DOCSLIB.ORG

PIK3C2G Sirna Set I PIK3C2G Sirna Set I

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
PIK3C2G Sirna Set I PIK3C2G Sirna Set I Catalog # Aliquot Size P25-911-05 3 x 5 nmol P25-911-20 3 x 20 nmol P25-911-50 3 x 50 nmol PIK3C2G siRNA Set I siRNA duplexes targeted against three exon regions Catalog # P25-911 Lot # Z2073-49 Specificity Formulation PIK3C2G siRNAs are designed to specifically knock-down The siRNAs are supplied as a lyophilized powder and human PIK3C2G expression. shipped at room temperature. Product Description Reconstitution Protocol PIK3C2G siRNA is a pool of three individual synthetic siRNA Briefly centrifuge the tubes (maximum RCF 4,000g) to duplexes designed to knock-down human PIK3C2G collect lyophilized siRNA at the bottom of the tube. mRNA expression. Each siRNA is 19-25 bases in length. The Resuspend the siRNA in 50 µl of DEPC-treated water gene accession number is BC130277. (supplied by researcher), which results in a 1x stock solution (10 µM). Gently pipet the solution 3-5 times to mix Gene Aliases and avoid the introduction of bubbles. Optional: aliquot MGC163149; PI3K-C2GAMMA 1x stock solutions for storage. Storage and Stability Related Products The lyophilized powder is stable for at least 4 weeks at room temperature. It is recommended that the Product Name Catalog Number lyophilized and resuspended siRNAs are stored at or PIK3C2A, Active P23-11G below -20oC. After resuspension, siRNA stock solutions ≥2 PIK3C2G, Active P25-11G µM can undergo up to 50 freeze-thaw cycles without PIK3C3 (Vps34), Active P26-10G significant degradation. For long-term storage, it is PIK3C2B Protein P24-31BG recommended that the siRNA is stored at -70oC. For most favorable performance, avoid repeated handling and multiple freeze/thaw cycles. Scientific Background PIK3C2G belongs to the phosphoinositide 3-kinase (PI3K) PIK3C2G siRNA Set I family which plays main roles in signaling pathways and siRNA duplexes targeted against three exon regions involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein Catalog # P25-911 trafficking (1). PIK3C2G contains a lipid kinase catalytic Lot # Z2073-49 domain as well as a C-terminal C2 domain, a Packaging Specifications 2.5 nmol/tube for 3 x 5 nmol characteristic of class II PI3-kinases that act as calcium- Format Lyophilized powder dependent phospholipid binding motifs which mediate Stability 1yr at -70oC from date of shipment translocation of proteins to membranes, and may also Storage & Shipping The lyophilized powder is stable for at least 4 weeks at room temperature. It is mediate protein-protein interactions and the N-terminal recommended that the lyophilized region of PIK3C2G and the C-terminal C2 domain are and resuspended siRNAs are stored at required for enzymatic activity (2). or below -20oC. After resuspension, siRNA stock solutions ≥2 µM can undergo up to 50 freeze-thaw cycles References without significant degradation. For 1. Rozycka, M.et.al: cDNA cloning of a third human C2- long-term storage, it is recommended domain-containing class II phosphoinositide 3-kinase, that the siRNA is stored at -70oC. For most favorable performance, avoid PI3K-C2-gamma, and chromosomal assignment of repeated handling and multiple this gene (PIK3C2G) to 12p12. Genomics 54: 569-574, freeze/thaw cycles. 1998. 2. Misawa, H. et.al: Cloning and characterization of a novel class II phosphoinositide 3-kinase containing C2 domain. Biochem. Biophys. Res. Commun. 244: 531- 539, 1998. To place your order, please contact us by phone 1-(604)-232-4600, fax 1-604-232-4601 or by email: [email protected] www.signalchem.com FOR IN VITRO RESEARCH PURPOSES ONLY. NOT INTENDED FOR USE IN HUMAN OR ANIMALS. .
Load more

Recommended publications
  • AN INVESTIGATION of the ROLE of PAK6 in TUMORIGENESIS By
    AN INVESTIGATION OF THE ROLE OF PAK6 IN TUMORIGENESIS by JoAnn Roberts A Thesis Submitted to the Faculty of The Charles E. Schmidt College of Medicine In Partial Fulfillment of the Requirements for the Degree of Master of Science Florida Atlantic University Boca Raton, Florida August 2012 ACKNOWLEDGMENTS This material is based upon work supported by the National Science Foundation under Grant No. DGE: 0638662. Any opinions, findings, and conclusions or recommendations expressed in this material are those of the author(s) and do not necessarily reflect the views of the National Science Foundation. I would like to thank and acknowledge my thesis advisor, Dr. Michael Lu, for his support and guidance throughout the writing of this thesis and design of experiments in this manuscript. I would also like to thank my colleagues for assistance in various trouble-shooting circumstances. Last, but certainly not least, I would like to thank my family and friends for their support in the pursuit of my graduate studies. iii ABSTRACT Author: JoAnn Roberts Title: An Investigation of the Role of PAK6 in Tumorigenesis Institution: Florida Atlantic University Thesis Advisor: Dr. Michael Lu Degree: Master of Science Year: 2012 The function and role of PAK6, a serine/threonine kinase, in cancer progression has not yet been clearly identified. Several studies reveal that PAK6 may participate in key changes contributing to cancer progression such as cell survival, cell motility, and invasiveness. Based on the membrane localization of PAK6 in prostate and breast cancer cells, we speculated that PAK6 plays a role in cancer progression cells by localizing on the membrane and modifying proteins linked to motility and proliferation.
    [Show full text]
  • PIK3C2G (NM 004570) Human Mutant ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC402758 PIK3C2G (NM_004570) Human Mutant ORF Clone Product data: Product Type: Mutant ORF Clones Product Name: PIK3C2G (NM_004570) Human Mutant ORF Clone Mutation Description: P146L Affected Codon#: 146 Affected NT#: 437 Nucleotide Mutation: PIK3C2G Mutant (P146L), Myc-DDK-tagged ORF clone of Homo sapiens phosphoinositide-3- kinase, class 2, gamma polypeptide (PIK3C2G) as transfection-ready DNA Effect: Dibees, ype 2, ssoiion wih Symbol: PIK3C2G Synonyms: PI3K-C2-gamma; PI3K-C2GAMMA Vector: pCMV6-Entry (PS100001) Tag: Myc-DDK ACCN: NM_004570 ORF Size: 4335 bp ORF Nucleotide >RC402758 representing NM_004570 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCATATTCTTGGCAAACGGATCCAAATCCTAATGAATCACACGAAAAGCAGTATGAACACCAAGAAT TTCTCTTTGTAAATCAACCCCATTCTTCTAGCCAAGTCAGTCTGGGTTTTGATCAGATAGTAGATGAGAT CAGTGGCAAAATTCCACACTACGAGAGTGAAATTGATGAAAACACCTTTTTTGTGCCCACTGCACCAAAA TGGGACTCAACAGGGCATTCATTAAATGAAGCACACCAAATATCCTTGAATGAATTCACTTCTAAAAGCC GTGAACTCTCCTGGCATCAAGTTAGCAAAGCACCAGCAATTGGTTTTAGTCCTTCTGTGTTACCAAAACC TCAAAATACGAATAAAGAATGCTCCTGGGGAAGCCCCATAGGAAAACATCATGGTGCTGATGATTCCAGA TTCAGTATTTTAGCTCTATCATTCACAAGTTTGGATAAAATTAATCTAGAGAAAGAATTAGAAAATGAAA ATCATAACTACCATATAGGATTTGAAAGTAGCATTCCTCCAACAAATTCATCCTTCTCAAGTGACTTCAT GCCGAAAGAAGAGAATAAAAGGAGTGGACATGTGAACATTGTGGAACCATCTTTGATGCTTTTGAAAGGC
    [Show full text]
  • The DNA Methylation Landscape of Glioblastoma Disease Progression Shows Extensive Heterogeneity in Time and Space
    bioRxiv preprint doi: https://doi.org/10.1101/173864; this version posted August 9, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The DNA methylation landscape of glioblastoma disease progression shows extensive heterogeneity in time and space Johanna Klughammer1*, Barbara Kiesel2,3*, Thomas Roetzer3,4, Nikolaus Fortelny1, Amelie Kuchler1, Nathan C. Sheffield5, Paul Datlinger1, Nadine Peter3,4, Karl-Heinz Nenning6, Julia Furtner3,7, Martha Nowosielski8,9, Marco Augustin10, Mario Mischkulnig2,3, Thomas Ströbel3,4, Patrizia Moser11, Christian F. Freyschlag12, Jo- hannes Kerschbaumer12, Claudius Thomé12, Astrid E. Grams13, Günther Stockhammer8, Melitta Kitzwoegerer14, Stefan Oberndorfer15, Franz Marhold16, Serge Weis17, Johannes Trenkler18, Johanna Buchroithner19, Josef Pichler20, Johannes Haybaeck21,22, Stefanie Krassnig21, Kariem Madhy Ali23, Gord von Campe23, Franz Payer24, Camillo Sherif25, Julius Preiser26, Thomas Hauser27, Peter A. Winkler27, Waltraud Kleindienst28, Franz Würtz29, Tanisa Brandner-Kokalj29, Martin Stultschnig30, Stefan Schweiger31, Karin Dieckmann3,32, Matthias Preusser3,33, Georg Langs6, Bernhard Baumann10, Engelbert Knosp2,3, Georg Widhalm2,3, Christine Marosi3,33, Johannes A. Hainfellner3,4, Adelheid Woehrer3,4#§, Christoph Bock1,34,35# 1 CeMM Research Center for Molecular Medicine of the Austrian Academy of Sciences, Vienna, Austria. 2 Department of Neurosurgery, Medical University of Vienna, Vienna, Austria. 3 Comprehensive Cancer Center, Central Nervous System Tumor Unit, Medical University of Vienna, Austria. 4 Institute of Neurology, Medical University of Vienna, Vienna, Austria. 5 Center for Public Health Genomics, University of Virginia, Charlottesville VA, USA. 6 Department of Biomedical Imaging and Image-guided Therapy, Computational Imaging Research Lab, Medical University of Vi- enna, Vienna, Austria.
    [Show full text]
  • Analysis of Inherited and Somatic Variants to Decipher Canine Complex Traits
    Digital Comprehensive Summaries of Uppsala Dissertations from the Faculty of Medicine 1454 Analysis of inherited and somatic variants to decipher canine complex traits KATE MEGQUIER ACTA UNIVERSITATIS UPSALIENSIS ISSN 1651-6206 ISBN 978-91-513-0310-9 UPPSALA urn:nbn:se:uu:diva-347165 2018 Dissertation presented at Uppsala University to be publicly examined in B:22, BMC, Husargatan 3, Uppsala, Monday, 21 May 2018 at 13:15 for the degree of Doctor of Philosophy (Faculty of Medicine). The examination will be conducted in English. Faculty examiner: David Sargan (University of Cambridge). Abstract Megquier, K. 2018. Analysis of inherited and somatic variants to decipher canine complex traits. Digital Comprehensive Summaries of Uppsala Dissertations from the Faculty of Medicine 1454. 67 pp. Uppsala: Acta Universitatis Upsaliensis. ISBN 978-91-513-0310-9. This thesis presents several investigations of the dog as a model for complex diseases, focusing on cancers and the effect of genetic risk factors on clinical presentation. In Papers I and II, we performed genome-wide association studies (GWAS) to identify germline risk factors predisposing US golden retrievers to hemangiosarcoma (HSA) and B- cell lymphoma (BLSA). Paper I identified two loci predisposing to both HSA and BLSA, approximately 4 megabases (Mb) apart on chromosome 5. Carrying the risk haplotype at these loci was associated with separate changes in gene expression, both relating to T-cell activation and proliferation. Paper II followed up on the HSA GWAS by performing a meta-analysis with additional cases and controls. This confirmed three previously reported GWAS loci for HSA and revealed three new loci, the most significant on chromosome 18.
    [Show full text]
  • Beyond Traditional Morphological Characterization of Lung
    Cancers 2020 S1 of S15 Beyond Traditional Morphological Characterization of Lung Neuroendocrine Neoplasms: In Silico Study of Next-Generation Sequencing Mutations Analysis across the Four World Health Organization Defined Groups Giovanni Centonze, Davide Biganzoli, Natalie Prinzi, Sara Pusceddu, Alessandro Mangogna, Elena Tamborini, Federica Perrone, Adele Busico, Vincenzo Lagano, Laura Cattaneo, Gabriella Sozzi, Luca Roz, Elia Biganzoli and Massimo Milione Table S1. Genes Frequently mutated in Typical Carcinoids (TCs). Mutation Original Entrez Gene Gene Rate % eukaryotic translation initiation factor 1A X-linked [Source: HGNC 4.84 EIF1AX 1964 EIF1AX Symbol; Acc: HGNC: 3250] AT-rich interaction domain 1A [Source: HGNC Symbol;Acc: HGNC: 4.71 ARID1A 8289 ARID1A 11110] LDL receptor related protein 1B [Source: HGNC Symbol; Acc: 4.35 LRP1B 53353 LRP1B HGNC: 6693] 3.53 NF1 4763 NF1 neurofibromin 1 [Source: HGNC Symbol;Acc: HGNC: 7765] DS cell adhesion molecule like 1 [Source: HGNC Symbol; Acc: 2.90 DSCAML1 57453 DSCAML1 HGNC: 14656] 2.90 DST 667 DST dystonin [Source: HGNC Symbol;Acc: HGNC: 1090] FA complementation group D2 [Source: HGNC Symbol; Acc: 2.90 FANCD2 2177 FANCD2 HGNC: 3585] piccolo presynaptic cytomatrix protein [Source: HGNC Symbol; Acc: 2.90 PCLO 27445 PCLO HGNC: 13406] erb-b2 receptor tyrosine kinase 2 [Source: HGNC Symbol; Acc: 2.44 ERBB2 2064 ERBB2 HGNC: 3430] BRCA1 associated protein 1 [Source: HGNC Symbol; Acc: HGNC: 2.35 BAP1 8314 BAP1 950] capicua transcriptional repressor [Source: HGNC Symbol; Acc: 2.35 CIC 23152 CIC HGNC:
    [Show full text]
  • TRIM24 As an Oncogene in the Mammary Gland
    The Texas Medical Center Library DigitalCommons@TMC The University of Texas MD Anderson Cancer Center UTHealth Graduate School of The University of Texas MD Anderson Cancer Biomedical Sciences Dissertations and Theses Center UTHealth Graduate School of (Open Access) Biomedical Sciences 5-2018 TRIM24 as an Oncogene in the Mammary Gland Aundrietta Duncan Follow this and additional works at: https://digitalcommons.library.tmc.edu/utgsbs_dissertations Part of the Cancer Biology Commons, Medicine and Health Sciences Commons, and the Other Genetics and Genomics Commons Recommended Citation Duncan, Aundrietta, "TRIM24 as an Oncogene in the Mammary Gland" (2018). The University of Texas MD Anderson Cancer Center UTHealth Graduate School of Biomedical Sciences Dissertations and Theses (Open Access). 845. https://digitalcommons.library.tmc.edu/utgsbs_dissertations/845 This Dissertation (PhD) is brought to you for free and open access by the The University of Texas MD Anderson Cancer Center UTHealth Graduate School of Biomedical Sciences at DigitalCommons@TMC. It has been accepted for inclusion in The University of Texas MD Anderson Cancer Center UTHealth Graduate School of Biomedical Sciences Dissertations and Theses (Open Access) by an authorized administrator of DigitalCommons@TMC. For more information, please contact [email protected]. TRIM24 AS AN ONCOGENE IN THE MAMMARY GLAND by Aundrietta DeVan Duncan, M.S. APPROVED: ______________________________ Michelle C. Barton, Ph.D. Advisory Professor ______________________________ Richard
    [Show full text]
  • Genomic Alterations in Fatal Forms of Non-Anaplastic Thyroid Cancer: Identification Of
    Published OnlineFirst June 20, 2017; DOI: 10.1158/1078-0432.CCR-17-1183 Genomic alterations in fatal forms of non-anaplastic thyroid cancer: Identification of MED12 and RBM10 as novel thyroid cancer genes associated with tumor virulence Tihana Ibrahimpasic1,2,⃰ Bin Xu4 ⃰ ,Iñigo Landa1, Snjezana Dogan4 , Sumit Middha4, Venkatraman Seshan6 , Shyam Deraje1, Diane L Carlson5, Jocelyn Migliecci2, Jeffrey A. Knauf1, Brian Untch1, Michael F. Berger1,4, Luc Morris1,2, R. Michael Tuttle3, Timothy Chan1, James A. Fagin1,3, Ronald Ghossein4, Ian Ganly1,2 Human Oncology and Pathogenesis Program1, Department of Head and Neck Surgery2, Department of Medicine3, Department of Pathology4, Department of Pathology, Cleveland Clinic5, Department of Epidemiology and Biostatistics6, Memorial Sloan Kettering Cancer Center, New York, New York, USA. ⃰TI and BX contributed equally to this work Correspondence: Ian Ganly MD PhD Head and Neck Service, Department of Surgery, Memorial Sloan Kettering Cancer Center 1275 York Avenue, New York, NY, 10065 Email: [email protected] ; Tel: 212 639 6244 Fax: 212 396 5560 Ronald Ghossein MD 1 Downloaded from clincancerres.aacrjournals.org on September 27, 2021. © 2017 American Association for Cancer Research. Published OnlineFirst June 20, 2017; DOI: 10.1158/1078-0432.CCR-17-1183 Department of Pathology,Memorial Sloan Kettering Cancer Center 1275 York Avenue, New York, NY, 10065 Email: [email protected] Running Title: Genomics of fatal forms of non-anaplastic thyroid cancer Key words: Non-anaplastic, Thyroid cancer, Next-generation sequencing, MED12, RBM10. Word count: 4688 Conflicts of interest: The authors declare no potential conflicts of interestnone Financial support: This work was supported in part by NIH grant P30-CA008748 and the LesLois Family Foundation 2 Downloaded from clincancerres.aacrjournals.org on September 27, 2021.
    [Show full text]
  • Genomic Analysis of Allele-Specific Expression in the Mouse Liver
    bioRxiv preprint doi: https://doi.org/10.1101/024588; this version posted August 13, 2015. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 TITLE: Genomic analysis of allele-specific expression in the mouse liver Ashutosh K. Pandey* and Robert W. Williams* *Department of Genetics, Genomics and Informatics, University of Tennessee Health Science Center, Memphis, TN, 38103 bioRxiv preprint doi: https://doi.org/10.1101/024588; this version posted August 13, 2015. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 2 RUNNING TITLE: Allele-specific expression in liver KEYWORDS: BXD, DBA/2J, haplotype-aware alignment, purifying selection, cis eQTL CORRESPONDING AUTHOR: Ashutosh K. Pandey 855 Monroe Avenue, Suite 512 Memphis, TN, 38163 Phone: 901-448-1761 Email addresses: [email protected] bioRxiv preprint doi: https://doi.org/10.1101/024588; this version posted August 13, 2015. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 3 ABSTRACT Genetic differences in gene expression contribute significantly to phenotypic diversity and differences in disease susceptibility. In fact, the great majority of causal variants highlighted by genome-wide association are in non-coding regions that modulate expression. In order to quantify the extent of allelic differences in expression, we analyzed liver transcriptomes of isogenic F1 hybrid mice. Allele-specific expression (ASE) effects are pervasive and are detected in over 50% of assayed genes.
    [Show full text]
  • (PX) Domains Based on Their Phosphoinositide Binding Specificities
    ARTICLE https://doi.org/10.1038/s41467-019-09355-y OPEN Classification of the human phox homology (PX) domains based on their phosphoinositide binding specificities Mintu Chandra1, Yanni K.-Y. Chin1, Caroline Mas1,6, J. Ryan Feathers2, Blessy Paul1, Sanchari Datta2, Kai-En Chen 1, Xinying Jia 3, Zhe Yang4, Suzanne J. Norwood1, Biswaranjan Mohanty5, Andrea Bugarcic1, Rohan D. Teasdale1,4, W. Mike Henne2, Mehdi Mobli 3 & Brett M. Collins1 1234567890():,; Phox homology (PX) domains are membrane interacting domains that bind to phosphati- dylinositol phospholipids or phosphoinositides, markers of organelle identity in the endocytic system. Although many PX domains bind the canonical endosome-enriched lipid PtdIns3P, others interact with alternative phosphoinositides, and a precise understanding of how these specificities arise has remained elusive. Here we systematically screen all human PX domains for their phospholipid preferences using liposome binding assays, biolayer interferometry and isothermal titration calorimetry. These analyses define four distinct classes of human PX domains that either bind specifically to PtdIns3P, non-specifically to various di- and tri- phosphorylated phosphoinositides, bind both PtdIns3P and other phosphoinositides, or associate with none of the lipids tested. A comprehensive evaluation of PX domain structures reveals two distinct binding sites that explain these specificities, providing a basis for defining and predicting the functional membrane interactions of the entire PX domain protein family. 1 Institute for Molecular Bioscience, The University of Queensland, St. Lucia, QLD 4072, Australia. 2 Department of Cell Biology, University of Texas Southwestern Medical Center, Dallas, TX 75390, USA. 3 Centre for Advanced Imaging and School of Chemistry and Molecular Biology, The University of Queensland, St.
    [Show full text]
  • Entrez ID Gene Name Fold Change Q-Value Description
    Entrez ID gene name fold change q-value description 4283 CXCL9 -7.25 5.28E-05 chemokine (C-X-C motif) ligand 9 3627 CXCL10 -6.88 6.58E-05 chemokine (C-X-C motif) ligand 10 6373 CXCL11 -5.65 3.69E-04 chemokine (C-X-C motif) ligand 11 405753 DUOXA2 -3.97 3.05E-06 dual oxidase maturation factor 2 4843 NOS2 -3.62 5.43E-03 nitric oxide synthase 2, inducible 50506 DUOX2 -3.24 5.01E-06 dual oxidase 2 6355 CCL8 -3.07 3.67E-03 chemokine (C-C motif) ligand 8 10964 IFI44L -3.06 4.43E-04 interferon-induced protein 44-like 115362 GBP5 -2.94 6.83E-04 guanylate binding protein 5 3620 IDO1 -2.91 5.65E-06 indoleamine 2,3-dioxygenase 1 8519 IFITM1 -2.67 5.65E-06 interferon induced transmembrane protein 1 3433 IFIT2 -2.61 2.28E-03 interferon-induced protein with tetratricopeptide repeats 2 54898 ELOVL2 -2.61 4.38E-07 ELOVL fatty acid elongase 2 2892 GRIA3 -2.60 3.06E-05 glutamate receptor, ionotropic, AMPA 3 6376 CX3CL1 -2.57 4.43E-04 chemokine (C-X3-C motif) ligand 1 7098 TLR3 -2.55 5.76E-06 toll-like receptor 3 79689 STEAP4 -2.50 8.35E-05 STEAP family member 4 3434 IFIT1 -2.48 2.64E-03 interferon-induced protein with tetratricopeptide repeats 1 4321 MMP12 -2.45 2.30E-04 matrix metallopeptidase 12 (macrophage elastase) 10826 FAXDC2 -2.42 5.01E-06 fatty acid hydroxylase domain containing 2 8626 TP63 -2.41 2.02E-05 tumor protein p63 64577 ALDH8A1 -2.41 6.05E-06 aldehyde dehydrogenase 8 family, member A1 8740 TNFSF14 -2.40 6.35E-05 tumor necrosis factor (ligand) superfamily, member 14 10417 SPON2 -2.39 2.46E-06 spondin 2, extracellular matrix protein 3437
    [Show full text]
  • Class II Pi3ks at the Intersection Between Signal Transduction and Membrane Trafficking
    biomolecules Review Class II PI3Ks at the Intersection between Signal Transduction and Membrane Trafficking Jean Piero Margaria , Edoardo Ratto, Luca Gozzelino, Huayi Li and Emilio Hirsch * Department of Molecular Biotechnology and Health Sciences, Molecular Biotechnology Center, University of Turin, 10126 Turin, Italy; [email protected] (J.P.M.); [email protected] (E.R.); [email protected] (L.G.); [email protected] (H.L.) * Correspondence: [email protected] Received: 30 January 2019; Accepted: 11 March 2019; Published: 15 March 2019 Abstract: Phosphorylation of inositol phospholipids by the family of phosphoinositide 3-kinases (PI3Ks) is crucial in controlling membrane lipid composition and regulating a wide range of intracellular processes, which include signal transduction and vesicular trafficking. In spite of the extensive knowledge on class I PI3Ks, recent advances in the study of the three class II PI3Ks (PIK3C2A, PIK3C2B and PIK3C2G) reveal their distinct and non-overlapping cellular roles and localizations. By finely tuning membrane lipid composition in time and space among different cellular compartments, this class of enzymes controls many cellular processes, such as proliferation, survival and migration. This review focuses on the recent developments regarding the coordination of membrane trafficking and intracellular signaling of class II PI3Ks through the confined phosphorylation of inositol phospholipids. Keywords: PIK3C2A; PIK3C2B; PIK3C2G; PI3K-C2α; PI3K-C2β; PI3K-C2γ; PI3K68D; piki-1; membrane trafficking; signal transduction 1. Introduction Phosphoinositide 3-kinases (PI3Ks) are a family of enzymes involved in the phosphorylation of the 30 position of the inositol group. The family is divided into three classes based on their structure and substrate specificity [1].
    [Show full text]
  • Page 1 Exploring the Understudied Human Kinome For
    bioRxiv preprint doi: https://doi.org/10.1101/2020.04.02.022277; this version posted June 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Exploring the understudied human kinome for research and therapeutic opportunities Nienke Moret1,2,*, Changchang Liu1,2,*, Benjamin M. Gyori2, John A. Bachman,2, Albert Steppi2, Rahil Taujale3, Liang-Chin Huang3, Clemens Hug2, Matt Berginski1,4,5, Shawn Gomez1,4,5, Natarajan Kannan,1,3 and Peter K. Sorger1,2,† *These authors contributed equally † Corresponding author 1The NIH Understudied Kinome Consortium 2Laboratory of Systems Pharmacology, Department of Systems Biology, Harvard Program in Therapeutic Science, Harvard Medical School, Boston, Massachusetts 02115, USA 3 Institute of Bioinformatics, University of Georgia, Athens, GA, 30602 USA 4 Department of Pharmacology, The University of North Carolina at Chapel Hill, Chapel Hill, NC 27599, USA 5 Joint Department of Biomedical Engineering at the University of North Carolina at Chapel Hill and North Carolina State University, Chapel Hill, NC 27599, USA Key Words: kinase, human kinome, kinase inhibitors, drug discovery, cancer, cheminformatics, † Peter Sorger Warren Alpert 432 200 Longwood Avenue Harvard Medical School, Boston MA 02115 [email protected] cc: [email protected] 617-432-6901 ORCID Numbers Peter K. Sorger 0000-0002-3364-1838 Nienke Moret 0000-0001-6038-6863 Changchang Liu 0000-0003-4594-4577 Ben Gyori 0000-0001-9439-5346 John Bachman 0000-0001-6095-2466 Albert Steppi 0000-0001-5871-6245 Page 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.04.02.022277; this version posted June 30, 2020.
    [Show full text]