DOCSLIB.ORG

Structure and Expression of the Bovine Coronavirus Hemagglutinin Protein

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Structure and Expression of the Bovine Coronavirus Hemagglutinin Protein STRUCTURE AND EXPRESSION OF THE BOVINE CORONAVIRUS HEMAGGLUTININ PROTEIN Thomas E. Kienzle, Sushma Abraham, Brenda G. Hogue 1 and David A. Brian Department of Microbiology The University of Tennessee Knoxville, Tennessee 37996-0845 INTRODUCTION cDNA clones prepared from genomic RNA of the Mebus strain of bovine coronavirus (BCV) were sequenced to reveal the hemagglutinin (H) gene of 1,272 bases that predicts a 47,700 mol. wt. apoprotein of 424 amino acids. The H gene mapped on the immediate 5' side of the peplomer gene. The H protein sequence revealed a putative N-terminal signal peptide of 18 amino acids, 9 potential glycosylation sites, 14 cysteine residues, and a potential C-terminal anchor region of 26 amino acids. When transcripts of the gene were translated in vitro in the presence of microsomes, signal cleavage, glycosylation, and membrane anchorage were observed, but not disulfide-linked dimerization. Translation of a truncated mRNA having no sequence for the C-terminal anchor resulted in a nonanchored, intraluminal (intramicrosomal) protein. When the H protein was expressed in cells in the absence of other coronaviral proteins, it became glycosylated, dimerized, and transported to the cell surface. The BCV hemagglutinin protein, therefore, is a type 1 glycoprotein that contains all the information it needs for signal cleavage, glycosylation, disulfide-linked dimerization, and transport to the cell surface. MATERIALS AND METHODS cDNA Cloning of BCV Genomic RNA The Mebus strain of BCV was grown on human rectal tumor (HRT) cells and purified as previously described (Lapps et. al., 1987). cDNA cloning was done essentially as described (Lapps et. al., 1987), except that random 5-mer oligodeoxynucleotides (Pharmacia) were used as primers for first strand synthesis to generate several clones, one of which was II (Fig. lA). A synthetically made primer (5' ATTATGACCGCACACC 3') was used to extend genomic sequence 5'-ward from clone II, and this was used to generate several clones one of which was LA6 (Fig. lA). Clones were selected by colony hybridization to randomly primed cDNA prepared from lCurrent address: Department of Microbiology and Immunology, UCLA School of Medicine, Center for Health Sciences, Los Angeles, CA 90024 COTOnoviruse3 and Their Diseases Edited by D. Cavanagh and T.D.K. Brown 95 Plenum Press, New York, 1990 genomic RNA, and clones were mapped relative to one another and to the 3' end of the genome using a matrix spot hybridization technique. DNA Sequencing and Sequence Analysis Dideoxy sequencing was used throughout. The ends of clones II and LA6 were sequenced using universal primers for pUC vectors, and the clones were ligated at the Hae 3 site (Fig. IA) to form a continuous sequence mapping in the region of the H gene. The reconstructed sequence was subcloned into pGEM3Z (Promega) and a 3' and 5' nested set of subclones was generated using exonuclease III and SI nuclease (Henikoff, 1984). Subclones were sequenced using universal primers for the pGEM vector, and by synthetic primers that were made complementary to regions within the H gene. Sequences were analyzed with the aid of the Microgenie program (Beckman). Expression Analyses A construct of the H gene beginning 15 bases upstream (i.e., beginning with the CTAAAC intergenic sequence) from the putative ATG start codon (an exonuclease III/SI-generated subclone of the LA6/I1 construct in pGEM4Z) and under the control of the Sp6 polymerase promoter, was made and named pHSp6 (Fig. IB). The same insert was also subcloned into pGEM3Z (using the Eco RI and Hind III sites within the multiple cloning region) such that the H gene was under the control of the T7 polymerase promoter. This was named pHT7 (Fig. IC). For in vitro expression analyses, pHSp6 was linearized with Hind III to yield full-length transcripts, or with Eco R5 to yield transcripts lacking the coding region for the C-terminal anchor, and transcribed with A ki1clb8ses 20 9 8 7 6 5 4 J 2 4' , , , , , , , r::::K::::::::::::+!::::::::::::::::::::::::::::::::::::2p~::::::::::::::::===4"~"8 ~-H::::t:=?=~=Fil=::::::::H """S"""l,i- LH~6 ' }JI-J{In-L_ -----.!.! " ~ 1 11 ~5 LP6L9___ ~HP~A2~~= ______G~6_MA_7 ______ __ Eco R5 H•• 3 '\ ( B c Fig 1. A. Gene map of the BCV genome, cDNA clone positions, and strategy for sequencing the H gene. B. Plasmid construct for generating H transcripts with Sp6 polymerase, C. Plasmid construct for generating H transcripts with T7 polymerase. 96 SP6 polymerase (Promega protocol for yielding capped transcripts). Translation was done in wheat germ extract (Promega) in the presence or absence of canine pancreatic microsomes (Promega). Protein was labeled with 35S-methionine (lCN). lmmunoprecipitates were made using polyclonal rabbit anti gp65 (H subunit) (Hogue et. a7., 1984) by the method of Anderson and Blobel (1983). Carbonate extractions at pH 11 were done by the method of Fujiki et. a7., (1982). Competitive inhibition of N-Linked glycosylation was accomplished with 30~M octanoyl-asparagine-leucine­ threonine (a gift from Dr. F. Naider, City University of New York), in the microsomal-containing translation mixture (Lau et. a7., 1983). Polyacrylamide gel electrophoresis analyses were done as previously described (Hogue et. a7., 1984). For in vivo expression and analysis by immunofluorescence, HRT cells were infected with a vaccinia virus recombinant (vTF7-3, moi of 30) that expresses T7 polymerase (Fuerst et. a7., 1987), transfected with pHT7 plasmid (1 ~g per 1 cm2 ) using Lipofectin Reagent (BRL) to mediate transfection, and prepared at 32h for internal or surface immunofluorescence using the method of Kaariainen et. a7., (1983). For • . 30 . • 60 • • 90 • • 120 CTAAACTCAGTGAAAATG'!TI'T'I'GCTTCTTAGATT:'G'ITCTAGTTAGCTGCATAATTG:3T>"GCC'!'AGGTTl"l'GATAACCCTCC'!'ACCAA'!'G'I'TG'I"!'TCGCATTTAAATGGAGATTGG'l":::'T = M F L L L R F v L V SCI I G S L G F 0 N P P T N V V S H L NM GJ:: Dr WG FF H- .0 IORF1- • . 150 . • 180 • • 210 • . 240 'l"l'A'I'TrGGTGACAG':'CG'I"!'CAGAT'I'GTAATCATGTTG'rl'AATACCAACCCCCGTAATTATl'CTTATATGGACCTTAATCCTGCCCTGTGTGAT!'CTGGTAAAATATCATCTAAAGCTGGC L F G 0 S R soc N H V V N T N P R ~ Y S Y MOL N PAL cOS G K ISS K A G Y L V T V v Q I V I M L LIP T P V I I L I W T L I L P C V I L V K Y H L K L A • • 270 • • 300 • • 330 • • 360 AACTCCATTT'I'TAGGAGTrTTCACTl'TACCGA'l"l"'ITrATAATTACACAGGCGAAGGTCAACAAATTATTI"I"I"l'ATGAGGGTGTTAA'l'T'I"l'ACGCCTTA.TCATGCCTTTAAATGCACCACT N S I FRS F H F T 0 F Y ~ Y T G E G Q Q I I F Y E G V@F T P Y H A F K C T T T P F L G V F T L P I F I I T Q A K V N K L F F M R V L I L R LIM P L NAP L • • 390 • • 4020 • • 450 • • 480 TCTGGTAGTAATGATA'I"rl'GGATGCAGAATAAAGGC'l"l'G"rlTl'ACACTCAGGT'l'TATAAGMTATGGCTGTGTATCGCAGCCTTAcrrrrG'I'TAATGTACCATATGttrATAATGGCTCT S G S N D I W M Q N K G L F Y T Q v Y K N M A V Y R S L T F V N V P Y v Y ~ G S L V V M I $ G C R I K A C F T L R FIR I W L C I A ALL L L M Y H M F I MAL • • 510 • • 540 • • 570 • • 600 GCACAATCTACAGCTCTrI'GTAAATCTGGTAGTTTAG'l"l'CTTAATAACCCTGCATATATAGCTCGTGAAGCTAA"rr1"l'GGGGATTATTATTATAAGG'l'TGAAGCTGACT"rrI'A'lTl'GTCA A Q S TAL C K S G S L V L K N PAY I ARE A N F G D Y Y Y K V E A D F Y L S H N L 0 L F V N L V V • • 630 • . 660 • • 690 • • no GG'rI'GTGACGAGTATATCGTACCACTrI'GTA'l"I"I'Tl'AACGGCAAG'l"ITl'TGTCGAATACAAAGTATTATGATGATAGTCAATA'l'TATrTTAATAAAGACAC'rGGTG'rl'A'l'TTATGGTC',!'C G C DEY I v P L C I F N G K F L S N T K Y Y DDS Q Y Y F N K D T G V I Y G L • • 750 , • 780 • • 810 • • 840 AA'l"l'CTAC'l'GAAACCA'I"l'ACCACTGG'lTl'TGA'rl"rl'AAttGTCA'rl'A'lTl'AGT"rrI'ACCCTCTGGTAATTA'l'TTAGCCA'l"rl'CAAATGAGCTA'I"l'G'I"l'AACTG'l'TCCTACGAAAGCAATC ~ S T BTl T T G F D F N C 8 Y L V L PSG N Y L A I S N ! L L LTV P T K A r • • 870 • • 900 • • 930 • • 960 TGTCTTAACAAGCGTAAGGA'l"I'Tl'ACGCCTGTACAGG"rl'G'l"l'GA'rl'CACGGTGGAACAATGCCAGGCAGTCTGATAACATGACGGCGG'rI'GCTTGTCAACCCCCGTACTGTTATrrI'CGT C L N K R K D r T P v Q v V D S R W N N A R Q S D ~ M T A V A C Q P P Y C Y F R • • 990 • • 1020 • • 1050 • • 1080 MTTCTACTACCAACTATGT'l'GGTGTTTATGATATCAATCATGGQGATGCTGGTrrl'ACThGCATACTCAGTGGTT'l'G"rl'ATATGATTCACCTTG'lTl"'l"'l'CGCAGCAAGGTG'lTl"'l"'l'AGG 00 S T T K Y V G V Y DIN H G D A G F T S I L S G L L Y D S P C F S Q Q G V F R M L 11 V MIS 1M G M L v L LAY S v v C Y M 1.8 L V FRS K V F L Q IORF2- • . 1110 • • 1140 • • 1170 • • 1200 TATGATAATG'l'TAGCAGTGTCTGGCCTCTCTATTCCTATGGCAGATGCCCTACTGCTGCTGATATTAATACCCCTGATGTACCTA'l'T'l'GTGTGTATGATCCGCTACCAC'l'TArrrrGC'l'T Y D 00 v s S v W PLY S Y G R CPT A A DIN T P D V PIC V Y D P L P L ILL M I M L A V S G LSI P MAD ALL L L I LIP L M Y L F V C M I R Y H L t c t • • 1230 • • 1260 • • GGCATCCTl"l"l'GGGTG'l"'l'GCGGTCATAATTAT'I'GTAG'l"ITl'G'l"l'G'rl'ATA'l'T'l"TATGGTGGATAATGGTACTAGGCTGCATGATGCTTAG GA IS LV LW Gv VL AR Vs I I r v v L L L Y F M V D [HI G T R L H 0 A Fig.
Load more

Recommended publications
  • NILES 66O YARTON BILER IL 6Y714 Èditiofl ; 4 (RJW9663900
    REC'O'J35 AUG % N o ç N1LE PUBLIC LiBRARY NILES 66O YARTON BILER IL 6Y714 Èditiofl ;_4_ (RJW9663900 VOL 39, NO.23 flIURSDYNOVEMBER301995 so CENTS PER COPY - Parkway Bank, Pontarelli --Car crashes,three police departm... ents usedto-apprehend thief - condos getgreen light byKathIeenQujrfrId Wild police chase endsin Voting unanimously, the would generate increased traffic Nues Village Board has finally congestion on their streets which laidtorestthecontroversy couldcreate unsafeconditions for -- - surrounding Parkway Bank and the areasmany children. - thief's arrest in Nues -ilssoon to be nwghhors, by Of particular concern to the By Rosemary Tirio approving the rezonrng petition residents was the exit peoposed to Niles andMorton Drove police About thetimeMulvaney to Greenwood and then proceed- permittingthe bank lo begin be developed by the hank onto joined Glenviewpolice in a highreached East Lake Avenue,aed soath ou Greenwood- to constrnction. Dobsen Street. - speed chase around 1 p.m. Nov.Glenview detective picked upon Shermer Road and Carol Avenue Parkway Blank hasbeen The Nibs Village Boaed heard 27 that endcd al Shermer Roadthe dispatch andjoined the chase. iuNites. attempl'mgto purchasethe- the mower atits -October 24 and Carol Avenue inNiles. Mulvaneycontinued-alhigh Around 1:30 p.m., the two of- property at 7601 N. Milwaukee meeting, bot tabled their vole The incident bogan in the park- speed fenders exited their moving veN- - Avenar(currently,the Nues until a Public Hearing could be leg lot of the Oleobrook Market Traveling at speeds betweencte al Shermer and Carol and a VillageHall) and establish a -conducted. Place shopping center at Willow65 mph and 70 mph, Mulvoneyfootchaseenssed.
    [Show full text]
  • New Mexico Daily Lobo, Volume 087, No 48, 10/27/1982." 87, 48 (1982)
    University of New Mexico UNM Digital Repository 1982 The aiD ly Lobo 1981 - 1985 10-27-1982 New Mexico Daily Lobo, Volume 087, No 48, 10/ 27/1982 University of New Mexico Follow this and additional works at: https://digitalrepository.unm.edu/daily_lobo_1982 Recommended Citation University of New Mexico. "New Mexico Daily Lobo, Volume 087, No 48, 10/27/1982." 87, 48 (1982). https://digitalrepository.unm.edu/daily_lobo_1982/130 This Newspaper is brought to you for free and open access by the The aiD ly Lobo 1981 - 1985 at UNM Digital Repository. It has been accepted for inclusion in 1982 by an authorized administrator of UNM Digital Repository. For more information, please contact [email protected]. 3 '?'if· 7?5( l)rJ ~ Q t..U Vol. 87 No.48 Wednesday, October 27, 1982 Rumors abound in presidential search Craig Chrissinger Be mali llo county, said he had not heard of the Anaya rumor. He With the third presidential finalist labeled that rumor as false, adding to visit campus scheduled for next Anaya has not promised anyone week, rumors are circulating that In­ jobs, including his campaign terim President John Perovich is workers. being considered as a possible Perovich was nominated as a seventh candidate for the post. candidate, but removed his name Perovich denied Monday that the from consideration in August when UNM Board of Regents had the Presidential Search Committee approached him. He declined to still was screening the candidates. comment about whether he would Regents Chairman Henry Jara­ allow his name to be considered, if millo has said the Regents still arc asked to be !l candidate.
    [Show full text]
  • Unicode Compression: Does Size Really Matter? TR CS-2002-11
    Unicode Compression: Does Size Really Matter? TR CS-2002-11 Steve Atkin IBM Globalization Center of Competency International Business Machines Austin, Texas USA 78758 [email protected] Ryan Stansifer Department of Computer Sciences Florida Institute of Technology Melbourne, Florida USA 32901 [email protected] July 2003 Abstract The Unicode standard provides several algorithms, techniques, and strategies for assigning, transmitting, and compressing Unicode characters. These techniques allow Unicode data to be represented in a concise format in several contexts. In this paper we examine several techniques and strategies for compressing Unicode data using the programs gzip and bzip. Unicode compression algorithms known as SCSU and BOCU are also examined. As far as size is concerned, algorithms designed specifically for Unicode may not be necessary. 1 Introduction Characters these days are more than one 8-bit byte. Hence, many are concerned about the space text files use, even in an age of cheap storage. Will storing and transmitting Unicode [18] take a lot more space? In this paper we ask how compression affects Unicode and how Unicode affects compression. 1 Unicode is used to encode natural-language text as opposed to programs or binary data. Just what is natural-language text? The question seems simple, yet there are complications. In the information age we are accustomed to discretization of all kinds: music with, for instance, MP3; and pictures with, for instance, JPG. Also, a vast amount of text is stored and transmitted digitally. Yet discretizing text is not generally considered much of a problem. This may be because the En- glish language, western society, and computer technology all evolved relatively smoothly together.
    [Show full text]
  • Official U.S. Bulletin
    : : : — : . PVBLISHEa DJIILY under order of THE PRESIDENT of THE UNITED STETES by COMMITTEE on PUBLIC INFORMATION GEORGE CREEL, Chairman ~k -k -k COMPLETE Record of U. S. GOUERNMENT Activities ' VoL. 3 WASHINGTON, MONDAY, FEBRUARY 24, 1919. No. 545 SIXTH BIWEEKLY OFFERING FIRST EDITION OF INCOME TAX CONDITIONS AT BREST CAMP OF TREASURY CERTIFICATES REGULATIONS READY THIS WEEK OUTLINED BY GEN. PERSHING OVERSUBSCRIBED $20,578,500 Second Edition for Use ef-Cor- porations Being Prepared IN RESPONSE TO REQUEST RESERVE BANK DISTRICT RESULTS Joint Edition Later. MADEBYPRESIDENTWILSON Aggregate Subscriptions in Anticipa- The Bureau of Internal Revenue issues the following; tion Victory Liberty Loan Now of The first edition of the income tax regu- INQUIRY RESULT OF $3,845,678,000-r—Bond Drive in lations which relate to the tax on individ- NEWSPAPER CHARGES ual incomes will be distributed by collec- Occupied Germany. tors of internal revenue early this week. The regulations were prepared under Complaints That Soldiers Secretary Glass announces that the the immediate direction of Hugh Satter- From Front and Red Cross sixth biweekly offering (Series V. F) of lee, of Rochester, N. Y. Mr. Satterlee Treasury certificates of indebtedness in was connected with the Bureau of In- Nurses Practically Held anticipation of the Victory Liberty Loan ternal Revenue last year as .special attor- was overscribed. The minimum amount ney and returned at the request of Com- Prisoners bsolutely offered was .'^GOO.000.000 and the total missioner Ddniel C. Roper to take charge Groundless/*Says Report, subscriptions aggregate $620,.578, 500. The of this branch of the work.
    [Show full text]
  • DN WIFE's WERE Woulobf CALLERS Idrihi
    rn» «uat b* tt**t«4 6.4» a. PLAINFI1XD. «SW m»K\\ FRIDAY. FEBRUARY 311. l»08. ' 'I How Leading Newspapers ^ DN WIFE'S Heap Big Indian* Smoke the' Bev. J. A. Ohambliss Chosen WERE WOUlOBf CALLERS Daughter Weakens Under View Civil Service Meas- Nicholas Kelly Is In a cell alt North Pipe a* Representatives of , President of the Plainfleld "Third Degree* and Tel* Attended by hundreds, of prom- ; Three Polaks. one of whom was ure Passed by Senate. Plalnfield headquarters, charged with 183 Tribes in V. J. , nent business *nd professional men, Ministers'Association. i looking for his sister, who la em- of Family's Wrongdoing. an attempt to beat hU wife whom j friends from every w*lk of life and ployed as a servant at a residence on previous attacks forced her to leave Prospect place, got an' awful scare COMPMMKNT I NIOX'H HKXATOR. j him and take lodgings on PUIXnEU)ER8 AT CX>VSCII^ ^^ <>f~hool children .swell a. HOLD FIVE MEETINGS A Pearl i public school, teacher*,: who have re~ early last night when they were ar- vom MTORKI is snew VORK. i street. Mrs. Kelly bears marks of a ! i alized what he did fof* the cause of rested by the borough police as sus- New York Tribune PraineH Bill, brutal attack made by the husband Hecend Htroajceat Order In State No- education, the fnneral of Dr. John Chatrrh Pariah Hoaof to picious characters. None of them when he met her on Grant avenue Robbed Hotel* la All Parts of tfc* Buck Probasco was held |n the First could "speak-a da English" or even WlMwr Author It Hay* Is One Wednesday night, bruising her about avricallr Holding Besaiosw To- Baptist churc/h this afternoon.
    [Show full text]
  • A Far-Infrared Michelson Interferometer and Its Application to the Study of Photoconductivity in Ultra-Pure Germanium
    PDF hosted at the Radboud Repository of the Radboud University Nijmegen The following full text is a publisher's version. For additional information about this publication click this link. http://hdl.handle.net/2066/147901 Please be advised that this information was generated on 2021-10-06 and may be subject to change. A FAR-INFRARED MICHELSON INTERFEROMETER AND ITS APPLICATION TO THE STUDY OF PHOTOCONDUCTIVITY IN ULTRA-PURE GERMANIUM H.W.H.M. JONGBLOETS A FAR-INFRARED MICHELSON INTERFEROMETER AND ITS APPLICATION TO THE STUDY OF PHOTOCONDUCTIVITY IN ULTRA-PURE GERMANIUM PROMOTOR: PROF.DR.P. WYDKR CO-REF:I:RENT DR. J.H.M. STOELINGA A FAR-INFRARED MICHELSON INTERFEROMETER AND ITS APPLICATION TO THE STUDY OF PHOTOCONDUCTIVITY IN ULTRA-PURE GERMANIUM PROEFSCHRIFT TER VERKRIJGING VAN DE GRAAD VAN DOCTOR IN DE WISKUNDE EN NATUURWETENSCHAPPEN AAN DE KATHOLIEKE UNIVERSITEIT TE NIJMEGEN, OP GEZAG VAN DE RECTOR MAGNIFICUS PROF. DR. P.G.A.B. WIJDEVELD, VOLGENS BESLUIT VAN HET COLLEGE VAN DECANEN IN HET OPENBAAR TE VERDEDIGEN OP DONDERDAG 13 MAART 1980 DES NAMIDDAGS TE 4.00 UUR door HENDRIKUS WILHELMUS HUBERTUS MARIA JONGBLOETS geboren te Nijmegen 1980 Druk: Krips Repro Meppel The investigations described in this thesis have been carried out in the group "Experimentele Natuurkunde IV" of the Research Institute for Materials of the Faculty of Science at the Catholic University of Nijmegen under the direction of Prof. Dr. P. Wyder. Part of this work has been supported by the "Stichting voor Fundamenteel Onderzoek der Materie" (FOM) with financial support from the "Nederlandse Organisatie voor Zuiver Wetenschappelijk Onderzoek" (ZWO).
    [Show full text]
  • Working with EC2 Instances
    PRODUCT DOCUMENTATION Pivotal™ Greenplum Database® Version 4.3 Installation Guide Rev: A31 © 2018 Pivotal Software, Inc. Copyright Installation Guide Notice Copyright Privacy Policy | Terms of Use Copyright © 2018 Pivotal Software, Inc. All rights reserved. Pivotal Software, Inc. believes the information in this publication is accurate as of its publication date. The information is subject to change without notice. THE INFORMATION IN THIS PUBLICATION IS PROVIDED "AS IS." PIVOTAL SOFTWARE, INC. ("Pivotal") MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND WITH RESPECT TO THE INFORMATION IN THIS PUBLICATION, AND SPECIFICALLY DISCLAIMS IMPLIED WARRANTIES OF MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Use, copying, and distribution of any Pivotal software described in this publication requires an applicable software license. All trademarks used herein are the property of Pivotal or their respective owners. Revised November 2018 (4.3.30.3) 2 Contents Installation Guide Contents Chapter 1: Preface.......................................................................................6 About This Guide................................................................................................................................ 7 About the Greenplum Database Documentation Set..........................................................................8 Document Conventions....................................................................................................................... 9 Command Syntax Conventions...............................................................................................
    [Show full text]
  • Phỏng Vấn Ts. Ngô Đình Học Về Winvnkey Và Chữ Việt Nhanh
    Phỏng vấn Ts. Ngô Đình Học về WinVNKey và Chữ Việt Nhanh Người thực hiện: Nguyễn Hữu Thiện Giới thiệu: Cuối năm 2014, nhà báo Nguyễn Hữu Thiện - sáng lập viên Tạp chí CNTT e-CHIP, Ủy viên BCH Hội Tin Học Tp.HCM - đứng ra phối hợp giữa Diễn đàn Tinh Tế (tinhte.vn) cùng trang mạng Chữ Việt Nhanh tổ chức ba cuộc thi về Chữ Việt Nhanh và WinVNKey (xem chi tiết ba cuộc thi ở http://chuvietnhanh.sourceforge.net/CacCuocThiTocKyCVN.htm). Ông Nguyễn Hữu Thiện đã thực hiện cuộc phỏng vấn qua email với Ts. Ngô Đình Học - tác giả WinVNKey - về bộ gõ WinVNKey và Chữ Việt Nhanh. Nay xin ghi lại nguyên văn toàn bộ email các câu hỏi phỏng vấn của nhà báo Nguyễn Hữu Thiện và email trả lời của Ts. Ngô Đình Học để độc giả có thông tin đầy đủ hơn về bộ gõ đa ngữ, đa năng WinVNKey và phương pháp tốc ký Chữ Việt Nhanh. -----000----- Email nêu câu hỏi phỏng vấn của nhà báo Nguyễn Hữu Thiện gởi đến Ts. Ngô Đình Học: Mến gởi anh Học, Như anh đã biết, nhân ba cuộc thi do các anh phối hợp với Diễn đàn Tinh Tế tổ chức, Thiện sẽ tổ chức loạt tin, bài để quảng bá mạnh hơn Chữ Việt Nhanh (CVN) và WinVNKey. Vì vậy, Thiện xin phép được phỏng vấn anh để cung cấp cho vài tờ báo lớn ở VN một cái nhìn có hệ thống hơn. Rất mong anh Học trả lời giúp Thiện mấy câu hỏi sau: 1.
    [Show full text]
  • PAN Localization Survey of Language Computing in Asia 2005
    Survey of Language Computing in Asia 2005 Sarmad Hussain Nadir Durrani Sana Gul Center for Research in Urdu Language Processing National University of Computer and Emerging Sciences www.nu.edu.pk www.idrc.ca Published by Center for Research in Urdu Language Processing National University of Computer and Emerging Sciences Lahore, Pakistan Copyrights © International Development Research Center, Canada Printed by Walayatsons, Pakistan ISBN: 969-8961-00-3 This work was carried out with the aid of a grant from the International Development Research Centre (IDRC), Ottawa, Canada, administered through the Centre for Research in Urdu Language Processing (CRULP), National University of Computer and Emerging Sciences (NUCES), Pakistan. ii To the languages which will be lost before they are saved iii iv Preface This report is an effort to document the state of localization in Asia. There are a lot of different initiatives undertaken to localize technology across Asia. However, no study surveys the extent of work completed. It is necessary to document the status to formulate effective and coordinated strategies for further development. Therefore, current work was undertaken to collect the available data to baseline local language computing in Asia. This work has been done through PAN Localization project. There are about 2200 languages spoken in Asia. It is difficult to undertake the task of documenting the status of all these languages. Twenty languages are being surveyed to assess the level of language computing across Asia. The selected languages have official status in Asian countries of Middle East, South, South East and East Asia. The selection has been done to cover a variety of scripts and languages of Asia, but is eventually arbitrary.
    [Show full text]
  • Pfilelllle 0 NATIONAL LEAGUE
    Trcm Cm Wrxncftsr 1: Manchuria,- - Oct. 2. for eanVrtnettee - 2 ! : -- e. I i i ! I Mongolia, Oct A , i i ? From Vncwvir: r r mi, . ' 1 I I i 1 1 I I l.-- i Indeialte, r ; v f j V i iii ,1 I .' J I I I For Vancouver: V 'I'M Indefinite, I,' --4 w . f Evening Bulletin, Est. 1882. No.; 5972 Hawaiian Star. VoL XXII, No. 7012 14 PAG ES HONOLULU, TERRITORY OP HAWAII, WEDNIDAYSEPTEMBER 30, 1914, 14 PAGES PRICE FIVE CZinZ i 00 . poo v. 0q 1 KOI9 xx ooo ooo ooo ooo ami nFnrnrm M MSI TO R1 ! li CANDIDATES T.IUST V k. m W a V w . BELGIAN STRONGHOLD UNDER ATTACK mm mm - -- j r 1 ; 1 r f f F 7 o PROVE ELECTION n r i J i TO 5S BALLOTS DIGFUTE J '.: . Y o::e rr.-.rjTR- onslaught made but repelled with Unless County Clerk Manda Judas .Whitnsy SuctIns C':' G..i LGoS, SAY BELGIANS BERLIN CONFIRMS BOM mused All Names Will Be ,'ticn to f.'urphy's Tc:1:.7.:.t, r:,nD:.:EfiT cEGUfj British and German official ; : Entered for November - ' au:.c: .ents agree German right not BROKEf lc;:::: claims it has been forced back aus-- AnORrJEY-GEriRA- L GIVES federal coutt cl::.:; THIA'. wULDIERS TO JOIN GERMANS AS COMPOSITE SECRETARY LEGAL ADVICE wiTfiEss cni::ai;;3 r;:1 - " - mm. UNIT ON: EAST ' Dr'.cE RUSSIA NOW GOVERNS Action by Supreme Court May Women Tcilcf Affair in F: ; .GALICIA BAVARIAN PRINCE REPORTED CAPTURED. Not Finally Dispose 01 very Court Building lz:.:.:,3 Associated Press Service by Federal Wlreleasl .
    [Show full text]
  • CJKV Information Processing
    CJKV Information Processing Ken Lunde Beijing • Cambridge • Köln • Paris • Sebastopol • Taipei • Tokyo CJKV Information Processing by Ken Lunde Copyright © 1999 O’Reilly & Associates, Inc. All rights reserved. Printed in the United States of America. Portions of this book previously appeared in Understanding Japanese Information Processing, Copyright © 1993 O’Reilly & Associates, Inc. Published by O’Reilly & Associates, Inc., 101 Morris Street, Sebastopol, CA 95472. Editors: Tim O’Reilly, Peter Mui, and Gigi Estabrook Production Editors: Ken Lunde and Jane Ellin Printing History: January 1999: First Edition. The association between the image of a blowfish and the topic of CJKV information processing is a trademark of O’Reilly & Associates, Inc. Nutshell Handbook, the Nutshell Handbook logo, and the O’Reilly logo are registered trademarks of O’Reilly & Associates, Inc. Many of the designations used by manufacturers and sellers to distinguish their products are claimed as trademarks. Where those designations appear in this book, and O’Reilly & Associates, Inc. was aware of a trademark claim, the designations have been printed in caps or initial caps. While every precaution has been taken in the preparation of this book, the publisher assumes no responsibility for errors or omissions, or for damages resulting from the use of the information contained herein. This book is printed on acid-free paper with 85% recycled content, 15% post-consumer waste. O’Reilly & Associates is committed to using paper with the highest recycled content available consistent with high quality. ISBN: 1-56592-224-7 Chapter 1 In this chapter: • Multiple Writing Systems • Character Set Standards • Encoding Methods 1 • Input Methods • Typography • Basic Concepts and 1.CJKV Information Terminology Processing Overview Template A lot of mystique and intrigue surrounds how CJKV—Chinese, Japanese, Korean, and Vietnamese—text is handled on computer systems.
    [Show full text]
  • Identification of Effective Implementation
    . " • ÿi [, a Report Identification of Effective Implementation Practices By Examining UNSCR 1540 (2004) after a Decade of its Existence Organized by Institute for Defence Studies Analyses, New Delhi, Institute for Strategic Studies, New Delhi and King's College London, in collaboration with United Nations Office for Disarmament Affairs February 25-26, 2014 • apÿoap puoaas s, uo.t:mioso.i aqÿ o:ÿu.t mAom oÿuaiieqa Ja:,I oq:ÿ snq:ÿ m. uoFm:ÿuamaIdmI • :ÿaÿ33o mnmrx-em ol pasn aq o:ÿ m. 0tTg I uoÿnIosa-z aq:ÿ jÿ. ÿuo!ot.jjns ÿou s! auore uoBÿis!ÿaI ÿqÿ paÿou aq 'am.r! arenas atB 1V "s>IaoÿammJ [ÿaI IÿUOgÿu m. apÿm uaaq pÿq saplÿls lÿaÿ 'aauals.rxa s, uoBnlosaN atBjo opÿoap lsÿg ottl m 'lml! polsoÿns uatÿoa ÿossatoÿd • m.sKÿIÿIAI ptm (agFl) saaÿJ.ÿma qÿJv pm!uFl aqa a>Iÿ.I savaunoo m. sloaluoa aaodxa 1o >IOÿI Palt.oIdxa Pÿq umt-'A :uot.lÿaaJt.Ioad IÿUOt.aÿusuÿa! .Io >Is.u ÿutÿaama aqa ssaappÿ oa paau attl puÿ ÿuu uot.lÿaaj.tioad uÿLDt "0"V all! 10 ÿuuaaooun a14! stÿa 'p.ms aq '0ÿS I jo sm.ÿ.uo !oaat.p all!, "paldopÿ sÿm 0tÿS I uot.lnIosaN qot.qaÿ u.t tÿ00g jo lxaauoo aql lno las uamoH aossa/Oÿd ('IOH) uopuo'I oÿffoIIOO s,ÿffU.rH 'sa.xpnÿS ,ÿ.unaÿS puÿ ÿauÿ.ÿoS :[oÿ ÿz:ÿua0 ';ÿoloa;ÿ.ÿI 'uÿA%oÿ[ u-ÿA1 • "InoAlÿlJ anbiun ÿ uoBnlosaN aql aAÿ 'ÿOIA s.Iq U.I 'qat.qm 'aal.mqo Nil aq! 1o L aaldÿqo aapun paadopÿ sÿ,ÿ 0t, S I aÿttl palou mdno aCI '£IIÿU.td "VSGI ÿ oouaÿa.luoo oq! aalte £IlaOqS aaÿId a>Iÿ! pInotÿ a!mmns £avnoas aÿaIanu pavia aqa !ÿq! ÿm.aou 'Xl.unoas aÿaionu oa pmÿIaa auamnaasu.ÿ lumaodml uÿ sÿ*ÿ O'ÿgl aÿql aaÿj oqa poaqÿqqÿq osiÿ ÿdn0 aG ">Iÿoÿ1au uoÿ.ÿaajÿload s, uHq}1 /aapÿ) Inpqg aqÿ o:ÿ asuodsaa ÿ sÿ sulÿuo s, OiTSI uodn IooUaa o1 uo luam uaql OH "ms.uoaaa1 1sulÿ aiÿnaÿs s,&.mnmmoo iÿuop,ÿu.Iaÿ,m, attÿ to IOO:ÿ 'ÿ.ÿpuI o! aoumaodmÿ, aÿIna!la-ed jo 'puÿ uoBÿaajÿ.Ioad m.luaaa.ÿd aoj auamnalsm, uÿ ÿmaq ÿu!pnIam.
    [Show full text]