(PX) Domains Based on Their Phosphoinositide Binding Specificities
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Screening and Identification of Key Biomarkers in Clear Cell Renal Cell Carcinoma Based on Bioinformatics Analysis
bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423889; this version posted December 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Screening and identification of key biomarkers in clear cell renal cell carcinoma based on bioinformatics analysis Basavaraj Vastrad1, Chanabasayya Vastrad*2 , Iranna Kotturshetti 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. 3. Department of Ayurveda, Rajiv Gandhi Education Society`s Ayurvedic Medical College, Ron, Karnataka 562209, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423889; this version posted December 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract Clear cell renal cell carcinoma (ccRCC) is one of the most common types of malignancy of the urinary system. The pathogenesis and effective diagnosis of ccRCC have become popular topics for research in the previous decade. In the current study, an integrated bioinformatics analysis was performed to identify core genes associated in ccRCC. An expression dataset (GSE105261) was downloaded from the Gene Expression Omnibus database, and included 26 ccRCC and 9 normal kideny samples. Assessment of the microarray dataset led to the recognition of differentially expressed genes (DEGs), which was subsequently used for pathway and gene ontology (GO) enrichment analysis. -
Small Cell Ovarian Carcinoma: Genomic Stability and Responsiveness to Therapeutics
Gamwell et al. Orphanet Journal of Rare Diseases 2013, 8:33 http://www.ojrd.com/content/8/1/33 RESEARCH Open Access Small cell ovarian carcinoma: genomic stability and responsiveness to therapeutics Lisa F Gamwell1,2, Karen Gambaro3, Maria Merziotis2, Colleen Crane2, Suzanna L Arcand4, Valerie Bourada1,2, Christopher Davis2, Jeremy A Squire6, David G Huntsman7,8, Patricia N Tonin3,4,5 and Barbara C Vanderhyden1,2* Abstract Background: The biology of small cell ovarian carcinoma of the hypercalcemic type (SCCOHT), which is a rare and aggressive form of ovarian cancer, is poorly understood. Tumourigenicity, in vitro growth characteristics, genetic and genomic anomalies, and sensitivity to standard and novel chemotherapeutic treatments were investigated in the unique SCCOHT cell line, BIN-67, to provide further insight in the biology of this rare type of ovarian cancer. Method: The tumourigenic potential of BIN-67 cells was determined and the tumours formed in a xenograft model was compared to human SCCOHT. DNA sequencing, spectral karyotyping and high density SNP array analysis was performed. The sensitivity of the BIN-67 cells to standard chemotherapeutic agents and to vesicular stomatitis virus (VSV) and the JX-594 vaccinia virus was tested. Results: BIN-67 cells were capable of forming spheroids in hanging drop cultures. When xenografted into immunodeficient mice, BIN-67 cells developed into tumours that reflected the hypercalcemia and histology of human SCCOHT, notably intense expression of WT-1 and vimentin, and lack of expression of inhibin. Somatic mutations in TP53 and the most common activating mutations in KRAS and BRAF were not found in BIN-67 cells by DNA sequencing. -
AN INVESTIGATION of the ROLE of PAK6 in TUMORIGENESIS By
AN INVESTIGATION OF THE ROLE OF PAK6 IN TUMORIGENESIS by JoAnn Roberts A Thesis Submitted to the Faculty of The Charles E. Schmidt College of Medicine In Partial Fulfillment of the Requirements for the Degree of Master of Science Florida Atlantic University Boca Raton, Florida August 2012 ACKNOWLEDGMENTS This material is based upon work supported by the National Science Foundation under Grant No. DGE: 0638662. Any opinions, findings, and conclusions or recommendations expressed in this material are those of the author(s) and do not necessarily reflect the views of the National Science Foundation. I would like to thank and acknowledge my thesis advisor, Dr. Michael Lu, for his support and guidance throughout the writing of this thesis and design of experiments in this manuscript. I would also like to thank my colleagues for assistance in various trouble-shooting circumstances. Last, but certainly not least, I would like to thank my family and friends for their support in the pursuit of my graduate studies. iii ABSTRACT Author: JoAnn Roberts Title: An Investigation of the Role of PAK6 in Tumorigenesis Institution: Florida Atlantic University Thesis Advisor: Dr. Michael Lu Degree: Master of Science Year: 2012 The function and role of PAK6, a serine/threonine kinase, in cancer progression has not yet been clearly identified. Several studies reveal that PAK6 may participate in key changes contributing to cancer progression such as cell survival, cell motility, and invasiveness. Based on the membrane localization of PAK6 in prostate and breast cancer cells, we speculated that PAK6 plays a role in cancer progression cells by localizing on the membrane and modifying proteins linked to motility and proliferation. -
Sorting Nexins in Protein Homeostasis Sara E. Hanley1,And Katrina F
Preprints (www.preprints.org) | NOT PEER-REVIEWED | Posted: 6 November 2020 doi:10.20944/preprints202011.0241.v1 Sorting nexins in protein homeostasis Sara E. Hanley1,and Katrina F. Cooper2* 1Department of Molecular Biology, Graduate School of Biomedical Sciences, Rowan University, Stratford, NJ, 08084, USA 1 [email protected] 2 [email protected] * [email protected] Tel: +1 (856)-566-2887 1Department of Molecular Biology, Graduate School of Biomedical Sciences, Rowan University, Stratford, NJ, 08084, USA Abstract: Sorting nexins (SNXs) are a highly conserved membrane-associated protein family that plays a role in regulating protein homeostasis. This family of proteins is unified by their characteristic phox (PX) phosphoinositides binding domain. Along with binding to membranes, this family of SNXs also comprises a diverse array of protein-protein interaction motifs that are required for cellular sorting and protein trafficking. SNXs play a role in maintaining the integrity of the proteome which is essential for regulating multiple fundamental processes such as cell cycle progression, transcription, metabolism, and stress response. To tightly regulate these processes proteins must be expressed and degraded in the correct location and at the correct time. The cell employs several proteolysis mechanisms to ensure that proteins are selectively degraded at the appropriate spatiotemporal conditions. SNXs play a role in ubiquitin-mediated protein homeostasis at multiple levels including cargo localization, recycling, degradation, and function. In this review, we will discuss the role of SNXs in three different protein homeostasis systems: endocytosis lysosomal, the ubiquitin-proteasomal, and the autophagy-lysosomal system. The highly conserved nature of this protein family by beginning with the early research on SNXs and protein trafficking in yeast and lead into their important roles in mammalian systems. -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
PIK3C2G (NM 004570) Human Mutant ORF Clone Product Data
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC402758 PIK3C2G (NM_004570) Human Mutant ORF Clone Product data: Product Type: Mutant ORF Clones Product Name: PIK3C2G (NM_004570) Human Mutant ORF Clone Mutation Description: P146L Affected Codon#: 146 Affected NT#: 437 Nucleotide Mutation: PIK3C2G Mutant (P146L), Myc-DDK-tagged ORF clone of Homo sapiens phosphoinositide-3- kinase, class 2, gamma polypeptide (PIK3C2G) as transfection-ready DNA Effect: Dibees, ype 2, ssoiion wih Symbol: PIK3C2G Synonyms: PI3K-C2-gamma; PI3K-C2GAMMA Vector: pCMV6-Entry (PS100001) Tag: Myc-DDK ACCN: NM_004570 ORF Size: 4335 bp ORF Nucleotide >RC402758 representing NM_004570 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCATATTCTTGGCAAACGGATCCAAATCCTAATGAATCACACGAAAAGCAGTATGAACACCAAGAAT TTCTCTTTGTAAATCAACCCCATTCTTCTAGCCAAGTCAGTCTGGGTTTTGATCAGATAGTAGATGAGAT CAGTGGCAAAATTCCACACTACGAGAGTGAAATTGATGAAAACACCTTTTTTGTGCCCACTGCACCAAAA TGGGACTCAACAGGGCATTCATTAAATGAAGCACACCAAATATCCTTGAATGAATTCACTTCTAAAAGCC GTGAACTCTCCTGGCATCAAGTTAGCAAAGCACCAGCAATTGGTTTTAGTCCTTCTGTGTTACCAAAACC TCAAAATACGAATAAAGAATGCTCCTGGGGAAGCCCCATAGGAAAACATCATGGTGCTGATGATTCCAGA TTCAGTATTTTAGCTCTATCATTCACAAGTTTGGATAAAATTAATCTAGAGAAAGAATTAGAAAATGAAA ATCATAACTACCATATAGGATTTGAAAGTAGCATTCCTCCAACAAATTCATCCTTCTCAAGTGACTTCAT GCCGAAAGAAGAGAATAAAAGGAGTGGACATGTGAACATTGTGGAACCATCTTTGATGCTTTTGAAAGGC -
Diverse Species-Specific Phenotypic Consequences of Loss of Function
www.nature.com/scientificreports OPEN Diverse species‑specifc phenotypic consequences of loss of function sorting nexin 14 mutations Dale Bryant1, Marian Seda1, Emma Peskett1, Constance Maurer1, Gideon Pomeranz1, Marcus Ghosh2, Thomas A. Hawkins2, James Cleak3, Sanchari Datta4, Hanaa Hariri4, Kaitlyn M. Eckert5,6, Daniyal J. Jafree1, Claire Walsh7, Charalambos Demetriou1, Miho Ishida1, Cristina Alemán‑Charlet1, Letizia Vestito1, Rimante Seselgyte1, Jefrey G. McDonald5,6, Maria Bitner‑Glindzicz1, Myriam Hemberger8, Jason Rihel2, Lydia Teboul3, W. Mike Henne4, Dagan Jenkins1, Gudrun E. Moore1 & Philip Stanier1* Mutations in the SNX14 gene cause spinocerebellar ataxia, autosomal recessive 20 (SCAR20) in both humans and dogs. Studies implicating the phenotypic consequences of SNX14 mutations to be consequences of subcellular disruption to autophagy and lipid metabolism have been limited to in vitro investigation of patient‑derived dermal fbroblasts, laboratory engineered cell lines and developmental analysis of zebrafsh morphants. SNX14 homologues Snz (Drosophila) and Mdm1 (yeast) have also been conducted, demonstrated an important biochemical role during lipid biogenesis. In this study we report the efect of loss of SNX14 in mice, which resulted in embryonic lethality around mid‑gestation due to placental pathology that involves severe disruption to syncytiotrophoblast cell diferentiation. In contrast to other vertebrates, zebrafsh carrying a homozygous, maternal zygotic snx14 genetic loss‑of‑function mutation were both viable and anatomically normal. Whilst no obvious behavioural efects were observed, elevated levels of neutral lipids and phospholipids resemble previously reported efects on lipid homeostasis in other species. The biochemical role of SNX14 therefore appears largely conserved through evolution while the consequences of loss of function varies between species. -
Sorting Nexin 27 Regulates the Lysosomal Degradation of Aquaporin-2 Protein in the Kidney Collecting Duct
cells Article Sorting Nexin 27 Regulates the Lysosomal Degradation of Aquaporin-2 Protein in the Kidney Collecting Duct Hyo-Jung Choi 1,2, Hyo-Ju Jang 1,3, Euijung Park 1,3, Stine Julie Tingskov 4, Rikke Nørregaard 4, Hyun Jun Jung 5 and Tae-Hwan Kwon 1,3,* 1 Department of Biochemistry and Cell Biology, School of Medicine, Kyungpook National University, Taegu 41944, Korea; [email protected] (H.-J.C.); [email protected] (H.-J.J.); [email protected] (E.P.) 2 New Drug Development Center, Daegu-Gyeongbuk Medical Innovation Foundation, Taegu 41061, Korea 3 BK21 Plus KNU Biomedical Convergence Program, Department of Biomedical Science, School of Medicine, Kyungpook National University, Taegu 41944, Korea 4 Department of Clinical Medicine, Aarhus University, Aarhus 8200, Denmark; [email protected] (S.J.T.); [email protected] (R.N.) 5 Division of Nephrology, Department of Medicine, Johns Hopkins University School of Medicine, Baltimore, MD 21205, USA; [email protected] * Correspondence: [email protected]; Tel.: +82-53-420-4825; Fax: +82-53-422-1466 Received: 30 March 2020; Accepted: 11 May 2020; Published: 13 May 2020 Abstract: Sorting nexin 27 (SNX27), a PDZ (Postsynaptic density-95/Discs large/Zonula occludens 1) domain-containing protein, cooperates with a retromer complex, which regulates intracellular trafficking and the abundance of membrane proteins. Since the carboxyl terminus of aquaporin-2 (AQP2c) has a class I PDZ-interacting motif (X-T/S-X-F), the role of SNX27 in the regulation of AQP2 was studied. Co-immunoprecipitation assay of the rat kidney demonstrated an interaction of SNX27 with AQP2. -
Emerging Roles of ARHGAP33 in Intracellular Trafficking of Trkb And
ARTICLE Received 21 Oct 2015 | Accepted 4 Jan 2016 | Published 3 Feb 2016 DOI: 10.1038/ncomms10594 OPEN Emerging roles of ARHGAP33 in intracellular trafficking of TrkB and pathophysiology of neuropsychiatric disorders Takanobu Nakazawa1,2,3, Ryota Hashimoto4,5, Kazuto Sakoori1, Yuki Sugaya1, Asami Tanimura1, Yuki Hashimotodani1, Kazutaka Ohi4, Hidenaga Yamamori4,6, Yuka Yasuda4, Satomi Umeda-Yano6, Yuji Kiyama7, Kohtarou Konno8, Takeshi Inoue2, Kazumasa Yokoyama2, Takafumi Inoue9, Shusuke Numata10, Tohru Ohnuma11, Nakao Iwata12, Norio Ozaki13, Hitoshi Hashimoto3,5,14, Masahiko Watanabe8, Toshiya Manabe7, Tadashi Yamamoto2,15, Masatoshi Takeda4,5 & Masanobu Kano1 Intracellular trafficking of receptor proteins is essential for neurons to detect various extra- cellular factors during the formation and refinement of neural circuits. However, the precise mechanisms underlying the trafficking of neurotrophin receptors to synapses remain elusive. Here, we demonstrate that a brain-enriched sorting nexin, ARHGAP33, is a new type of regulator for the intracellular trafficking of TrkB, a high-affinity receptor for brain-derived neurotrophic factor. ARHGAP33 knockout (KO) mice exhibit reduced expression of synaptic TrkB, impaired spine development and neuropsychiatric disorder-related behavioural abnormalities. These deficits are rescued by specific pharmacological enhancement of TrkB signalling in ARHGAP33 KO mice. Mechanistically, ARHGAP33 interacts with SORT1 to cooperatively regulate TrkB trafficking. Human ARHGAP33 is associated with brain pheno- types and reduced SORT1 expression is found in patients with schizophrenia. We propose that ARHGAP33/SORT1-mediated TrkB trafficking is essential for synapse development and that the dysfunction of this mechanism may be a new molecular pathology of neuropsychiatric disorders. 1 Department of Neurophysiology, Graduate School of Medicine, The University of Tokyo, Tokyo 113-0033, Japan. -
The DNA Methylation Landscape of Glioblastoma Disease Progression Shows Extensive Heterogeneity in Time and Space
bioRxiv preprint doi: https://doi.org/10.1101/173864; this version posted August 9, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The DNA methylation landscape of glioblastoma disease progression shows extensive heterogeneity in time and space Johanna Klughammer1*, Barbara Kiesel2,3*, Thomas Roetzer3,4, Nikolaus Fortelny1, Amelie Kuchler1, Nathan C. Sheffield5, Paul Datlinger1, Nadine Peter3,4, Karl-Heinz Nenning6, Julia Furtner3,7, Martha Nowosielski8,9, Marco Augustin10, Mario Mischkulnig2,3, Thomas Ströbel3,4, Patrizia Moser11, Christian F. Freyschlag12, Jo- hannes Kerschbaumer12, Claudius Thomé12, Astrid E. Grams13, Günther Stockhammer8, Melitta Kitzwoegerer14, Stefan Oberndorfer15, Franz Marhold16, Serge Weis17, Johannes Trenkler18, Johanna Buchroithner19, Josef Pichler20, Johannes Haybaeck21,22, Stefanie Krassnig21, Kariem Madhy Ali23, Gord von Campe23, Franz Payer24, Camillo Sherif25, Julius Preiser26, Thomas Hauser27, Peter A. Winkler27, Waltraud Kleindienst28, Franz Würtz29, Tanisa Brandner-Kokalj29, Martin Stultschnig30, Stefan Schweiger31, Karin Dieckmann3,32, Matthias Preusser3,33, Georg Langs6, Bernhard Baumann10, Engelbert Knosp2,3, Georg Widhalm2,3, Christine Marosi3,33, Johannes A. Hainfellner3,4, Adelheid Woehrer3,4#§, Christoph Bock1,34,35# 1 CeMM Research Center for Molecular Medicine of the Austrian Academy of Sciences, Vienna, Austria. 2 Department of Neurosurgery, Medical University of Vienna, Vienna, Austria. 3 Comprehensive Cancer Center, Central Nervous System Tumor Unit, Medical University of Vienna, Austria. 4 Institute of Neurology, Medical University of Vienna, Vienna, Austria. 5 Center for Public Health Genomics, University of Virginia, Charlottesville VA, USA. 6 Department of Biomedical Imaging and Image-guided Therapy, Computational Imaging Research Lab, Medical University of Vi- enna, Vienna, Austria. -
Predicting Clinical Response to Treatment with a Soluble Tnf-Antagonist Or Tnf, Or a Tnf Receptor Agonist
(19) TZZ _ __T (11) EP 2 192 197 A1 (12) EUROPEAN PATENT APPLICATION (43) Date of publication: (51) Int Cl.: 02.06.2010 Bulletin 2010/22 C12Q 1/68 (2006.01) (21) Application number: 08170119.5 (22) Date of filing: 27.11.2008 (84) Designated Contracting States: (72) Inventor: The designation of the inventor has not AT BE BG CH CY CZ DE DK EE ES FI FR GB GR yet been filed HR HU IE IS IT LI LT LU LV MC MT NL NO PL PT RO SE SI SK TR (74) Representative: Habets, Winand Designated Extension States: Life Science Patents AL BA MK RS PO Box 5096 6130 PB Sittard (NL) (71) Applicant: Vereniging voor Christelijk Hoger Onderwijs, Wetenschappelijk Onderzoek en Patiëntenzorg 1081 HV Amsterdam (NL) (54) Predicting clinical response to treatment with a soluble tnf-antagonist or tnf, or a tnf receptor agonist (57) The invention relates to methods for predicting a clinical response to a therapy with a soluble TNF antagonist, TNF or a TNF receptor agonist and a kit for use in said methods. EP 2 192 197 A1 Printed by Jouve, 75001 PARIS (FR) EP 2 192 197 A1 Description [0001] The invention relates to methods for predicting a clinical response to a treatment with a soluble TNF antagonist, with TNF or a TNF receptor agonist using expression levels of genes of the Type I INF pathway and a kit for use in said 5 methods. In another aspect, the invention relates to a method for evaluating a pharmacological effect of a treatment with a soluble TNF antagonist, TNF or a TNF receptor agonist. -
Sorting Nexin-27 Regulates AMPA Receptor Trafficking Through The
RESEARCH ARTICLE Sorting nexin-27 regulates AMPA receptor trafficking through the synaptic adhesion protein LRFN2 Kirsty J McMillan1†*, Paul J Banks2†, Francesca LN Hellel1, Ruth E Carmichael1, Thomas Clairfeuille3, Ashley J Evans1, Kate J Heesom4, Philip Lewis4, Brett M Collins3, Zafar I Bashir2, Jeremy M Henley1, Kevin A Wilkinson1*, Peter J Cullen1* 1School of Biochemistry, University of Bristol, Bristol, United Kingdom; 2School of Physiology, Pharmacology and Neuroscience, University of Bristol, Bristol, United Kingdom; 3Institute for Molecular Bioscience, The University of Queensland, Queensland, Australia; 4Proteomics facility, School of Biochemistry, University of Bristol, Bristol, United Kingdom Abstract The endosome-associated cargo adaptor sorting nexin-27 (SNX27) is linked to various neuropathologies through sorting of integral proteins to the synaptic surface, most notably AMPA receptors. To provide a broader view of SNX27-associated pathologies, we performed proteomics in rat primary neurons to identify SNX27-dependent cargoes, and identified proteins linked to excitotoxicity, epilepsy, intellectual disabilities, and working memory deficits. Focusing on the *For correspondence: synaptic adhesion molecule LRFN2, we established that SNX27 binds to LRFN2 and regulates its [email protected] endosomal sorting. Furthermore, LRFN2 associates with AMPA receptors and knockdown of (KJMM); LRFN2 results in decreased surface AMPA receptor expression, reduced synaptic activity, and [email protected] attenuated hippocampal long-term potentiation. Overall, our study provides an additional (KAW); mechanism by which SNX27 can control AMPA receptor-mediated synaptic transmission and [email protected] (PJC) plasticity indirectly through the sorting of LRFN2 and offers molecular insight into the perturbed †These authors contributed function of SNX27 and LRFN2 in a range of neurological conditions.