(PX) Domains Based on Their Phosphoinositide Binding Specificities

Total Page:16

File Type:pdf, Size:1020Kb

Load more

ARTICLE https://doi.org/10.1038/s41467-019-09355-y OPEN Classification of the human phox homology (PX) domains based on their phosphoinositide binding specificities Mintu Chandra1, Yanni K.-Y. Chin1, Caroline Mas1,6, J. Ryan Feathers2, Blessy Paul1, Sanchari Datta2, Kai-En Chen 1, Xinying Jia 3, Zhe Yang4, Suzanne J. Norwood1, Biswaranjan Mohanty5, Andrea Bugarcic1, Rohan D. Teasdale1,4, W. Mike Henne2, Mehdi Mobli 3 & Brett M. Collins1 1234567890():,; Phox homology (PX) domains are membrane interacting domains that bind to phosphati- dylinositol phospholipids or phosphoinositides, markers of organelle identity in the endocytic system. Although many PX domains bind the canonical endosome-enriched lipid PtdIns3P, others interact with alternative phosphoinositides, and a precise understanding of how these specificities arise has remained elusive. Here we systematically screen all human PX domains for their phospholipid preferences using liposome binding assays, biolayer interferometry and isothermal titration calorimetry. These analyses define four distinct classes of human PX domains that either bind specifically to PtdIns3P, non-specifically to various di- and tri- phosphorylated phosphoinositides, bind both PtdIns3P and other phosphoinositides, or associate with none of the lipids tested. A comprehensive evaluation of PX domain structures reveals two distinct binding sites that explain these specificities, providing a basis for defining and predicting the functional membrane interactions of the entire PX domain protein family. 1 Institute for Molecular Bioscience, The University of Queensland, St. Lucia, QLD 4072, Australia. 2 Department of Cell Biology, University of Texas Southwestern Medical Center, Dallas, TX 75390, USA. 3 Centre for Advanced Imaging and School of Chemistry and Molecular Biology, The University of Queensland, St. Lucia, QLD 4072, Australia. 4 School of Biomedical Sciences, Faculty of Medicine, The University of Queensland, St. Lucia, QLD 4072, Australia. 5 Medicinal Chemistry, Monash Institute of Pharmaceutical Sciences, Monash University, 381 Royal Parade, Parkville 3052 VIC, Australia. 6Present address: Integrated Structural Biology Grenoble, Grenoble, France. These authors contributed equally: Yanni K.-Y. Chin, Caroline Mas. Correspondence and requests for materials should be addressed to B.M.C. (email: [email protected]) NATURE COMMUNICATIONS | (2019) 10:1528 | https://doi.org/10.1038/s41467-019-09355-y | www.nature.com/naturecommunications 1 ARTICLE NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-019-09355-y he phosphoinositides or phosphatidylinositol phospholi- Alzheimer’s, cancer, and pathogen invasion, a clearer under- T pids (PtdInsPs) are, along with the Rab family of small standing of PX domain membrane affinities is critical. GTPase proteins, among the most important markers of In this study, we have purified over three-quarters of the organelle identity within the secretory and endocytic system. human PX domains and performed a systematic and compre- Phosphoinositides are differentially phosphorylated at the hensive analysis of their phosphoinositide-binding properties D3, D4, and D5 positions of the 6-carbon inositol ring by using qualitative liposome pelleting assays and quantitative iso- phosphoinositide kinases and phosphatases and provide both thermal titration calorimetry (ITC) and biolayer interferometry specific membrane anchors for recruiting peripheral membrane (BLItz) biophysical measurements. These studies resolve four proteins, as well as substrates for generating other lipids and distinct categories of PX domains; those that bind specifically to 1 second messengers, such as Ins(1,4,5)P3 . A variety of protein the canonical lipid PtdIns3P, those that bind other phosphoino- domains have been discovered with specific PtdInsP-binding sitides as well as PtdIns3P, those that bind other lipids but not properties, and these are found in proteins with diverse functions PtdIns3P, and those that do not appear to bind membrane lipids in membrane trafficking, cell signaling, or membrane-associated significantly at all. An analysis of PX domain sequences and scaffolding roles2–4. Examples include pleckstrin homology (PH), structures, including several new crystallographic and NMR fab1/yotb/vac1/eea1 (FYVE), and C2 domains. Several well- structures, suggest that a common determinant of noncanonical characterized domains are now used as tools for imaging lipid binding is the presence of a His or Tyr side chain within the cellular locations of different PtdInsPs, such as helix α1 along with adjacent basic residues. Using structure- plasma membrane-enriched PtdIns(4,5)P2 by the PH domain guided mutagenesis, we demonstrate the general role of this δ of PLC , transiently produced PtdIns(3,4,5)P3 by the PH secondary His/Tyr-containing site in noncanonical lipid binding domain of Grp1, and the endosomal lipid PtdIns3P by the FYVE and have verified the in vitro observations for several family domain of EEA1. This has all led to the concept of a phosphoi- members using a yeast cell-based membrane recruitment assay. nositide code that is recognized by these various PtdInsP effec- Altogether, our biochemical, structural, and cellular studies pro- tors3, although it is important to understand that many of these vide a thorough description of the membrane-binding specificities lipid-effector interactions are of relatively low affinity, and of the human PX domain family, with potential implications for are often conditional on coordinated binding or coincident their roles in signal transduction and membrane trafficking. detection of other localization signals, such as the presence of Rabs or other lipids4. The Phox homology (PX) domain was first identified in the Results NADPH phagocyte oxidase complex subunits p40phox and Classifying the human PX domain PtdInsP specificity.As p47phox5, and has since been found in proteins in every eukar- summarized in Supplementary Table 1, many previous reports yotic species from yeast to human6–8. The human genome have described interactions of human PX domain proteins with a encodes 49 proteins that possess PX domains, many of which are variety of different phosphoinositide lipids, as well as other lipids termed sorting nexins (SNXs), that all play diverse roles in sig- such as phosphatidylserine (PS) and phosphatidic acid (PA) that naling, trafficking, and membrane homeostasis. The PX domain may promote recruitment to various cellular organelles and was established early on as a phosphoinositide-binding domain, membrane domains. Our aim was to perform parallel compar- and shown to bind to the endosomal lipid PtdIns3P based on isons of as many human PX domains as possible, using qualitative studies of yeast Vam7, human SNX3, and p40phox9–16. Sub- and quantitative approaches to measure binding to both mem- sequent work showed that the majority of yeast PX domains had brane mimetics and soluble phosphoinositide headgroups. We preferential affinity for PtdIns3P17, and studies since have shown first cloned 46 of the 49 human PX domains with the N-terminal that specific interactions with PtdIns3P are essential for cellular GST fusion tags and expressed them in bacteria, followed by localization of many PX domain proteins to the outer leaflet of purification by glutathione affinity chromatography and removal early endosomes in various organisms7,8. Nonetheless, affinities of the GST-tag by thrombin cleavage. Our strict criterion for of PX domains for a variety of other phosphoinositides and lipids further analysis was that the PX domains could be isolated as have also been reported7, including p47phox18 and PI3KC2α19. predominantly single and homogeneous species via gel filtration. Despite relatively low overall sequence homology, PX domains Of the 46 human PX domains cloned, we successfully purified 39 all possess the same core fold, consisting of three antiparallel β- for further study (Supplementary Figure 1; Supplementary strands (β1-β3), followed by three α-helices (α1–α3)8.An Table 2). extended sequence traverses the protein between helices α1 and We next assessed the binding of the human PX domain α2, termed the PPK loop as it generally contains a conserved containing proteins to membranes containing phosphoinositides ΨPxxPxK motif (Ψ = large aliphatic amino acids V, I, L, and M). using qualitative liposome pelleting assays (Figs. 1, 2a). None of Side chains of residues from the β3 strand, α1 helix and PPK loop the tested proteins showed nonspecific pelleting in buffer or with together form a binding pocket for the headgroup of the cano- control PC/PE membranes. As expected a number of PX domains nical lipid PtdIns3P. Several crystal structures have now defined showed exclusive interaction with liposomes containing PtdIns3P the molecular details of the stereo-specific recognition of (SNX3, SNX7, SNX19, SNX17, SNX27, p40phox, PXK, and PtdIns3P, and mutations in the side-chains that bind the SNX16), with SNX11 and SNX12 showing a slight preference for PtdIns3P headgroup invariably cause dissociation of these PX this endosome-enriched lipid. The somewhat surprising result domain proteins from endosomal compartments. Notwithstand- was that the PX domains that bound selectively to the canonical ing this knowledge, the mechanism(s) by which alternative or PtdIns3P were in the minority. More commonly the PX domains noncanonical phosphoinositides bind to PX domains, the range either showed a range of lipid-binding preferences or did not bind of different phosphoinositides that associate
Recommended publications
  • Screening and Identification of Key Biomarkers in Clear Cell Renal Cell Carcinoma Based on Bioinformatics Analysis

    Screening and Identification of Key Biomarkers in Clear Cell Renal Cell Carcinoma Based on Bioinformatics Analysis

    bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423889; this version posted December 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Screening and identification of key biomarkers in clear cell renal cell carcinoma based on bioinformatics analysis Basavaraj Vastrad1, Chanabasayya Vastrad*2 , Iranna Kotturshetti 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. 3. Department of Ayurveda, Rajiv Gandhi Education Society`s Ayurvedic Medical College, Ron, Karnataka 562209, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423889; this version posted December 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract Clear cell renal cell carcinoma (ccRCC) is one of the most common types of malignancy of the urinary system. The pathogenesis and effective diagnosis of ccRCC have become popular topics for research in the previous decade. In the current study, an integrated bioinformatics analysis was performed to identify core genes associated in ccRCC. An expression dataset (GSE105261) was downloaded from the Gene Expression Omnibus database, and included 26 ccRCC and 9 normal kideny samples. Assessment of the microarray dataset led to the recognition of differentially expressed genes (DEGs), which was subsequently used for pathway and gene ontology (GO) enrichment analysis.
  • Small Cell Ovarian Carcinoma: Genomic Stability and Responsiveness to Therapeutics

    Small Cell Ovarian Carcinoma: Genomic Stability and Responsiveness to Therapeutics

    Gamwell et al. Orphanet Journal of Rare Diseases 2013, 8:33 http://www.ojrd.com/content/8/1/33 RESEARCH Open Access Small cell ovarian carcinoma: genomic stability and responsiveness to therapeutics Lisa F Gamwell1,2, Karen Gambaro3, Maria Merziotis2, Colleen Crane2, Suzanna L Arcand4, Valerie Bourada1,2, Christopher Davis2, Jeremy A Squire6, David G Huntsman7,8, Patricia N Tonin3,4,5 and Barbara C Vanderhyden1,2* Abstract Background: The biology of small cell ovarian carcinoma of the hypercalcemic type (SCCOHT), which is a rare and aggressive form of ovarian cancer, is poorly understood. Tumourigenicity, in vitro growth characteristics, genetic and genomic anomalies, and sensitivity to standard and novel chemotherapeutic treatments were investigated in the unique SCCOHT cell line, BIN-67, to provide further insight in the biology of this rare type of ovarian cancer. Method: The tumourigenic potential of BIN-67 cells was determined and the tumours formed in a xenograft model was compared to human SCCOHT. DNA sequencing, spectral karyotyping and high density SNP array analysis was performed. The sensitivity of the BIN-67 cells to standard chemotherapeutic agents and to vesicular stomatitis virus (VSV) and the JX-594 vaccinia virus was tested. Results: BIN-67 cells were capable of forming spheroids in hanging drop cultures. When xenografted into immunodeficient mice, BIN-67 cells developed into tumours that reflected the hypercalcemia and histology of human SCCOHT, notably intense expression of WT-1 and vimentin, and lack of expression of inhibin. Somatic mutations in TP53 and the most common activating mutations in KRAS and BRAF were not found in BIN-67 cells by DNA sequencing.
  • AN INVESTIGATION of the ROLE of PAK6 in TUMORIGENESIS By

    AN INVESTIGATION of the ROLE of PAK6 in TUMORIGENESIS By

    AN INVESTIGATION OF THE ROLE OF PAK6 IN TUMORIGENESIS by JoAnn Roberts A Thesis Submitted to the Faculty of The Charles E. Schmidt College of Medicine In Partial Fulfillment of the Requirements for the Degree of Master of Science Florida Atlantic University Boca Raton, Florida August 2012 ACKNOWLEDGMENTS This material is based upon work supported by the National Science Foundation under Grant No. DGE: 0638662. Any opinions, findings, and conclusions or recommendations expressed in this material are those of the author(s) and do not necessarily reflect the views of the National Science Foundation. I would like to thank and acknowledge my thesis advisor, Dr. Michael Lu, for his support and guidance throughout the writing of this thesis and design of experiments in this manuscript. I would also like to thank my colleagues for assistance in various trouble-shooting circumstances. Last, but certainly not least, I would like to thank my family and friends for their support in the pursuit of my graduate studies. iii ABSTRACT Author: JoAnn Roberts Title: An Investigation of the Role of PAK6 in Tumorigenesis Institution: Florida Atlantic University Thesis Advisor: Dr. Michael Lu Degree: Master of Science Year: 2012 The function and role of PAK6, a serine/threonine kinase, in cancer progression has not yet been clearly identified. Several studies reveal that PAK6 may participate in key changes contributing to cancer progression such as cell survival, cell motility, and invasiveness. Based on the membrane localization of PAK6 in prostate and breast cancer cells, we speculated that PAK6 plays a role in cancer progression cells by localizing on the membrane and modifying proteins linked to motility and proliferation.
  • Sorting Nexins in Protein Homeostasis Sara E. Hanley1,And Katrina F

    Sorting Nexins in Protein Homeostasis Sara E. Hanley1,And Katrina F

    Preprints (www.preprints.org) | NOT PEER-REVIEWED | Posted: 6 November 2020 doi:10.20944/preprints202011.0241.v1 Sorting nexins in protein homeostasis Sara E. Hanley1,and Katrina F. Cooper2* 1Department of Molecular Biology, Graduate School of Biomedical Sciences, Rowan University, Stratford, NJ, 08084, USA 1 [email protected] 2 [email protected] * [email protected] Tel: +1 (856)-566-2887 1Department of Molecular Biology, Graduate School of Biomedical Sciences, Rowan University, Stratford, NJ, 08084, USA Abstract: Sorting nexins (SNXs) are a highly conserved membrane-associated protein family that plays a role in regulating protein homeostasis. This family of proteins is unified by their characteristic phox (PX) phosphoinositides binding domain. Along with binding to membranes, this family of SNXs also comprises a diverse array of protein-protein interaction motifs that are required for cellular sorting and protein trafficking. SNXs play a role in maintaining the integrity of the proteome which is essential for regulating multiple fundamental processes such as cell cycle progression, transcription, metabolism, and stress response. To tightly regulate these processes proteins must be expressed and degraded in the correct location and at the correct time. The cell employs several proteolysis mechanisms to ensure that proteins are selectively degraded at the appropriate spatiotemporal conditions. SNXs play a role in ubiquitin-mediated protein homeostasis at multiple levels including cargo localization, recycling, degradation, and function. In this review, we will discuss the role of SNXs in three different protein homeostasis systems: endocytosis lysosomal, the ubiquitin-proteasomal, and the autophagy-lysosomal system. The highly conserved nature of this protein family by beginning with the early research on SNXs and protein trafficking in yeast and lead into their important roles in mammalian systems.
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
  • PIK3C2G (NM 004570) Human Mutant ORF Clone Product Data

    PIK3C2G (NM 004570) Human Mutant ORF Clone Product Data

    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC402758 PIK3C2G (NM_004570) Human Mutant ORF Clone Product data: Product Type: Mutant ORF Clones Product Name: PIK3C2G (NM_004570) Human Mutant ORF Clone Mutation Description: P146L Affected Codon#: 146 Affected NT#: 437 Nucleotide Mutation: PIK3C2G Mutant (P146L), Myc-DDK-tagged ORF clone of Homo sapiens phosphoinositide-3- kinase, class 2, gamma polypeptide (PIK3C2G) as transfection-ready DNA Effect: Dibees, ype 2, ssoiion wih Symbol: PIK3C2G Synonyms: PI3K-C2-gamma; PI3K-C2GAMMA Vector: pCMV6-Entry (PS100001) Tag: Myc-DDK ACCN: NM_004570 ORF Size: 4335 bp ORF Nucleotide >RC402758 representing NM_004570 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCATATTCTTGGCAAACGGATCCAAATCCTAATGAATCACACGAAAAGCAGTATGAACACCAAGAAT TTCTCTTTGTAAATCAACCCCATTCTTCTAGCCAAGTCAGTCTGGGTTTTGATCAGATAGTAGATGAGAT CAGTGGCAAAATTCCACACTACGAGAGTGAAATTGATGAAAACACCTTTTTTGTGCCCACTGCACCAAAA TGGGACTCAACAGGGCATTCATTAAATGAAGCACACCAAATATCCTTGAATGAATTCACTTCTAAAAGCC GTGAACTCTCCTGGCATCAAGTTAGCAAAGCACCAGCAATTGGTTTTAGTCCTTCTGTGTTACCAAAACC TCAAAATACGAATAAAGAATGCTCCTGGGGAAGCCCCATAGGAAAACATCATGGTGCTGATGATTCCAGA TTCAGTATTTTAGCTCTATCATTCACAAGTTTGGATAAAATTAATCTAGAGAAAGAATTAGAAAATGAAA ATCATAACTACCATATAGGATTTGAAAGTAGCATTCCTCCAACAAATTCATCCTTCTCAAGTGACTTCAT GCCGAAAGAAGAGAATAAAAGGAGTGGACATGTGAACATTGTGGAACCATCTTTGATGCTTTTGAAAGGC
  • Diverse Species-Specific Phenotypic Consequences of Loss of Function

    Diverse Species-Specific Phenotypic Consequences of Loss of Function

    www.nature.com/scientificreports OPEN Diverse species‑specifc phenotypic consequences of loss of function sorting nexin 14 mutations Dale Bryant1, Marian Seda1, Emma Peskett1, Constance Maurer1, Gideon Pomeranz1, Marcus Ghosh2, Thomas A. Hawkins2, James Cleak3, Sanchari Datta4, Hanaa Hariri4, Kaitlyn M. Eckert5,6, Daniyal J. Jafree1, Claire Walsh7, Charalambos Demetriou1, Miho Ishida1, Cristina Alemán‑Charlet1, Letizia Vestito1, Rimante Seselgyte1, Jefrey G. McDonald5,6, Maria Bitner‑Glindzicz1, Myriam Hemberger8, Jason Rihel2, Lydia Teboul3, W. Mike Henne4, Dagan Jenkins1, Gudrun E. Moore1 & Philip Stanier1* Mutations in the SNX14 gene cause spinocerebellar ataxia, autosomal recessive 20 (SCAR20) in both humans and dogs. Studies implicating the phenotypic consequences of SNX14 mutations to be consequences of subcellular disruption to autophagy and lipid metabolism have been limited to in vitro investigation of patient‑derived dermal fbroblasts, laboratory engineered cell lines and developmental analysis of zebrafsh morphants. SNX14 homologues Snz (Drosophila) and Mdm1 (yeast) have also been conducted, demonstrated an important biochemical role during lipid biogenesis. In this study we report the efect of loss of SNX14 in mice, which resulted in embryonic lethality around mid‑gestation due to placental pathology that involves severe disruption to syncytiotrophoblast cell diferentiation. In contrast to other vertebrates, zebrafsh carrying a homozygous, maternal zygotic snx14 genetic loss‑of‑function mutation were both viable and anatomically normal. Whilst no obvious behavioural efects were observed, elevated levels of neutral lipids and phospholipids resemble previously reported efects on lipid homeostasis in other species. The biochemical role of SNX14 therefore appears largely conserved through evolution while the consequences of loss of function varies between species.
  • Sorting Nexin 27 Regulates the Lysosomal Degradation of Aquaporin-2 Protein in the Kidney Collecting Duct

    Sorting Nexin 27 Regulates the Lysosomal Degradation of Aquaporin-2 Protein in the Kidney Collecting Duct

    cells Article Sorting Nexin 27 Regulates the Lysosomal Degradation of Aquaporin-2 Protein in the Kidney Collecting Duct Hyo-Jung Choi 1,2, Hyo-Ju Jang 1,3, Euijung Park 1,3, Stine Julie Tingskov 4, Rikke Nørregaard 4, Hyun Jun Jung 5 and Tae-Hwan Kwon 1,3,* 1 Department of Biochemistry and Cell Biology, School of Medicine, Kyungpook National University, Taegu 41944, Korea; [email protected] (H.-J.C.); [email protected] (H.-J.J.); [email protected] (E.P.) 2 New Drug Development Center, Daegu-Gyeongbuk Medical Innovation Foundation, Taegu 41061, Korea 3 BK21 Plus KNU Biomedical Convergence Program, Department of Biomedical Science, School of Medicine, Kyungpook National University, Taegu 41944, Korea 4 Department of Clinical Medicine, Aarhus University, Aarhus 8200, Denmark; [email protected] (S.J.T.); [email protected] (R.N.) 5 Division of Nephrology, Department of Medicine, Johns Hopkins University School of Medicine, Baltimore, MD 21205, USA; [email protected] * Correspondence: [email protected]; Tel.: +82-53-420-4825; Fax: +82-53-422-1466 Received: 30 March 2020; Accepted: 11 May 2020; Published: 13 May 2020 Abstract: Sorting nexin 27 (SNX27), a PDZ (Postsynaptic density-95/Discs large/Zonula occludens 1) domain-containing protein, cooperates with a retromer complex, which regulates intracellular trafficking and the abundance of membrane proteins. Since the carboxyl terminus of aquaporin-2 (AQP2c) has a class I PDZ-interacting motif (X-T/S-X-F), the role of SNX27 in the regulation of AQP2 was studied. Co-immunoprecipitation assay of the rat kidney demonstrated an interaction of SNX27 with AQP2.
  • Emerging Roles of ARHGAP33 in Intracellular Trafficking of Trkb And

    Emerging Roles of ARHGAP33 in Intracellular Trafficking of Trkb And

    ARTICLE Received 21 Oct 2015 | Accepted 4 Jan 2016 | Published 3 Feb 2016 DOI: 10.1038/ncomms10594 OPEN Emerging roles of ARHGAP33 in intracellular trafficking of TrkB and pathophysiology of neuropsychiatric disorders Takanobu Nakazawa1,2,3, Ryota Hashimoto4,5, Kazuto Sakoori1, Yuki Sugaya1, Asami Tanimura1, Yuki Hashimotodani1, Kazutaka Ohi4, Hidenaga Yamamori4,6, Yuka Yasuda4, Satomi Umeda-Yano6, Yuji Kiyama7, Kohtarou Konno8, Takeshi Inoue2, Kazumasa Yokoyama2, Takafumi Inoue9, Shusuke Numata10, Tohru Ohnuma11, Nakao Iwata12, Norio Ozaki13, Hitoshi Hashimoto3,5,14, Masahiko Watanabe8, Toshiya Manabe7, Tadashi Yamamoto2,15, Masatoshi Takeda4,5 & Masanobu Kano1 Intracellular trafficking of receptor proteins is essential for neurons to detect various extra- cellular factors during the formation and refinement of neural circuits. However, the precise mechanisms underlying the trafficking of neurotrophin receptors to synapses remain elusive. Here, we demonstrate that a brain-enriched sorting nexin, ARHGAP33, is a new type of regulator for the intracellular trafficking of TrkB, a high-affinity receptor for brain-derived neurotrophic factor. ARHGAP33 knockout (KO) mice exhibit reduced expression of synaptic TrkB, impaired spine development and neuropsychiatric disorder-related behavioural abnormalities. These deficits are rescued by specific pharmacological enhancement of TrkB signalling in ARHGAP33 KO mice. Mechanistically, ARHGAP33 interacts with SORT1 to cooperatively regulate TrkB trafficking. Human ARHGAP33 is associated with brain pheno- types and reduced SORT1 expression is found in patients with schizophrenia. We propose that ARHGAP33/SORT1-mediated TrkB trafficking is essential for synapse development and that the dysfunction of this mechanism may be a new molecular pathology of neuropsychiatric disorders. 1 Department of Neurophysiology, Graduate School of Medicine, The University of Tokyo, Tokyo 113-0033, Japan.
  • The DNA Methylation Landscape of Glioblastoma Disease Progression Shows Extensive Heterogeneity in Time and Space

    The DNA Methylation Landscape of Glioblastoma Disease Progression Shows Extensive Heterogeneity in Time and Space

    bioRxiv preprint doi: https://doi.org/10.1101/173864; this version posted August 9, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The DNA methylation landscape of glioblastoma disease progression shows extensive heterogeneity in time and space Johanna Klughammer1*, Barbara Kiesel2,3*, Thomas Roetzer3,4, Nikolaus Fortelny1, Amelie Kuchler1, Nathan C. Sheffield5, Paul Datlinger1, Nadine Peter3,4, Karl-Heinz Nenning6, Julia Furtner3,7, Martha Nowosielski8,9, Marco Augustin10, Mario Mischkulnig2,3, Thomas Ströbel3,4, Patrizia Moser11, Christian F. Freyschlag12, Jo- hannes Kerschbaumer12, Claudius Thomé12, Astrid E. Grams13, Günther Stockhammer8, Melitta Kitzwoegerer14, Stefan Oberndorfer15, Franz Marhold16, Serge Weis17, Johannes Trenkler18, Johanna Buchroithner19, Josef Pichler20, Johannes Haybaeck21,22, Stefanie Krassnig21, Kariem Madhy Ali23, Gord von Campe23, Franz Payer24, Camillo Sherif25, Julius Preiser26, Thomas Hauser27, Peter A. Winkler27, Waltraud Kleindienst28, Franz Würtz29, Tanisa Brandner-Kokalj29, Martin Stultschnig30, Stefan Schweiger31, Karin Dieckmann3,32, Matthias Preusser3,33, Georg Langs6, Bernhard Baumann10, Engelbert Knosp2,3, Georg Widhalm2,3, Christine Marosi3,33, Johannes A. Hainfellner3,4, Adelheid Woehrer3,4#§, Christoph Bock1,34,35# 1 CeMM Research Center for Molecular Medicine of the Austrian Academy of Sciences, Vienna, Austria. 2 Department of Neurosurgery, Medical University of Vienna, Vienna, Austria. 3 Comprehensive Cancer Center, Central Nervous System Tumor Unit, Medical University of Vienna, Austria. 4 Institute of Neurology, Medical University of Vienna, Vienna, Austria. 5 Center for Public Health Genomics, University of Virginia, Charlottesville VA, USA. 6 Department of Biomedical Imaging and Image-guided Therapy, Computational Imaging Research Lab, Medical University of Vi- enna, Vienna, Austria.
  • Predicting Clinical Response to Treatment with a Soluble Tnf-Antagonist Or Tnf, Or a Tnf Receptor Agonist

    Predicting Clinical Response to Treatment with a Soluble Tnf-Antagonist Or Tnf, Or a Tnf Receptor Agonist

    (19) TZZ _ __T (11) EP 2 192 197 A1 (12) EUROPEAN PATENT APPLICATION (43) Date of publication: (51) Int Cl.: 02.06.2010 Bulletin 2010/22 C12Q 1/68 (2006.01) (21) Application number: 08170119.5 (22) Date of filing: 27.11.2008 (84) Designated Contracting States: (72) Inventor: The designation of the inventor has not AT BE BG CH CY CZ DE DK EE ES FI FR GB GR yet been filed HR HU IE IS IT LI LT LU LV MC MT NL NO PL PT RO SE SI SK TR (74) Representative: Habets, Winand Designated Extension States: Life Science Patents AL BA MK RS PO Box 5096 6130 PB Sittard (NL) (71) Applicant: Vereniging voor Christelijk Hoger Onderwijs, Wetenschappelijk Onderzoek en Patiëntenzorg 1081 HV Amsterdam (NL) (54) Predicting clinical response to treatment with a soluble tnf-antagonist or tnf, or a tnf receptor agonist (57) The invention relates to methods for predicting a clinical response to a therapy with a soluble TNF antagonist, TNF or a TNF receptor agonist and a kit for use in said methods. EP 2 192 197 A1 Printed by Jouve, 75001 PARIS (FR) EP 2 192 197 A1 Description [0001] The invention relates to methods for predicting a clinical response to a treatment with a soluble TNF antagonist, with TNF or a TNF receptor agonist using expression levels of genes of the Type I INF pathway and a kit for use in said 5 methods. In another aspect, the invention relates to a method for evaluating a pharmacological effect of a treatment with a soluble TNF antagonist, TNF or a TNF receptor agonist.
  • Sorting Nexin-27 Regulates AMPA Receptor Trafficking Through The

    Sorting Nexin-27 Regulates AMPA Receptor Trafficking Through The

    RESEARCH ARTICLE Sorting nexin-27 regulates AMPA receptor trafficking through the synaptic adhesion protein LRFN2 Kirsty J McMillan1†*, Paul J Banks2†, Francesca LN Hellel1, Ruth E Carmichael1, Thomas Clairfeuille3, Ashley J Evans1, Kate J Heesom4, Philip Lewis4, Brett M Collins3, Zafar I Bashir2, Jeremy M Henley1, Kevin A Wilkinson1*, Peter J Cullen1* 1School of Biochemistry, University of Bristol, Bristol, United Kingdom; 2School of Physiology, Pharmacology and Neuroscience, University of Bristol, Bristol, United Kingdom; 3Institute for Molecular Bioscience, The University of Queensland, Queensland, Australia; 4Proteomics facility, School of Biochemistry, University of Bristol, Bristol, United Kingdom Abstract The endosome-associated cargo adaptor sorting nexin-27 (SNX27) is linked to various neuropathologies through sorting of integral proteins to the synaptic surface, most notably AMPA receptors. To provide a broader view of SNX27-associated pathologies, we performed proteomics in rat primary neurons to identify SNX27-dependent cargoes, and identified proteins linked to excitotoxicity, epilepsy, intellectual disabilities, and working memory deficits. Focusing on the *For correspondence: synaptic adhesion molecule LRFN2, we established that SNX27 binds to LRFN2 and regulates its [email protected] endosomal sorting. Furthermore, LRFN2 associates with AMPA receptors and knockdown of (KJMM); LRFN2 results in decreased surface AMPA receptor expression, reduced synaptic activity, and [email protected] attenuated hippocampal long-term potentiation. Overall, our study provides an additional (KAW); mechanism by which SNX27 can control AMPA receptor-mediated synaptic transmission and [email protected] (PJC) plasticity indirectly through the sorting of LRFN2 and offers molecular insight into the perturbed †These authors contributed function of SNX27 and LRFN2 in a range of neurological conditions.