, but the animals show typical changes of alcoholic liver disease, like steatosis [141, 142]. To assess the potency of FK506 it was necessary to achieve fibrosis in all animals, with some animals showing advanced fibrotic changes.
72
Male Wistar rats (n=32) weighing 150 - 200 grams and approximately 50 days of age were randomly divided into four groups. Group 1 (n=8) was exposed to 5% ethanol in the drinking water at will, as the only source of water. In addition, a biweekly intraperitoneal (i.p) injections of CCl4 at 0.5 µL/g in mineral oil were performed (CCl4+EtOH group); Group 2 (n=8) received the identical treatment, but with daily administration of FK506 (4 mg/g i.p.) from the day 1 (CCl4+EtOH+FK506 group); Group 3 (n=8) received only FK506 daily (FK506 group), while group 4 (n=8) received only vehicle (CON group). Daily liquid intake was measured and there was no significant difference between the groups in the total volume consumed (data not shown). After 28 days (24 hours after the last injection) liver samples and plasma were collected for analysis. The histology of two representative livers from each group stained with Mason’s trichrome is shown in Fig. 22. Fig. 22A shows 100x magnification and Fig. 22B shows 500x magnification of the selected squared area. The CCl4+EtOH group developed moderate to advanced fibrosis with clearly visible bridging between adjacent portal tracts. In the
CCl4+EtOH+FK506 group the fibrosis was completely absent and liver histology was similar to the CON group. Group which received only FK506 also did not show histopathological changes.
The percentage of area of fibrosis was computed using the ImageJ software from all 8 trichrome stained slides of each group and plotted in Fig. 22C. The area of fibrosis in the CCl4+EtOH group was estimated to be 8.5% of the total liver area. In the CCl4+EtOH+FK506 group it was
~2%, what represents a highly significant decrease of fibrosis (p<0.01). It was only slightly greater than the trichrome positively stained area in the CON group and FK506 group (~1.2%) and this was not statistically significant. This result clearly indicated that FK506 was highly potent in preventing development of liver fibrosis in the alcohol/CCl4 model.
73
We also measured the level of amino-transferases in the plasma. The levels of ALT and
AST were within the normal range in all groups averaging 20 ± 2 U/L for ALT and 30 ± 3 U/L for AST (Fig. 22D and E). This suggested that no significant necrosis accompanied fibrosis in our model, what was further verified by H&E staining and evaluation of liver histology (not shown).
Figure 22. Antifibrotic effect of FK506 in alcohol model of hepatic fibrosis. A. Masson’s trichrome staining of the liver sections from rats treated for 4 weeks as indicated. Two livers of each treatment group are shown at 100x magnification. B. 500x magnification of the squared sections in A. C. Percentage of liver fibrosis was determined from the Masson’s trichrome staining using ImageJ software and plotted as percent fibrotic area vs total liver area. Data represents average and ± 1 SEM from 8 rats, *** represents significance at p<0.01. D. Aminotransferases in plasma of the experimental animals. The activity is presented as average and ± 1 SEM of 8 animals analyzed in duplicate.
74
To further validate the FK506 efficacy, we analyzed type I collagen protein and mRNA expression in the liver samples by western blots and RT-PCR. All eight livers from each group were analyzed and used in statistical evaluation of these biochemical parameters (Fig. 23B and
C), but we show the raw data of the four livers from each group (Fig. 23A and E). Fig. 23A shows the expression of collagen α1(I) and α2(I) mRNAs, αSMA mRNA and actin mRNA, as a loading control. The CCl4+EtOH livers had about 50-fold increased level of collagen α1(I) and
α2(I) mRNAs, compared to CON and FK506 groups (for quantification see Fig. 23B and D).
αSMA mRNA expression was clearly detected in this experimental group, but was absent in all other groups. This indicated activation of HSCs and massive upregulation of collagen mRNA expression, what correlated well with the histology (Fig. 22). In the CCl4+EtOH+FK506 livers, expression of collagen α1(I) mRNA was also significantly increased; to about 25-fold higher level than that in CON and FK506 groups (Fig. 23A and B). However, the expression of collagen
α2(I) mRNA in this group was completely suppressed and no different compared to CON and
FK506 livers (Fig. 23D). This indicated that FK506 treatment failed to completely inhibit expression of collagen α1(I) mRNA, but abolished expression of collagen α2(I) mRNA, as well as development of fibrosis (Fig. 22). Expression of αSMA mRNA was undetectable in the
CCl4+EtOH+FK506 livers, indicating that FK506 treatment also inhibited activation of HSCs.
Alternatively; it may have reduced the number of HSCs in the livers. This result is similar to the result obtained with liver slices, where FK506 also decreased the expression of this marker of
HSCs activation (Fig. 21).
Because of the failure of FK506 to completely suppress collagen α1(I) mRNA, in spite of preventing activation of HSCs and fibrosis, we measure the level of collagen α1(I) polypeptide in the livers by western blot (Fig. 23E). While collagen α1(I) polypeptide was highly upregulated in
75 the CCl4+EtOH livers, its expression in the CCl4+EtOH+FK506 livers was not upregulated and was similar to that of CON and FK506 livers (Fig. 23E and F). This is consistent with absence of fibrosis in the CCl4+EtOH+FK506 livers, but does not correlate with the expression of its mRNA, which was still 25 fold higher than in CON and FK506 livers. The discrepancy between the mRNA level and protein level suggested that either, the α1(I) mRNA was not translated, or the α1(I) polypeptide was rapidly degraded.
The expression of αSMA protein was high in all CCl4+EtOH livers and significantly decreased in CCl4+EtOH+FK506 livers (Fig. 23G). Thus, by measuring αSMA protein, we could also demonstrate that FK506 treatment inhibited activation of HSCs or reduced their number in the liver. Based on these results we concluded that FK506 has multiple effects in the liver; which may include impaired translation of collagen α1(I) mRNA and inhibition of general activation of
HSCs.
Figure 23. FK506 reduces expression of type I collagen and αSMA in hepatic fibrosis. A. RT- PCR analysis of collagen α1(I) mRNA (COL1A1), collagen α2(I) mRNA (COL1A2), αSMA mRNA and actin (ACT) mRNA in total liver RNA from the experimental animals. The results from 4 animals in each group are shown. B. Quantification of expression of collagen α1(I) and α2(I) mRNA after normalization to actin mRNA expression. The data from all 8 animals were used and presented as average and ± 1 SEM. *** represents significance at p<0.01. C. Western blot analysis of total proteins from the livers of experimental animals. Collagen α1(I) polypeptide (COL α1(I)), αSMA and actin (ACT), as a loading control, from 4 animals of each group is shown. D and E. Quantification of expression of collagen α1(I) polypeptide αSMA after normalization to actin expression.
76
Chronic inflammation under lays many fibrotic processes [75], therefore, it is possible that immunosuppressive activity of FK506 may have contributed to prophylaxis against fibrosis
[143]. H&E staining showed no infiltration of lymphocytes, plasma cells nor neutrophils in any of the livers. We also assessed the biochemical markers of Kupffer cells activation and analyzed the expression of TNF- , IL1β, IL6, lipopolysaccharide binding protein (LPS-BP), CD64 and
CD68. TNF-α, IL1β and IL-6 are the cytokines most commonly associated with liver inflammation, while CD64 and CD68 are markers of Kupffer cell activation [144, 145]. LPS-BP is binding protein for LPS, which presents LPS to its receptor [146, 147]. It is of particular importance, because alcoholic liver injury is mediated by increased absorption of LPS from gut flora and stimulation of Kupffer cells by LPS [148]. Expression of TNF- , IL1β, IL6, CD64 was undetectable by RT-PCR in the livers of all groups (data not shown). When CD64 was analyzed, its expression was variable between the groups, but there was no clear correlation between the
CD64 expression, fibrosis and FK506 treatment (Fig. 24A and C). The expression of LPS-BP was down-regulated in the FK506 and CCl4+EtOH+FK506 groups, suggesting that FK506 can alter the expression of this mediator of Kupffer cell activation. However, the expression of LPS-
BP was similar in the CCl4+EtOH and CON groups (Fig.. 5A and B), suggesting that it probably did not play a major role in the pathogenesis in our model. We concluded from these experiments that our fibrosis model was not associated with overt inflammation and that it is not likely that immunosuppressive action of FK506 is responsible for its dramatic antifibrotic effect.
77
Figure 24. Expression of LPS-BP and CD64 mRNA in the livers of experimental animals. A. Total RNA from the livers of treated animals was analyzed by RT-PCR for expression of lipopolysaccharide binding protein mRNA (LPS-BP) and CD64 mRNA. Data from 4 animals of each group are shown. Loading control, actin (ACT). B. Quantification of expression of LPS- BP mRNA after normalization to actin mRNA expression. The data from all 8 animals were used and presented as average and ± 1 SEM. * represents significance at p<0.05. C. Quantification of expression of CD64 mRNA after normalization to actin mRNA. *** represents significance at p<0.01 and * represents significance at p<0.05.
LARP6 dependent mechanism of collagen synthesis as a target of FK506.
LARP6 is the protein that binds 5’SL of collagen mRNAs [53]. It has been implicated in regulation of stability and translation of collagen mRNAs [54, 58, 84]. Using yeast-two-hybrid screening we cloned FKBP3 as one of the proteins that interacts with LARP6. This approach also indicated that the interaction between these two proteins is direct. Since FKBP3 binds
FK506 [149], this raised a possibility that this drug may interfere with LARP6/FKBP3 interaction, as one of the mechanisms by which it could suppress collagen synthesis. To test this hypothesis we first verified the interaction of LARP6 and FKBP3. To map the interaction domain on LARP6 we designed adenoviruses expressing different mutants of LARP6 (shown in
78
Fig. 25A) and analyzed these constructs for the ability to interact with endogenous FKBP3. By immunoprecipitation (IP) of LARP6 and western blot analysis for FKBP3 pull down (Fig. 24B) we demonstrated that FKBP3 only immunoprecipitated with the full size LARP6. LARP6ΔC, a mutant which lacks the C-terminal domain, but still can bind 5’SL [53, 84], showed no interaction with FKBP3. Even shorter construct, LARP6ΔC/RBD, also did not interact with
FKBP3, so we concluded that FKBP3 binding to LARP6 requires the presence of the C-terminal domain of LARP6. Detailed LARP6/FKBP3 interaction and its function is currently under investigation (Chapter 3).
To test if FK506 may inhibit the interaction of endogenous LARP6 and FKBP3 we treated the HLFs with 2 µM of FK506, the concentration which reduced collagen synthesis in these cells (Fig. 20). Similar experiment in HSCs was not possible due to lower expression of
LARP6 in these cells compared to HLFs. In the presence of FK506, the pull down of LARP6 with anti-FKBP3 antibody was reduced by ~50% (Fig. 25C, lane 1), compared to the control pull down (lane 2). The control reactions using anti-fibronectin antibody or no antibody did not pull down any LARP6 (lanes 3 and 4). The expression of proteins in the input material was similar
(Fig. 25C, lower panel). This suggested that FKBP3 may interfere with the direct binding of
LARP6 to FKBP3. To verify that this interaction is not cell type specific we repeated
FKBP3/LARP6 pull downs in scleroderma skin fibroblasts with the same result (data not shown).
79
Figure 25. Interaction of LARP6 with FK506 binding protein 3 (FKBP3). A. Schematic representation of LARP6 constructs used in immunoprecipitations (IP) with amino-acid numbering on the top. All constructs contained HA tag at the N-terminus. Full size LARP6 (FS) has the domains indicated: N-TER, N-terminal domain, La, La homology domain, RRM, RNA recognition motif, C-TER, C-terminal domain. Binding of the constructs to 5’ SL RNA is indicated to the right. B. IP of endogenous FKBP3 with LARP6 constructs. Upper panel: after expression of HA-tagged LARP6 constructs in HEK293 cells, IP was performed with anti-HA antibody and Western blot with anti-FKBP3 antibody. Bottom panel: Expression of the proteins in the input material analyzed by Western blot. C. IP of endogenous LARP6 with endogenous FKBP3 in cells treated with FK506. Top panel: HLFs were treated with the indicated concentrations of FK506. The IP was done using anti-FKBP3 antibody (lanes 1 and 2) or anti- fibronectin antibody (FIB, lanes 3 and 4), as control, and Western blot probed with anti-LARP6 antibody. Bottom panel: expression of proteins in the input material.
80
FKBP3 is not an RNA binding protein, but it interacted with LARP6 and this interaction was attenuated by FK506 (Fig. 25). This raises a possibility that FK506 may interfere with the function of LARP6/FKBP3 complex when bound to collagen mRNAs. Therefore, we tested the interaction of FKBP3 with collagen α1(I) and α2(I) mRNAs in the presence or absence of
FK506. These experiments were done using human lung fibroblasts (HLFs), which express high level of endogenous LARP6, allowing the analysis of the interaction of the endogenous proteins
[53]. The cells were treated with 2 μM of FK506 or DMSO (CON) for 24 h and immunoprecipitated with anti-FKBP3 or control anti-fibronectin antibodies. After the immunoprecipitation, RNA was extracted and analyzed by RT-PCR for pull down of collagen
α1(I) and α2(I) mRNAs (Fig. 26B). Collagen α1(I) and α2(I) mRNAs were efficiently immunoprecipitated with anti-FKBP3 antibody (Fig. 26B lane 4), while there was no immunoprecipitation with the control (anti-fibronectin) antibody (Fig. 26B lanes 1 and 3). Actin mRNA was not pulled down with either antibody, suggesting that the interaction of collagen mRNAs with FKBP3 is specific for this mRNA. Since FKBP3 has not been shown to bind any
RNA, and it does not bind collagen mRNAs without the presence of LARP6, the pull down of collagen mRNAs was almost certainly mediated by interaction of FKBP3 and LARP6. However, when HLFs were treated with FK506, the collagen pull down was reduced 2-3 fold (Fig. 26B lane 2). The amount of proteins (Fig. 26A) and collagen mRNAs (Fig. 26B) in the input material was similar, suggesting that the strength of interaction between FKBP3 and LARP6 was altered.
To better quantify the results shown in Fig. 26B, we re-analyzed the samples from the immunoprecipitation reaction by real time RT-PCR (Fig. 26C). The quantitative RT-PCR was in excellent agreement with the semi-quantitative RT-PCR and verified that both, α1(I) and α2(I)
81 mRNAs, were pulled down 50% less efficiently in FK506 treated HLFs. We concluded from these experiments that one of the mechanisms of antifibrotic activity of FK506 may involve inhibition of the interaction between LARP6 and FKBP3, resulting in aberrant translation of collagen mRNAs and inefficient folding and secretion of collagen polypeptides.
Figure 26. FK506 inhibits association of collagen mRNAs with FKBP3. A. Expression of proteins in the input material used for mRNA pull downs analyzed by Western blot. B. Top panel: pull down of collagen mRNAs with FKBP3. HLFs treated with 2 μM FK506 (lanes 1 and 2) or untreated HLFs (lanes 3 and 4) were used for IP with anti-FKBP3 antibody (lanes 2 and 4) or anti-fibronectin antibody (lanes 1 and 3). The IP material was analyzed for collagen α1(I) (COL1A1), collagen α2(I) (COL1A2) and actin (ACT) mRNA by semi-quantitative RT-PCR. Bottom panel: analysis of the mRNAs in the input material. C. Quantitative RT-PCR (qRT- PCR) analysis of the collagen mRNAs in the IP from A. The experiments were done in duplicates and plotted as fold change over the negative control, actin mRNA. The error bars represent average with ± 1 SEM. *** represents significance with p<0.01.
82
4.3 - Discussion
Post-transcriptional regulation of type I collagen is the major mechanism of excessive synthesis of type I collagen in fibrosis of various organs [45, 53, 54, 58, 84]. The mechanism probably operates in all collagen producing cells, including fibroblasts, myofibroblasts and HSCs
[113]. To understand the molecular details of the mechanism which governs collagen synthesis we have previously identified and characterized a novel RNA binding protein, LARP6 [53]. In the 5’ UTR of collagen α1(I) and α2(I) mRNAs there is a unique sequence that can be folded into a stem-loop structure, the 5’SL [35]. LARP6 binds 5’SL of collagen mRNA and regulates coordinated translation of collagen α1(I) and α2(I) mRNAs [53]. LARP6 also interacts with several other proteins, including RNA helicase A, vimentin, non-muscle myosin and STRP [54,
58, 84]. Recently, we have discovered yet another protein that interacts with LARP6, FKBP3.
Our preliminary results suggested that knock-down of FKBP3 decreases expression of type I collagen (Fig. 14). Elucidation of the molecular mechanism of collagen synthesis is crucial for development of specific antifibrotic therapy. Since FKBP3 binds the well-established immunosuppressive drug, FK506 [73], we surmised that this compound may interfere with
FKBP3 function in collagen synthesis. In previous studies, FK506 had both profibrotic [136,
137] and antifibrotic [135, 150] effects, based on the animal models used. In this study, we wanted to establish the effectiveness of FK506 in an alcohol related model and in addition, provide an insight into a novel mechanism of action of FK506.
Our results show that in vitro (Fig. 20) and in cultured liver slices (Fig. 21), FK506 reduced collagen expression. This was predominantly due to a reduced excretion of collagen into the cellular medium. In liver slices it also inhibited the activation of HSC, as judged by expression of the marker of activation, αSMA. In vivo, in an alcohol model of hepatic fibrosis,
83
FK506 completely prevented development of fibrosis (Fig. 22). We employed a preventive model in this study; however, the potency of FK506 remains to be evaluated in a curative model.
Based on our results, such study is highly warranted.
FK506 is thought to be nephrotoxic at higher doses [151]. Our dosage was 30% higher than the therapeutic recommendations in humans, but the treated animals did not show any overt renal impairment. One other drawback of chronic administration of FK506 is immunosuppression. The duration of our study was too short to observe any adverse effects on the immune system. The vast experience with this drug in human use will help adjust the dose to avert severe side effects if the drug reaches clinical trials for fibrosis.
What is the mechanism of action of FK506 in fibrosis? First, FK506 either prevented activation of HSCs in liver slices (Fig. 21) and in the animal model (Fig. 23) or reduced their numbers, without affecting the activation. The measurement of αSMA in total liver homogenates could not distinguish between these possibilities, but, based on the results with liver slices, we believe that it suppressed the activation of HSCs. However, it is clear that FK506 inhibited the interaction between LARP6 and FKBP3. Both of these proteins are critical for efficient collagen synthesis (in preparation and [53]). It also reduced the fraction of collagen mRNAs that can be immunoprecipitated with FKBP3 (Fig. 25). This indicates that coordinated translation of collagen mRNAs and efficient folding of collagen triple helix may have been perturbed.
Collagen synthesis impairment results in unfolded collagen polypeptides accumulate in the ER which undergoes excessive post-translational modifications [124, 152]. The intracellular accumulation of hyper modified polypeptides triggers the unfolded protein response and cell apoptosis [153, 154]. Such mechanism may have inhibited activation of HSCs and/or caused their elimination from the liver.
84
Second, FK506 completely inhibited upregulation of collagen α2(I) mRNA in the fibrotic livers (Fig. 23A), this is consistent with the absence of activated HSCs in these organs. However, collagen α1(I) mRNA was still significantly increased compared to the control livers (Fig. 23A).
It is possible that α1(I) mRNA originated from portal fibroblasts or other cell types and not from
HSCs, but we could not determine this. Nevertheless, this collagen α1(I) mRNA was not translated, as evidenced by the absence of α1(I) polypeptide in these livers (Fig. 23). Different regulation of α1(I) mRNA and α2(I) mRNA, associated with the lack of translation of α1(I) mRNA, is another indication of a perturbed collagen synthesis. This is consistent with explanation that FK506 disrupted LARP6 mediated coordination of collagen biosynthesis by blocking the FKBP3/LARP6 interaction.
Third, liver fibrosis is often accompanied by subclinical chronic inflammation [123].
Chronic ethanol consumption causes oxidative stress and promotes inflammation [121]. In addition, increased gut permeability of alcoholics allows increased absorption of LPS produced by the gut flora. LPS binds to LPS-BP and is presented to the receptors on Kupffer cells, this results in activation of Kupffer cells with upregulation of the markers of Kupffer cells activation,
CD64 and CD68 and production of cytokines such as TNF-α, IL-6 and IL1 [122, 123,
155].Therefore, we measured the expression of these factors in the livers (Fig. 24), but could not detect any difference in expression between fibrotic vs control livers. Histological examination did not reveal infiltration of any immune cells into the liver. We particularly looked for lymphocyte infiltration, because it is known that FK506 can suppress activation of T- lymphocytes [127, 143]. These findings suggested that the fibrosis model employed in this study is not associated with a detectable hepatic inflammation. However, it does not exclude the presence of subclinical pro-inflammatory changes, therefore, we cannot completely exclude that
85 some of the FK506 antifibrotic effects are due to suppressing the immune response. However, we do not believe that this is the major mechanism of FK506 activity in the model employed.
Fourth, in addition to FKBP3, there are additional FK506 binding proteins (FKBPs) which bind FK506 with high affinity. They all possess peptidyl-prolyl isomerase activity (PPI), which is inhibited by FK506 at the half maximal PPI inhibitory concentration of 400 nM [73].
The general inhibition of prolyl bonds conversion in proteins may have contributed to the antifibrotic effect by limiting cis-trans-isomerization of the propyl-peptide bonds in collagen polypeptides. However, the general PPI inhibition would affect all proteins and would be highly toxic to all cells, including hepatocytes. We have not observed any necrosis of hepatocytes, as evidenced by normal aminotransferase levels (Fig. 22D and E) and absence of necro- inflammatory changes in histology (not shown). Also, FK506 has been in clinical practice for years with well-established doses and side effects [129, 156], which exclude general cytotoxicity.
In conclusion, our study is first to provide an insight into the mechanism of antifibrotic effect of FK506. Our results support the hypothesis that FK506 perturbs synthesis of type I collagen by interfering with binding of FKBP3 to LARP6. This interaction is necessary for regulating the synthesis of heterotrimeric type I collagen and is currently studied in our lab.
Impaired collagen synthesis may result in overloading of the ER with unfolded collagen polypeptides and apoptosis of collagen producing cells. Although encouraging, these are only preliminary results that need to be further tested in other models of hepatic fibrosis and with respect to translation of collagen mRNAs, unfolded protein response and apoptosis of HSCs.
Lastly, we are not eliminating a possibility that FK506 may target additional PPIs that may play
86 a critical role in proper collagen folding and excretion. We believe that this report will renew the interest of using FK506 as an antifibrotic drug.
4.4 – Materials and Methods
Chemicals:
FK506 (LC Laboratories) was dissolved in DMSO at 5 mM and stored in -20oC for in-vitro studies. For animal injections FK506 was dissolved in 10% Chremaphor (Sigma-Aldrich) and sterilized by filtration. Pure ethanol used in drinking water was purchased by Pharmaco-AAPER.
Carbon tetrachloride (HPLC grade) was from Sigma-Aldrich.
Cells and Transfections:
Human HSCs were described before [138]. Rat HSCs were isolated by perfusion of rat livers with pronase and collagenase, followed by centrifugation on Nykodenz gradient, as described
[99]. HEK293 cells and HLFs were also described before [84, 107]. The cells were grown under the standard conditions [53]. HEK293 cells were transfected with 1 μg of LARP6 constructs per
35 mm culture dish using 293TransIT reagent (Mirus). The cells were harvested 48 to 72 hours after the transfection. LARP6 constructs were cloned into pCDNA3 vector (Stratagene) having the N-terminal HA tag and were described previously [53, 84]. For FK506 treatment, cells were incubated with the indicated concentrations of FK506 for 24h. The cells were then washed 3 times with PBS and incubated for 3h in serum free medium to accumulate secreted collagen. The medium and cells were collected for western blot or RT-PCR analysis.
Precision cut liver slices:
Precision cut liver slices were cut from normal rat livers using the well-established method [139,
140] and Krumdieck microtome. The slices were cultured in DMEM supplemented with 10%
87
FBS, 0.4 μg/ml dexamethasone, 50 μg/ml ascorbic acid, 0.5 μg/ml insulin and the medium was changed daily.
Reverse Transcription-Polymerase Chain Reaction (RT-PCR) analysis:
Total RNA was extracted using RNA isolation kit (Sigma-Aldrich). The extraction of rat liver
RNA was done using TRI-Reagent (Sigma), as per manufacturer protocol. The RNA was treated with DNaseI to remove contaminating DNA. For semi-quantitative RT-PCR, 100 ng of total
RNA was reverse transcribed using rTth polymerase (Boca Scientific) and the gene specific primer (Table 1). The PCR amplification was done in presence of [α32P]-dATP and radiolabeled
PCR products were resolved on a sequencing gel and visualized by autoradiography, as previously described [53, 58]. The identity of the PCR products was confirmed by expected size or by sequencing.
For quantitative real time RT-PCR (qRT-PCR), equal amount of RNA (100 ng) was reverse transcribed using SuperScript II RT (Invitrogen). Five percent of the cDNA was used in qRT-
PCR (BioRad-IQ5 Thermocycler) with the primers indicated in Table 1. The qRT-PCR was performed in duplicates and the threshold cycle (CT) and statistical analysis were computed using
IQ-5 software (BioRad) and GraphPad Prism 3.02, as previously described [84].
Western blotting:
Cells and liver tissue were lysed in RIPA buffer (50 mM Tris pH 7.4, 150 mM NaCl, 0.5% sodium deoxycholate, 1% NP-40, 0.1% SDS and 1 mM EDTA), supplemented with protease inhibitor cocktail (Sigma). 50 µg of cellular extract or of whole liver extract was typically analyzed. For analysis of cellular medium, cells were placed in serum free medium and collagen accumulation was allowed to proceed for 3h. After that, 45 μL of the medium was directly loaded onto the SDS-PAGE gel. Antibodies used were: anti-collagen α1(I) antibody from
88
Rockland), anti-collagen α2 (I) from Santa Cruz Biotechnology, anti-fibronectin antibody from
BD Transduction Laboratories, anti-tubulin antibody from Cell Signaling, anti-LARP6 antibody from Abnova, anti-HA antibody from Sigma-Aldrich, anti-FKBP3 antibody from Abcam, anti- actin antibody and anti-αSMA antibody from Abnova.
Immunoprecipitations (IP):
Cells were lysed in isotonic buffer for 1h at 4 oC and 1 mg of total protein was incubated with 1
μg of the specific antibody, followed by incubation for 4h with 20 μL of equilibrated protein A/G beads (Santa Cruz Biotechnology). The beads were washed three times with PBS supplemented with 0.5% NP-40 and analyzed by western blotting. Co-precipitation of collagen mRNAs was analyzed by extracting total RNA from the immunoprecipitation reactions and performing semi- quantitative RT-PCR and qRT-PCR reactions. All immunoprecipitations were repeated in two independent experiments.
Animal Study:
Male inbred alki Wistar rats weighing 150- 200 grams and approximately 50 days of age were obtained from Charles River. The procedure was done in accordance to the approved Florida
State University Animal Care and Use Committee protocol number 1119. The animals were acclimated for 5 days upon arrival by housing with 12h dark-light cycle and receiving standard chow diet with ab libitum access to water and food. At the start of the study, drinking water was replaced by 5% ethanol as the only source of liquid and the rats were allowed to drink at will.
Alcohol containing water was changed every 3 days to maintain the 5% ethanol level. The liquid intake and body weight was recorded daily. Carbon tetrachloride (CCl4) was administered intraperitoneally (i.p.) at 0.5 µl/g of CCl4 in mineral oil twice a week for 4 weeks [141, 157].
FK506 was dissolved in 200 uL of Cremaphor (Sigma) and injected at daily dose of 4 mg/kg for
89
4 weeks (28 days). Control animals received by i.p. injections the Cremaphor vehicle. Eight animals were used per condition (4 conditions total) to average for the biological variability and for statistical analysis. The groups were as follows: group 1: 5% ethanol liquid + CCl4 injections; group 2: 5% ethanol liquid + CCl4 injections + FK506 treatment; group 3: FK506 treatment only; group 4: vehicle only. Four weeks after the start of treatment and 24h after the last injection the animals will be deeply anesthetized to avoid suffering with 80-140 mg/kg Ketamine + 10 mg/kg
Xylazine. The depth of anesthesia was measured by checking for the absence of the pedal/tail withdrawal reflexes. Blood was collected by puncture of the abdominal aorta. Animals were euthanized by exsanguination after blood collection, followed by liver removal. A part of the largest liver lobe was fixed in 10% formalin for histological analysis. Total RNA and protein were extracted from parts of this and other liver lobes and analyzed by RT-PCR and western blotting.
Histology Analysis:
Fixed liver tissue was embedded in paraffin and 10 µM thick slices were placed on microscope slides. Slices were prepared for H&E and Masson’s trichrome staining. The degree of hepatic fibrosis was and other histological changes were evaluated by one of the authors (J.B.).
Quantification of the degree of fibrosis was done using Image J software with Treshold-color plug-in logarithm. Percent fibrosis was calculated by dividing the area of fibrosis (blue regions) by the total area.
ALT and AST Determination:
ALT and AST were measured by standard kinetic protocol #2920 and #2930 using the Stanbio
Laboratory reagents. Positive and negative controls were included in the analysis and all samples were analyzed in duplicates.
90
Statistical Analysis:
The equation for the determination of Standard Error was computed using biostatistics program
GraphPad Prism 3.0 or Microsoft Excel. The statistical significance between groups for the in- vivo study was determined by analysis of variance (ANOVA). Type I error (α) and type II error
(β) were set at 0.05 and 0.01 respectively. Student’s t-test was used to assess the statistical significance between two groups. The statistical significance was determined to be at p<0.05 and the error bars shown in figures represent ± 1 SD.
TABLE 2
Primer Sets
F: AGAGGCGAAGGCAACAGTCG h-collagen α1 (I) R: GCAGGGCCAATGTCTAGTCC F: CTTCGTGCCTAGCAACATGC h-collagen α2 (I) R: TCAACACCATCTCTGCCTCG F: TGAGCCAGCAGATTGAGAAC r-collagen α1 (I) R: TGATGGCATCCAGGTTGCAG F: CTCACTCCTGAAGGCTCTAG r-collagen α2 (I) R: CTCCTAACCAGACATGCTTG F: GTGCGTGACATTAAGGAGAAG h-actin R: GAAGGTAGTTTCGTGGATGCC F: CGTGCGTGACATTAAAGAGAAGC r-actin R: TGCATGCCACAGGATTCCATACC F: ACAGAGAGAAGATGACGCAG r-αSMA R: GGAAGATGATGCAGCAGTAG F: GGATCATACTGGTGCGAGGT r-CD64 R: TTGCTTTCTTCCCCTTCTCA F: CAAAAAGGCTGCCACTCTTC r-CD68 R: GTGGGAGAAACTGTGGCATT F: AGATGTGGAACTGGCAGAGG r-TNF-α R: CCCATTTGGGAACTTCTCCT F: CTGTGACTCGTGGGATGATG r-interleukin 1β R: GGGATTTTGTCGTTGCTTG F: CCGGAGAGGAGACTTCACAG r-interleukin 6 R: ACAGTGCATCATCGCTGTTC F: AAGGCGCAAGTGAGACTGAT r-lipopolysaccharide binding protein R: AGTCGAGGTCGTGGAGCTTA h = human, r = rat,
91
CHAPTER FIVE
LA RIBONUCLEOPROTEIN DOMAIN FAMILY MEMBER 6
(LARP6); A CRUCIAL FACTOR IN REGULATING
CILIOGENESIS AND NEURAL TUBE FORMATION DURING
VERTEBRATE ONTOGENY
The contributions to this project were equally shared by me and Dr. Koichi Tanaka. In addition,
Dr. Yoichi Kato’s expertise and equipment were absolutely essential and instrumental in development of this project.
5.1 - Introduction
Currently, LARP6 has only been described in context of collagen synthesis with no other known function. Since in vast biological systems one protein usually has numerous functions it is likely that LARP6 may have other roles, in addition to its well-established role in collagen synthesis. Finding other targets and understanding complete biological function of LARP6 is in particular of interest to the lab, as LARP6 is a primary target for antifibrotic treatment. In search for additional LARP6 functions, we used microinjections into Xenopus laevis (X.laevis) embryos in Dr. Kato’s lab.
It is important to note that both LARP6 and collagen mRNAs are highly conserved between humans and X.laevis, making X.laevis a very powerful animal model with obvious advantages to our study. The embryos can readily be obtained, are sturdy and larger in size with identifiable blastomeres. The eggs can be cultured in vitro and the ovulation can be stimulated year round to
92 obtain large number of eggs. Gene and protein levels can be easily manipulated by injecting specific mRNAs or morpholino oligo-nucleotides (nucleic acid analogs used to knockdown gene expression) into embryos. This model system also allows us to monitor phenotypical changes under dissection microscope. Xenopus embryogenesis follows a very well defined developmental cycle. About 60 minutes after fertilization of the embryos at 25ºC, a 2 cell stage is reached with two distinct regions separated into animal and vegetal poles. The next division happens in 30 minutes as the embryo enters stage 3 (4 cells) with initiation of cortical cytoplasmic flow [158-
160]. The next dozen divisions follow a very fast progression with no cell cycle gap phases. This results to an embryo composed of about 4000 cells and a formation of the blastocyst cavity [161,
162]. This blastula embryo contains three distinct regions, the animal cap which gives rise to ectoderm, marginal zone forms mesoderm and the vegetal mass forms endoderm. By the stage 10 cell movement initiates and marks the beginning of the gastrulation events that converts the embryo into three definitive layers with distinct axes [158].
Gastrulation is characterized by drastic cellular changes including cell mobility and although detailed process differs slightly between animal groups, the cellular mechanisms are shared among all groups. The primary germ layers are organized into 1) ectoderm (animal pole) that forms skin, brain and nervous system, 2) mesoderm (transition zone, the middle layer) forms muscle, circulatory system and the skeletal system, 3) endoderm (vegetal zone) forms the lining of internal organs. During the process of gastrulation, rows of cells interlocate forming the process called “convergent extension” that closes the blastospore and elongates the embryo at its posterior-anterior axis [163-165]. Furthermore, during the apical constriction epithelial cell start narrowing which results in a cell bending inwards creating a local invagination [166-168].
93
Changes of ectoderm from cuboidal into columnar epithelial cells initiate development of neural plate and the process of neurulation. Changes of cell adhesion result into plate folding and formation of a tube-like structure. In X.laevis the entire neural tube closes simultaneously that is slightly different from humans as the middle of the tube closes first and then triggers closure of both ends [169-171]. The early phase of neural plate development can be categorized into 4 distinct processes, 1. differentiation of ectoderm into neuroepithelium, 2. converging and elongation of the neural plate, 3. convergence of neural plate into a neural fold and 4. cilium formation and signal transduction of neural plate cells [172-175]. In embryos, the neural plate (a flat sheet of neuroepithelial cells) is the first step of neurulation, which gives rise to the neural tube (a tube-like structure) that further developed into the brain and the spinal cord [172]. Failure of neural tube closure results in a severe and fetal phenotype that leads to developmental catastrophe and is the most common form of neural tube defect [176]. Neural tube defects are one of the major causes of miscarriages and are common birth defects as it affects 0.1% of infants that either die shortly after birth or suffer from severe mental retardation [176, 177].
Organogenesis starts after about 24 hours of fertilization that also is the initiation of collagen synthesis with metamorphosis starting at stage 45, about 4 days post fertilization. The entire developmental process takes about 60 days with the stage 66 marking the end of the development and start of maturation.
In this study, the discovery that knockdown of LARP6 resulted in failure of neural tube closure lead us to investigate new functions of LARP6 unrelated to the collagen synthesis.
94
5.2-Results
LARP6 expression profile in developing embryos
In the last 4 years, LARP6 has been studied extensively as a key regulator of collagen synthesis. In search for additional functions of LARP6, we analyzed the temporal expression during embryogenesis at different stages of embryonic development, as indicated in figure 27A.
LARP6 mRNA was detected as early as stage 2, indicating maternal expression with slight increase at stage 8 that reached its full peak of expression at stage 15 (Fig. 27A). This was in particular of interest since Kubota lab and our lab have shown that type I collagen mRNA is not expressed in early embryo but only after stage 19 (neurula stage) [83]. Next, we analyzed the spatial expression of LARP6. LARP6 expression at stage 9 was detected around the animal pole with continuous expression outlining the neural plate in stages 14 and somites in stage 18. Later its expression was in somites and eye foci at stage 24 and in notochord at stage 30 (Fig. 27B). In addition, we checked for the mRNA expression of FKBP3 and type III collagen (Fig. 27A). Type
III collagen expression closely parallels that of type I collagen. FKBP3, described in chapters 3 and 4 as protein involved in collagen synthesis, showed very weak expression at early stages of embryogenesis (stages 2-15) with increasingly higher concentration at later stages (stages 19-30).
This paralleled collagen expression and such expression profile of FKBP3 in embryogenesis further suggests its role in collagen synthesis.
95
Figure 27. LARP6 expression pattern in Xenopus laevis embryos. A. Expression profile of LARP6, FKBP3 and type III collagen (COL III) at different stages of X. laevis embryonic development. The mRNA expression was analyzed by semi-quontitative RT-PCR. B. Spatial expression of LARP6 in embryos. Whole mount in situ hybridization of X. laevis embryos. Pink staining indicates LARP6 mRNA and arrows point to the expression sites. a-anterior, d-dorsal, p- posterior, v-ventral sides of the embryo.
Role of LARP6 in neural tube formation
To analyze the function of LARP6 in embryonic development we knocked down
LARP6 in X.laevis embryos by injecting LARP6 specific morholino oligo (MO) which inhibits
96 translation of LARP6 mRNA. To confirm the knock-down we analyzed LARP6 protein expression at stage 11. LARP6 MO eradicated LARP6 protein expression almost completely when compared to a non-specific control MO (Fig. 28A). To further test the specificity of the
LARP6 MO we constructed full size human LARP6 clone (hLARP6) which is resistant to the
LARP6 MO. This construct was co-injected with LARP6 MO into the embryos (Figure 28B) and was able to rescue the protein expression at two different stages, stage 10 and stage 20. The ability to efficiently knockdown LARP6 and to rescue the expression with the resistant construct allowed us to proceed with analysis of the phenotypical changes.
Figure 28. LARP6-MO expression efficiency in X. laevis. A. 60 ng of LARP6 MO injected into the animal pole at stage 2, eradicated protein expression at stage 11 of 2HA-LARP6. Control MO (CON) when co-injected with the 2HA-LARP6 did not impair LARP6 expression. Actin was used as loading control. B. HA tagged human LARP6 resistant to MO was co-injected with LARP6-MO. LARP6 was measured at stage 10 and 20 by immunoblotting.
To test loss of function of LARP6 during development we injected 60 ng of LARP6
MO into the dorsal site of 4-cell-stage embryos (Fig. 28 A and B). The analysis of 73 embryos
(n=73) injected with LARP6-MO showed that knockdown of LARP6 resulted in the failure of neural tube closure in 82% of the embryos (Fig. 29 A,D,G, different views shown). The defects of neural tube closure were rescued by co-injection of the hLARP6, MO-resistant clone. (Fig. 29
B,E,H). The control MO had no impact on neural tube development (Fig. 29 C,F,I), suggesting
97 that the effect is LARP6 specific. Figure 29 J,K,L indicate the percentage of embryos with the observed phenotypes, categorized by normal (blue), gastrulation problems (green) and failure of neural tube closure (red). The result suggested that LARP6 predominantly regulates the developmental pathway leading to proper neural tube closure.
Figure 29. Knockdown of LARP6 in X. laevis results in failure of neural tube closure. Different views showing specific changes (arrows) and brackets pointing to the opening of the neural tube A. D. G. Fixed X.L. embryo at stage 21 dorsal side of the animal pole injected with 60ng of LARP6 MO at stage 3 (4 cells). B. E. H. rescue experiment with LARP6 MO co-injected with the hLARP6. C. F. I. 60 ng of control MO. VIEWS: a-anterior, d-dorsal, p-posterior, v-ventral. J. K. L. total count of embryos under each condition with indicative percentage change categorized in 3 major groups at either normal (blue), gastrulation (green) and neural tube failure to close (red).
98
Since LARP6 has multiple domains we wanted to map out the domain of LARP6 important participating in the process of neural tube development. We constructed a series of
LARP6 constructs and tested them for the rescue of the phenotype (Fig. 30A). The data revealed two important results. First, the only two constructs that were able to rescue the phenotype are the full size wild type LARP6 and LARP6 carrying mutations of two amino-acids. These 2 amino acid substitutions significantly reduced binding affinity to the 5’SL of collagen mRNAs, but the mutant was able to efficiently rescue the phenotype (n=91, 95%), further supporting the
LARP6 function independent to the collagen synthesis. The C-terminal domain of LARP6 and any other truncation mutant of LARP6 were not able to rescue the phenotype.
In figure 30B, we further analyzed the wild type LAPR6 and the LARP6 mutant constructs that successfully rescued the neural tube closure for stimulation of expression of collagen RNA, by semi-quantitative RT-PCR. LARP6 knockdown (LARP6-MO) analysis failed to close neural tube and had significant reduction of collagen expression. Collagen expression starts at stage 19 and is dramatically increased when wild type hLARP6 (resistant to MO) was co-injected into the embryo (Fig. 30B, middle section). The mutant form of LARP6 (MUT-
LARP6) that binds poorly to the 5’SL rescued the neural tube phenotype, but failed to rescue collagen expression in LARP6 knock-down embryos (Fig. 30B, right panel). This further suggested that LARP6 function in neural tube closure is completely independent of its ability to stimulate collagen synthesis and is due to a different mechanism unrelated to binding 5’SL.
99
Figure 30. Neural tube closure requires full size LARP6. A. Schematic representations of LARP6 constructs used. Numbers indicate amino acid number in the protein. LARP6 domains are also indicated. The ability of constructs to bind 5’SL of collagen and to rescue neural tube closure defect is indicated to the right. B. Expression of collagen α1(I) mRNA at stage 19, 24 and 30 in embryos injected with LARP6 MO, LARP6 MO + hLARP6 rescue clone and LARP6 MO + MUT-LARP6. ODC, internal loading control mRNA.
LARP6 controls neural tube closure through formation of primary cilia.
To examine the mechanism of neural tube development in the absence of LARP6 we examined epithelial remodeling and shaping of the neural plate by the planer cell polarity assay
(PCP). In this assay we injected LARP6-MO or CON-MO into animal pole at stage 2. At stage 8
(5 hours post fertilization) animal cap was removed by well-established protocol and animal cap cells isolated for further culturing. These cells were cultured in presence or absence of activin, a growth factor which induces convergent extension [178]. The cells from LARP6 knockdown
100 embryos were able to undergo convergent extension, suggesting that LARP6 knock-down did not affect the mobility of the cells within the neural plate (Fig. 31). To test the viability of neural plate cells we need to look for apoptotic and mitotic markers and this is a future direction.
Figure 31. LARP6-MO did not interfere with the convergent extension pathway. LARP6 MO was injected into animal pole of two blastomeres of 2-cell stage embryos and embryos were cultured until stage 8. Animal cap explants were dissected and cultured with activin. Performed by Koichi Tanaka.
Next we checked if LARP6 knockdown changed neural induction process. We checked the expression of the pan-neural marker, sox2, by whole mount in situ hybridization, but its expression was unchanged (Fig. 32). In figure 32A we show the expression profile of sox2 at stage 14. The quantitative analysis of 30 embryos per group showed no statistical difference in sox2 expression (Fig. 32B). This indicated that the absence of LARP6 did not interfere with formation and shaping of the neural plate.
101
Figure 32. Sox2 expression is not affected by LARP6 knock-down. The expression of Sox2 at stage 14 was tested by whole-mount in situ hybridization. The percentage of the Sox2-expressing embryo in 3 injection protocols (CON-MO: n=32; LARP6-MO: n=35; LARP-MO+hLARP6: n=31) is shown. Data supplied by Dr. Koichi Tanaka.
Recent studies have indicated that cilia may have implications in proper neural tube formation [173, 175]. There are two types of cilia, the primary cilia and the motile cilia [179]. In mammalians, one primary cilium is found on almost every cell and is predominantly used as a sensory organ [173, 180]. Although cilium was discovered about 100 years ago it was not studied until the last 2 decades. Cilium is now known to have functions in cell signaling, cell division and differentiation, organogenesis, polarity of tissues and some human disorders are associated with malfunction of the cilia [173, 180-182]. Neural plate has primary cilium and cilia have been associated with neural tube closure. To test if LARP6 may have a role on ciliogenesis, we examined the cilia on cells in the neural tube in LARP6 knockdown and control embryos.
The embryos were injected at stage 3 at the dorsal marginal zone with 60 ng of LARP6-MO or
60 ng of CON-MO and co-injected with the Membrane RFP (red) to indicate the site of injection
102 and stain the membranes. The embryos were then collected for immunohistochemistry staining at stage 25. We used anti-acetylated tubulin antibody, as the cilia marker (Fig. 33). Embryos were sanctioned transversely (as indicated at the top panel cartoon) and analyzed by confocal microscopy. We observed reduced cell number in LARP6 MO injected neural tube, but all the remaining cells lacked the cilium. This suggested that knockdown of LARP6 resulted in absence of cilia and that the failure of neural tube closure may be the secondary effect due to lack of cilia.
To test the specificity of the knock-down the rescue with hLARP6 restored cilia formation, suggesting that the LARP6 plays an important role in regulating ciliogenesis. To test this further we will use additional cilia markers such as ARL13B to verify the absence of cilia (in progress).
Figure 33. Knock-down of LARP6 results in loss of cilia. LARP6 MO or CON MO was injected in both dorsal blastomeres at 4 cell stage. The embryos were cultured until sage 25, fixed and analyzed by immunohistochemistry with acetylated tubulin antibody (green), and membrane RFP (red). Transversal sections were visualized by confocal microscopy. The approximate section of the slice is indicated. Arrows indicate cilia.
103
Previous studies have implied that notochord plays an important source in signal transduction important in neural tube development [183]. In addition, there are several components of SHH pathway associated with the cilium. To test if LARP6 knockdown may have influenced SHH expression we analyzed the embryos by semi-quantitative RT-PCR. The analysis of sonic hedgehog (SHH) and its receptor PTCH1 showed drastic reduction in LARP6 knockdown embryos. Future work will be required to analyze the effect of LARP6 knockdown on the SHH signaling pathway. Regulation of SHH may be yet another function of LARP6 that needs to be characterized if LARP6 effects are through a direct pathway or indirectly by modulating ciliogenesis.
LARP6 regulated genes participating in ciliogenesis.
LARP6 has devoted a large portion of the protein to RNA binding and it is possible that LARP6 may bind mRNAs that are involved in ciliogenesis. To determine which mRNAs may be regulated by LARP6 we measured expression of the most known genes required for development of cilia. First, we analyzed transcription factors regulating cilia related genes, such as HNF1β, RFXs and NOTO (Fig. 34 A). In line with this we injected embryos with LARP6-
MO, CON-MO, or rescue combination (LARP6-MO+hLARP6) and analyzed the mRNA expression by semi-quantitative RT-PCR at stage 20. Both HNF1β and NOTO were not affected, as seen in figure 34 B. Analysis of RFXs, transcription factor superfamily indicated that RFX4 and RFX7 were the only two family members showing significant decrease in expression with
LARP6 knock-down. We further confirmed these results in mammalian cells by knocking down
LARP6 in human lung fibroblasts, as shown in figure 34C. LARP6 knockdown was analyzed by western (Fig. 34C, bottom panel), and the corresponding RNA analysis (Fig. 34C, top panel)
104 showed drastic reduction of RFX4 expression, with modest decrease in RFX7 expression, similar to the X. laevis analysis (Fig. 34B).
We also looked at other markers of ciliogenesis in X. laevis embryos, like ARL13B
(ciliary protein with GTPase activity) [184], MIG12, TTC25 (intraflageller proteins) [185], XFY
(effector of planar cell polarity pathway) [186], FOXJ1 (transcription factor) [187]. ARL13B,
TTC25 and FOXJ1 all showed a decreased expression, which could be rescued by supplementing
LARP6. If the rescue can also restore the cilia, is being currently tested. Since ARL13B and
TTC25 are cilia proteins it is not a surprise to see their lower expression in LARP6 knockdown.
FOXJ1 is a transcription factor that regulates genes of the motile cilium (not the primary cilium).
The XFY, which regulates cell polarity, was affected by LARP6 knockdown, what is in agreement with results of the animal cap assay described before. This analysis identified potential targets of LARP6 involved in cilia formation. In particular, we focused on RFX4 and preliminary results suggest that neural tube closure defect induced by LARP6 MO can be rescued by supplementing RFX4 (work in progress).
Figure 34. Expression profile of genes associated with ciliogenesis in LARP6 knock-down embryos. A. Schematic cascade of ciliogenesis pathway (from Thomas et al., 2010). B. RT-PCR expression of the genes involved in ciliogenesis. RNA was isolated from X.L. embryo at stage 20. CON, internal loading control ODC. C. LARP6 knockdown in Human Lung Fibroblasts. Top panel: analysis of RNA, GAPDH, loading control. Bottom panel, knockdown of LARP6 with actin loading control (ACT). 105
5.3 – Discussion
This work, as my collaboration with Dr. Kato and Dr. Koichi, revealed novel results:
1) novel function of LARP6 in neural tube closure and unrelated to collagen synthesis has been identified. 2) requirement of LARP6 for ciliogenesis has been demonstrated.
Knock-down of LARP6 in X. laevis’ embryos results in opened neural tube and lack of cilia formation in the neural plate. These events take place much earlier than the onset of collagen synthesis in the embryo. Supplementing LARP6 to the knocked down embryos can completely reverse the effect. Only the full size LARP6 can rescue the phenotype, suggesting the involvement of all domains and interactions with multiple other proteins. LARP6 with mutations of the two amino critical for collagen 5’SL RNA binding could also rescue neural tube formation. This suggests that it is unlikely that RNA binding of LARP6 to any structure similar to the 5’SL is involved in the process. LARP6 is maternal and is present in all stages of development, whereas collagen production starts around stage 19 of X. laevis’ development. This further supported the notion of LARP6 functions unrelated to collagen synthesis.
So far there have been no reports on the involvement of any of the LARP proteins in ciliogenesis. Knock-down of LARP6 results in complete absence of cilia within the neural tube.
Since cilia are necessary for neural tube closure, it is highly likely that the primary phenotype is the absence of cilia and that neural tube closure is the secondary event. Therefore, it was critical to identify the genes which are affected by LARP6 and relate their function to ciliogenesis. By analyzing genes, expression of which is down-regulated by absence of LARP6 I discovered several candidate genes which have a role in ciliogenesis. Of particular interest is the transcription factor RFX4. Knock-down of LARP6 in mammalian cells also resulted in down- regulation of RFX4. RFXs are transcription factors that recognize X-BOX promoter elements
106 and these elements are found in some genes important for ciliogenesis [188-191]. RFX4 knockdown in mice has been implicated in dorsal midline defects and perinatal death [192-194].
In addition, RFX4 with mutation in the dimerization domain of the protein fails to localize to the nucleus. Transgenic mice carrying this mutation have loss of function of cilia, down regulation of SHH and embryonic lethality [192]. This raises the interesting possibility that LARP6 regulates RFX4 and this hypothesis is the subject of current and future studies. Overall, this work will contribute to our understanding of neural tube formation, ciliogenesis and molecular events pertaining to developmental defects of neural tube.
5.4 - Materials and Methods
In vitro Fertilization of X. laevis:
In vitro fertilization is done by mixing egg with homogenated testis, culturing and staging of embryos was done in accordance with well-established techniques [195, 196].
Immunoblotting:
Proteins from embryos at specified stage were homogenized in RIPA lysis buffer in addition with cocktail of protease inhibitors. The yoke was carefully removed and the protein samples were separated by the SDS PAGE. Antibodies used, anti-HA and anti-beta Actin (Sigma-
Aldrich).
Microinjections:
RNAs used in rescue experiments were generated by in vitro transcription. Morpholino Oligos
(MO) were generated by Gene Tools, LLC with sequence shown in Table 3. The microinjections were performed in 3% Ficoll 400 in 0.1× Marc’s Modified Ringer’s solution (MMR solution) and injected embryos were further transferred and cultured in 0.1× MMR. Concentrations of all
107
RNA injected per embryo were set at 1ng with beta- galactoside (β-gal) of 200 pg for observing injection tracing in whole-mount in situ hybridization.
Animal Caps Explants Assay:
Adapted by Dr. Koichi Takana. Embryos were staged according to the normal stage of Xenopus laevis development (Nieuwkoop and Faber, 1967). Animal caps were isolated from stage 8 control and experimental embryos in 0.5 x MMR using forceps under a dissection microscope.
Explants were incubated in the presence or absence of 10 ng/ ml human recombinant activin A
(Stemgent) in 0.5xMMR with 0.1 µg/ml BSA (Fisher Scientific) for 18 hours at room temperature (RT).
Beta-Galactosidase Staining and Whole-Mount In Situ Hybridization:
Adapted by Dr. Koichi Takana. Embryos were fixed with MEMFA (0.1M MOPS, 2mM EGTA
[pH8.0], 1mM MgSO4 and 3.7% formaldehyde) containing 0.02% Triton-X for 30 min at RT.
Galactosidase activity was visualized with the RedGal substrate (Research Organics) in staining buffer (5 mM K3[Fe(CN)6], 5 mM K4[Fe(CN)6], 2 mM MgCl2 in PBS). After staining, embryos were refixed with MEMFA for 30 min. Whole-mount in situ hybridization was performed essentially as described previously (Harland, 1991; Takada et al., 2005) by using
Digoxigenin (Roche Applied Science)-labeled antisense RNA probes and BM purple (Roche
Applied Science) for the chromogenic reaction.
Immunohistochemistry:
Adapted by Dr. Koichi Takana. Embryos were fixed with MEMFA for 2.5 hours at RT. After fixing the embryos were replaced in methanol and stored at -20˚C at least for 1hour. After rinsing with PBS and PBT (2mg/ml BSA, 0.1% Triton X in PBS), embryos were blocked with
PBTS (10% goat serum in PBT) for 1 hour at RT. After blocking the embryos were incubated
108 with anti-acetylated tubulin antibody (Sigma) overnight at 4˚C. After rinsing with PBT for 6 times, the embryos were incubated with Cy2-conjugated anti-goat antibody (Millipore) for overnight at 4˚C. After rinsing with PBT, the embryos were embedded in Tissue Freezing
Medium (Sakura) and sectioned to a 200 μm in thickness on a cryostat at − 22 °C. After washing with PBS for 5 min, the sections were observed by a Leica confocal laser microscope.
RT-PCR analysis:
Total RNA was isolated using RNA isolation kit (Sigma-Aldrich). The RNA was treated with
DNaseI to remove contaminating DNA and analyzed by two RT-PCR techniques. RT-PCR with radiolabeling of the PCR products was done as previously described [35, 53, 58, 95]. Briefly,
50ng of total RNA was reverse transcribed using rTth reverse transcriptase (Boca Scientific) and the primer specific for the mRNA under analysis. The PCR reactions were performed in the presence of α32P-dATP. PCR products were visualized by autoradiography. The identity of the
PCR bands was verified by sequencing and by their expected size.
Statistical Analysis:
The equation for the determination of Standard Error was computed using biostatistics program
GraphPad Prism 3.0 or Microsoft Excel. The statistical significance between groups for the in- vivo study was determined by analysis of variance (ANOVA). Type I error (α) and type II error
(β) were set at 0.05 and 0.01 respectively. Student’s t-test was used to assess the statistical significance between two groups. The statistical significance was determined to be at p<0.05 and the error bars shown in figures represent ± 1 SD.
109
Table 3:
Morpholino Oligos and Primer Set sequences
LARP6 MO 5'TCTCCTCGGGCTCCTCCATGTCACT3' RFX4 MO 5'GCTGCTGTTCCTCTTCCATGATTGC3' RFX7 MO 5'GCTGTTCAGTAAGCCACAATGCAT3' CON MO 5'CCTCTTACCTCAgTTACAATTTATA3' XFY 5' ACGATGTTCCCATTCTCCAG XFY 3' GAGTGAGGTGCCAGAGAAGC RFX2 5' GGCAGCCAGACAGTTTCTTC RFX2 3' TGCACAGGAGACATTGAAGC ARL13B 5' AGTGCTCTGCTGGCGATAAT ARL13B 3' ACTGCTCTGCTGGCGATAAT TTC25 5' TCCTGAAAGGAGCCAGAAGA TTC25 3' GCGTGTCCAGGTACAGGATT MIG12 5' GGGAGAGGACAGGAAAAAGG MIG12 3' ACATGGGCTTTTCTGGTGAG NOTO 5' TCCAGATCATCCTCGTCCTC NOTO 3' GCAATACATGGTTGGCACTG RFX7 5' GCCAACTCCAACTCCAACAT RFX7 3' TAGGTGTGAACGCAAATGGA HIPI 5' CCCCAGCTGAAAGTCACAAT HIPI 3' AGCTGCTCCAGTTGGTTGTT RFX6 5' TGAAAAATGCAGATGCAGG RFX6 3' CCAGAATGCTGTTCAGACGA hRFX7 5' TGCTTATGGAGCAGCAAATG hRFX7 3' TTGGGGTTGGAGTAGGAGTG LARP6 5' TGTGCGCAAAAACAAGTCTC LARP6 3' TTGTCCACAAGGGCTACTCC RFX1 5' ACCGAGTGGACTTCACCAAC RFX1 3' AAGTTTCAGCACCTGGGAGA RFX4 5' TCCAAGCTGGGCACTTTACT RFX4 3' GAACCCAACACAGGAAGCAT hRFX4 5' CAGCTATCTCTGGGCCACTC hRFX4 3' AGTTTCCGTACCTCGTCGCAGAA COLIII 5' CTGCAACATGGAAACTGGTG COLIII 3' CCTCAGGAAGCTCTGCATCT ODC 5' GGGCTGGATCGTATGGTAGA ODC 3' CTTCAGGGAGAATGCCATGT FKBP3 5' GGCCAGCTGACTTTTCTTTG FKBP3 3' CGCGAGTGGAGTAATGAACA all primers are derived from X.L. sequences but if indicated by (h): human
110
CHAPTER SIX
SUMMARY AND DEVELOPMENT OF NEW METHODOLOGY
TO STUDY COORDINATED TRANSLATION OF COLLAGEN
MRNAS
Hepatic fibrosis caused by chronic alcohol abuse, hepatitis B and C, chemochromatosis and nonalcoholic steatohepatitis (NASH) increasingly represents a worldwide medical problem with a high mortality rate [7, 9, 197]. Despite the medical advances, there are no effective anti- fibrotic drugs available, and the only option in late fibrotic stages is liver transplantation. Liver fibrosis of any etiology results in activation of hepatic stellate cells (HSC), which are primary cells responsible for excessive collagen synthesis and its extracellular deposition (scarring) during the development of fibrosis [14]. This excessive collagen deposition is a central to pathogenesis of hepatic fibrosis and is primarily due to dramatic up-regulation of type I collagen synthesis at the post-transcriptional level [34, 105]. The long term goal in our lab and the main topic of this dissertation is to elucidate the factors involved in translational regulation of type I collagen mRNAs and validate them for anti-collagen therapy as a cure for liver fibrosis. mRNAs encoding for type I collagen have a unique 5’ stem loop structure (5’SL) that contains the start codon that is the key regulatory element [33]. To understand this regulation our lab has recently characterized a novel protein, La ribonucleoprotein domain family member 6 (LARP6), as the protein which binds the 5’SL of collagen mRNAs [53]. LARP6 directly binds the 5’SL and may act as an integral component for the assembly of a more complex ribonucleoprotein particle
(mRNP) including factors like RHA, vimentin, non-muscle myosin and STRAP [53]. In this
111 dissertation we report that: 1) LARP6 interacts with RHA and mediates RHA association with collagen α1(I) and α2(I) mRNAs in vivo; 2) We mapped RHA expression profile in primary hepatic stellate cells and showed that RHA is required for efficient collagen synthesis; 3) We showed that RHA is necessary for polysomal loading and activation of collagen mRNAs translation; 4) we identified another LARP6 interacting protein essential in collagen synthesis,
FKBP3; 5) we elucidated that FKBP3 is regulating collagen synthesis indirectly, by stabilizing and preventing LARP6 from proteasomal degradation; 6) we targeted FKBP3 with FK506, an immunosuppressant drug, this reduced collagen expression predominantly due to a reduced excretion of collagen into the cellular medium. 7) FK506 also inhibited the activation of HSC, as judged by expression of the marker of activation, αSMA; 8) we showed that, in vivo, in an alcohol induced model of hepatic fibrosis, FK506 completely prevented the development of fibrosis; 9) our in vivo study is the first to provide an insight into the mechanism of antifibrotic effect of FK506, which is unrelated to its well described immune activity: 10) the work in collaboration with Dr. Yoichi Kato and his postdoctoral associate Dr. Koichi Tanaka has shown that LARP6 as a crucial factor in regulating neural tube closure during early stages of Xenopus laevis development and that this activity is independent of collagen synthesis; 11) the same work identified lack of cilia development in the LARP6 knockdown embryos, suggesting a role of
LARP6 in cilia formation; 12) preliminary evidence was obtained suggesting that transcription factors RFX4 and RFX7 are downstream target of LARP6 in ciliogenesis.
Taking into account these 12 contributions, I believe that this dissertation has significantly contributed to the better understanding of collagen synthesis and has discovered a novel way to regulate ciliogenesis. It also provides the necessary basis for further research leading to discovery of antifibrotic drugs. In the last part of this dissertation I will describe the
112 pioneering new methodology that will be used in future studies. Of particular interest is application of this methodology to elucidate the mechanism of the coordinated translation of collagen α1(I) and α2(I) mRNAs. This hypothesis states that in order to produce heterotrimeric type I collagen, collagen α1(I) mRNA and collagen α2(I) mRNA must be translated in a well- defined sub-regions on the membrane of the ER and not randomly throughout the compartment.
Such organization increases the local concentration of collagen polypeptides to allow folding of two α1(I) chains and one α2(I) chain and prevents assembly of the α1(I) homotrimers. The methodology used to demonstrate this was initiated by the former member of this lab Dr.
Azariyas Challa, with collaborative efforts from Dr. Robert Singer at Albert Einstein College of
Medicine, and was further refined by my work. To verify the hypothesis of the spatial co- translation of two collagen mRNAs it is necessary to visualize both transcripts at the same time.
To directly visualize molecules of collagen mRNA in vivo we applied RNA fluorescent in situ hybridization (RNA FISH) [198, 199]. To achieve the required specificity and signal-to-noise ratio 5 short oligonucleotide probes, specific for collagen α1(I) mRNA and 5 specific for collagen α2(I) mRNA were designed and labeled with Cy2 (green) and Cy5 (red) fluorescent dyes, respectively [58]. We hybridized these probes to permebilized cells, either human lung fibroblast cells or human hepatic stellate cells and collected the fluorescent images using confocal microscope. It is important to note that we have also reversed the labeling on our probes with the same results. This ensured that the signal recorded was not refraction and that different excitement and emission peaks by the same probe resulted in reproducible results. The analysis of co-localization (yellow spots) is semi-quantitative in nature and multiple algorithms have to be applied, so we compared two parameters using ImageJ software, the Mander’s (overlay of
Cy2 and Cy5 signals) and the Pearson’s (individual intensity of Cy2 and Cy5 signals), with
113 sequential acquisition of the images. For future analysis this technique can be expended to visualize interactions not only between individual chains of collagen mRNAs but also with interactions of other factors by applying immunofluorescence.
Figure 35 shows the images. To verify that our hybridization probes specifically detect collagen mRNAs, we hybridized them to HeLa cells, which do not transcribe collagen genes and have no detectable levels of collagen mRNAs. As seen in Fig. 35A, no red or green fluorescent signal was obtained, verifying that there is no nonspecific hybridization. Then, we analyzed HLf and the image in Fig. 35B shows a representative cell from of 3 independent experiments with 15 individual cells analyzed per experiment. Collagen α1(I) (COL1A1) mRNA was visualized with
Cy5 oligonucleotides and appeared as multiple, red, well defined spots in the peri-nuclear region
(Fig. 35B). Collagen α2(I) mRNA (COL1A2) was visualized with Cy2 oligonucleotides and appeared as green dots, also well-defined and localized around the nucleus. Nuclear staining is blue (DAPI) and the cell boundary was visualized by the transmitted light (TL) imaging. The large overlayed image is shown at the bottom of Fig. 35B, to visualize the yellow dots, which represent overlapping collagen α1(I) and α2(I) signals. Not all collagen α1(I) and α2(I) co- localized, but we estimated that 34% of collagen mRNAs in this cells showed strict co- localization (yellow dots). Considering that only about 30-40% of collagen mRNAs are actively engaged with the translating polysomes, while the rest is not in the phase of translation elongation or not translated at all (Fig. 7), the result strongly supports the hypothesis that collagen mRNAs are co-localized and probably coordinately translated.
To monitor changes of the mRNA distribution we treated the cells with ML-7, a myosin light chain kinase inhibitor that disrupts non-muscle myosin filaments. ML-7 treatment results in lack of secretion of collagen polypeptides and their accelerated intracellular degradation,
114 suggesting that without non-muscle myosin filaments individual collagen polypeptides cannot fold into a triple helix. To visualize if collagen mRNA localization is disrupted by ML-7 treatment and if this is the reason for the inefficient collagen synthesis observed we treated hLFs with ML-7 and stained for collagen mRNAs. The changes in collagen mRNAs localization were remarkable and there was a complete uncoupling of collagen α1(I) and α2(I) mRNAs (Fig. 35C).
Collagen α1(I) mRNA accumulated in several much larger granules in and around the nucleus
(red, indicated by arrows), while collagen α2(I) mRNA (green) was still visualized in the cytoplasm as discrete dots, but a fraction seemed to re-enter the nucleus as discrete dots were seen within the nuclear compartment. There was no obvious co-localization of the two collagen mRNAs and the yellow signal was estimated to represent only 7% of the total signal. A similar result was obtained for human HSCs.
Figure 35. Co-localization of collagen mRNAs. RNA FISH of collagen α1(I) mRNA (red) and α2(I) mRNA (green), nuclear staining blue, with co-localization (yellow). A. Signal in HeLa cells (negative control, because these cells lack collagen expression). Individual channels and the overlay are shown. DAPI, nuclear staining. B. RNA FISH in human lung fibroblast. The cell outline is shown as a mirror image from the transmitted light (TL) channel. The overlay of collagen α1(I) channel (COL1A1, red) and α2(I) channel (COL1A2, green) is shown at the bottom. The percentage of the co-localization (yellow) was estimated by Image J software. C. Same as in B. but the cells were treated with ML-7.
115
The RNA FISH method described above may have future implications, as it will be used as a powerful tool to analyze localization of collagen mRNA under variety of conditions. The manipulations include dissociation of polysomes with puromycin, induction of stress granules by arsenite, knock-down of LARP6 or FKBP3 or vimentin by siRNAs. This future work will complement the results described in this dissertation and provide continuation of the successful elucidation of the molecular mechanism that governs collagen synthesis in fibrosis. The ultimate goal is to discover and validate antifibrotic drugs and I believe that this dissertation provided a major contribution to this goal.
116
APPENDIX A
ACUC PROTOCOL 1123
117
APPENDIX B
ACUC PROTOCOL 1119
118
APPENDIX C
ACUC PROTOCOL 1213
119
APPENDIX D
RNA JOURNAL APPROVAL OF REPRODCUTION
Dear Zarko Manojlovic,
As the editor of RNA and a representative of the RNA Society I give you permission to reproduce the following article:
A novel role of RNA helicase A in regulation of translation of type I collagen mRNAs Zarko Manojlovic and Branko Stefanovic RNA February 2012 18: 321-334
The article will be reproduced in a thesis at Florida State University. If you require additional documentation other than this email or if your institution has its own required form, please let me know.
Sincerely, Timothy W. Nilsen
120
APPENDIX E
PLOS ONE JOURNAL APPROVAL OF REPRODCUTION
Dear Zarko:
I have been traveling last week and have been very busy catching up. Your PLOS`1 manuscript is on my desk. I have had a cha ce to read the revised a uscript PONE-D-13-0 0 Tacroli us FK 0 prevents early stages of ethanol induced hepatic fibrosis by targeting LARP6 dependent mechanism of collagen synthesis PLO“ ONE . I believe that you have satisfactorily responded to all of the initial review questions and comments and I have recommended publication. .
It will take a few days for you to receive the official letter of acceptance from the Editorial office. In the meantime my recommendation to accept the manuscript will have to suffice. You can certainly include paper that in your dissertation reference list.
It is a very nice paper. Good luck with your dissertation defense.
Sincerely,
Arthur Veis, Ph.D.
Academic Editor, PLOS 1. Professor Emeritus of Biochemistry and Molecular Biology Department of Cell and Molecular Biology Feinberg School of Medicine, Northwestern University 303 E. Chicago Avenue Chicago, IL 60611 Phone: 312-503-1355; Fax: 312-503-2544 [email protected]
121
REFERENCES
1. Friedman, S.L., Liver fibrosis - from bench to bedside. Journal of Hepatology, 2003. 38: p. S38-S53.
2. Tsukada, S., C.J. Parsons, and R.A. Rippe, Mechanisms of liver fibrosis. Clin Chim Acta, 2006. 364(1-2): p. 33-60.
3. Wynn, T.A., Common and unique mechanisms regulate fibrosis in various fibroproliferative diseases. J Clin Invest, 2007. 117(3): p. 524-9.
4. Wynn, T.A., Cellular and molecular mechanisms of fibrosis. J Pathol, 2008. 214(2): p. 199-210.
5. Friedman, S.L., Evolving challenges in hepatic fibrosis. Nat Rev Gastroenterol Hepatol, 2010. 7(8): p. 425-36.
6. Chedid, A., et al., Prognostic factors in alcoholic liver disease. VA Cooperative Study Group. Am J Gastroenterol, 1991. 86(2): p. 210-6.
7. Lieber, C.S., Ethanol metabolism, cirrhosis and alcoholism. Clin Chim Acta, 1997. 257(1): p. 59-84.
8. Gravitz, L., Introduction: a smouldering public-health crisis. Nature, 2011. 474(7350): p. S2-4.
9. Jansen, P.L., Non-alcoholic steatohepatitis. Eur J Gastroenterol Hepatol, 2004. 16(11): p. 1079-85.
10. Das, K. and P. Kar, Non-alcoholic steatohepatitis. J Assoc Physicians India, 2005. 53: p. 195-9.
11. Friedman, S.L. and M.B. Bansal, Reversal of hepatic fibrosis -- fact or fantasy? Hepatology, 2006. 43(2 Suppl 1): p. S82-8.
12. Friedman, S.L., Hepatic stellate cells. Prog Liver Dis, 1996. 14: p. 101-30.
13. Friedman, S.L., Cytokines and fibrogenesis. Semin Liver Dis, 1999. 19(2): p. 129-40.
122
14. Friedman, S.L., Stellate cell activation in alcoholic fibrosis--an overview. Alcohol Clin Exp Res, 1999. 23(5): p. 904-10.
15. Gressner, A.M. and R. Weiskirchen, Modern pathogenetic concepts of liver fibrosis suggest stellate cells and TGF-beta as major players and therapeutic targets. J Cell Mol Med, 2006. 10(1): p. 76-99.
16. Jiang, F. and B. Stefanovic, Homeobox gene Prx1 is expressed in activated hepatic stellate cells and transactivates collagen alpha1(I) promoter. Exp Biol Med (Maywood), 2008. 233(3): p. 286-96.
17. Mak, K.M., M.A. Leo, and C.S. Lieber, Alcoholic liver injury in baboons: transformation of lipocytes to transitional cells. Gastroenterology, 1984. 87(1): p. 188-200.
18. Pares, A., et al., Acetaldehyde activates the promoter of the mouse alpha 2(I) collagen gene. Hepatology, 1994. 19(2): p. 498-503.
19. Rippe, R.A. and D.A. Brenner, From quiescence to activation: Gene regulation in hepatic stellate cells. Gastroenterology, 2004. 127(4): p. 1260-1262.
20. Tao, L.H., et al., Appearance of denuded hepatic stellate cells and their subsequent myofibroblast-like transformation during the early stage of biliary fibrosis in the rat. Med Electron Microsc, 2000. 33(4): p. 217-30.
21. Aycock, R.S. and J.M. Seyer, Collagens of normal and cirrhotic human liver. Connect Tissue Res, 1989. 23(1): p. 19-31.
22. Leask, A. and D.J. Abraham, TGF-beta signaling and the fibrotic response. FASEB J, 2004. 18(7): p. 816-27.
23. Verrecchia, F., A. Mauviel, and D. Farge, Transforming growth factor-beta signaling through the Smad proteins: role in systemic sclerosis. Autoimmun Rev, 2006. 5(8): p. 563-9.
24. Rodriguez-Vita, J., et al., Angiotensin II activates the Smad pathway in vascular smooth muscle cells by a transforming growth factor-beta-independent mechanism. Circulation, 2005. 111(19): p. 2509-17.
25. Naito, T., et al., Angiotensin II induces thrombospondin-1 production in human mesangial cells via p38 MAPK and JNK: a mechanism for activation of latent TGF- beta1. Am J Physiol Renal Physiol, 2004. 286(2): p. F278-87.
123
26. Fertin, C., et al., Interleukin-4 stimulates collagen synthesis by normal and scleroderma fibroblasts in dermal equivalents. Cell Mol Biol, 1991. 37(8): p. 823-9.
27. Kivirikko, K.I., Collagen biosynthesis: a mini-review cluster. Matrix Biol, 1998. 16(7): p. 355-6.
28. Pardo, A. and M. Selman, Matrix metalloproteases in aberrant fibrotic tissue remodeling. Proc Am Thorac Soc, 2006. 3(4): p. 383-8.
29. Lindquist, J.N., B. Stefanovic, and D.A. Brenner, Regulation of collagen alpha1(I) expression in hepatic stellate cells. J Gastroenterol, 2000. 35 Suppl 12: p. 80-3.
30. Brenner, D.A., et al., Stimulation of the collagen alpha 1 (I) endogenous gene and transgene in carbon tetrachloride-induced hepatic fibrosis. Hepatology, 1993. 17(2): p. 287-92.
31. Eckes, B., et al., Downregulation of collagen synthesis in fibroblasts within three- dimensional collagen lattices involves transcriptional and posttranscriptional mechanisms. FEBS Lett, 1993. 318(2): p. 129-33.
32. Houglum, K., et al., Two different cis-acting regulatory regions direct cell-specific transcription of the collagen alpha 1(I) gene in hepatic stellate cells and in skin and tendon fibroblasts. J Clin Invest, 1995. 96(5): p. 2269-76.
33. Stefanovic, B., C. Hellerbrand, and D.A. Brenner, Regulatory role of the conserved stem- loop structure at the 5' end of collagen alpha1(I) mRNA. Mol Cell Biol, 1999. 19(6): p. 4334-42.
34. Stefanovic, B., et al., Posttranscriptional regulation of collagen alpha1(I) mRNA in hepatic stellate cells. Mol Cell Biol, 1997. 17(9): p. 5201-9.
35. Stefanovic, B., J. Lindquist, and D.A. Brenner, The 5' stem-loop regulates expression of collagen alpha1(I) mRNA in mouse fibroblasts cultured in a three-dimensional matrix. Nucleic Acids Res, 2000. 28(2): p. 641-7.
36. Stefanovic, B., B. Schnabl, and D.A. Brenner, Inhibition of collagen alpha 1(I) expression by the 5' stem-loop as a molecular decoy. J Biol Chem, 2002. 277(20): p. 18229-37.
37. Bogdanovic, Z., et al., Upstream regulatory elements necessary for expression of the rat COL1A1 promoter in transgenic mice. J Bone Miner Res, 1994. 9(2): p. 285-92.
124
38. Chung, K.Y., et al., An AP-1 binding sequence is essential for regulation of the human alpha2(I) collagen (COL1A2) promoter activity by transforming growth factor-beta. J Biol Chem, 1996. 271(6): p. 3272-8.
39. Ramirez, F., S. Tanaka, and G. Bou-Gharios, Transcriptional regulation of the human alpha2(I) collagen gene (COL1A2), an informative model system to study fibrotic diseases. Matrix Biol, 2006. 25(6): p. 365-72.
40. Zhang, W., et al., Synergistic cooperation between Sp1 and Smad3/Smad4 mediates transforming growth factor beta1 stimulation of alpha 2(I)-collagen (COL1A2) transcription. J Biol Chem, 2000. 275(50): p. 39237-45.
41. Rossert, J., H. Eberspaecher, and B. de Crombrugghe, Separate cis-acting DNA elements of the mouse pro-alpha 1(I) collagen promoter direct expression of reporter genes to different type I collagen-producing cells in transgenic mice. J Cell Biol, 1995. 129(5): p. 1421-32.
42. Rossert, J.A., et al., Identification of a minimal sequence of the mouse pro-alpha 1(I) collagen promoter that confers high-level osteoblast expression in transgenic mice and that binds a protein selectively present in osteoblasts. Proc Natl Acad Sci U S A, 1996. 93(3): p. 1027-31.
43. Lindquist, J.N., W.F. Marzluff, and B. Stefanovic, Fibrogenesis. III. Posttranscriptional regulation of type I collagen. Am J Physiol Gastrointest Liver Physiol, 2000b. 279(3): p. G471-6.
44. Rippe, R.A. and B. Stefanovic, Methods for assessing the molecular mechanisms controlling gene regulation. Methods Mol Med, 2005. 117: p. 141-60.
45. Stefanovic, B. and D.A. Brenner, 5' stem-loop of collagen alpha 1(I) mRNA inhibits translation in vitro but is required for triple helical collagen synthesis in vivo. J Biol Chem, 2003. 278(2): p. 927-33.
46. Fritz, D., et al., Progress towards discovery of antifibrotic drugs targeting synthesis of type I collagen. Curr Med Chem, 2011. 18(22): p. 3410-6.
47. Lindquist, J.N., et al., Regulation of alpha1(I) collagen messenger RNA decay by interactions with alphaCP at the 3'-untranslated region. J Biol Chem, 2004. 279(22): p. 23822-9.
125
48. Lindquist, J.N., et al., Characterization of the interaction between alphaCP(2) and the 3'- untranslated region of collagen alpha1(I) mRNA. Nucleic Acids Res, 2000. 28(21): p. 4306-16.
49. Yamada, Y., M. Mudryj, and B. de Crombrugghe, A uniquely conserved regulatory signal is found around the translation initiation site in three different collagen genes. J Biol Chem, 1983. 258(24): p. 14914-9.
50. Hartman, T.R., et al., RNA helicase A is necessary for translation of selected messenger RNAs. Nat Struct Mol Biol, 2006. 13(6): p. 509-16.
51. Li, J., et al., A role for RNA helicase A in post-transcriptional regulation of HIV type 1. Proc Natl Acad Sci U S A, 1999. 96(2): p. 709-14.
52. Parsons, C.J., et al., Mutation of the 5'-untranslated region stem-loop structure inhibits alpha1(I) collagen expression in vivo. J Biol Chem, 2011. 286(10): p. 8609-19.
53. Cai, L., et al., Binding of LARP6 to the conserved 5' stem-loop regulates translation of mRNAs encoding type I collagen. J Mol Biol, 2010. 395(2): p. 309-26.
54. Cai, L., et al., Nonmuscle myosin-dependent synthesis of type I collagen. J Mol Biol, 2010. 401(4): p. 564-78.
55. Simerly, C., et al., Differential expression and functions of cortical myosin IIA and IIB isotypes during meiotic maturation, fertilization, and mitosis in mouse oocytes and embryos. Mol Biol Cell, 1998. 9(9): p. 2509-25.
56. Conrad, P.A., et al., Relative distribution of actin, myosin I, and myosin II during the wound healing response of fibroblasts. J Cell Biol, 1993. 120(6): p. 1381-91.
57. Beck, K., et al., Triple helix formation of procollagen type I can occur at the rough endoplasmic reticulum membrane. J Biol Chem, 1996. 271(35): p. 21566-73.
58. Challa, A.A. and B. Stefanovic, A novel role of vimentin filaments: binding and stabilization of collagen mRNAs. Mol Cell Biol, 2011. 31(18): p. 3773-89.
59. Clarke, E.J. and V. Allan, Intermediate filaments: vimentin moves in. Curr Biol, 2002. 12(17): p. R596-8.
126
60. Eckes, B., et al., Impaired wound healing in embryonic and adult mice lacking vimentin. J Cell Sci, 2000. 113 ( Pt 13): p. 2455-62.
61. Challa, A.A., et al., Withaferin-A reduces type I collagen expression in vitro and inhibits development of myocardial fibrosis in vivo. PLoS One, 2012. 7(8): p. e42989.
62. Fujii, R., et al., A Role of RNA Helicase A in cis-Acting Transactivation Response Element-mediated Transcriptional Regulation of Human Immunodeficiency Virus Type 1. J Biol Chem, 2001. 276(8): p. 5445-51.
63. Zhang, S. and F. Grosse, Multiple functions of nuclear DNA helicase II (RNA helicase A) in nucleic acid metabolism. Acta Biochim Biophys Sin (Shanghai), 2004. 36(3): p. 177- 83.
64. Cordin, O., et al., The DEAD-box protein family of RNA helicases. Gene, 2006. 367: p. 17-37.
65. Chuang, R.Y., et al., Requirement of the DEAD-Box protein ded1p for messenger RNA translation. Science, 1997. 275(5305): p. 1468-71.
66. Lee, C.G. and J. Hurwitz, A new RNA helicase isolated from HeLa cells that catalytically translocates in the 3' to 5' direction. J Biol Chem, 1992. 267(7): p. 4398-407.
67. Lee, C.S., et al., Human DDX3 functions in translation and interacts with the translation initiation factor eIF3. Nucleic Acids Res, 2008. 36(14): p. 4708-18.
68. Jackson, R.J. and M. Wickens, Translational controls impinging on the 5'-untranslated region and initiation factor proteins. Curr Opin Genet Dev, 1997. 7(2): p. 233-41.
69. Kozak, M., Regulation of translation via mRNA structure in prokaryotes and eukaryotes. Gene, 2005. 361: p. 13-37.
70. Jin, Y.J. and S.J. Burakoff, The 25-kDa FK506-binding protein is localized in the nucleus and associates with casein kinase II and nucleolin. Proc Natl Acad Sci U S A, 1993. 90(16): p. 7769-73.
71. Ochocka, A.M., et al., FKBP25, a novel regulator of the p53 pathway, induces the degradation of MDM2 and activation of p53. FEBS Lett, 2009. 583(4): p. 621-6.
127
72. Frizell, E., et al., Fk506 Enhances Fibrogenesis in an Invitro and Invivo Model of Liver Fibrosis. Hepatology, 1991. 14(4): p. A49-A49.
73. Jin, Y.J., S.J. Burakoff, and B.E. Bierer, Molecular cloning of a 25-kDa high affinity rapamycin binding protein, FKBP25. J Biol Chem, 1992. 267(16): p. 10942-5.
74. Bataller, R. and D.A. Brenner, Hepatic stellate cells as a target for the treatment of liver fibrosis. Semin Liver Dis, 2001. 21(3): p. 437-51.
75. Bitterman, P.B. and C.A. Henke, Fibroproliferative disorders. Chest, 1991. 99(3 Suppl): p. 81S-84S.
76. Li, D. and S.L. Friedman, Liver fibrogenesis and the role of hepatic stellate cells: new insights and prospects for therapy. J Gastroenterol Hepatol, 1999. 14(7): p. 618-33.
77. Fallowfield, J.A., Therapeutic targets in liver fibrosis. Am J Physiol Gastrointest Liver Physiol, 2011. 300(5): p. G709-15.
78. Fallowfield, J.A., T.J. Kendall, and J.P. Iredale, Reversal of fibrosis: no longer a pipe dream? Clin Liver Dis, 2006. 10(3): p. 481-97, viii.
79. Iredale, J.P., et al., Mechanisms of spontaneous resolution of rat liver fibrosis. Hepatic stellate cell apoptosis and reduced hepatic expression of metalloproteinase inhibitors. J Clin Invest, 1998. 102(3): p. 538-49.
80. Aleynik, S.I., et al., Polyenylphosphatidylcholine prevents carbon tetrachloride-induced lipid peroxidation while it attenuates liver fibrosis. J Hepatol, 1997. 27(3): p. 554-61.
81. Brown, K.E., et al., Effect of vitamin E supplementation on hepatic fibrogenesis in chronic dietary iron overload. Am J Physiol, 1997. 272(1 Pt 1): p. G116-23.
82. Svegliati Baroni, G., et al., Fibrogenic effect of oxidative stress on rat hepatic stellate cells. Hepatology, 1998. 27(3): p. 720-6.
83. Goto, T., et al., Expression and characterization of Xenopus type I collagen alpha 1 (COL1A1) during embryonic development. Dev Growth Differ, 2000. 42(3): p. 249-56.
84. Manojlovic, Z. and B. Stefanovic, A novel role of RNA helicase A in regulation of translation of type I collagen mRNAs. RNA, 2012. 18(2): p. 321-34.
128
85. Chester, N., et al., Stage-specific apoptosis, developmental delay, and embryonic lethality in mice homozygous for a targeted disruption in the murine Bloom's syndrome gene. Genes Dev, 1998. 12(21): p. 3382-93.
86. Butsch, M., et al., The 5' RNA terminus of spleen necrosis virus contains a novel posttranscriptional control element that facilitates human immunodeficiency virus Rev/RRE-independent Gag production. J Virol, 1999. 73(6): p. 4847-55.
87. Hull, S. and K. Boris-Lawrie, RU5 of Mason-Pfizer monkey virus 5' long terminal repeat enhances cytoplasmic expression of human immunodeficiency virus type 1 gag-pol and nonviral reporter RNA. J Virol, 2002. 76(20): p. 10211-8.
88. Roberts, T.M. and K. Boris-Lawrie, The 5' RNA terminus of spleen necrosis virus stimulates translation of nonviral mRNA. J Virol, 2000. 74(17): p. 8111-8.
89. Short, J.D. and C.M. Pfarr, Translational regulation of the JunD messenger RNA. J Biol Chem, 2002. 277(36): p. 32697-705.
90. van Dam, H. and M. Castellazzi, Distinct roles of Jun : Fos and Jun : ATF dimers in oncogenesis. Oncogene, 2001. 20(19): p. 2453-64.
91. Kozak, M., The scanning model for translation: an update. J Cell Biol, 1989. 108(2): p. 229-41.
92. Merrick, W.C., Cap-dependent and cap-independent translation in eukaryotic systems. Gene, 2004. 332: p. 1-11.
93. Sonenberg, N. and A.C. Gingras, The mRNA 5' cap-binding protein eIF4E and control of cell growth. Curr Opin Cell Biol, 1998. 10(2): p. 268-75.
94. Pelletier, J. and N. Sonenberg, Insertion mutagenesis to increase secondary structure within the 5' noncoding region of a eukaryotic mRNA reduces translational efficiency. Cell, 1985. 40(3): p. 515-26.
95. Fritz, D. and B. Stefanovic, RNA-binding protein RBMS3 is expressed in activated hepatic stellate cells and liver fibrosis and increases expression of transcription factor Prx1. J Mol Biol, 2007. 371(3): p. 585-95.
96. Bolinger, C., et al., RNA helicase A interacts with divergent lymphotropic retroviruses and promotes translation of human T-cell leukemia virus type 1. Nucleic Acids Res, 2007. 35(8): p. 2629-42.
129
97. Stefanovic, L., et al., Inhibitory effect of dicationic diphenylfurans on production of type I collagen by human fibroblasts and activated hepatic stellate cells. Life Sci, 2005. 76(17): p. 2011-26.
98. Friedman, S.L., Hepatic stellate cells: protean, multifunctional, and enigmatic cells of the liver. Physiol Rev, 2008. 88(1): p. 125-72.
99. Weiskirchen, R. and A.M. Gressner, Isolation and culture of hepatic stellate cells. Methods Mol Med, 2005. 117: p. 99-113.
100. Mak, K.M. and C.S. Lieber, Lipocytes and transitional cells in alcoholic liver disease: a morphometric study. Hepatology, 1988. 8(5): p. 1027-33.
101. Aratani, S., et al., Dual roles of RNA helicase A in CREB-dependent transcription. Mol Cell Biol, 2001. 21(14): p. 4460-9.
102. Lee, C.G., et al., RNA helicase A is essential for normal gastrulation. Proc Natl Acad Sci U S A, 1998. 95(23): p. 13709-13.
103. Nakajima, T., et al., RNA helicase A mediates association of CBP with RNA polymerase II. Cell, 1997. 90(6): p. 1107-12.
104. Jin, J., et al., Evidence that Lin28 stimulates translation by recruiting RNA helicase A to polysomes. Nucleic Acids Res, 2011.
105. Stefanovic, B., C. Hellerbrand, and D.A. Brenner, Post-transcriptional regulation of collagen alpha 1(I) mRNA in hepatic stellate cells. Nucleic Acids Symp Ser, 1995(33): p. 212-4.
106. He, T.C., et al., A simplified system for generating recombinant adenoviruses. Proc Natl Acad Sci U S A, 1998. 95(5): p. 2509-14.
107. Graham, F.L., et al., Characteristics of a human cell line transformed by DNA from human adenovirus type 5. J Gen Virol, 1977. 36(1): p. 59-74.
108. Dignam, J.D., R.M. Lebovitz, and R.G. Roeder, Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res, 1983. 11(5): p. 1475-89.
130
109. Veyrune, J.L., et al., A localisation signal in the 3' untranslated region of c-myc mRNA targets c-myc mRNA and beta-globin reporter sequences to the perinuclear cytoplasm and cytoskeletal-bound polysomes. J Cell Sci, 1996. 109 ( Pt 6): p. 1185-94.
110. Alam, J. and J.L. Cook, Reporter genes: application to the study of mammalian gene transcription. Anal Biochem, 1990. 188(2): p. 245-54.
111. Schmid, F.X., Prolyl isomerase: enzymatic catalysis of slow protein-folding reactions. Annu Rev Biophys Biomol Struct, 1993. 22: p. 123-42.
112. Yang, W.M., Y.L. Yao, and E. Seto, The FK506-binding protein 25 functionally associates with histone deacetylases and with transcription factor YY1. Embo Journal, 2001. 20(17): p. 4814-4825.
113. Friedman, S.L., Molecular regulation of hepatic fibrosis, an integrated cellular response to tissue injury. J Biol Chem, 2000. 275(4): p. 2247-50.
114. Kettenbach, A.N., J. Rush, and S.A. Gerber, Absolute quantification of protein and post- translational modification abundance with stable isotope-labeled synthetic peptides. Nat Protoc, 2011. 6(2): p. 175-86.
115. Gerber, S.A., et al., The absolute quantification strategy: application to phosphorylation profiling of human separase serine 1126. Methods Mol Biol, 2007. 359: p. 71-86.
116. Kirkpatrick, D.S., S.A. Gerber, and S.P. Gygi, The absolute quantification strategy: a general procedure for the quantification of proteins and post-translational modifications. Methods, 2005. 35(3): p. 265-73.
117. Gerber, S.A., et al., Absolute quantification of proteins and phosphoproteins from cell lysates by tandem MS. Proc Natl Acad Sci U S A, 2003. 100(12): p. 6940-5.
118. Friedman, S.L., Evolving challenges in hepatic fibrosis. Nature Reviews Gastroenterology & Hepatology, 2010. 7(8): p. 425-436.
119. Hernandez-Gea, V. and S.L. Friedman, Pathogenesis of Liver Fibrosis. Annual Review of Pathology: Mechanisms of Disease, Vol 6, 2011. 6: p. 425-456.
120. Cook, R.T., Alcohol abuse, alcoholism, and damage to the immune system--a review. Alcohol Clin Exp Res, 1998. 22(9): p. 1927-42.
131
121. Lieber, C.S., Alcoholic fatty liver: its pathogenesis and mechanism of progression to inflammation and fibrosis. Alcohol, 2004. 34(1): p. 9-19.
122. Canbay, A., S. Friedman, and G.J. Gores, Apoptosis: The nexus of liver injury and fibrosis. Hepatology, 2004. 39(2): p. 273-278.
123. McCaughan, G.W., et al., Molecular pathogenesis of liver disease: an approach to hepatic inflammation, cirrhosis and liver transplant tolerance. Immunol Rev, 2000. 174: p. 172-91.
124. Lamande, S.R. and J.F. Bateman, Procollagen folding and assembly: The role of endoplasmic reticulum enzymes and molecular chaperones. Seminars in Cell & Developmental Biology, 1999. 10(5): p. 455-464.
125. Michnick, S.W., et al., Solution structure of FKBP, a rotamase enzyme and receptor for FK506 and rapamycin. Science, 1991. 252(5007): p. 836-9.
126. Wiederrecht, G., et al., The mechanism of action of FK-506 and cyclosporin A. Ann N Y Acad Sci, 1993. 696: p. 9-19.
127. Steinmann, B., A. Superti-Furga, and P. Bruckner, Mechanism of action of FK 506 and cyclosporin. Lancet, 1991. 337(8738): p. 439.
128. Kino, T., et al., Fk-506, a Novel Immunosuppressant Isolated from a Streptomyces .2. Immunosuppressive Effect of Fk-506 Invitro. Journal of Antibiotics, 1987. 40(9): p. 1256- 1265.
129. Kondo, H., et al., Efficacy and safety of tacrolimus (FK506) in treatment of rheumatoid arthritis: a randomized, double blind, placebo controlled dose-finding study. J Rheumatol, 2004. 31(2): p. 243-51.
130. Cetinkale, O., et al., Modulating the functions of neutrophils and lipid peroxidation by FK506 in a rat model of thermal injury. Burns, 1999. 25(2): p. 105-12.
131. Garcia-Criado, F.J., et al., Tacrolimus (FK506) down-regulates free radical tissue levels, serum cytokines, and neutrophil infiltration after severe liver ischemia. Transplantation, 1997. 64(4): p. 594-8.
132. Kawano, K., et al., Evidence That Fk506 Alleviates Ischemia-Reperfusion Injury to the Rat-Liver - in-Vivo Demonstration for Suppression of Tnf-Alpha Production in Response to Endotoxemia. European Surgical Research, 1994. 26(2): p. 108-115.
132
133. Suzuki, S., et al., Neutrophil Infiltration as an Important Factor in Liver Ischemia and Reperfusion Injury - Modulating Effects of Fk506 and Cyclosporine. Transplantation, 1993. 55(6): p. 1265-1272.
134. Tunon, M.J., et al., Effects of FK506 and rapamycin on generation of reactive oxygen species, nitric oxide production and nuclear factor kappa B activation in rat hepatocytes. Biochem Pharmacol, 2003. 66(3): p. 439-45.
135. Nagano, J., et al., Use of tacrolimus, a potent antifibrotic agent, in bleomycin-induced lung fibrosis. European Respiratory Journal, 2006. 27(3): p. 460-469.
136. Frizell, E., et al., Fk506 Enhances Fibrogenesis in in-Vitro and in-Vivo Models of Liver Fibrosis in Rats. Gastroenterology, 1994. 107(2): p. 492-498.
137. Patsenker, E., et al., Potent antifibrotic activity of mTOR inhibitors sirolimus and everolimus but not of cyclosporine A and tacrolimus in experimental liver fibrosis. J Hepatol, 2011. 55(2): p. 388-98.
138. Schnabl, B., et al., Replicative senescence of activated human hepatic stellate cells is accompanied by a pronounced inflammatory but less fibrogenic phenotype. Hepatology, 2003. 37(3): p. 653-64.
139. de Graaf, I.A.M., et al., Preparation and incubation of precision-cut liver and intestinal slices for application in drug metabolism and toxicity studies. Nature Protocols, 2010. 5(9): p. 1540-1551.
140. Zimmermann, M., et al., Improved reproducibility in preparing precision-cut liver tissue slices. Cytotechnology, 2009. 61(3): p. 145-152.
141. Younes, M., W. Reichl, and C.P. Siegers, Effect of carbon tetrachloride--alcohol-induced liver fibrosis on microsomal mixed-function oxidases and the cytosolic glutathione- conjugating system in rat liver. Xenobiotica, 1983. 13(1): p. 47-51.
142. Siegers, C.P., et al., Effects of dithiocarb and (+)-catechin against carbon tetrachloride- alcohol-induced liver fibrosis. Agents Actions, 1982. 12(5-6): p. 743-8.
143. Sakuma, S., et al., FK506 potently inhibits T cell activation induced TNF-alpha and IL-1 beta production in vitvo by human peripheral blood mononuclear cells. British Journal of Pharmacology, 2000. 130(7): p. 1655-1663.
133
144. Keeley, E.C., B. Mehrad, and R.M. Strieter, Fibrocytes: Bringing new insights into mechanisms of inflammation and fibrosis. International Journal of Biochemistry & Cell Biology, 2010. 42(4): p. 535-542.
145. Stienstra, R., et al., Kupffer cells promote hepatic steatosis via interleukin-1 beta- dependent suppression of peroxisome proliferator-activated receptor alpha activity (vol 51, pg 511, 2010). Hepatology, 2011. 53(4): p. 1415-1415.
146. Palsson-McDermott, E.M. and L.A.J. O'Neill, Signal transduction by the lipopolysaccharide receptor, Toll-like receptor-4. Immunology, 2004. 113(2): p. 153- 162.
147. Pugin, J., et al., Lipopolysaccharide Activation of Human Endothelial and Epithelial- Cells Is Mediated by Lipopolysaccharide-Binding Protein and Soluble Cd14. Proc Natl Acad Sci U S A, 1993. 90(7): p. 2744-2748.
148. Zhang, X., et al., Effects of lipopolysaccharides stimulated Kupffer cells on activation of rat hepatic stellate cells. World Journal of Gastroenterology, 2004. 10(4): p. 610-613.
149. Schreiber, S.L. and G.R. Crabtree, The mechanism of action of cyclosporin A and FK506. Immunol Today, 1992. 13(4): p. 136-42.
150. Takeda, Y., et al., Calcineurin inhibition attenuates mineralocorticoid-induced cardiac hypertrophy. Circulation, 2002. 105(6): p. 677-9.
151. Uchida, J., et al., Renal endothelin in FK506-induced nephrotoxicity in spontaneously hypertensive rats. Jpn J Pharmacol, 1998. 76(1): p. 39-49.
152. Makareeva, E. and S. Leikin, Procollagen Triple Helix Assembly: An Unconventional Chaperone-Assisted Folding Paradigm. PLoS One, 2007. 2(10).
153. Gotkin, M.G., et al., Intracellular trafficking and degradation of unassociated pro alpha(I) collagen chains. Molecular Biology of the Cell, 1997. 8: p. 2617-2617.
154. Ripley, C.R. and R.S. Bienkowski, Localization of procollagen I in the lysosome/endosome system of human fibroblasts. Experimental Cell Research, 1997. 236(1): p. 147-154.
155. Su, G.L., et al., Activation of human and mouse Kupffer cells by lipopolysaccharide is mediated by CD14. American Journal of Physiology-Gastrointestinal and Liver Physiology, 2002. 283(3): p. G640-G645.
134
156. Iwasaki, K., Metabolism of tacrolimus (FK506) and recent topics in clinical pharmacokinetics. Drug Metab Pharmacokinet, 2007. 22(5): p. 328-35.
157. Guo, M.Z., et al., Rhein inhibits liver fibrosis induced by carbon tetrachloride in rats. Acta Pharmacol Sin, 2002. 23(8): p. 739-44.
158. Heasman, J., Patterning the early Xenopus embryo. Development, 2006. 133(7): p. 1205- 1217.
159. Landstrom, U., H. Lovtruprein, and S. Lovtrup, Control of Cell-Division and Cell- Differentiation by Deoxynucleotides in Early Embryo of Xenopus-Laevis. Cell Differentiation, 1975. 4(5): p. 313-325.
160. Larrain, J.A., Dorsal and ventral patterning during early development of the Xenopus embryo. Developmental Biology, 2007. 306(1): p. 287-287.
161. Newport, J.W. and M.W. Kirschner, Regulation of the Cell-Cycle during Early Xenopus Development. Cell, 1984. 37(3): p. 731-742.
162. Waiter, J. and J.W. Newport, Regulation of replicon size in Xenopus egg extracts. Science, 1997. 275(5302): p. 993-995.
163. Shindo, A., et al., Fritz regulates the membrane stability mediated by septins dynamics during Convergent Extension in Xenopus embryo. Developmental Biology, 2010. 344(1): p. 450-450.
164. Carron, C., et al., Antagonistic interaction between IGF and Wnt/JNK signaling in convergent extension in Xenopus embryo. Mechanisms of Development, 2005. 122(11): p. 1234-1247.
165. Yamada, T. and S.P. Modak, Genetic evidence for posterior specification by convergent extension in the Xenopus embryo. Development Growth & Differentiation, 1998. 40(2): p. 125-132.
166. Choi, S.C. and J.K. Han, Involvement of PAR-6 in the regulation of gastrulation cell movement in Xenopus early development. Developmental Biology, 2001. 235(1): p. 189- 190.
167. Cooke, J., Xenopus Mesoderm Induction - Evidence for Early Size Control and Partial Autonomy for Pattern Development by Onset of Gastrulation. Development, 1989. 106(3): p. 519-529.
135
168. Maleyvar, R.P. and R. Lowery, Correlation between the Cell-Cycle in the Neurectoderm and Differentiation during the Early Development of Xenopus-Laevis .2. Inhibition of DNA-Synthesis and Mitosis during Gastrulation. Cytobios, 1981. 32(126): p. 97-105.
169. Lau, G.T.C., et al., Embryonic expression of Xenopus Mab21l2 is required for neural tube closure, eye development and posterior structure formation. Developmental Biology, 2000. 222(1): p. 264-264.
170. Clarke, J.D.W., et al., Neuroanatomical and Functional-Analysis of Neural-Tube Formation in Notochordless Xenopus-Embryos - Laterality of the Ventral Spinal-Cord Is Lost. Development, 1991. 112(2): p. 499-516.
171. Lowery, R.S., A Reinvestigation of Some of Tissue Movements Involved in Formation of Neural Tube and Eye/Lens System of Triturus Alpestris and Xenopus Laevis. Journal of Embryology and Experimental Morphology, 1966. 16: p. 431-&.
172. Kibar, Z., V. Capra, and P. Gros, Toward understanding the genetic basis of neural tube defects. Clin Genet, 2007. 71(4): p. 295-310.
173. Singla, V. and J.F. Reiter, The primary cilium as the cell's antenna: Signaling at a sensory organelle. Science, 2006. 313(5787): p. 629-633.
174. Wallingford, J.B., Planar cell polarity, ciliogenesis and neural tube defects. Hum Mol Genet, 2006. 15 Spec No 2: p. R227-34.
175. Zohn, I.E., K.V. Anderson, and L. Niswander, Using genomewide mutagenesis screens to identify the genes required for neural tube closure in the mouse. Birth Defects Research Part a-Clinical and Molecular Teratology, 2005. 73(9): p. 583-590.
176. Botto, L.D., et al., Neural-tube defects. N Engl J Med, 1999. 341(20): p. 1509-19.
177. Copp, A.J. and N.D. Greene, Genetics and development of neural tube defects. J Pathol, 2010. 220(2): p. 217-30.
178. Smith, J.C., et al., Identification of a potent Xenopus mesoderm-inducing factor as a homologue of activin A. Nature, 1990. 345(6277): p. 729-31.
179. Nigg, E.A. and J.W. Raff, Centrioles, centrosomes, and cilia in health and disease. Cell, 2009. 139(4): p. 663-78.
136
180. Roy, S., The motile cilium in development and disease: emerging new insights. Bioessays, 2009. 31(7): p. 694-9.
181. Fuchs, J.L. and H.D. Schwark, Neuronal primary cilia: a review. Cell Biol Int, 2004. 28(2): p. 111-8.
182. Goetz, S.C. and K.V. Anderson, The primary cilium: a signalling centre during vertebrate development. Nat Rev Genet, 2010. 11(5): p. 331-44.
183. Litingtung, Y. and C. Chiang, Control of Shh activity and signaling in the neural tube. Dev Dyn, 2000. 219(2): p. 143-54.
184. Chung, M.I., et al., RFX2 is broadly required for ciliogenesis during vertebrate development. Dev Biol, 2012. 363(1): p. 155-65.
185. Hayes, J.M., et al., Identification of novel ciliogenesis factors using a new in vivo model for mucociliary epithelial development. Dev Biol, 2007. 312(1): p. 115-30.
186. Park, T.J., S.L. Haigo, and J.B. Wallingford, Ciliogenesis defects in embryos lacking inturned or fuzzy function are associated with failure of planar cell polarity and Hedgehog signaling. Nat Genet, 2006. 38(3): p. 303-11.
187. Stubbs, J.L., et al., The forkhead protein Foxj1 specifies node-like cilia in Xenopus and zebrafish embryos. Nat Genet, 2008. 40(12): p. 1454-60.
188. Aftab, S., et al., Identification and characterization of novel human tissue-specific RFX transcription factors. BMC Evol Biol, 2008. 8: p. 226.
189. Dorn, A., et al., Conserved major histocompatibility complex class II boxes--X and Y--are transcriptional control elements and specifically bind nuclear proteins. Proc Natl Acad Sci U S A, 1987. 84(17): p. 6249-53.
190. Dubruille, R., et al., Drosophila regulatory factor X is necessary for ciliated sensory neuron differentiation. Development, 2002. 129(23): p. 5487-98.
191. Swoboda, P., H.T. Adler, and J.H. Thomas, The RFX-type transcription factor DAF-19 regulates sensory neuron cilium formation in C. elegans. Mol Cell, 2000. 5(3): p. 411-21.
192. Ashique, A.M., et al., The Rfx4 transcription factor modulates Shh signaling by regional control of ciliogenesis. Sci Signal, 2009. 2(95): p. ra70.
137
193. Blackshear, P.J., et al., Graded phenotypic response to partial and complete deficiency of a brain-specific transcript variant of the winged helix transcription factor RFX4. Development, 2003. 130(19): p. 4539-52.
194. Zarbalis, K., et al., A focused and efficient genetic screening strategy in the mouse: identification of mutations that disrupt cortical development. PLoS Biol, 2004. 2(8): p. E219.
195. Nieuwkoop, P.D. and J. Faber, Normal table of Xenopus laevis (Daudin) : a systematical and chronological survey of the development from the fertilized egg till the end of metamorphosis1994, New York: Garland Pub. 252 p., 10 leaves of plates.
196. Peng, H.B., Xenopus laevis: Practical uses in cell and molecular biology. Solutions and protocols. Methods Cell Biol, 1991. 36: p. 657-62.
197. American Association for the Study of Liver Diseases., Hepatology : official journal of the American Association for the Study of Liver Diseases, 1981, Williams & Wilkins: Baltimore, MD. p. v.
198. Ben-Ari, Y., et al., The life of an mRNA in space and time. J Cell Sci, 2010. 123(Pt 10): p. 1761-74.
199. Femino, A.M., et al., Visualization of single molecules of mRNA in situ. Methods Enzymol, 2003. 361: p. 245-304.
138
BIOGRAPHICAL SKETCH
Zarko Manojlovic completed his Bachelors of Science (B.S.) in Biology with double minors in Mathematics and Chemistry at Thomas University in 2005. Prior to the doctoral program he worked under the advisement of Dr. Blaine Bartholomew at Southern Illinois University School of Medicine on chromatin remodeling project and Dr. Carlos Bolaños-Guzmán at Florida State University Program of Neuroscience on identifying molecular markers associated with drug addiction in specific brain regions. He began the doctoral program in Biomedical Sciences at Florida State University College of Medicine in the fall of 2009 under the mentorship of Professor Branko Stefanovic.
139