bioRxiv preprint doi: https://doi.org/10.1101/488411; this version posted December 7, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

Mutations In PIK3C2A Cause Syndromic Short Stature, Skeletal Abnormalities, and Cataracts Associated With Ciliary Dysfunction

Dov Tiosano,1,2,17 Hagit Baris Feldman,2,3,17 Anlu Chen,4,17 Marrit M. Hitzert,5,17 Markus Schueler,6,17 Federico Gulluni,7,17 Antje Wiesener,8 Antonio Bergua,9 Adi Mory,3 Brett Copeland,10 Joseph G. Gleeson,10,11 Patrick Rump,5 Hester van Meer,12 Deborah A. Sival,12 Volker Haucke,13 Josh Kriwinsky14, Karl X. Knaup,6 André Reis,8 Nadine N. Hauer,8 Emilio Hirsch,7 Ronald Roepman,15 Rolph Pfundt,15 Christian T. Thiel,8,18 Michael S. Wiesener,6,18 Mariam G. Aslanyan,15,18 and David A. Buchner4,14,16,18*

1Division of Pediatric Endocrinology, Ruth Children's Hospital, Rambam Medical Center, Haifa 30196, Israel.

2Rappaport Family Faculty of Medicine, Technion - Israel Institute of Technology, Haifa 30196, Israel.

3The Genetics Institute, Rambam Health Care Campus, Haifa 3109601, Israel.

4Department of Biochemistry, Case Western Reserve University, Cleveland, OH 44106, USA.

5Department of Genetics, University of Groningen, University Medical Center Groningen, PO Box 30001 9700 RB Groningen, The Netherlands.

6Department of Nephrology and Hypertension, Friedrich-Alexander University Erlangen- Nürnberg, Erlangen, Germany.

7Department of Molecular Biotechnology and Health Sciences, Molecular Biotechnology Center, University of Turin, Via Nizza 52, 10126, Torino, Italy.

8Institute of Human Genetics, Friedrich-Alexander University Erlangen-Nürnberg, Erlangen, Germany.

9Department of Ophthalmology, Friedrich-Alexander University Erlangen-Nürnberg, Erlangen, Germany.

10Laboratory of Pediatric Brain Diseases, Rockefeller University, New York, New York, USA.

11Department of Neurosciences, University of California, San Diego, La Jolla, CA, USA.

12Department of Pediatrics, Beatrix Children’s Hospital, University of Groningen, University Medical Center Groningen, PO Box 3001 9700 RB Groningen, the Netherlands.

13Leibniz-Institut für Molekulare Pharmakologie (FMP), Robert-Rössle-Strasse 10, 13125 Berlin Faculty of Biology, Chemistry, and Pharmacy, Freie Universität Berlin, 14195 Berlin, Germany.

1 bioRxiv preprint doi: https://doi.org/10.1101/488411; this version posted December 7, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

14Department of Genetics and Genome Sciences, Case Western Reserve University, Cleveland, OH 44106, USA.

15Department of Human Genetics, Radboud Institute for Molecular Life Sciences, Radboud University Medical Center, Nijmegen, The Netherlands.

16Research Institute for Children’s Health, Case Western Reserve University, Cleveland, OH 44106, USA.

17These authors contributed equally to this work 18These authors contributed equally to this work * [email protected]

2 bioRxiv preprint doi: https://doi.org/10.1101/488411; this version posted December 7, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

Abstract

PIK3C2A is a class II member of the phosphoinositide 3-kinase (PI3K) family that catalyzes the

phosphorylation of phosphatidylinositol (PI) into PI(3)P and the phosphorylation of PI(4)P into

PI(3,4)P2. We identified homozygous loss-of-function mutations in PIK3C2A in children from

three independent consanguineous families with short stature, coarse facial features, cataracts with

secondary glaucoma, multiple skeletal abnormalities, neurological manifestations, among other

findings. Cellular studies of patient-derived fibroblasts found that they lacked PIK3C2A protein,

had impaired cilia formation and function, and demonstrated reduced proliferative capacity.

Collectively, the genetic and molecular data implicate mutations in PIK3C2A in a new Mendelian

disorder of PI metabolism, thereby shedding light on the critical role of a class II PI3K in growth,

vision, skeletal formation and neurological development. This discovery expands what is known

about disorders of PI metabolism and helps unravel the role of PIK3C2A and class II PI3Ks in

health and disease.

3 bioRxiv preprint doi: https://doi.org/10.1101/488411; this version posted December 7, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

Introduction

Identifying the genetic basis of diseases with Mendelian inheritance provides insight into gene

function, susceptibility to disease, and can guide the development of new therapeutics. To date,

~50% of the genes underlying Mendelian phenotypes have yet to be discovered (Chong et al.,

2015). The disease genes that have been identified thus far have led to a better understanding of

the pathophysiological pathways and to the development of medicinal products approved for the

clinical treatment of such rare disorders (Boycott et al., 2013). Furthermore, technological

advances in DNA sequencing have facilitated the identification of novel genetic mutations that

result in rare Mendelian disorders (Koboldt et al., 2013; Sobreira et al., 2015). We have applied

these next-generation sequencing technologies to discover mutations in PIK3C2A that cause a

newly identified genetic syndrome consisting of dysmorphic features, short stature, cataracts and

skeletal abnormalities.

PIK3C2A is a class II member of the phosphoinositide 3-kinase (PI3K) family of lipid kinases that

catalyzes the phosphorylation of phosphatidylinositol (PI) (Cantley, 2002). The functions of class

II PI3Ks are poorly understood. However, they are generally thought to catalyze the

phosphorylation of PI and/or PI 4-phosphate [PI(4)P] to generate PI(3)P and PI(3,4)P2,

respectively (Jean and Kiger, 2014). PIK3C2A has been attributed a wide-range of biological

functions including glucose transport, angiogenesis, Akt activation, endosomal trafficking,

phagosome maturation, mitotic spindle organization, exocytosis, and autophagy (Behrends et al.,

2010; Campa et al., 2015; Devereaux et al., 2013; Falasca and Maffucci, 2012; Franco et al., 2014;

Gulluni et al., 2017; Krag et al., 2010; Leibiger et al., 2010; Posor et al., 2013; Yoshioka et al.,

2012). In addition, PIK3C2A is critical for the formation and function of primary cilia (Falasca

4 bioRxiv preprint doi: https://doi.org/10.1101/488411; this version posted December 7, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

and Maffucci, 2012; Franco et al., 2014). However, there is as yet no causal link between

PIK3C2A, or any class II PI3K, and human disease. Here, we describe the evidence that

homozygous loss-of-function mutations in PIK3C2A cause a novel syndromic disorder involving

neurological, visual, skeletal, growth, and occasionally hearing impairments.

Results

Five individuals between the ages of 8 and 21 from three unrelated consanguineous families were

found by diagnostic analyses to have a similar constellation of clinical features including

dysmorphic facial features, short stature, skeletal and neurological abnormalities, and cataracts

(Figure 1, Table 1, Table S1). The dysmorphic facial features included coarse facies, low hairline,

epicanthal folds, flat and broad nasal bridges, and retrognathia (Figure 1B, Table S1). Skeletal

findings included scoliosis, delayed bone age, diminished ossification of femoral heads, cervical

lordosis, shortened fifth digits with mild metaphyseal dysplasia and clinodactyly, as well as dental

findings such as broad maxilla incisors, narrow mandible teeth, and enamel defects (Figures 1C,

1D, Table S1, Figure S1). Most of the affected individuals exhibited neurological involvement

including developmental delay and stroke. This was first seen in individual I-II-2 when she

recently started having seizures, with an EEG demonstrating sharp waves in the central areas of

the right hemisphere and short sporadic generalized epileptic seizures. Her brain MRI showed a

previous stroke in the right corpus striatum (Figure 1F). Hematological studies were normal for

hypercoagulability and platelet function (Table S2). In addition, brain MRI of patient II-II-3

showed multiple small frontal and periventricular lacunar infarcts (Figure S1E). Unclear episodes

of syncope also led to neurological investigations including EEG in individual III-II-2, without

any signs of epilepsy. Her brain MRI showed symmetrical structures and normal cerebrospinal

5 bioRxiv preprint doi: https://doi.org/10.1101/488411; this version posted December 7, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

fluid spaces but pronounced lesions of the white matter (Figure S1E). Other recurrent features

included hearing loss, secondary glaucoma, and nephrocalcinosis.

In addition to the shared syndromic features described above in all three families, both affected

daughters in Family I were diagnosed with congenital adrenal hyperplasia (CAH), due to 17-alpha-

hydroxylase deficiency, and were found to have a homozygous familial mutation:

NM_000102.3:c.286C>T; p.(Arg96Trp) in the CYP17A1 gene (OMIM #202110) (Laflamme et

al., 1996; Martin et al., 2003). The affected individuals in Families II and III do not carry mutations

in CYP17A1 or have CAH, suggesting the presence of two independent and unrelated conditions

in Family I. The co-occurrence of multiple monogenic disorders is not uncommon among this

highly consanguineous population (Kurolap et al., 2016).

To identify the genetic basis of this disorder, enzymatic assays related to the

mucopolysaccharidosis subtypes MPS I, MPS IVA, MPS IVB, and MPSVI were tested in Families

I and II and found to be normal. Enzymatic assays for mucolipidosis II/III were also normal and

no pathogenic mutations were found in galactosamine-6-sulfate sulfatase (GALNS) in Family I.

Additionally, since some of the features of patient II-II-3 were reminiscent of Noonan syndrome,

Hennekam syndrome, and Aarskog-Scott syndrome, individual genes involved in these disorders

were analyzed in Family II, but no pathogenic mutation was identified. In patient III-II-2,

Williams-Beuren syndrome was excluded in childhood. Additionally, direct molecular testing at

presentation in adulthood excluded Leri-Weill syndrome, Alstrom disease, and mutations in

FGFR3.

6 bioRxiv preprint doi: https://doi.org/10.1101/488411; this version posted December 7, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

Given the negative results of targeted genetic testing, WES and CNV analysis was performed for

the affected individuals from all three families. Five homozygous candidate variants were

identified in Family I, including the CYP17A1 (p.Arg96Trp) mutation that is the cause of the CAH

(Laflamme et al., 1996; Martin et al., 2003), but is not known to cause the other phenotypes. The

remaining four variants affected the genes ATF4, DNAH14, PLEKHA7, and PIK3C2A (Table 2).

In Family II, homozygous missense variants were identified in KIAA1549L, METAP1, and PEX2,

in addition to a homozygous deletion in PIK3C2A that encompassed exons 1-24 out of 32 total

exons (Table 2). The deletion was limited to PIK3C2A and did not affect the neighboring genes.

Sequence analysis of Family III showed a homozygous missense variant in PTH2R, nonsense

variant in DPRX, and splice site variant in PIK3C2A (Table 2).

Sequencing analyses revealed that all affected family members in the Families I, II, and III were

homozygous for predicted loss-of-function variants in PIK3C2A, and none of the unaffected family

members were homozygous for the PIK3C2A variants (Figure 2). The initial link between these

three families with rare mutations in PIK3C2A was made possible through the sharing of

information via the GeneMatcher website (Sobreira et al., 2015). The PIK3C2A deletion in Family

II was confirmed by multiplex amplicon quantification. The single nucleotide PIK3C2A variants

in Families I and III were confirmed by Sanger sequencing (Figure 2C, D).

In Family I, the nonsense mutation in PIK3C2A (p.Tyr195*) truncates 1,492 amino acids from a

protein that is 1,686 amino acids. This is predicted to eliminate nearly all functional domains

including the catalytic kinase domain, and is expected to trigger nonsense-mediated mRNA decay

(Campa et al., 2015). Accordingly, levels of PIK3C2A mRNA are significantly decreased in both

7 bioRxiv preprint doi: https://doi.org/10.1101/488411; this version posted December 7, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

heterozygous and homozygous individuals carrying the p.Tyr195* variant (Figure 3A). The

deletion in Family II eliminates the first 24 exons of the 32-exon PIK3C2A gene and is thus

predicted to cause a loss of protein expression. This is consistent with a lack of PIK3C2A mRNA

expression (Figure 3B). The variant in PIK3C2A in Family III affects an essential splice site

(c.1640+1G>T) that leads to decreased mRNA levels (Figure 3C). Deep sequencing of the RT-

PCR products revealed 4 alternative transcripts in patient-derived lymphocytes

(p.[Asn483_Arg547delinsLys, Ala521Thrfs*4, Ala521_Glu568del, and Arg547SerinsTyrIleIle*])

of which the transcript encoding p. Asn483_Arg547delinsLys that skips both exons 5 and 6 was

also observed in patient’s fibroblasts (Figure S2). Although this transcript remains in-frame, no

PIK3C2A protein was detected by Western blotting (Figure 3D). This is consistent with Families

I and II, for which Western blotting also failed to detect any full-length PIK3C2A in fibroblasts

from the affected homozygous children (Figure 3E). Thus, all three PIK3C2A variants likely

encode loss-of-function alleles. Importantly, among the 141,456 WES and whole genome

sequences from control individuals in the Genome Aggregation Database (gnomAD v2.1) (Lek et

al., 2016), none are homozygous for loss-of-function mutations in PIK3C2A, which is consistent

with total PIK3C2A deficiency causing severe early onset disease.

To test whether the observed loss-of-function mutations in PIK3C2A cause cellular phenotypes

consistent with loss of PIK3C2A function, we examined PI metabolism, cilia formation and

function, and cellular proliferation rates. PIK3C2A deficiency in the patient-derived fibroblasts

decreased the levels of PI(3,4)P2 throughout the cell (Figure 4A) as well as decreased the levels

of PI(3)P at the ciliary base (Figures 4B, S3A). The reduction in PI(3)P at the ciliary base was

associated with a reduction in ciliary length (Figure 5A), although the percentage of ciliated cells

8 bioRxiv preprint doi: https://doi.org/10.1101/488411; this version posted December 7, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

was not altered (Figure 5B). Additional cilia defects include a reduction in the levels of RAB11 at

the ciliary base (Figures 5C, S3B), and increased accumulation of IFT88 along the length of the

cilium (Figures 5D, S3C) that are suggestive of defective trafficking of ciliary components.

Finally, the proliferative capacity of PIK3C2A deficient cells was reduced relative to control cells

(Figure 6).

As PIK3C2A is a member of the class II PI3K family, we tested whether the expression of the

other family members PIK3C2B and PIK3C2G were altered by PIK3C2A deficiency. The

expression of PIK3C2G was not detected by qRT-PCR in either patient-derived or control primary

fibroblasts. This is consistent with the relatively restricted expression pattern of this gene in the

GTEx portal (GTEx Consortium, 2013), with expression largely limited to stomach, skin, liver,

esophagus, mammary tissue, and kidney, but absent in fibroblast cells and most other tissues. In

contrast, PIK3C2B expression was detected, with both mRNA and protein levels significantly

increased in PIK3C2A deficient cells (Figure 7A-C). Downregulation of PIK3C2A using an

inducible shRNA in HeLa cells also resulted in elevated levels of PIK3C2B (Figure 7D). Together,

these data are consistent with increased levels of PIK3C2B serving to partially compensate for

PIK3C2A deficiency.

Discussion

Here we describe the identification of three independent families with homozygous loss-of-

function mutations in PIK3C2A resulting in a novel syndrome consisting of short stature, cataracts,

secondary glaucoma, and skeletal abnormalities among other features. Patient-derived fibroblasts

had decreased levels of PI(3,4)P2 and PI(3)P, shortening of the cilia and impaired ciliary protein

9 bioRxiv preprint doi: https://doi.org/10.1101/488411; this version posted December 7, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

localization, and reduced proliferation capacity. Thus, based on the loss-of-function mutations in

PIK3C2A, the phenotypic overlap between the three independent families, and the patient-derived

cellular data consistent with previous studies of PIK3C2A function, we conclude that loss-of-

function mutations in PIK3C2A cause this novel syndrome.

The identification of PIK3C2A loss-of-function mutations in humans represents the first mutations

identified in any class II PI-3-kinase in a disorder with a Mendelian inheritance, and thus sheds

light into the biological role of this poorly understood class of PI3Ks (Jean and Kiger, 2014;

Vanhaesebroeck et al., 2016). This is significant not only for understanding the role of PIK3C2A

in rare monogenic disorders, but also the potential contribution of common variants in PIK3C2A

in more genetically complex disorders. There are now numerous examples where severe mutations

in a gene cause a rare Mendelian disorder, whereas more common variants in the same gene, with

a less deleterious effect on protein function, are associated with polygenic human traits and

disorders (Blair et al., 2013; Lupski et al., 2011; Marouli et al., 2017). For example, severe

mutations in PPARG cause monogenic lipodystrophy, whereas less severe variants are associated

with complex polygenic forms of lipodystrophy (Lotta et al., 2016; Semple et al., 2011). In the

case of PIK3C2A deficiency, the identification of various neurological features including

developmental delay, selective mutism, and the brain abnormalities detected by MRI (Table S1)

may provide biological insight into the mechanisms underlying the association between common

variants in PIK3C2A and schizophrenia (Goes et al., 2015; Ruderfer et al., 2014; Schizophrenia

Psychiatric Genome-Wide Association Study (GWAS) Consortium, 2011).

10 bioRxiv preprint doi: https://doi.org/10.1101/488411; this version posted December 7, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

Other monogenic disorders of phosphoinositide metabolism include Lowe’s syndrome and Joubert

syndrome, which can be caused by mutations in the inositol polyphosphate 5-phosphatases OCRL

and INPP5E, respectively (Conduit et al., 2012). All three of these disorders of PI metabolism

affect some of the same organ systems, namely the brain, eye, and kidney. However, the phenotype

associated with mutations in INPP5E is quite distinct, and includes cerebellar vermis hypo-

dysplasia, coloboma, hypotonia, ataxia, and neonatal breathing dysregulation (Travaglini et al.,

2013). In contrast, the phenotypes associated with Lowe’s syndrome share many of the same

features with PIK3C2A deficiency including congenital cataracts, secondary glaucoma, kidney

defects, skeletal abnormalities, developmental delay, and short stature (Bökenkamp and Ludwig,

2016; Staiano et al., 2015). The enzyme defective in Lowe’s syndrome, OCRL, is functionally

similar to PIK3C2A as well, as it is also required for membrane trafficking and ciliogenesis (Mehta

et al., 2014). The similarities between Lowe’s syndrome and PIK3C2A deficiency suggest that

similar defects in phosphatidylinositol metabolism may underlie both disorders. In addition to

Lowe’s syndrome, there is partial overlap between PIK3C2A deficiency and yet other Mendelian

disorders of PI metabolism such as the early-onset cataracts in patients with INPP5K deficiency

(Osborn et al., 2017; Wiessner et al., 2017), demonstrating the importance of PI metabolism in

lens development.

The viability of humans with PIK3C2A deficiency is in stark contrast to mouse Pik3c2a knockout

models that result in growth retardation by e8.5 and embryonic lethality between e10.5-11.5 due

to vascular defects (Yoshioka et al., 2012). One potential explanation for this discrepancy is

functional differences between human PIK3C2A and the mouse ortholog. However, the

involvement of both human and mouse PIK3C2A in cilia formation, PI metabolism, and cellular

11 bioRxiv preprint doi: https://doi.org/10.1101/488411; this version posted December 7, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

proliferation suggests a high degree of functional conservation at the cellular level (Franco et al.,

2014; Gulluni et al., 2017). An alternate possibility is that the species viability differences

associated with PIK3C2A deficiency result from altered compensation from other PI metabolizing

enzymes. For instance, there are species-specific differences between humans and mice in the

transcription and splicing of the OCRL homolog INPP5B that may uniquely contribute to PI

metabolism in each species (Bothwell et al., 2010). Alternately, PIK3C2B levels were significantly

increased in human PIK3C2A deficient cells, including both patient-derived cells and HeLa cells

surviving PIK3C2A deletion, suggesting that this may partially compensate for the lack of

PIK3C2A in humans, although it remains to be determined whether a similar compensatory

pathway exists in mice.

It is intriguing that both PIK3C2A and OCRL have important roles in primary cilia formation

(Franco et al., 2014; Luo et al., 2012; Prosseda et al., 2017). Primary cilia are evolutionary

conserved microtubule-derived cellular organelles that protrude from the surface of most

mammalian cell types. Primary cilia formation is initiated by a cascade of processes involving the

targeted trafficking and docking of Golgi-derived vesicles near the mother centriole. They play a

pivotal role in a number of processes, such as left-right patterning during embryonic development,

cell growth, and differentiation. Abnormal phosphatidylinositol metabolism results in ciliary

dysfunction (Bielas et al., 2009), including loss of PIK3C2A that impairs ciliogenesis in mouse

embryonic fibroblasts, likely due to defective trafficking of ciliary components (Franco et al.,

2014). The importance of primary cilia in embryonic development and tissue homeostasis has

become evident over the two past decades, as a number of proteins which localize to the cilium

harbor defects causing syndromic diseases, collectively known as ciliopathies (Braun and

12 bioRxiv preprint doi: https://doi.org/10.1101/488411; this version posted December 7, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

Hildebrandt, 2017; Reiter and Leroux, 2017). Hallmark features of ciliopathies share many

features with PIK3C2A deficiency and include skeletal abnormalities, progressive vision and

hearing loss, mild to severe intellectual disabilities, polydactyly, and kidney phenotypes. Further

work and the identification of additional patients with mutations in PIK3C2A will continue to

improve our understanding of the genotype-phenotype correlation associated with PIK3C2A

deficiency. However, the identification of the first patients with PIK3C2A deficiency establishes

a role for PIK3C2A in neurological and skeletal development, as well as vision, and growth and

implicates loss-of-function PIK3C2A mutations as a potentially new cause of a cilia-associated

disease.

Material and Methods

Human studies. The study was approved by the ethics committees of Rambam Hospital, Haifa,

Israel, and University Hospital, Erlangen, Germany and was in accordance with the regulations of

the University Medical Center Groningen’s ethical committee. Informed consent was obtained

from all participants.

Whole exome sequencing. Whole exome sequencing (WES) of two patients from Family I was

performed using DNA (1µg) extracted from whole blood and fragmented and enriched using the

Truseq DNA PCR Free kit (Illumina). Samples were sequenced on a HiSeq2500 (Illumina) with

2x100bp read length and analyzed as described (Chen et al., 2018). Raw fastq files were mapped

to the reference human genome GRCh37 using BWA (Li and Durbin, 2009) (v.0.7.12). Duplicate

reads were removed by Picard (v. 1.119) and local realignment and base quality score recalibration

was performed following the GATK pipeline (McKenna et al., 2010) (v. 3.3). The average read

13 bioRxiv preprint doi: https://doi.org/10.1101/488411; this version posted December 7, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

depth was 98x (I-II-1) and 117x (I-II-2). HaplotypeCaller was used to call SNPs and indels and

variants were further annotated with Annovar (Wang et al., 2010). Databases used in Annovar

were RefSeq (Pruitt et al., 2007), Exome Aggregation Consortium (ExAC) (Lek et al., 2016) (v.

exac03), ClinVar (Landrum et al., 2016) (v. clinvar_20150330) and LJB database (Liu et al., 2011)

(v. ljb26_all). Exome variants in Family I were filtered out if they were not homozygous in both

affected individuals, had a population allele frequency greater than 0.1% in either the ExAC

database (Lek et al., 2016) or the Greater Middle East Variome Project (Scott et al., 2016), and

were not predicted to be deleterious by either SIFT (Kumar et al., 2009) or Polyphen2 (Adzhubei

et al., 2010).

Whole exome sequencing was performed on the two affected individuals of Family II and both

their parents essentially as previously described (Neveling et al., 2013). Target regions were

enriched using the Agilent SureSelectXT Human All Exon 50Mb Kit. Whole-exome sequencing

was performed on the Illumina HiSeq platform (BGI Europe) followed by data processing with

BWA (Li and Durbin, 2009) (read alignment) and GATK (McKenna et al., 2010) (variant calling)

software packages. Variants were annotated using an in-house developed pipeline. Prioritization

of variants was done by an in-house designed ‘variant interface’ and manual curation.

The DNAs of Family III were enriched using the SureSelect Human All Exon Kit v6 (Agilent) and

sequenced on an Illumina HiSeq 2500 (Illumina). Alignment, variant calling, and annotation were

performed as described (Hauer et al., 2018). The average read depth was 95x (III-II-2), 119x (III-

I-1) and 113x (III-I-2). Variants were selected that were covered by at least 10% of the average

coverage of each exome and for which at least 5 novel alleles were detected from 2 or more callers.

14 bioRxiv preprint doi: https://doi.org/10.1101/488411; this version posted December 7, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

All modes of inheritance were analyzed (Hauer et al., 2018). Variants were prioritized based on a

population frequency of 10-3 or below (based on the ExAC database (Lek et al., 2016) and an in-

house variant database), on the evolutionary conservation, and on the mutation severity prediction.

All candidate variants in Families I, II, and III were confirmed by Sanger sequencing (primers

listed in Table S3).

Copy number variant (CNV) analysis. Microarray analysis for CNV detection in Family I was

performed using a HumanOmni5-Quad chip (Illumina). SNP array raw data was mapped to the

reference human genome GRCh37 and analyzed using GenomeStudio (v. 2011/1). Signal

intensity files with Log R ratio and B-allele frequency were further analyzed with PennCNV

(Wang et al., 2007) (v. 2014/5/7). In Family III the diagnostic chromosomal microarray analysis

was performed with an Affymetrix CytoScan HD-Array and analyzed using Affymetrix

Chromosome analysis Suite-Software, compared with the Database of Genomic Variants and

820 in house controls. All findings refer to UCSC Genome Browser on Human, February 2009

Assembly (hg19), Human Genome built 37.

CNV analysis on the WES data of Families II and III were performed using CoNIFER (Krumm et

al., 2012). Variants were annotated using an in-house developed pipeline. Prioritization of variants

was done by an in-house designed ‘variant interface’ and manual curation as described before

(Pfundt et al., 2017). Subsequent segregation analysis of the pathogenic CNV in Family II was

performed with MAQ by using a targeted primer set with primers in exons 3, 10, 20 and 24 which

15 bioRxiv preprint doi: https://doi.org/10.1101/488411; this version posted December 7, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

are located within the deletion and exons 28, 32, 34 which are located outside of the deletion

(Multiplex Amplicon Quantification (MAQ); Multiplicom)).

Cell culture. Human dermal fibroblasts were obtained from sterile skin punches cultured in

DMEM (Dulbecco's Modified Eagle's Medium) supplemented with 10 - 20% Fetal Calf Serum,

1% Sodium Pyruvate and 1% Penicillin and streptomycin (P/S) in 5% CO2 at 37°C. Control

fibroblasts were obtained from healthy age-matched volunteers. Fibroblasts from passages 4–8

were used for the experiments. To measure cell proliferation, cells were detached using trypsin

and counted with an Automated Cell Counter (ThermoFisher). Cells (n=2500) were plated in

triplicate in 96-well plates. Viability was measured at day 2, 4, 6 and 8. Each measurement was

normalized to day 0 (measured the day after plating) and expressed as a fold increase. Viability

was assessed by using CellTiter-Glo Luminescent Cell Viability Assay (Promega). Three

independent experiments were performed.

Inducible knockdown of PIK3C2A. HeLa cells were infected with lentiviral particles containing

pLKO-TET-PI3KC2A-shRNA or pLKO-TET-scramble-shRNA in six-well plates (n=50,000

cells). After two days, the medium containing lentiviral particles was replaced with DMEM 10%

FBS, 1.5µg/ml puromycin. After 7 days of selection, cells were detached and 100,000 cells were

plated in six-well plates in triplicate in the presence of doxycycline (0.5, 1 and 2 µg/ml). Medium

containing doxycycline was replaced every 48 hours. After 10 days of doxycycline treatment, cells

were lysed and analysed by Western blot.

16 bioRxiv preprint doi: https://doi.org/10.1101/488411; this version posted December 7, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

cDNA and quantitative real time-PCR. Total RNA was purified from primary fibroblasts using

the PureLink RNA purification kit (ThermoFisher) or RNAPure peqGOLD (Peqlab). RNA was

reverse transcribed into complementary DNA with random hexamer using a high-Capacity cDNA

Reverse Transcription Kit (ThermoFisher). RT-PCR from lymphocytes to detect exon-skipping in

family III was performed using primers flanking exon 6. The resulting product was sequenced on

an Illumina HiSeq2500 (Illumina) to detect splicing variants with high sensitivity. Gene expression

was quantified by SYBR Green real-time PCR using the CFX Connect Real-Time System

(BioRad). Primers used are detailed in Table S3. Expression levels were calculated using the DDCT

method relative to GADPH.

Western Blotting. Protein was extracted from cultured primary fibroblast cells as described

(Buchner et al., 2015; Knaup et al., 2017). Extracts were quantified using the DC protein assay

(BioRad) or the BCA method. Equal amounts of protein were separated by SDS-PAGE and

electrotransferred onto polyvinylidene difluoride membranes (Millipore). Membranes were

blocked with TBST/5% fat-free dried milk and stained with antibodies as detailed in Table S4.

Secondary antibodies were goat anti-rabbit (1:5,000, ThermoFisher #31460) goat anti-mouse

(1:5,000, ThermoFisher #31430), goat anti-rabbit (1:2,000, Dako #P0448), and goat anti-mouse

(1:2,000, Dako #P0447).

Immunostaining. Primary fibroblasts were grown on glass coverslips to approximately 80% -

90% confluency in DMEM + 10% FCS + 1% P/S, at which time the medium was replaced with

DMEM without FCS for 48 hours to induce ciliogenesis. Cells were fixed in either methanol for

10 minutes at -20°C or 4% paraformaldehyde for 10 minutes at room temperature (RT). Fixed cells

17 bioRxiv preprint doi: https://doi.org/10.1101/488411; this version posted December 7, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

were washed in PBS, and incubated with 10% normal goat serum, 1% bovine serum albumin in

PBS for 1 hour at RT. If cells were fixed with paraformaldehyde, blocking solutions contained

0.5% Triton X-100. Cells were incubated with primary antibody overnight at 4°C, washed in PBS,

and incubated with secondary antibody including Diamidino-2-Phenylindole (DAPI) to stain

nuclei for 1 hours at RT. Coverslips were mounted on glass slides with fluoromount (Science

Services) and imaged on a confocal laser scanning system with a 63x objectives (LSM 710, Carl

Zeiss MicroImaging). Primary antibodies are detailed in Table S4.

Cilia analysis. To induce ciliogenesis, cells were grown in DMEM with 0 - 0.2% FCS for 48

hours. Cells were washed in PBS, then fixed and permeabilized in ice-cold methanol for 5 minutes,

followed by extensive washing with PBS. After blocking in 5% Bovine Serum Albumin, cells

were incubated with primary antibodies for 1.5 hours at RT and extensively washed in PBS-T.

Primary antibodies used for Centrin and ARL13B are detailed in Table S4. To wash off the primary

antibody, cells were extensively washed in PBS-T. Subsequently, cells were incubated with

secondary antibodies, Alexa Flour 488 (1:800, Invitrogen) and Alexa Fluor 568 (1:800,

Invitrogen), for 45 min followed by washing with PBS-T. Finally, cells were shortly rinsed in

ddH2O and samples were mounted using Vectashield with DAPI. Images were taken using an

Axio Imager Z2 microscope with an Apotome (Zeiss) at 63x magnification. Cilia were measured

manually using Fiji software taking the whole length of the cilium based on ARL13B staining. At

least 300 cilia were measured per sample. Cilia lengths were pooled for 3 control cell lines and

compare to 2 patient-derived samples (II-II-2 and II-II-3). Statistical significance was calculated

using a Student t-test.

18 bioRxiv preprint doi: https://doi.org/10.1101/488411; this version posted December 7, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

Acknowledgements

The authors would like to thank the Genome Aggregation Database (gnomAD) and the groups that

provided exome and genome variant data to this resource. A full list of contributing groups can be

found at http://gnomad.broadinstitute.org/about. This research was also supported by the

Genomics Core Facility of the CWRU School of Medicine’s Genetics and Genome Sciences

Department. We would also like to thank the Research Institute for Children’s Health at Case

Western Reserve University and its director, Dr. Mitchell Drumm, for support and guidance. This

work was supported by the NIDDK (grants DK112846 and DK099533 to D.A.B.), the Sigma Xi

Scientific Research Society (grant G201603152079889 to A.C.), the DFG grants: TH 896/3-3, TH

896/3-4, TH 896/6-1, SCHU 3314/1-1, the IZKF (Interdisciplinary Centre for Clinical Research

of the Universität Erlangen-Nürnberg, (FAU)) project F4, the Fondazione Italiana per la Ricerca

sul Cancro (grant FIRC 19421 to F.G.), and the Johannes und Frieda Marohn-Stiftung of the FAU

(WIE/2015).

19 bioRxiv preprint doi: https://doi.org/10.1101/488411; this version posted December 7, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

Competing Interests. The authors declare no competing interests.

20 bioRxiv preprint doi: https://doi.org/10.1101/488411; this version posted December 7, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

References Adzhubei IA, Schmidt S, Peshkin L, Ramensky VE, Gerasimova A, Bork P, Kondrashov AS, Sunyaev SR. 2010. A method and server for predicting damaging missense mutations. Nat Methods 7:248–249. doi:10.1038/nmeth0410-248 Behrends C, Sowa ME, Gygi SP, Harper JW. 2010. Network organization of the human autophagy system. Nature 466:68–76. doi:10.1038/nature09204 Bielas SL, Silhavy JL, Brancati F, Kisseleva MV, Al-Gazali L, Sztriha L, Bayoumi RA, Zaki MS, Abdel-Aleem A, Rosti RO, Kayserili H, Swistun D, Scott LC, Bertini E, Boltshauser E, Fazzi E, Travaglini L, Field SJ, Gayral S, Jacoby M, Schurmans S, Dallapiccola B, Majerus PW, Valente EM, Gleeson JG. 2009. Mutations in INPP5E, encoding inositol polyphosphate-5-phosphatase E, link phosphatidyl inositol signaling to the ciliopathies. Nat Genet 41:1032–1036. doi:10.1038/ng.423 Blair DR, Lyttle CS, Mortensen JM, Bearden CF, Jensen AB, Khiabanian H, Melamed R, Rabadan R, Bernstam EV, Brunak S, Jensen LJ, Nicolae D, Shah NH, Grossman RL, Cox NJ, White KP, Rzhetsky A. 2013. A Nondegenerate Code of Deleterious Variants in Mendelian Loci Contributes to Complex Disease Risk. Cell 155:70–80. doi:10.1016/j.cell.2013.08.030 Bökenkamp A, Ludwig M. 2016. The oculocerebrorenal syndrome of Lowe: an update. Pediatr Nephrol Berl Ger 31:2201–2212. doi:10.1007/s00467-016-3343-3 Bothwell SP, Farber LW, Hoagland A, Nussbaum RL. 2010. Species-specific difference in expression and splice-site choice in Inpp5b, an inositol polyphosphate 5-phosphatase paralogous to the enzyme deficient in Lowe Syndrome. Mamm Genome 21:458–466. doi:10.1007/s00335-010-9281-7 Boycott KM, Vanstone MR, Bulman DE, MacKenzie AE. 2013. Rare-disease genetics in the era of next-generation sequencing: discovery to translation. Nat Rev Genet 14:681–691. doi:10.1038/nrg3555 Braun DA, Hildebrandt F. 2017. Ciliopathies. Cold Spring Harb Perspect Biol 9. doi:10.1101/cshperspect.a028191 Buchner DA, Charrier A, Srinivasan E, Wang L, Paulsen MT, Ljungman M, Bridges D, Saltiel AR. 2015. Zinc Finger Protein 407 (ZFP407) Regulates Insulin-stimulated Glucose Uptake and Glucose Transporter 4 (Glut4) mRNA. J Biol Chem 290:6376–6386. doi:10.1074/jbc.M114.623736 Campa CC, Franco I, Hirsch E. 2015. PI3K-C2α: One enzyme for two products coupling vesicle trafficking and signal transduction. FEBS Lett 589:1552–1558. doi:10.1016/j.febslet.2015.05.001 Cantley LC. 2002. The Phosphoinositide 3-Kinase Pathway. Science 296:1655–1657. doi:10.1126/science.296.5573.1655 Chen A, Tiosano D, Guran T, Baris HN, Bayram Y, Mory A, Shapiro-Kulnane L, Hodges CA, Akdemir ZC, Turan S, Jhangiani SN, van den Akker F, Hoppel CL, Salz HK, Lupski JR, Buchner DA. 2018. Mutations in the mitochondrial ribosomal protein MRPS22 lead to primary ovarian insufficiency. Hum Mol Genet 27:1913–1926. doi:10.1093/hmg/ddy098 Chong JX, Buckingham KJ, Jhangiani SN, Boehm C, Sobreira N, Smith JD, Harrell TM, McMillin MJ, Wiszniewski W, Gambin T, Coban Akdemir ZH, Doheny K, Scott AF, Avramopoulos D, Chakravarti A, Hoover-Fong J, Mathews D, Witmer PD, Ling H, Hetrick K, Watkins L, Patterson KE, Reinier F, Blue E, Muzny D, Kircher M, Bilguvar K, López-Giráldez F, Sutton VR, Tabor HK, Leal SM, Gunel M, Mane S, Gibbs RA,

21 bioRxiv preprint doi: https://doi.org/10.1101/488411; this version posted December 7, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

Boerwinkle E, Hamosh A, Shendure J, Lupski JR, Lifton RP, Valle D, Nickerson DA, Centers for Mendelian Genomics, Bamshad MJ. 2015. The Genetic Basis of Mendelian Phenotypes: Discoveries, Challenges, and Opportunities. Am J Hum Genet 97:199–215. doi:10.1016/j.ajhg.2015.06.009 Conduit SE, Dyson JM, Mitchell CA. 2012. Inositol polyphosphate 5-phosphatases; new players in the regulation of cilia and ciliopathies. FEBS Lett 586:2846–2857. doi:10.1016/j.febslet.2012.07.037 Devereaux K, Dall’Armi C, Alcazar-Roman A, Ogasawara Y, Zhou X, Wang F, Yamamoto A, De Camilli P, Di Paolo G. 2013. Regulation of mammalian autophagy by class II and III PI 3-kinases through PI3P synthesis. PloS One 8:e76405. doi:10.1371/journal.pone.0076405 Falasca M, Maffucci T. 2012. Regulation and cellular functions of class II phosphoinositide 3- kinases. Biochem J 443:587–601. doi:10.1042/BJ20120008 Franco I, Gulluni F, Campa CC, Costa C, Margaria JP, Ciraolo E, Martini M, Monteyne D, De Luca E, Germena G, Posor Y, Maffucci T, Marengo S, Haucke V, Falasca M, Perez- Morga D, Boletta A, Merlo GR, Hirsch E. 2014. PI3K Class II α Controls Spatially Restricted Endosomal PtdIns3P and Rab11 Activation to Promote Primary Cilium Function. Dev Cell 28:647–658. doi:10.1016/j.devcel.2014.01.022 Goes FS, McGrath J, Avramopoulos D, Wolyniec P, Pirooznia M, Ruczinski I, Nestadt G, Kenny EE, Vacic V, Peters I, Lencz T, Darvasi A, Mulle JG, Warren ST, Pulver AE. 2015. Genome-wide association study of schizophrenia in Ashkenazi Jews. Am J Med Genet Part B Neuropsychiatr Genet Off Publ Int Soc Psychiatr Genet 168:649–659. doi:10.1002/ajmg.b.32349 GTEx Consortium. 2013. The Genotype-Tissue Expression (GTEx) project. Nat Genet 45:580– 585. doi:10.1038/ng.2653 Gulluni F, Martini M, De Santis MC, Campa CC, Ghigo A, Margaria JP, Ciraolo E, Franco I, Ala U, Annaratone L, Disalvatore D, Bertalot G, Viale G, Noatynska A, Compagno M, Sigismund S, Montemurro F, Thelen M, Fan F, Meraldi P, Marchiò C, Pece S, Sapino A, Chiarle R, Di Fiore PP, Hirsch E. 2017. Mitotic Spindle Assembly and Genomic Stability in Breast Cancer Require PI3K-C2α Scaffolding Function. Cancer Cell 32:444-459.e7. doi:10.1016/j.ccell.2017.09.002 Hauer NN, Popp B, Schoeller E, Schuhmann S, Heath KE, Hisado-Oliva A, Klinger P, Kraus C, Trautmann U, Zenker M, Zweier C, Wiesener A, Abou Jamra R, Kunstmann E, Wieczorek D, Uebe S, Ferrazzi F, Büttner C, Ekici AB, Rauch A, Sticht H, Dörr H-G, Reis A, Thiel CT. 2018. Clinical relevance of systematic phenotyping and exome sequencing in patients with short stature. Genet Med 20:630–638. doi:10.1038/gim.2017.159 Jean S, Kiger AA. 2014. Classes of phosphoinositide 3-kinases at a glance. J Cell Sci 127:923– 928. doi:10.1242/jcs.093773 Knaup KX, Guenther R, Stoeckert J, Monti JM, Eckardt K-U, Wiesener MS. 2017. HIF is not essential for suppression of experimental tumor growth by mTOR inhibition. J Cancer 8:1809–1817. doi:10.7150/jca.16486 Koboldt DC, Steinberg KM, Larson DE, Wilson RK, Mardis ER. 2013. The next-generation sequencing revolution and its impact on genomics. Cell 155:27–38. doi:10.1016/j.cell.2013.09.006

22 bioRxiv preprint doi: https://doi.org/10.1101/488411; this version posted December 7, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

Krag C, Malmberg EK, Salcini AE. 2010. PI3KC2α, a class II PI3K, is required for dynamin- independent internalization pathways. J Cell Sci 123:4240–4250. doi:10.1242/jcs.071712 Krumm N, Sudmant PH, Ko A, O’Roak BJ, Malig M, Coe BP, NHLBI Exome Sequencing Project, Quinlan AR, Nickerson DA, Eichler EE. 2012. Copy number variation detection and genotyping from exome sequence data. Genome Res 22:1525–1532. doi:10.1101/gr.138115.112 Kumar P, Henikoff S, Ng PC. 2009. Predicting the effects of coding non-synonymous variants on protein function using the SIFT algorithm. Nat Protoc 4:1073–1081. doi:10.1038/nprot.2009.86 Kurolap A, Orenstein N, Kedar I, Weisz Hubshman M, Tiosano D, Mory A, Levi Z, Marom D, Cohen L, Ekhilevich N, Douglas J, Nowak CB, Tan W-H, Baris HN. 2016. Is one diagnosis the whole story? patients with double diagnoses. Am J Med Genet A 170:2338– 2348. doi:10.1002/ajmg.a.37799 Laflamme N, Leblanc JF, Mailloux J, Faure N, Labrie F, Simard J. 1996. Mutation R96W in cytochrome P450c17 gene causes combined 17 alpha-hydroxylase/17-20-lyase deficiency in two French Canadian patients. J Clin Endocrinol Metab 81:264–268. doi:10.1210/jcem.81.1.8550762 Landrum MJ, Lee JM, Benson M, Brown G, Chao C, Chitipiralla S, Gu B, Hart J, Hoffman D, Hoover J, Jang W, Katz K, Ovetsky M, Riley G, Sethi A, Tully R, Villamarin-Salomon R, Rubinstein W, Maglott DR. 2016. ClinVar: public archive of interpretations of clinically relevant variants. Nucleic Acids Res 44:D862-868. doi:10.1093/nar/gkv1222 Leibiger B, Moede T, Uhles S, Barker CJ, Creveaux M, Domin J, Berggren P-O, Leibiger IB. 2010. Insulin-feedback via PI3K-C2alpha activated PKBalpha/Akt1 is required for glucose-stimulated insulin secretion. FASEB J Off Publ Fed Am Soc Exp Biol 24:1824– 1837. doi:10.1096/fj.09-148072 Lek M, Karczewski KJ, Minikel EV, Samocha KE, Banks E, Fennell T, O’Donnell-Luria AH, Ware JS, Hill AJ, Cummings BB, Tukiainen T, Birnbaum DP, Kosmicki JA, Duncan LE, Estrada K, Zhao F, Zou J, Pierce-Hoffman E, Berghout J, Cooper DN, Deflaux N, DePristo M, Do R, Flannick J, Fromer M, Gauthier L, Goldstein J, Gupta N, Howrigan D, Kiezun A, Kurki MI, Moonshine AL, Natarajan P, Orozco L, Peloso GM, Poplin R, Rivas MA, Ruano-Rubio V, Rose SA, Ruderfer DM, Shakir K, Stenson PD, Stevens C, Thomas BP, Tiao G, Tusie-Luna MT, Weisburd B, Won H-H, Yu D, Altshuler DM, Ardissino D, Boehnke M, Danesh J, Donnelly S, Elosua R, Florez JC, Gabriel SB, Getz G, Glatt SJ, Hultman CM, Kathiresan S, Laakso M, McCarroll S, McCarthy MI, McGovern D, McPherson R, Neale BM, Palotie A, Purcell SM, Saleheen D, Scharf JM, Sklar P, Sullivan PF, Tuomilehto J, Tsuang MT, Watkins HC, Wilson JG, Daly MJ, MacArthur DG. 2016. Analysis of protein-coding genetic variation in 60,706 humans. Nature 536:285–291. doi:10.1038/nature19057 Li H, Durbin R. 2009. Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinforma Oxf Engl 25:1754–1760. doi:10.1093/bioinformatics/btp324 Liu X, Jian X, Boerwinkle E. 2011. dbNSFP: a lightweight database of human nonsynonymous SNPs and their functional predictions. Hum Mutat 32:894–899. doi:10.1002/humu.21517 Lotta LA, Gulati P, Day FR, Payne F, Ongen H, van de Bunt M, Gaulton KJ, Eicher JD, Sharp SJ, Luan J, De Lucia Rolfe E, Stewart ID, Wheeler E, Willems SM, Adams C, Yaghootkar H, Langenberg C, Scott RA, Sharp SJ, Forouhi NG, Kerrison ND, Sims M, Lucarelli DME, Barroso I, Deloukas P, McCarthy MI, Arriola L, Balkau B, Barricarte A,

23 bioRxiv preprint doi: https://doi.org/10.1101/488411; this version posted December 7, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

Boeing H, Franks PW, Gonzalez C, Grioni S, Kaaks R, Key TJ, Navarro C, Nilsson PM, Overvad K, Palli D, Panico S, Quirós JR, Rolandsson O, Sacerdote C, Salamanca- Fernández E, Slimani N, Tjonneland A, Tumino R, Spijkerman AMW, van der A DL, van der Schouw YT, Riboli E, Wareham NJ, Semple RK, Adams C, Stears A, George S, Walker M, Gurnell E, Maguire D, Mukhtar R, Nag S, Adler A, Soeters MR, Laji K, Watt A, Aylwin S, Johnson A, Rayman G, Hanna F, Ellard S, Ross R, Blaslov K, Duvnjak LS, O’Rahilly S, Savage DB, Forouhi NG, Khaw K-T, Johnson AD, Semple RK, Frayling T, Perry JRB, Dermitzakis E, McCarthy MI, Barroso I, Wareham NJ, Savage DB, Langenberg C, O’Rahilly S, Scott RA. 2016. Integrative genomic analysis implicates limited peripheral adipose storage capacity in the pathogenesis of human insulin resistance. Nat Genet 49:17–26. doi:10.1038/ng.3714 Luo N, West CC, Murga-Zamalloa CA, Sun L, Anderson RM, Wells CD, Weinreb RN, Travers JB, Khanna H, Sun Y. 2012. OCRL localizes to the primary cilium: a new role for cilia in Lowe syndrome. Hum Mol Genet 21:3333–3344. doi:10.1093/hmg/dds163 Lupski JR, Belmont JW, Boerwinkle E, Gibbs RA. 2011. Clan genomics and the complex architecture of human disease. Cell 147:32–43. doi:10.1016/j.cell.2011.09.008 Marouli E, Graff M, Medina-Gomez C, Lo KS, Wood AR, Kjaer TR, Fine RS, Lu Y, Schurmann C, Highland HM, Rüeger S, Thorleifsson G, Justice AE, Lamparter D, Stirrups KE, Turcot V, Young KL, Winkler TW, Esko T, Karaderi T, Locke AE, Masca NGD, Ng MCY, Mudgal P, Rivas MA, Vedantam S, Mahajan A, Guo X, Abecasis G, Aben KK, Adair LS, Alam DS, Albrecht E, Allin KH, Allison M, Amouyel P, Appel EV, Arveiler D, Asselbergs FW, Auer PL, Balkau B, Banas B, Bang LE, Benn M, Bergmann S, Bielak LF, Blüher M, Boeing H, Boerwinkle E, Böger CA, Bonnycastle LL, Bork-Jensen J, Bots ML, Bottinger EP, Bowden DW, Brandslund I, Breen G, Brilliant MH, Broer L, Burt AA, Butterworth AS, Carey DJ, Caulfield MJ, Chambers JC, Chasman DI, Chen Y-DI, Chowdhury R, Christensen C, Chu AY, Cocca M, Collins FS, Cook JP, Corley J, Galbany JC, Cox AJ, Cuellar-Partida G, Danesh J, Davies G, de Bakker PIW, de Borst GJ, de Denus S, de Groot MCH, de Mutsert R, Deary IJ, Dedoussis G, Demerath EW, den Hollander AI, Dennis JG, Di Angelantonio E, Drenos F, Du M, Dunning AM, Easton DF, Ebeling T, Edwards TL, Ellinor PT, Elliott P, Evangelou E, Farmaki A-E, Faul JD, Feitosa MF, Feng S, Ferrannini E, Ferrario MM, Ferrieres J, Florez JC, Ford I, Fornage M, Franks PW, Frikke-Schmidt R, Galesloot TE, Gan W, Gandin I, Gasparini P, Giedraitis V, Giri A, Girotto G, Gordon SD, Gordon-Larsen P, Gorski M, Grarup N, Grove ML, Gudnason V, Gustafsson S, Hansen T, Harris KM, Harris TB, Hattersley AT, Hayward C, He L, Heid IM, Heikkilä K, Helgeland Ø, Hernesniemi J, Hewitt AW, Hocking LJ, Hollensted M, Holmen OL, Hovingh GK, Howson JMM, Hoyng CB, Huang PL, Hveem K, Ikram MA, Ingelsson E, Jackson AU, Jansson J-H, Jarvik GP, Jensen GB, Jhun MA, Jia Y, Jiang X, Johansson S, Jørgensen ME, Jørgensen T, Jousilahti P, Jukema JW, Kahali B, Kahn RS, Kähönen M, Kamstrup PR, Kanoni S, Kaprio J, Karaleftheri M, Kardia SLR, Karpe F, Kee F, Keeman R, Kiemeney LA, Kitajima H, Kluivers KB, Kocher T, Komulainen P, Kontto J, Kooner JS, Kooperberg C, Kovacs P, Kriebel J, Kuivaniemi H, Küry S, Kuusisto J, La Bianca M, Laakso M, Lakka TA, Lange EM, Lange LA, Langefeld CD, Langenberg C, Larson EB, Lee I-T, Lehtimäki T, Lewis CE, Li H, Li J, Li-Gao R, Lin H, Lin L-A, Lin X, Lind L, Lindström J, Linneberg A, Liu Yeheng, Liu Yongmei, Lophatananon A, Luan J, Lubitz SA, Lyytikäinen L-P, Mackey DA, Madden PAF, Manning AK, Männistö S, Marenne G, Marten J, Martin NG, Mazul

24 bioRxiv preprint doi: https://doi.org/10.1101/488411; this version posted December 7, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

AL, Meidtner K, Metspalu A, Mitchell P, Mohlke KL, Mook-Kanamori DO, Morgan A, Morris AD, Morris AP, Müller-Nurasyid M, Munroe PB, Nalls MA, Nauck M, Nelson CP, Neville M, Nielsen SF, Nikus K, Njølstad PR, Nordestgaard BG, Ntalla I, O’Connel JR, Oksa H, Loohuis LMO, Ophoff RA, Owen KR, Packard CJ, Padmanabhan S, Palmer CNA, Pasterkamp G, Patel AP, Pattie A, Pedersen O, Peissig PL, Peloso GM, Pennell CE, Perola M, Perry JA, Perry JRB, Person TN, Pirie A, Polasek O, Posthuma D, Raitakari OT, Rasheed A, Rauramaa R, Reilly DF, Reiner AP, Renström F, Ridker PM, Rioux JD, Robertson N, Robino A, Rolandsson O, Rudan I, Ruth KS, Saleheen D, Salomaa V, Samani NJ, Sandow K, Sapkota Y, Sattar N, Schmidt MK, Schreiner PJ, Schulze MB, Scott RA, Segura-Lepe MP, Shah S, Sim X, Sivapalaratnam S, Small KS, Smith AV, Smith JA, Southam L, Spector TD, Speliotes EK, Starr JM, Steinthorsdottir V, Stringham HM, Stumvoll M, Surendran P, ‘t Hart LM, Tansey KE, Tardif J-C, Taylor KD, Teumer A, Thompson DJ, Thorsteinsdottir U, Thuesen BH, Tönjes A, Tromp G, Trompet S, Tsafantakis E, Tuomilehto J, Tybjaerg-Hansen A, Tyrer JP, Uher R, Uitterlinden AG, Ulivi S, van der Laan SW, Van Der Leij AR, van Duijn CM, van Schoor NM, van Setten J, Varbo A, Varga TV, Varma R, Edwards DRV, Vermeulen SH, Vestergaard H, Vitart V, Vogt TF, Vozzi D, Walker M, Wang F, Wang CA, Wang S, Wang Y, Wareham NJ, Warren HR, Wessel J, Willems SM, Wilson JG, Witte DR, Woods MO, Wu Y, Yaghootkar H, Yao J, Yao P, Yerges-Armstrong LM, Young R, Zeggini E, Zhan X, Zhang W, Zhao JH, Zhao W, Zhao W, Zheng H, Zhou W, Rotter JI, Boehnke M, Kathiresan S, McCarthy MI, Willer CJ, Stefansson K, Borecki IB, Liu DJ, North KE, Heard-Costa NL, Pers TH, Lindgren CM, Oxvig C, Kutalik Z, Rivadeneira F, Loos RJF, Frayling TM, Hirschhorn JN, Deloukas P, Lettre G. 2017. Rare and low- frequency coding variants alter human adult height. Nature 542:186–190. doi:10.1038/nature21039 Martin RM, Lin CJ, Costa EMF, de Oliveira ML, Carrilho A, Villar H, Longui CA, Mendonca BB. 2003. P450c17 deficiency in Brazilian patients: biochemical diagnosis through progesterone levels confirmed by CYP17 genotyping. J Clin Endocrinol Metab 88:5739– 5746. doi:10.1210/jc.2003-030988 McKenna A, Hanna M, Banks E, Sivachenko A, Cibulskis K, Kernytsky A, Garimella K, Altshuler D, Gabriel S, Daly M, DePristo MA. 2010. The Genome Analysis Toolkit: A MapReduce framework for analyzing next-generation DNA sequencing data. Genome Res 20:1297–1303. doi:10.1101/gr.107524.110 Mehta ZB, Pietka G, Lowe M. 2014. The cellular and physiological functions of the Lowe syndrome protein OCRL1. Traffic Cph Den 15:471–487. doi:10.1111/tra.12160 Neveling K, Feenstra I, Gilissen C, Hoefsloot LH, Kamsteeg E-J, Mensenkamp AR, Rodenburg RJT, Yntema HG, Spruijt L, Vermeer S, Rinne T, van Gassen KL, Bodmer D, Lugtenberg D, de Reuver R, Buijsman W, Derks RC, Wieskamp N, van den Heuvel B, Ligtenberg MJL, Kremer H, Koolen DA, van de Warrenburg BPC, Cremers FPM, Marcelis CLM, Smeitink JAM, Wortmann SB, van Zelst-Stams WAG, Veltman JA, Brunner HG, Scheffer H, Nelen MR. 2013. A post-hoc comparison of the utility of sanger sequencing and exome sequencing for the diagnosis of heterogeneous diseases. Hum Mutat 34:1721–1726. doi:10.1002/humu.22450 Osborn DPS, Pond HL, Mazaheri N, Dejardin J, Munn CJ, Mushref K, Cauley ES, Moroni I, Pasanisi MB, Sellars EA, Hill RS, Partlow JN, Willaert RK, Bharj J, Malamiri RA, Galehdari H, Shariati G, Maroofian R, Mora M, Swan LE, Voit T, Conti FJ, Jamshidi Y,

25 bioRxiv preprint doi: https://doi.org/10.1101/488411; this version posted December 7, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

Manzini MC. 2017. Mutations in INPP5K Cause a Form of Congenital Muscular Dystrophy Overlapping Marinesco-Sjögren Syndrome and Dystroglycanopathy. Am J Hum Genet 100:537–545. doi:10.1016/j.ajhg.2017.01.019 Pfundt R, Del Rosario M, Vissers LELM, Kwint MP, Janssen IM, de Leeuw N, Yntema HG, Nelen MR, Lugtenberg D, Kamsteeg E-J, Wieskamp N, Stegmann APA, Stevens SJC, Rodenburg RJT, Simons A, Mensenkamp AR, Rinne T, Gilissen C, Scheffer H, Veltman JA, Hehir-Kwa JY. 2017. Detection of clinically relevant copy-number variants by exome sequencing in a large cohort of genetic disorders. Genet Med Off J Am Coll Med Genet 19:667–675. doi:10.1038/gim.2016.163 Posor Y, Eichhorn-Gruenig M, Puchkov D, Schöneberg J, Ullrich A, Lampe A, Müller R, Zarbakhsh S, Gulluni F, Hirsch E, Krauss M, Schultz C, Schmoranzer J, Noé F, Haucke V. 2013. Spatiotemporal control of endocytosis by phosphatidylinositol-3,4- bisphosphate. Nature 499:233–237. doi:10.1038/nature12360 Prosseda PP, Luo N, Wang B, Alvarado JA, Hu Y, Sun Y. 2017. Loss of OCRL increases ciliary PI(4,5)P2 in Lowe oculocerebrorenal syndrome. J Cell Sci 130:3447–3454. doi:10.1242/jcs.200857 Pruitt KD, Tatusova T, Maglott DR. 2007. NCBI reference sequences (RefSeq): a curated non- redundant sequence database of genomes, transcripts and proteins. Nucleic Acids Res 35:D61-65. doi:10.1093/nar/gkl842 Reiter JF, Leroux MR. 2017. Genes and molecular pathways underpinning ciliopathies. Nat Rev Mol Cell Biol 18:533–547. doi:10.1038/nrm.2017.60 Ruderfer DM, Fanous AH, Ripke S, McQuillin A, Amdur RL, Schizophrenia Working Group of Psychiatric Genomics Consortium, Bipolar Disorder Working Group of Psychiatric Genomics Consortium, Cross-Disorder Working Group of Psychiatric Genomics Consortium, Gejman PV, O’Donovan MC, Andreassen OA, Djurovic S, Hultman CM, Kelsoe JR, Jamain S, Landén M, Leboyer M, Nimgaonkar V, Nurnberger J, Smoller JW, Craddock N, Corvin A, Sullivan PF, Holmans P, Sklar P, Kendler KS. 2014. Polygenic dissection of diagnosis and clinical dimensions of bipolar disorder and schizophrenia. Mol Psychiatry 19:1017–1024. doi:10.1038/mp.2013.138 Schizophrenia Psychiatric Genome-Wide Association Study (GWAS) Consortium. 2011. Genome-wide association study identifies five new schizophrenia loci. Nat Genet 43:969–976. doi:10.1038/ng.940 Scott EM, Halees A, Itan Y, Spencer EG, He Y, Azab MA, Gabriel SB, Belkadi A, Boisson B, Abel L, Clark AG, Rahim SA, Abdel-Hadi S, Abdel-Salam G, Abdel-Salam E, Abdou M, Abhytankar A, Adimi P, Ahmad J, Akcakus M, Aksu G, Hajjar SA, Juamaah SA, Muhsen SA, Sannaa NA, Tameni SA, Al-Aama J, Al-Allawi N, Al-Baradie R, Al-Gazali L, Al-Hashem A, Al-Herz W, Al-Jeaid D, Al-Tawari A, Alangari A, Alcais A, S AlFawaz T, Alsum Z, Ammar-Khodja A, Amouian S, Arikan C, Aryani O, Aslanger A, Aydogmus C, Aytekin C, Azam M, Bansagi B, Barbouche M-R, Bastaki L, Ben-Omran T, Bindu PS, Blancas L, Boisson-Dupuis S, Bonnet D, Stambouli OB, Bousfiha A, Boussafara L, Boutros J, Bustamante J, Caksen H, Camcioglu Y, Catherinot E, Celik FC, Ciancanelli M, Cipe FE, Clark G, Cobat A, Comu S, Condie A, Condino-Neto A, Desai M, Dobyns W, Dogu F, Domaia M, Dorum M, Egritas O, Azbaoui SE, Baghdadi JE, Ruby ME, El-Harouni A, Elfeky RA, Elghazali G, Faqeih E, Fenerci E, Fieschi C, Funda C, Gamal I, Gelik U, Genel F, Gezdirici A, M Girisha K, Goldstein A, Grattan-Smith P, Gupta N, Hahn J, Hatipoglu N, Hennekam R, Houshmand M, Ichai P, Ikinciogullari A,

26 bioRxiv preprint doi: https://doi.org/10.1101/488411; this version posted December 7, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

Ismail S, Jalas C, Jouanguy E, Kabra M, Kalkan G, Kara M, Karaca N, Karaer K, Kariminejad A, Kayserili H, Keser-Emiroglu M, Kilic SS, Kissani N, Kokron C, Koul R, Kutukculer N, Lanternier F, Mahdaviani A, Mahlaoui N, Mansour L, Mansouri D, Margari L, Valente EM, Marzouki N, Masri A, Megahed A, Megahed H, Mekki N, Mesdaghi M, Mikati M, Mojahedi F, Mulley J, Nampoothiri S, Navarrete C, Omar T, Oraby A, Pandaluz A, Parvaneh N, Patiroglu T, Koc ZP, Pellier I, Picard C, Puel A, Raas-Rothschild A, Rajab A, Raoult D, Reisli I, Rezaei N, Sabri A, Sahin Y, Saleem L, Salem F, AlSediq NS, Sanal O, Sanger T, Shakankiry H, Shang L, Shehata N, Shembesh N, Shkalim V, Softah A, Sogaty S, Soliman N, Sonmez-Aunaci F, Sztriha L, Taibi- Berrah L, Temtamy S, Tonekaboni H, Trauner D, Tuysuz B, Tuysuz B, Varan A, Vogt G, Walsh C, Woods G, Yesil G, Yildiran A, Yildiz B, Yuksel A, Zaki M, Zhang S-Y, Alkuraya FS, Casanova J-L, Gleeson JG. 2016. Characterization of Greater Middle Eastern genetic variation for enhanced disease gene discovery. Nat Genet 48:1071–1076. doi:10.1038/ng.3592 Semple RK, Savage DB, Cochran EK, Gorden P, O’Rahilly S. 2011. Genetic syndromes of severe insulin resistance. Endocr Rev 32:498–514. doi:10.1210/er.2010-0020 Sobreira N, Schiettecatte F, Valle D, Hamosh A. 2015. GeneMatcher: a matching tool for connecting investigators with an interest in the same gene. Hum Mutat 36:928–930. doi:10.1002/humu.22844 Staiano L, De Leo MG, Persico M, De Matteis MA. 2015. Mendelian disorders of PI metabolizing enzymes. Biochim Biophys Acta BBA - Mol Cell Biol Lipids 1851:867–881. doi:10.1016/j.bbalip.2014.12.001 Travaglini L, Brancati F, Silhavy J, Iannicelli M, Nickerson E, Elkhartoufi N, Scott E, Spencer E, Gabriel S, Thomas S, Ben-Zeev B, Bertini E, Boltshauser E, Chaouch M, Cilio MR, de Jong MM, Kayserili H, Ogur G, Poretti A, Signorini S, Uziel G, Zaki MS, International JSRD Study Group, Johnson C, Attié-Bitach T, Gleeson JG, Valente EM. 2013. Phenotypic spectrum and prevalence of INPP5E mutations in Joubert syndrome and related disorders. Eur J Hum Genet EJHG 21:1074–1078. doi:10.1038/ejhg.2012.305 Vanhaesebroeck B, Whitehead MA, Piñeiro R. 2016. Molecules in medicine mini-review: isoforms of PI3K in biology and disease. J Mol Med 94:5–11. doi:10.1007/s00109-015- 1352-5 Wang K, Li M, Hadley D, Liu R, Glessner J, Grant SFA, Hakonarson H, Bucan M. 2007. PennCNV: an integrated hidden Markov model designed for high-resolution copy number variation detection in whole-genome SNP genotyping data. Genome Res 17:1665–1674. doi:10.1101/gr.6861907 Wang K, Li M, Hakonarson H. 2010. ANNOVAR: functional annotation of genetic variants from high-throughput sequencing data. Nucleic Acids Res 38:e164. doi:10.1093/nar/gkq603 Wiessner M, Roos A, Munn CJ, Viswanathan R, Whyte T, Cox D, Schoser B, Sewry C, Roper H, Phadke R, Marini Bettolo C, Barresi R, Charlton R, Bönnemann CG, Abath Neto O, Reed UC, Zanoteli E, Araújo Martins Moreno C, Ertl-Wagner B, Stucka R, De Goede C, Borges da Silva T, Hathazi D, Dell’Aica M, Zahedi RP, Thiele S, Müller J, Kingston H, Müller S, Curtis E, Walter MC, Strom TM, Straub V, Bushby K, Muntoni F, Swan LE, Lochmüller H, Senderek J. 2017. Mutations in INPP5K , Encoding a Phosphoinositide 5- Phosphatase, Cause Congenital Muscular Dystrophy with Cataracts and Mild Cognitive Impairment. Am J Hum Genet 100:523–536. doi:10.1016/j.ajhg.2017.01.024

27 bioRxiv preprint doi: https://doi.org/10.1101/488411; this version posted December 7, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

Yoshioka K, Yoshida K, Cui H, Wakayama T, Takuwa N, Okamoto Y, Du W, Qi X, Asanuma K, Sugihara K, Aki S, Miyazawa H, Biswas K, Nagakura C, Ueno M, Iseki S, Schwartz RJ, Okamoto H, Sasaki T, Matsui O, Asano M, Adams RH, Takakura N, Takuwa Y. 2012. Endothelial PI3K-C2α, a class II PI3K, has an essential role in angiogenesis and vascular barrier function. Nat Med 18:1560–1569. doi:10.1038/nm.2928

28 bioRxiv preprint doi: https://doi.org/10.1101/488411; this version posted December 7, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

Figure Titles and Legends.

Figure 1. Pedigrees and pictures of the individuals studied. (A) Pedigree of three consanguineous families studied. Black boxes indicated affected individuals. Roman numerals indicating the generation are on the left and Arabic numerals indicating the individual are below each pedigree symbol. (B) Photographs of affected individuals under their corresponding pedigree symbol indicating coarse facial features including a broad nasal bridge, thick columella, and thick alae nasi. Of note, the left eye of patient II-II-2 shows phthisis bulbi of unknown etiology, as evidenced by an atrophic non-functional eye. Representative images are shown of (C) an X-ray indicating square shaped vertebral bodies and a flat pelvis, subluxation of the hips, and meta- and epiphyseal dysplasia of the femoral heads in patient III-II-2. (D) the teeth in patient II-II-3 indicating broad maxilla incisors, narrow mandible teeth, and dental enamel defects (E) the eye with a visible cataract (Cataracta polaris anterior), as indicated by a white arrow, in individual III- II-2, and (F) a brain MRI demonstrating areas of altered signal intensity as indicated by the white arrow in individual I-II-2.

Figure 2. Homozygous loss-of-function mutations in PIK3C2A. (A) Diagram of the intron/exon and protein domain structures of PIK3C2A indicating the location of mutations identified in three independent consanguineous families with homozygous loss-of-function mutations in PIK3C2A. (B) CNV analysis confirmed a homozygous deletion encompassing exons 1-24 out of 32 total exons of PIK3C2A, indicated with the red line (C) Sanger sequencing confirmed homozygosity for the PIK3C2A c.585T variant in Family I. (D) Sanger sequencing confirmed homozygosity for the PIK3C2A c.1640+1 G>T variant in Family III.

Figure 3. Protein and mRNA levels of PIK3C2A in patient-derived cells. PIK3C2A mRNA levels were detected by qRT-PCR in patient derived fibroblasts from (A) Family I, (B) Family II, and (C) Family III. (D, E) Whole cell lysates from fibroblasts of healthy controls (WT), heterozygous parents, and affected individuals from (D) Family III and (E) Families I and II were analyzed by Western blotting for PIK3C2A and the loading controls Actin or GAPDH. Immunogen of anti-PIK3C2A antibodies (AB1-AB4) are detailed in Table S4. * indicates p < 0.05. ** indicates p < 0.01. *** indicates p < 0.0001. qRT-PCR data is represented as mean ± SEM (n=3-4 technical replicates per sample).

Figure 4. Impaired PI metabolism in patient-derived fibroblasts. Quantification of PI(3,4)P2 and PI(3)P were analysed and normalized on whole cell fluorescence. (A) Immunofluorescence analysis of cellular PI(3,4)P2 levels. Results showed that PI(3,4)P2 is significantly reduced throughout the cell in -/- cells compared with +/+ cells. (B) Immunofluorescence analysis of PI(3)P

29 bioRxiv preprint doi: https://doi.org/10.1101/488411; this version posted December 7, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

localization at the base of the primary cilium. Results showed that PI(3)P is significantly reduced at the base of the primary cilium in -/- cells compared with +/+ and or +/- cells. Nuclei are stained with DAPI. ** indicates p < 0.01. *** indicates p < 0.0001.

Figure 5. Ciliary defects due to PIK3C2A deficiency in patient-derived fibroblasts. (A) Cilia length and (B) cilia number were determined in primary fibroblasts from two affected individuals and three unrelated controls. Data is represented as mean ± SEM (n>300/sample). (C) Immunofluorescence analysis of RAB11 localization at the base of the primary cilium. Results showed that RAB11 is significantly reduced at the base of the primary cilium in -/- cells compared with +/+ and or +/- cells. (D) Immunofluorescence analysis of IFT88 localization within the primary cilia. Results showed that IFT88 is significantly increased along the primary cilium in -/- cells compared with +/+ and or +/- cells, suggesting a defective trafficking of ciliary components. Quantification of IFT88 and RAB11 were normalized on whole cell fluorescence. *** indicates p < 0.0001.

Figure 6. PIK3C2A deficiency causes delayed proliferation rates in patient-derived fibroblasts. Proliferation curve of primary fibroblasts isolated from PIK3C2A WT (+/+), heterozygous (+/-), and homozygous (-/-) individuals. Values are reported as the mean ± SEM. * indicates p < 0.05, *** indicates p < 0.0001.

Figure 7. PIK3C2B levels are increased by PIK3C2A deficiency. PIK3C2B mRNA levels were detected by qRT-PCR in (A) Family I, (B) Family II, and (C) Family III. qRT-PCR data is represented as mean ± SEM (n=3). (D) PIK3C2B protein levels were detected by Western blotting in Family I. (E) PIK3C2A and PIK3C2B protein levels were analyzed in HeLa cells by Western blotting following doxycycline inducible shRNA mediated knockdown of PIK3C2A. * indicates p < 0.05, ** indicates p < 0.01. *** indicates p < 0.0001.

30 bioRxiv preprint doi: https://doi.org/10.1101/488411; this version posted December 7, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

Tables.

Table 1. Phenotypic characteristics of PIK3C2A deficient patients.

Family I I II II III

Patient II-1 II-2 II-2 II-3 II-2

Age (years) 13 8 12 10 20

Gender female female male male female Israel Israel Origin (Muslim- (Muslim- Syria Syria Tunisia Arabic) Arabic) Consanguineous + + + + +

Height -3.3 SD -2.3 SD -2.5 SD -4.8 SD -2.5 SD

Weight -0.2 SD -1.7 SD -0.2 SD -3.9 SD -1.9 SD Head -0.25 SD N.D. +0.9 SD -1.1 SD +0.5 SD circumference Congenital + + + + + cataract Secondary + + + + - glaucoma Hearing loss + - - + + Scoliosis/Skeletal + + + + + abnormalities Teeth + + + + + Abnormalities Developmental + + N.D. N.D. N.D. delay Elevated urine + N.D. + + N.D. MPS levels "+" indicates presence of trait, "-" indicates absence of trait, N.D., not done.

31 bioRxiv preprint doi: https://doi.org/10.1101/488411; this version posted December 7, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

Table 2. Homozygous candidate variants identified by WES.

SIFT Polyphen2 Polyphen2 Gene SNP ID MAF Type Effect Transcript cDNA Protein SIFT Score HVAR Score Family I ATF4 rs144769713 8.1e-6 SNV Missense NM_001675 c.512C>T p.(Ser171Phe) Damaging 0 Benign 0.188 CYP17A1 rs104894138 3.6e-5 SNV Missense NM_000102 c.286C>T p.(Arg96Trp) Damaging 0 Prob Dam 1 DNAH14 . . SNV Missense NM_001373 c.5135T>A p.(Leu1712His) Damaging 0 Prob Dam 0.998 PIK3C2A . . SNV Nonsense NM_002645 c.585T>G p.Tyr195* . . . . PLEKHA7 . . SNV Missense NM_175058 c.2899C>T p.(Arg967Trp) Damaging 0 Prob Dam 1 Family II KIAA1549L rs761694178 4.1e-6 SNV Missense NM_012194 c.2132C>A p.(Pro717Leu) Damaging 0.02 Poss Dam 0.837 METAP1 . . SNV Missense NM_015143 c.408A>G p.(Ile136Met) Damaging 0 Prob Dam 0.985 PEX2 rs35689779 7.4e-4 SNV Missense NM_000318 c.209A>G p.(Tyr70Cys) Damaging 0.04 Prob Dam 0.989 c.(0+1_1-1)_ PIK3C2A . . DEL Deletion NM_002645 (4007+1_400 p.0 . . . . 8-1)del Family III PTH2R . 4.1e-6 SNV Missense NM_005048 c.773G>A p.(Gly258Asp) Damaging 0 Prob Dam 1 NM_001012 DPRX rs201435914 3.4e-4 SNV Nonsense c.466C>T p.(Arg156*) . . . . 728 Splice p.Asn483_Arg5 PIK3C2A . . SNV NM_002645 c.1640+1G>T . . . . site 47delinsLys ZSCAN18 . . SNV Missense NM_023926 c.965C>T p.(Thr322Ile) Damaging 0.02 Benign 0.083

32 bioRxiv preprint doi: https://doi.org/10.1101/488411; this version posted December 7, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

SNV, single nucleotide variant. DEL, deletion. Prob Dam, probably damaging. Poss Dam, possibly damaging. MAF, minor allele

frequency (from gnomAD v2.0.2)

33 bioRxiv preprint doi: https://doi.org/10.1101/488411; this version posted December 7, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

Supplemental Tables

Table S2. Hematological evaluation of patients in Family I.

I-II-1 I-II-2 FVIII normal normal APCR FV Leiden normal Factor V Leiden mutation Heterozygote normal Prothrombin G20210A normal Heterozygote MTHFR C677T Heterozygote normal Platelet aggregation with ADP and normal normal collagen Platelet aggregation with low ADP normal low mild and collagen

Platelet aggregation in low ristocetin B or Platelet 2 to test for VWD type normal normal type VWD

TEG normal normal

34 bioRxiv preprint doi: https://doi.org/10.1101/488411; this version posted December 7, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

Table S3. List of primers used in this study.

Primer Forward Reverse Source PIK3C2A Exon3 GACATTGAAGGA Splicing-effect TTTCAGCTACC PIK3C2A Exon10 GCACAGTCTGTAGG Splicing-effect ACTCCTACC PIK3C2A Exon4 TTGCTGGGTACAT Splicing-effect GATGACTTG PIK3C2A Exon8 TTGGAAGATTAACT Splicing-effect GCTCTCTTTAGC PIK3C2A Exon 1-2 CTCAGCTTGCAAA CTGGGTTTGTGCGG Gene expression AGCCCAG TGATTG PIK3C2A Exon 24 GTGCTGACCTCTG CAAGTTGTAGGCCT Gene expression ATATGGC GACAGC PIK3C2B TGTTTGGCAACAT AATCATGGAAGCG Gene expression CAAGCGG GCTGGAA PIK3C2G AAACATTCATCTC GTGGGACACTACAG Gene expression CCAGATGGC AGTCGG GAPDH AATCCCATCACCA TGGACTCCACGACG Gene expression TCTTCCA TACTCA PIK3C2A ACAGTGGCCACC TCAGTCCTTGCTTT Sequencing, TGGATTAC CCCATT Family I PIK3C2A TTATTGTGGCTGA GACAATAGAAAGA Sequencing, AGGATGC CCAAAGAGTGG Family III

35 bioRxiv preprint doi: https://doi.org/10.1101/488411; this version posted December 7, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

Table S4. List of antibodies used in this study.

Antigen Host Catalog # Source Dilution IF Dilution IB PIK3C2A rabbit --- Gift from Prof. 1:200 1:1,000 (AB1) Haucke (Berlin), epitope: a.a. 2-365 PIK3C2A mouse Sc-365290 Santa Cruz, 1:50 1:1,000 (AB2) epitope: a.a. 61-360 PIK3C2A rabbit 12402 Cell Signaling, - 1:1,000 (AB3) epitope: ~ a.a. 717 PIK3C2A Rabbit 22028-1-AP ProteinTech, 1:1,000 (AB4) epitope: a.a. 1-338 PIK3C2B mouse 611342 BD Biosciences 1:1,000 Acetylated α- mouse T7451 Sigma 1:300 -- Tubulin (Lys40) Acetylated α- rabbit 5335 Cell Signaling 1:200 -- Tubulin (Lys40) IFT88 rabbit 13967-1-AP ProteinTech 1:50 -- PI(3,4)P2 mouse Z-P034b Echelon 1:150 -- PI(3)P mouse Z-P003 Echelon 1:100 -- RAB11A rabbit Ab65200 Abcam 1:100 -- Centrin mouse 04-1624 Millipore 1:500 -- ARL13B rabbit 17711-1-AP Proteintech 1:500 -- GAPDH mouse MA5-15738 Thermo Fisher -- 1:10,000

IF, immunofluorescence; IB, immunoblot; a.a., amino acid

36 bioRxiv preprint doi: https://doi.org/10.1101/488411; this version posted December 7, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Figure 1

A Family I Family II Family III

I 1 2 1 2 1 2

II 1 2 1 2 3 4 5 1 2 B I-II-1 I-II-2 II-II-2 II-II-3 III-II-2

Not Not Not Not Not shown shown shown shown shown in in in in in BioRxiv BioRxiv BioRxiv BioRxiv BioRxiv

Not Not Not Not Not shown shown shown shown shown in in in in in BioRxiv BioRxiv BioRxiv BioRxiv BioRxiv

C D E F bioRxiv preprint doi: https://doi.org/10.1101/488411; this version posted December 7, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BYFigure 4.0 International 2 license.

A

B Deletion ABCC8 PLEKHA7 PRS13 PIK3C2A NUCB2 NCR3LG1 OR7E14P LOC105376575KCNJ11 8 7 6 5 4 3 2 1 II-II-3 0 -1 -2 -3 -4 -5 -6 -7 Mb -8 16.9 17.0 17.1 17.2 17.3 17.4 Chromosome 11

C c.585T>G p.Tyr195Ter

T CC A T A T TT C T C A T A Reference Pro Tyr Phe Ser

T CC A T A G TT C T C A T A

I-II-1

D c.1640+1G>T p.K390_Q482del

A C G A G g ta t a Reference Thr Arg A C G A G t ta t a

III-II-2 bioRxiv preprint doi: https://doi.org/10.1101/488411; this version posted December 7, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BYFigure 4.0 International 3 license.

A 1.2 B 1.2 C 1.2

1.0 1.0 1.0

0.8 ** ** 0.8 0.8 * 0.6 *** *** 0.6 0.6 0.4 0.4 0.4 *** PIK3C2A mRNA PIK3C2A PIK3C2A mRNA PIK3C2A PIK3C2A mRNA PIK3C2A 0.2 0.2 0.2 *** *** 0.0 0.0 0.0 WT I-I-I I-I-2 I-II-1 I-II-2 WT II-II-2 II-II-3 WT III-I-2 III-II-2 PIK3C2A +/+ +/- +/- -/- -/- PIK3C2A +/+ -/- -/- PIK3C2A +/+ +/- -/-

D E WT III-I-2 III-II-2 WT I-I-2 I-I-1 I-II-1 I-II-2 II-II-2 II-II-3 PIK3C2A +/+ +/- -/- PIK3C2A +/+ +/- +/- -/- -/- -/- -/-

PIK3C2A (AB1) PIK3C2A (AB3)

Actin

PIK3C2A GAPDH (AB2)

Actin PIK3C2A (AB4) PIK3C2A (AB3)

Actin GAPDH bioRxiv preprint doi: https://doi.org/10.1101/488411; this version posted December 7, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Figure 4

A PI(3,4)P2 Acetyl-tub DAPI B PI3P Acetyl-tub DAPI +/+ +/+ +/+

+/-

-/- -/-

-/-

1.25 1.25 1.0 1.0 ** *** 0.75 0.75 0.5 0.5

intensity (AU) intensity 0.25 0.25 PI3P fluorescence fluorescence PI3P

PI(3,4)P2 fluorescence fluorescence PI(3,4)P2 0 0

+/+ -/- (AU) base ciliary at intensity +/+ +/- -/- bioRxiv preprint doi: https://doi.org/10.1101/488411; this version posted December 7, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available underFigure aCC-BY 4.0 International 5 license.

A 6 B 100 *** *** 80

4 60

40

Cilia length (um) 2

20 Percentage of ciliated cells

0 0 PIK3C2A +/+ -/- -/- PIK3C2A +/+ -/- -/-

C Rab11 Acetyl-tub DAPI D IFT88 Acetyl-tub DAPI +/+ +/+

+/- +/-

-/- -/-

1.25 2.0 *** 1.0 1.5 0.75 *** 1.0 0.5

11 fluorescence fluorescence 11 0.25 0.5

ciliary length(AU) ciliary

IFT88 fluorescence fluorescence IFT88 Rab

0 on normalized intensity 0

intensity at ciliary base (AU) base ciliary at intensity +/+ +/- -/- +/+ +/- -/- bioRxiv preprint doi: https://doi.org/10.1101/488411; this version posted December 7, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

Figure 6

2.5 +/+ +/- -/- 2 * *** *** 1.5 * *

1 Proliferation (fold change)

0

2 4 6 8 Time (days) bioRxiv preprint doi: https://doi.org/10.1101/488411; this version posted December 7, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Figure 7

A B 6 *** *** C

5 5 10 ** ** * 4 4 8

3 3 6

2 2 4 PIK3C2B mRNA PIK3C2B mRNA PIK3C2B mRNA 1 1 2

0 0 0 WT I-I-I I-I-2 I-II-1 I-II-2 WT II-II-2 II-II-3 III-II-1 III-II-2 PIK3C2A +/+ +/- +/- -/- -/- PIK3C2A +/+ -/- -/- PIK3C2A +/- -/-

D E Ctrl Doxycycline

PIK3C2A +/+ -/-+/+ -/- PIK3C2A (AB4) PIK3C2B PIK3C2B GAPDH

GAPDH bioRxiv preprint doi: https://doi.org/10.1101/488411; this version posted December 7, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. A I-II-1 I-II-2 II-II-2 II-II-3 III-II-2

B

C

D

E

Figure S1. Images of individuals with PIK3C2A deficiency. Photographic images of (A) teeth, (B) hands, and (C) feet are shown from the five individuals with PIK3C2A deficiency. (D) X-Ray images of the pelvis and (E) MRI images of the brain are shown when available. White arrows in the MRI images indicate regions of altered signal intensity. bioRxiv preprint doi: https://doi.org/10.1101/488411; this version posted December 7, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available A under aCC-BY 4.0 International license.

B

Exon4 Exon5 Exon6 Exon7

WT…CTGCAGAAgta…cagTAATCAT….GCCCGAACAgtaa….tttagGCAGAA…GCCATGACGAGgtatat….tttcagACACCCTGTTGAA…

III-II-2 …CTGCAGAAgta…cagTAATCAT….GCCCGAACAgtaa….tttagGCAGAA…GCCATGACGAGttatat….tttcagACACCCTGTTGAA… NQL N HN ART AE AMT R R HPV V

12 3 5 7864 9 10 11 13 15 17 19 21 222018161412

Exon 4 Exon 5 Exon6 Exon 7 WT

GAAGTGCTGC AGAAAATTT C A GCCTT T …….. CTGG CCC GAACCA AGG AA ATGG ATG .……… GAAGCCATGACGAGACACCCTGT TGAA

III-II-2 Exon 4 Exon 7

TATGTTCT AAAA GTTTGTGGTCAAGAGGAA TTGG C CAGG AA ACA CCCT GGT T AAGAACTC TT AGATTC TT ATCACAACCAAGT

Figure S2. The c.1650+1G>T mutation in PIK3C2A disrupts the splice donor site in intron 6. (A) Deep sequencing of RT-PCR products revealed 4 alternative transcripts in lymphocytes (red lines) compared to control samples (blue lines): *: r.1561_1704del; p.Ala521_Glu568del, **: r. 1640_1641ins1640+1_1640+27; p. Arg547SerinsTyrIleIle* , ***: r.1561_1640del; p.Ala521Thrfs*4, ****: r.1449_1640del; p.Asn483_Arg547delinsLys. Exon/intron structure of PIK3C2A (exons: yellow boxes) with transcripts of the patient of family III compared to controls. (B) Example of sequenced RT-PCR products from cDNA of fibroblasts from wild-type control and the patient of family III using primers located in exons 3 and 10. Skipping of exons 5 and 6 is the result of the mutation. Positions of primers are indicated by orange arrows and position of the splice site mutation is indicated by a black arrow. bioRxiv preprint doi: https://doi.org/10.1101/488411; this version posted December 7, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

A B C *** 1.25 1.25 1.5

1.0 1.0 *** 1.25 *** 0.75 0.75 1.0

0.5 0.5 0.5+/-

0.25 0.25 0.25

ciliary length(AU) ciliary

PI3P fluorescence fluorescence PI3P IFT88 fluorescence fluorescence IFT88 0 fluorescence Rab11

0 on normalized intensity 0 intensity at ciliary base (AU) base ciliary at intensity +/+ -/- (AU) base ciliary at intensity +/+ -/- +/+ -/- Family I Family I Family I

1.25 1.25 2.0 ***

1.0 1.0 1.5 0.75 0.75 *** *** 1.0

0.5 0.5 fluorescence

0.25 0.25 0.5

ciliary length(AU) ciliary

PI3P fluorescence fluorescence PI3P IFT88 IFT88 Rab11 fluorescence fluorescence Rab11 0

0 on normalized intensity 0 intensity at ciliary base (AU) base ciliary at intensity intensity at ciliary base (AU) base ciliary at intensity +/+ +/- -/- +/+ +/- -/- +/+ +/- -/- Family II Family II Family II

1.25 1.25 2.0

1.0 1.0 1.5 0.75 0.75 1.0 0.5 0.5

0.25 fluorescence 11 0.25 0.5

ciliary length(AU) ciliary

PI3P fluorescence fluorescence PI3P IFT88 fluorescence fluorescence IFT88

0 Rab 0

intensity normalized on on normalized intensity 0 intensity at ciliary base (AU) base ciliary at intensity +/+ +/- -/- (AU) base ciliary at intensity +/+ +/- -/- +/+ +/- -/- Family III Family III Family III

Figure S3. Quantification of fluorescence in patient-derived fibroblasts. Quantification of fluorescence intensity for (A) PI(3)P at the ciliary base, (B) Rab11 at the ciliary base, and (C) ciliary IFT88. Data is shown seperately for each individual family as indicated.