DOCSLIB.ORG

TRIM24 As an Oncogene in the Mammary Gland

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

The Texas Medical Center Library DigitalCommons@TMC The University of Texas MD Anderson Cancer Center UTHealth Graduate School of The University of Texas MD Anderson Cancer Biomedical Sciences Dissertations and Theses Center UTHealth Graduate School of (Open Access) Biomedical Sciences 5-2018 TRIM24 as an Oncogene in the Mammary Gland Aundrietta Duncan Follow this and additional works at: https://digitalcommons.library.tmc.edu/utgsbs_dissertations Part of the Cancer Biology Commons, Medicine and Health Sciences Commons, and the Other Genetics and Genomics Commons Recommended Citation Duncan, Aundrietta, "TRIM24 as an Oncogene in the Mammary Gland" (2018). The University of Texas MD Anderson Cancer Center UTHealth Graduate School of Biomedical Sciences Dissertations and Theses (Open Access). 845. https://digitalcommons.library.tmc.edu/utgsbs_dissertations/845 This Dissertation (PhD) is brought to you for free and open access by the The University of Texas MD Anderson Cancer Center UTHealth Graduate School of Biomedical Sciences at DigitalCommons@TMC. It has been accepted for inclusion in The University of Texas MD Anderson Cancer Center UTHealth Graduate School of Biomedical Sciences Dissertations and Theses (Open Access) by an authorized administrator of DigitalCommons@TMC. For more information, please contact [email protected]. TRIM24 AS AN ONCOGENE IN THE MAMMARY GLAND by Aundrietta DeVan Duncan, M.S. APPROVED: ______________________________ Michelle C. Barton, Ph.D. Advisory Professor ______________________________ Richard Behringer, Ph.D. ______________________________ Guillermina Lozano, Ph.D. ______________________________ Sendurai Mani, Ph.D. ______________________________ Jeffrey T. Chang, Ph.D. APPROVED: ____________________________ Dean, The University of Texas MD Anderson Cancer Center UTHealth Graduate School of Biomedical Sciences TRIM24 AS AN ONCOGENE IN THE MAMMARY GLAND A Dissertation Presented to the Faculty of The University of Texas MD Anderson Cancer Center UT Health Graduate School of Biomedical Sciences in Partial Fulfillment Of the Requirements for the Degree of Doctor of Philosophy By Aundrietta DeVan Duncan, MS Houston, Texas May 2018 ii For Cohen. iii Acknowledgements To my mentor, Dr. Michelle C. Barton. For seeing in me what I did not see in myself, being patient beyond words, always finding the silver lining, and giving me the freedom to explore my passions, I am eternally grateful. You are a brilliant example of what living in one’s purpose means. To my committee members past and present - Dr. Guillermina Lozano, Dr. Sendurai Mani, Dr. Jeff Chang, Dr. Elsa Flores, Dr. Roel Verhaak, Dr. Hui-Kuan Lin, Dr. Jill Schumacher, Dr. Xiobing Shi, Dr. Russel Broaddus, Dr. Mark Bedford – for supporting me, challenging me, not always telling me what I wanted to hear, encouraging me, and filling in when I needed. To Dr. Richard Behringer for every interaction that led to P!NK. To the Barton lab members, past and present – Dr. Joe Taube, Dr. Wen-Wei Tsai, Dr. Svitlana Kurrina, Dr. Teresa Yiu, Dr. Ryan McCarthy, Dr. Srikanth Appikonda, Dr. Kaushik Thakkar, Dr. Jing Li, Sabrina Stratton, Kendra Allton, Dr. Abhinav Jain, Dr. Thushangi Parthiraja, Dr. Lalit Patel, Dr. Kadir Akdemir. You each have contributed to my growth as a scientist and a person in your own unique way. Dr. Shiming Jiang, Hui Wei without whom this project would not be possible. To all of the GSBS staff for making our school a welcoming environment and all of the hard work you do to keep everything running. To my student organization colleagues – Jill Losh, Alex Perakis, Erin Atkinson, and many others - your passion for service and making GSBS a place where all students feel welcome inspires me. iv To the Behringer lab members especially Dr. Rachel Mullen and Jenny Deng. You all were my second lab and your continued friendship means more to me than you know. To my collaborators Dr. Jan Parker-Thornburg, Dr. Stacey Moulder, Dr. Jeff Chang, Dr. Michael Gagea, Dr. Michael Gilcrease, Nancy Otto for elevating the possibilities of the project and making real the possible implications beyond the bench. To my supporters the strong and lovely women of the American Legion Auxiliary, the Tzu Chi Organization, the family of R.W. Butcher, and the National Institutes of Health Ruth L. Kirchtein fellowship program. To the Genes and Development program faculty, staff, and students for being a community in which I felt comfortable to be myself. To those who fit in one of the above categories and have become dear friends, Cheryl Spitzenberger, Elisabeth Lindhiem, Susan Simon, Dr. Lindsey Minter, Dr. Zeynep Coban Akdemir. Having gained your friendship during this journey is one of my most meaningful accomplishments. To my family Paula, William, Joyce, Kevin, and Cherrelle Duncan. For being my inspiration, my role models, my disciplinarians, prayer warriors, confidants, my biggest fans. Anything I accomplish in life is because of you. To my husband, Christopher Broussard, for being my balance. v To Cohen - you have been my motivation even before you came into existence. vi Abstract TRIM24 AS AN ONCOGENE IN THE MAMMARY GLAND Aundrietta DeVan Duncan, M.S. Advisory Professor: Michelle C. Barton Despite the many advances made in breast cancer research and treatments, breast cancer remains one of the deadliest diseases plaguing women worldwide. While many findings on genetic mutations and their role in predisposing people to breast cancer have been uncovered, we are just beginning to understand the extent to which epigenetic regulators promote tumorigenic phenotypes, metastasis, and chemotherapeutic resistance. Moreover, new experimental tools offer the ability to address questions we were previously unable to assess. My project takes advantage of a new mouse model to understand the role of a proto-oncogenic, transcriptional co- regulator, TRIM24, in mammary gland development and disease. We previously reported an unknown binding partner and negative regulator of p53, Tripartite Motif protein 24 (TRIM24). TRIM24 is a multifunctional protein, which acts as a co- regulator of estrogen receptor, a histone reader with tandem PHD and Bromo domains, and a ubiquitin E3-ligase targeting p53 by its RING domain. TRIM24 is over-expressed in human breast cancers, which is correlated with poor patient survival. Previous in cellulo studies in our lab show that TRIM24 over-expression leads to transformation of immortalized human mammary epithelial cells. However, whether over-expression of TRIM24 drives cancer development in vivo remains unknown. To address this gap in our knowledge, we developed a physiologically relevant mouse model to determine if over-expression of TRIM24 promotes tumor development in mammary vii epithelial cells, consistent with TRIM24 function as an oncogene. We hypothesize that TRIM24 acts as an oncogene in the mammary gland. To test this hypothesis, we generated transgenic mice, which in the presence of cre- recombinase, conditionally over-express mouse TRIM24 fused to a C-terminal FLAG epitope tag. Our studies reveal that increased expression of Trim24 in the mouse mammary gland is sufficient to drive tumorigenesis by 8 months of age. To facilitate genome wide and targeted therapeutic studies, I developed multiple primary cell lines (tumor and normal mammary epithelia) from each genotype. Colony formation and proliferation assays indicate that over-expression of TRIM24 gives cells a survival and proliferative advantage. RNA-deep sequencing and genome-wide binding profiles of these tumor-derived cell lines reveal that TRIM24 over-expression may be a direct driver of the epithelial-mesenchymal transition (EMT). These data corroborate unpublished in cellulo data from our lab, which implicate TRIM24 as a metastasis-promoting protein through its ability to activate EMT gene expression. Furthermore, we have observed an over-representation of metaplastic breast carcinomas (MpBC), a rare and devastatingly aggressive disease that has an EMT signature, in profiles of tumors generated in our mouse model. We have performed exome- sequencing, RNA-sequencing and immunohistochemistry on mice, which are currently being compared to human MpBC patient samples with the end goal of identifying the common alterations and substantiate TRIM24 as a player in the development of the MpBC phenotype. Finally, we present our mouse model as a useful tool to test the efficacy of potential therapeutics targeting MpBC and other breast cancers. viii ACKNOWLEDGEMENTS ................................................................................................................ IV ABSTRACT ................................................................................................................................. VII LIST OF FIGURES ......................................................................................................................... XI LIST OF APPENDICES .................................................................................................................. XII CHAPTER 1: INTRODUCTION .........................................................................................................1 1.1 COMPARATIVE ANATOMY OF THE MAMMARY GLAND ........................................................................... 2 1.2 TRANSCRIPTIONAL REGULATION IN THE DEVELOPING MAMMARY GLAND ................................................ 5 1.3 PATHOLOGIES OF THE BREAST WITH A FOCUS ON METAPLASTIC BREAST CANCERS ....................................... 9 1. 4 TRIM24
Recommended publications
  • Mechanical Forces Induce an Asthma Gene Signature in Healthy Airway Epithelial Cells Ayşe Kılıç1,10, Asher Ameli1,2,10, Jin-Ah Park3,10, Alvin T

    Mechanical Forces Induce an Asthma Gene Signature in Healthy Airway Epithelial Cells Ayşe Kılıç1,10, Asher Ameli1,2,10, Jin-Ah Park3,10, Alvin T

    www.nature.com/scientificreports OPEN Mechanical forces induce an asthma gene signature in healthy airway epithelial cells Ayşe Kılıç1,10, Asher Ameli1,2,10, Jin-Ah Park3,10, Alvin T. Kho4, Kelan Tantisira1, Marc Santolini 1,5, Feixiong Cheng6,7,8, Jennifer A. Mitchel3, Maureen McGill3, Michael J. O’Sullivan3, Margherita De Marzio1,3, Amitabh Sharma1, Scott H. Randell9, Jefrey M. Drazen3, Jefrey J. Fredberg3 & Scott T. Weiss1,3* Bronchospasm compresses the bronchial epithelium, and this compressive stress has been implicated in asthma pathogenesis. However, the molecular mechanisms by which this compressive stress alters pathways relevant to disease are not well understood. Using air-liquid interface cultures of primary human bronchial epithelial cells derived from non-asthmatic donors and asthmatic donors, we applied a compressive stress and then used a network approach to map resulting changes in the molecular interactome. In cells from non-asthmatic donors, compression by itself was sufcient to induce infammatory, late repair, and fbrotic pathways. Remarkably, this molecular profle of non-asthmatic cells after compression recapitulated the profle of asthmatic cells before compression. Together, these results show that even in the absence of any infammatory stimulus, mechanical compression alone is sufcient to induce an asthma-like molecular signature. Bronchial epithelial cells (BECs) form a physical barrier that protects pulmonary airways from inhaled irritants and invading pathogens1,2. Moreover, environmental stimuli such as allergens, pollutants and viruses can induce constriction of the airways3 and thereby expose the bronchial epithelium to compressive mechanical stress. In BECs, this compressive stress induces structural, biophysical, as well as molecular changes4,5, that interact with nearby mesenchyme6 to cause epithelial layer unjamming1, shedding of soluble factors, production of matrix proteins, and activation matrix modifying enzymes, which then act to coordinate infammatory and remodeling processes4,7–10.
  • AN INVESTIGATION of the ROLE of PAK6 in TUMORIGENESIS By

    AN INVESTIGATION of the ROLE of PAK6 in TUMORIGENESIS By

    AN INVESTIGATION OF THE ROLE OF PAK6 IN TUMORIGENESIS by JoAnn Roberts A Thesis Submitted to the Faculty of The Charles E. Schmidt College of Medicine In Partial Fulfillment of the Requirements for the Degree of Master of Science Florida Atlantic University Boca Raton, Florida August 2012 ACKNOWLEDGMENTS This material is based upon work supported by the National Science Foundation under Grant No. DGE: 0638662. Any opinions, findings, and conclusions or recommendations expressed in this material are those of the author(s) and do not necessarily reflect the views of the National Science Foundation. I would like to thank and acknowledge my thesis advisor, Dr. Michael Lu, for his support and guidance throughout the writing of this thesis and design of experiments in this manuscript. I would also like to thank my colleagues for assistance in various trouble-shooting circumstances. Last, but certainly not least, I would like to thank my family and friends for their support in the pursuit of my graduate studies. iii ABSTRACT Author: JoAnn Roberts Title: An Investigation of the Role of PAK6 in Tumorigenesis Institution: Florida Atlantic University Thesis Advisor: Dr. Michael Lu Degree: Master of Science Year: 2012 The function and role of PAK6, a serine/threonine kinase, in cancer progression has not yet been clearly identified. Several studies reveal that PAK6 may participate in key changes contributing to cancer progression such as cell survival, cell motility, and invasiveness. Based on the membrane localization of PAK6 in prostate and breast cancer cells, we speculated that PAK6 plays a role in cancer progression cells by localizing on the membrane and modifying proteins linked to motility and proliferation.
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
  • 4-6 Weeks Old Female C57BL/6 Mice Obtained from Jackson Labs Were Used for Cell Isolation

    4-6 Weeks Old Female C57BL/6 Mice Obtained from Jackson Labs Were Used for Cell Isolation

    Methods Mice: 4-6 weeks old female C57BL/6 mice obtained from Jackson labs were used for cell isolation. Female Foxp3-IRES-GFP reporter mice (1), backcrossed to B6/C57 background for 10 generations, were used for the isolation of naïve CD4 and naïve CD8 cells for the RNAseq experiments. The mice were housed in pathogen-free animal facility in the La Jolla Institute for Allergy and Immunology and were used according to protocols approved by the Institutional Animal Care and use Committee. Preparation of cells: Subsets of thymocytes were isolated by cell sorting as previously described (2), after cell surface staining using CD4 (GK1.5), CD8 (53-6.7), CD3ε (145- 2C11), CD24 (M1/69) (all from Biolegend). DP cells: CD4+CD8 int/hi; CD4 SP cells: CD4CD3 hi, CD24 int/lo; CD8 SP cells: CD8 int/hi CD4 CD3 hi, CD24 int/lo (Fig S2). Peripheral subsets were isolated after pooling spleen and lymph nodes. T cells were enriched by negative isolation using Dynabeads (Dynabeads untouched mouse T cells, 11413D, Invitrogen). After surface staining for CD4 (GK1.5), CD8 (53-6.7), CD62L (MEL-14), CD25 (PC61) and CD44 (IM7), naïve CD4+CD62L hiCD25-CD44lo and naïve CD8+CD62L hiCD25-CD44lo were obtained by sorting (BD FACS Aria). Additionally, for the RNAseq experiments, CD4 and CD8 naïve cells were isolated by sorting T cells from the Foxp3- IRES-GFP mice: CD4+CD62LhiCD25–CD44lo GFP(FOXP3)– and CD8+CD62LhiCD25– CD44lo GFP(FOXP3)– (antibodies were from Biolegend). In some cases, naïve CD4 cells were cultured in vitro under Th1 or Th2 polarizing conditions (3, 4).
  • PIK3C2G (NM 004570) Human Mutant ORF Clone Product Data

    PIK3C2G (NM 004570) Human Mutant ORF Clone Product Data

    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC402758 PIK3C2G (NM_004570) Human Mutant ORF Clone Product data: Product Type: Mutant ORF Clones Product Name: PIK3C2G (NM_004570) Human Mutant ORF Clone Mutation Description: P146L Affected Codon#: 146 Affected NT#: 437 Nucleotide Mutation: PIK3C2G Mutant (P146L), Myc-DDK-tagged ORF clone of Homo sapiens phosphoinositide-3- kinase, class 2, gamma polypeptide (PIK3C2G) as transfection-ready DNA Effect: Dibees, ype 2, ssoiion wih Symbol: PIK3C2G Synonyms: PI3K-C2-gamma; PI3K-C2GAMMA Vector: pCMV6-Entry (PS100001) Tag: Myc-DDK ACCN: NM_004570 ORF Size: 4335 bp ORF Nucleotide >RC402758 representing NM_004570 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCATATTCTTGGCAAACGGATCCAAATCCTAATGAATCACACGAAAAGCAGTATGAACACCAAGAAT TTCTCTTTGTAAATCAACCCCATTCTTCTAGCCAAGTCAGTCTGGGTTTTGATCAGATAGTAGATGAGAT CAGTGGCAAAATTCCACACTACGAGAGTGAAATTGATGAAAACACCTTTTTTGTGCCCACTGCACCAAAA TGGGACTCAACAGGGCATTCATTAAATGAAGCACACCAAATATCCTTGAATGAATTCACTTCTAAAAGCC GTGAACTCTCCTGGCATCAAGTTAGCAAAGCACCAGCAATTGGTTTTAGTCCTTCTGTGTTACCAAAACC TCAAAATACGAATAAAGAATGCTCCTGGGGAAGCCCCATAGGAAAACATCATGGTGCTGATGATTCCAGA TTCAGTATTTTAGCTCTATCATTCACAAGTTTGGATAAAATTAATCTAGAGAAAGAATTAGAAAATGAAA ATCATAACTACCATATAGGATTTGAAAGTAGCATTCCTCCAACAAATTCATCCTTCTCAAGTGACTTCAT GCCGAAAGAAGAGAATAAAAGGAGTGGACATGTGAACATTGTGGAACCATCTTTGATGCTTTTGAAAGGC
  • Phosphoinositide 3-Kinase-C2α Regulates Polycystin-2 Ciliary Entry

    Phosphoinositide 3-Kinase-C2α Regulates Polycystin-2 Ciliary Entry

    BASIC RESEARCH www.jasn.org Phosphoinositide 3-Kinase-C2a Regulates Polycystin-2 Ciliary Entry and Protects against Kidney Cyst Formation † Irene Franco,* Jean Piero Margaria,* Maria Chiara De Santis,* Andrea Ranghino, ‡ Daniel Monteyne, Marco Chiaravalli,§ Monika Pema,§ Carlo Cosimo Campa,* ‡| Edoardo Ratto,* Federico Gulluni,* David Perez-Morga, Stefan Somlo,¶ Giorgio R. Merlo,* Alessandra Boletta,§ and Emilio Hirsch* *Molecular Biotechnology Center, Department of Molecular Biotechnology and Health Sciences, University of Torino, Turin, Italy; †Renal Transplantation Center “A. Vercellone”, Division of Nephrology, Dialysis and Transplantation, Department of Medical Sciences, Città della Salute e della Scienza, Hospital and Research Center for Experimental Medicine (CeRMS) and Center for Molecular Biotechnology, University of Torino, Turin, Italy; ‡Laboratoire de Parasitologie Moléculaire, Institut de Biologie et de Médecine Moléculaires (IBMM), Université Libre de Bruxelles, Gosselies, Charleroi, Belgium; §Division of Genetics and Cell Biology, Dibit San Raffaele Scientific Institute, Milan, Italy; |Center for Microscopy and Molecular Imaging (CMMI), Université Libre de Bruxelles, Gosselies, Belgium; and ¶Section of Nephrology, Yale University School of Medicine, New Haven, Connecticut. ABSTRACT Signaling from the primary cilium regulates kidney tubule development and cyst formation. However, the mechanism controlling targeting of ciliary components necessary for cilium morphogenesis and signaling is largely unknown. Here, we studied the function of class II phosphoinositide 3-kinase-C2a (PI3K-C2a)inrenal tubule-derived inner medullary collecting duct 3 cells and show that PI3K-C2a resides at the recycling endo- some compartment in proximity to the primary cilium base. In this subcellular location, PI3K-C2a controlled the activation of Rab8, a key mediator of cargo protein targeting to the primary cilium.
  • Genetic Variant in 3' Untranslated Region of the Mouse Pycard Gene

    Genetic Variant in 3' Untranslated Region of the Mouse Pycard Gene

    bioRxiv preprint doi: https://doi.org/10.1101/2021.03.26.437184; this version posted March 26, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 1 2 3 Title: 4 Genetic Variant in 3’ Untranslated Region of the Mouse Pycard Gene Regulates Inflammasome 5 Activity 6 Running Title: 7 3’UTR SNP in Pycard regulates inflammasome activity 8 Authors: 9 Brian Ritchey1*, Qimin Hai1*, Juying Han1, John Barnard2, Jonathan D. Smith1,3 10 1Department of Cardiovascular & Metabolic Sciences, Lerner Research Institute, Cleveland Clinic, 11 Cleveland, OH 44195 12 2Department of Quantitative Health Sciences, Lerner Research Institute, Cleveland Clinic, Cleveland, OH 13 44195 14 3Department of Molecular Medicine, Cleveland Clinic Lerner College of Medicine of Case Western 15 Reserve University, Cleveland, OH 44195 16 *, These authors contributed equally to this study. 17 Address correspondence to Jonathan D. Smith: email [email protected]; ORCID ID 0000-0002-0415-386X; 18 mailing address: Cleveland Clinic, Box NC-10, 9500 Euclid Avenue, Cleveland, OH 44195, USA. 19 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.03.26.437184; this version posted March 26, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 20 Abstract 21 Quantitative trait locus mapping for interleukin-1 release after inflammasome priming and activation 22 was performed on bone marrow-derived macrophages (BMDM) from an AKRxDBA/2 strain intercross.
  • Cellular and Molecular Signatures in the Disease Tissue of Early

    Cellular and Molecular Signatures in the Disease Tissue of Early

    Cellular and Molecular Signatures in the Disease Tissue of Early Rheumatoid Arthritis Stratify Clinical Response to csDMARD-Therapy and Predict Radiographic Progression Frances Humby1,* Myles Lewis1,* Nandhini Ramamoorthi2, Jason Hackney3, Michael Barnes1, Michele Bombardieri1, Francesca Setiadi2, Stephen Kelly1, Fabiola Bene1, Maria di Cicco1, Sudeh Riahi1, Vidalba Rocher-Ros1, Nora Ng1, Ilias Lazorou1, Rebecca E. Hands1, Desiree van der Heijde4, Robert Landewé5, Annette van der Helm-van Mil4, Alberto Cauli6, Iain B. McInnes7, Christopher D. Buckley8, Ernest Choy9, Peter Taylor10, Michael J. Townsend2 & Costantino Pitzalis1 1Centre for Experimental Medicine and Rheumatology, William Harvey Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, Charterhouse Square, London EC1M 6BQ, UK. Departments of 2Biomarker Discovery OMNI, 3Bioinformatics and Computational Biology, Genentech Research and Early Development, South San Francisco, California 94080 USA 4Department of Rheumatology, Leiden University Medical Center, The Netherlands 5Department of Clinical Immunology & Rheumatology, Amsterdam Rheumatology & Immunology Center, Amsterdam, The Netherlands 6Rheumatology Unit, Department of Medical Sciences, Policlinico of the University of Cagliari, Cagliari, Italy 7Institute of Infection, Immunity and Inflammation, University of Glasgow, Glasgow G12 8TA, UK 8Rheumatology Research Group, Institute of Inflammation and Ageing (IIA), University of Birmingham, Birmingham B15 2WB, UK 9Institute of
  • The DNA Methylation Landscape of Glioblastoma Disease Progression Shows Extensive Heterogeneity in Time and Space

    The DNA Methylation Landscape of Glioblastoma Disease Progression Shows Extensive Heterogeneity in Time and Space

    bioRxiv preprint doi: https://doi.org/10.1101/173864; this version posted August 9, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The DNA methylation landscape of glioblastoma disease progression shows extensive heterogeneity in time and space Johanna Klughammer1*, Barbara Kiesel2,3*, Thomas Roetzer3,4, Nikolaus Fortelny1, Amelie Kuchler1, Nathan C. Sheffield5, Paul Datlinger1, Nadine Peter3,4, Karl-Heinz Nenning6, Julia Furtner3,7, Martha Nowosielski8,9, Marco Augustin10, Mario Mischkulnig2,3, Thomas Ströbel3,4, Patrizia Moser11, Christian F. Freyschlag12, Jo- hannes Kerschbaumer12, Claudius Thomé12, Astrid E. Grams13, Günther Stockhammer8, Melitta Kitzwoegerer14, Stefan Oberndorfer15, Franz Marhold16, Serge Weis17, Johannes Trenkler18, Johanna Buchroithner19, Josef Pichler20, Johannes Haybaeck21,22, Stefanie Krassnig21, Kariem Madhy Ali23, Gord von Campe23, Franz Payer24, Camillo Sherif25, Julius Preiser26, Thomas Hauser27, Peter A. Winkler27, Waltraud Kleindienst28, Franz Würtz29, Tanisa Brandner-Kokalj29, Martin Stultschnig30, Stefan Schweiger31, Karin Dieckmann3,32, Matthias Preusser3,33, Georg Langs6, Bernhard Baumann10, Engelbert Knosp2,3, Georg Widhalm2,3, Christine Marosi3,33, Johannes A. Hainfellner3,4, Adelheid Woehrer3,4#§, Christoph Bock1,34,35# 1 CeMM Research Center for Molecular Medicine of the Austrian Academy of Sciences, Vienna, Austria. 2 Department of Neurosurgery, Medical University of Vienna, Vienna, Austria. 3 Comprehensive Cancer Center, Central Nervous System Tumor Unit, Medical University of Vienna, Austria. 4 Institute of Neurology, Medical University of Vienna, Vienna, Austria. 5 Center for Public Health Genomics, University of Virginia, Charlottesville VA, USA. 6 Department of Biomedical Imaging and Image-guided Therapy, Computational Imaging Research Lab, Medical University of Vi- enna, Vienna, Austria.
  • Mutations in PIK3C2A Cause Syndromic Short Stature

    Mutations in PIK3C2A Cause Syndromic Short Stature

    University of Groningen Mutations in PIK3C2A cause syndromic short stature, skeletal abnormalities, and cataracts associated with ciliary dysfunction Tiosano, Dov; Baris, Hagit N; Chen, Anlu; Hitzert, Marrit M; Schueler, Markus; Gulluni, Federico; Wiesener, Antje; Bergua, Antonio; Mory, Adi; Copeland, Brett Published in: PLoS genetics DOI: 10.1371/journal.pgen.1008088 IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please check the document version below. Document Version Publisher's PDF, also known as Version of record Publication date: 2019 Link to publication in University of Groningen/UMCG research database Citation for published version (APA): Tiosano, D., Baris, H. N., Chen, A., Hitzert, M. M., Schueler, M., Gulluni, F., ... Buchner, D. A. (2019). Mutations in PIK3C2A cause syndromic short stature, skeletal abnormalities, and cataracts associated with ciliary dysfunction. PLoS genetics, 15(4), [e1008088]. https://doi.org/10.1371/journal.pgen.1008088 Copyright Other than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons). Take-down policy If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim. Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons the number of authors shown on this cover page is limited to 10 maximum.
  • TAZ-CAMTA1 and YAP-TFE3 Alter the TAZ/YAP Transcriptome By

    TAZ-CAMTA1 and YAP-TFE3 Alter the TAZ/YAP Transcriptome By

    RESEARCH ARTICLE TAZ-CAMTA1 and YAP-TFE3 alter the TAZ/YAP transcriptome by recruiting the ATAC histone acetyltransferase complex Nicole Merritt1†, Keith Garcia1,2†, Dushyandi Rajendran3, Zhen-Yuan Lin3, Xiaomeng Zhang4, Katrina A Mitchell4,5, Nicholas Borcherding6, Colleen Fullenkamp1, Michael S Chimenti7, Anne-Claude Gingras3, Kieran F Harvey4,5,8, Munir R Tanas1,2,9,10* 1Department of Pathology, University of Iowa, Iowa City, United States; 2Cancer Biology Graduate Program, University of Iowa, Iowa City, United States; 3Lunenfeld- Tanenbaum Research Institute, Mount Sinai Hospital, Toronto, United States; 4Peter MacCallum Cancer Centre, Melbourne, Australia; 5Sir Peter MacCallum Department of Oncology, The University of Melbourne, Parkville, Australia; 6Department of Pathology and Immunology, Washington University, St. Louis, United States; 7Iowa Institute of Human Genetics, Carver College of Medicine, University of Iowa, Iowa City, United States; 8Department of Anatomy and Developmental Biology and Biomedicine Discovery Institute, Monash University, Clayton, Australia; 9Holden Comprehensive Cancer Center, University of Iowa, Iowa City, United States; 10Pathology and Laboratory Medicine, Veterans Affairs Medical Center, Iowa City, United States *For correspondence: Abstract Epithelioid hemangioendothelioma (EHE) is a vascular sarcoma that metastasizes early [email protected] in its clinical course and lacks an effective medical therapy. The TAZ-CAMTA1 and YAP-TFE3 fusion proteins are chimeric transcription factors and initiating oncogenic drivers of EHE. A combined †These authors contributed proteomic/genetic screen in human cell lines identified YEATS2 and ZZZ3, components of the equally to this work Ada2a-containing histone acetyltransferase (ATAC) complex, as key interactors of both fusion Competing interests: The proteins despite the dissimilarity of the C terminal fusion partners CAMTA1 and TFE3.
  • Trim24 Targets Endogenous P53 for Degradation

    Trim24 Targets Endogenous P53 for Degradation

    Trim24 targets endogenous p53 for degradation Kendra Alltona,b,1, Abhinav K. Jaina,b,1, Hans-Martin Herza, Wen-Wei Tsaia,b, Sung Yun Jungc, Jun Qinc, Andreas Bergmanna, Randy L. Johnsona,b, and Michelle Craig Bartona,b,2 aDepartment of Biochemistry and Molecular Biology, Program in Genes and Development, Graduate School of Biomedical Sciences and bCenter for Stem Cell and Developmental Biology, University of Texas M.D. Anderson Cancer Center, 1515 Holcombe Boulevard, Houston, TX 77030; and cDepartment of Molecular and Cellular Biology, Baylor College of Medicine, 1 Baylor Plaza, Houston, TX 77030 Edited by Carol L. Prives, Columbia University, New York, NY, and approved May 15, 2009 (received for review December 23, 2008) Numerous studies focus on the tumor suppressor p53 as a protector regulator of p53 suggests that potential therapeutic targets to of genomic stability, mediator of cell cycle arrest and apoptosis, restore p53 functions remain to be identified. and target of mutation in 50% of all human cancers. The vast majority of information on p53, its protein-interaction partners and Results and Discussion regulation, comes from studies of tumor-derived, cultured cells Creation of a Mouse and Stem Cell Model for p53 Analysis. To where p53 and its regulatory controls may be mutated or dysfunc- facilitate analysis of endogenous p53 in normal cells, we per- tional. To address regulation of endogenous p53 in normal cells, formed gene targeting to create mouse embryonic stem (ES) we created a mouse and stem cell model by knock-in (KI) of a cells and mice (12), which express endogenously regulated p53 tandem-affinity-purification (TAP) epitope at the endogenous protein fused with a C-terminal TAP tag (p53-TAPKI, Fig.