DOCSLIB.ORG

Microarray Analysis of Bleomycin-Exposed Lymphoblastoid Cells for Identifying Cancer Susceptibility Genes

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Microarray Analysis of Bleomycin-Exposed Lymphoblastoid Cells for Identifying Cancer Susceptibility Genes Microarray Analysis of Bleomycin-Exposed Lymphoblastoid Cells for Identifying Cancer Susceptibility Genes Jacqueline Cloos,1,2 Wim P.H. de Boer,3 Mireille H.J. Snel,1 Paul van den IJssel,4 Bauke Ylstra,4 C. Rene´Leemans,1 Ruud H. Brakenhoff,1 and Boudewijn J.M. Braakhuis1 1Section Tumor Biology, Department of Otolaryngology/Head-Neck Surgery, 2Department of Pediatric Oncology/Hematology, 3Department of Medical Oncology, and 4Microarray Core Facility, VU University Medical Center, Amsterdam, the Netherlands Abstract Introduction The uncovering of genes involved in susceptibility to The development of head and neck squamous cell carcinoma the sporadic cancer types is a great challenge. It is well (HNSCC) is strongly associated with excessive tobacco established that the way in which an individual deals smoking and alcohol intake (1). During the last decade, much with DNA damage is related to the chance to develop emphasis has been laid on the genetic factors that act in concert cancer. Mutagen sensitivity is a phenotype that reflects with environmental features to determine an individual’s risk an individual’s susceptibility to the major sporadic for developing HNSCC. These so-called molecular epidemiol- cancer types, including colon, lung, and head and ogy studies are based on the knowledge that there is a variation neck cancer. A standard test for mutagen sensitivity in the population with respect to the capability of cells to is measuring the number of chromatid breaks in deal with DNA damage. This variation has been addressed by lymphocytes after exposure to bleomycin. The aim of analyzing polymorphisms in genes involved in DNA damage the present study was to search for the pathways processing or detoxification pathways (2). In addition, involved in mutagen sensitivity. Lymphoblastoid cell functional tests have been developed that measure how cells lines of seven individuals with low mutagen sensitivity respond to induced DNA damage. Of these latter tests, the were compared with seven individuals with a ‘‘mutagen sensitivity test’’ (3) has particularly often been used. high score. RNA was isolated from cells exposed to Mutagen sensitivity is determined in peripheral blood lympho- bleomycin (4 hours) and from unexposed cells. cytes as the mean number of chromatid breaks per cell (b/c) Microarray analysis (19K) was used to compare gene at metaphase induced by bleomycin exposure in the late S-G2 expression of insensitive and sensitive cells. The phase of the cell cycle. A high mutagen-sensitive phenotype profile of most altered genes after bleomycin exposure, (having more than a mean of 1.0 b/c) was found at higher analyzed in all 14 cell lines, included relatively many frequency in patients not only with HNSCC but also with lung genes involved in biological processes, such as cell and colon cancer compared with the control population without growth and/or maintenance, proliferation, and regulation cancer (4-9). Mutagen sensitivity is not influenced by gender, of cell cycle, as well as some genes involved in DNA tumor stage, or smoking and alcohol intake of the subjects and repair. When comparing the insensitive and sensitive only slightly increases with age (4, 10, 11); it is considered to individuals, other differentially expressed genes were be an intrinsic factor, reflecting how an individual copes with found that are involved in signal transduction and DNA damage (12). In combination with carcinogenic exposure cell growth and/or maintenance (e.g., BUB1 and DUSP4). (smoking and alcohol intake), a mutagen hypersensitivity This difference in expression profiles between phenotype is associated with a greatly increased risk of mutagen-sensitive and mutagen-insensitive individuals developing HNSCC (13). Moreover, it was shown in a justifies further studies aimed at elucidating the genes prospective patient study that mutagen hypersensitivity is responsible for the development of sporadic cancers. related to the development of second primary tumors (5). The (Mol Cancer Res 2006;4(2):71–7) findings of all mutagen sensitivity studies support the notion that a common genetic susceptibility to DNA damage, and thereby a susceptibility to cancer, exists in the general Received 10/6/05; revised 12/21/05; accepted 12/21/05. population (9). In a twin study, we showed that mutagen The costs of publication of this article were defrayed in part by the payment of sensitivity has a high heritability estimate, indicating a clear page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. genetic basis (12). It is interesting to note that, in line with our Note: Supplementary data for this article are available at Molecular Cancer finding, a Mendelian inheritance pattern of radiation-induced Research Online (http://mcr.aacrjournals.org/). Requests for reprints: Boudewijn J.M. Braakhuis, Section Tumor Biology, b/c score was found when investigating cancer-prone families Department of Otolaryngology/Head-Neck Surgery, VU University Medical (14), again indicative for a clear genetic basis of mutagen Center, P.O. Box 7057, 1007 MB Amsterdam, the Netherlands. Phone: 31-20- sensitivity. In that study, it was calculated that mutagen 444-0905; Fax: 31-20-444-3688. E-mail: [email protected] Copyright D 2006 American Association for Cancer Research. sensitivity may be explained by one or at the most two genes. doi:10.1158/1541-7786.MCR-05-0196 The question arose whether bleomycin-induced chromatid Mol Cancer Res 2006;4(2). February 2006 71 Downloaded from mcr.aacrjournals.org on September 30, 2021. © 2006 American Association for Cancer Research. 72 Cloos et al. break sensitivity is linked with cancer predisposition in the cell proliferation, and regulation of cell cycle were the most same way as radiation-induced sensitivity. Although bleomycin prominently altered processes (P < 0.001 in all cases, Fisher’s is called a ‘‘radiomimetic’’ agent, it differs from radiation in the exact test) with 96, 41, and 20 of the 206 genes involved, way the damage is induced (15). Despite the differences, a good respectively. Two genes involved in DNA repair, POLH and correlation was found when bleomycin- and radiation-induced XPC, were found to have a significantly increased expression b/c values were compared in the mutagen sensitivity test of the as a result of the exposure to bleomycin. same cells (16), suggesting that a kind of similar mechanism is underlying these damage-sensitive phenotypes. Mutagen Sensitivity-Related Genes The aim of the current study was to reveal what pathway(s) is Two groups of seven lymphoblastoid cell lines were selected, involved in the mutagen-sensitive phenotype to facilitate the one group with a relatively high level of bleomycin-induced understanding of susceptibility to several of the most common chromatid breaks and one with a low level of such breaks. cancer types. There is some indication that cell cycle regulation Table 2 shows that the insensitive cell lines had an average is aberrant in mutagen-sensitive individuals (17). However, mutagen sensitivity score of 0.6 b/c, whereas this score for the specific information concerning which pathway and which sensitive group reached the value of 1.04 b/c (significantly molecules are involved is lacking. In the current study, we have higher; P = 0.00145, Student’s t test). The microarray used an integrative genomic approach to screen for possible expression analysis was done on samples that were untreated pathways by comparing gene expression of cells from individ- and on those exposed to bleomycin for 4 hours, and for each uals with a high and a low mutagen sensitivity by mRNA gene, the expression ratios were compared. For 101 genes with a expression microarray analysis. There is evidence that mutagen known function, a statistically significant different expression sensitivity has a genetic basis determined by one or at the most ratio was determined (P < 0.02): 46 genes with higher and two genes and that it is functionally related to cell cycle control. 55 genes with lower expression in the sensitive group Therefore, we hypothesized that mutagen sensitivity would be (Supplementary Information 2). The 4- over 0-hour Z ratios reflected in a specific pattern of mRNA expression that may give are shown in Supplementary Information 3. Cluster analysis of the opportunity to reveal the responsible pathways. Another these ratios (Fig. 1) showed that (a) the sensitive group is clearly intention of our study was to examine global bleomycin-induced separated from the insensitive group and (b) each cell line has its expression profile changes that should be comparable with unique pattern of expression across the genes. The genes that already published profiles of genes that are differentially most significantly differed between insensitive and sensitive expressed after exposure to radiation. groups, with a P < 0.01, are shown in Table 3: 13 genes with higher and 24 genes with lower expression in the sensitive group. Based on the analysis with Expression Analysis Results Systematic Explorer, some specific cellular processes (catego- Expression Arraying rized according to the Gene Ontology database) were found to By using spotted oligonucleotide arrays, we hybridized 28 be more represented in this group of 101 genes compared with samples (14 untreated and 14 after 4-hour bleomycin exposure) the total human genome. Genes involved in signal transduction against our common reference sample and found expression in and cell growth and/or maintenance were most prominent 80% of the 19K genes. The 4-hour time point was chosen (P < 0.01, Fisher’s exact test). because preliminary results with filter arrays have shown that it was optimal for showing differences in expression levels due to bleomycin exposure. Longer incubation periods were not Discussion considered, because that may result in effects not related to Our quest was to identify a pathway involved in cancer break induction, which is typically measured in the mutagen susceptibility.
Load more

Recommended publications
  • The Human Y Chromosome's Azoospermia Factor B (Azfb) Region
    18 ORIGINAL ARTICLE J Med Genet: first published as 10.1136/jmg.40.1.18 on 1 January 2003. Downloaded from The human Y chromosome’s azoospermia factor b (AZFb) region: sequence, structure, and deletion analysis in infertile men A Ferlin, E Moro, A Rossi, B Dallapiccola, C Foresta ............................................................................................................................. J Med Genet 2003;40:18–24 See end of article for authors’ affiliations Microdeletions of the Y chromosome long arm are the most common mutations in infertile males, where ....................... they involve one or more “azoospermia factors” (AZFa, b, and c). Understanding of the AZF structure and gene content and mapping of the deletion breakpoints in infertile men are still incomplete. We Correspondence to: Professor C Foresta, have assembled a complete 4.3 Mb map of AZFb and surrounding regions by means of 38 BAC University of Padova, clones. The proximal part of AZFb consists of large repeated sequences organised in palindromes, but Department of Medical and most of it is single copy sequence. A number of known and novel genes and gene families map in this Surgical Sciences, Clinica interval, and most of them are testis specific or have testis specific transcripts. STS mapping allowed us Medica 3, Via Ospedale to identify four severely infertile subjects with a deletion in AZFb with similar breakpoints, therefore 105, 35128 Padova, Italy; [email protected] suggesting a common deletion mechanism. This deletion includes at least five single copy genes and two duplicated genes, but does not remove the historical AZFb candidate gene RBMY1. These data Revised version received suggest that other genes in AZFb may have important roles in spermatogenesis.
    [Show full text]
  • The Role of Y Chromosome Deletions in Male Infertility
    European Journal of Endocrinology (2000) 142 418–430 ISSN 0804-4643 INVITED REVIEW The role of Y chromosome deletions in male infertility Kun Ma, Con Mallidis and Shalender Bhasin Division of Endocrinology, Metabolism and Molecular Medicine, Department of Internal Medicine, Charles R Drew University of Medicine and Science, 1731 East 120th Street, Los Angeles, California 90050, USA (Correspondence should be addressed to K Ma; Email: [email protected]) Abstract Male infertility affects approximately 2–7% of couples around the world. Over one in ten men who seek help at infertility clinics are diagnosed as severely oligospermic or azoospermic. Recent extensive molecular studies have revealed that deletions in the azoospermia factor region of the long arm of the Y chromosome are associated with severe spermatogenic impairment (absent or severely reduced germ cell development). Genetic research into male infertility, in the last 7 years, has resulted in the isolation of a great number of genes or gene families on the Y chromosome, some of which are believed to influence spermatogenesis. European Journal of Endocrinology 142 418–430 Introduction of Infertility, with the objective of creating a standard protocol for the investigation of infertile couples. Normal Defective spermatogenesis is the result of a multitude of semen was classified as containing a sperm concentra- causes, such as diseases, malnutrition, endocrinological 6 tion of at least 20 × 10 /ml, of which more than 40% disorders, genetic defects or environmental hazards (1). are progressively motile, more than 60% are alive, and Genetic defects, such as mutations and chromosomal over 50% show normal morphology. In addition, the abnormalities, have been estimated to account for at 6 semen should contain no more than 1 × 10 /ml of white least 30% of male infertility (2).
    [Show full text]
  • Partial Azfc Deletions and Duplications: Clinical Correlates in the Italian Population
    FLORE Repository istituzionale dell'Università degli Studi di Firenze Partial AZFc deletions and duplications: clinical correlates in the Italian population. Questa è la Versione finale referata (Post print/Accepted manuscript) della seguente pubblicazione: Original Citation: Partial AZFc deletions and duplications: clinical correlates in the Italian population / Giachini C; Laface I; Guarducci E; Balercia G; Forti G; Krausz C.. - In: HUMAN GENETICS. - ISSN 0340-6717. - STAMPA. - 124(2008), pp. 399-410. Availability: This version is available at: 2158/333113 since: 2019-11-07T18:24:55Z Terms of use: Open Access La pubblicazione è resa disponibile sotto le norme e i termini della licenza di deposito, secondo quanto stabilito dalla Policy per l'accesso aperto dell'Università degli Studi di Firenze (https://www.sba.unifi.it/upload/policy-oa-2016-1.pdf) Publisher copyright claim: (Article begins on next page) 28 September 2021 Hum Genet (2008) 124:399–410 DOI 10.1007/s00439-008-0561-1 ORIGINAL INVESTIGATION Partial AZFc deletions and duplications: clinical correlates in the Italian population Claudia Giachini · Ilaria Laface · Elena Guarducci · Giancarlo Balercia · Gianni Forti · Csilla Krausz Received: 7 August 2008 / Accepted: 9 September 2008 / Published online: 21 September 2008 © Springer-Verlag 2008 Abstract The role of partial AZFc deletions of the Y potential methodological and selection biases were care- chromosome in spermatogenic impairment is currently fully avoided to detect the clinical signiWcance of partial debated. Recently, it was also reported that duplications of AZFc deletions and duplications. Our study provides strong the same region are associated with oligozoospermia in evidence that gr/gr deletion is a risk factor for impaired Han-Chinese men.
    [Show full text]
  • Nº Ref Uniprot Proteína Péptidos Identificados Por MS/MS 1 P01024
    Document downloaded from http://www.elsevier.es, day 26/09/2021. This copy is for personal use. Any transmission of this document by any media or format is strictly prohibited. Nº Ref Uniprot Proteína Péptidos identificados 1 P01024 CO3_HUMAN Complement C3 OS=Homo sapiens GN=C3 PE=1 SV=2 por 162MS/MS 2 P02751 FINC_HUMAN Fibronectin OS=Homo sapiens GN=FN1 PE=1 SV=4 131 3 P01023 A2MG_HUMAN Alpha-2-macroglobulin OS=Homo sapiens GN=A2M PE=1 SV=3 128 4 P0C0L4 CO4A_HUMAN Complement C4-A OS=Homo sapiens GN=C4A PE=1 SV=1 95 5 P04275 VWF_HUMAN von Willebrand factor OS=Homo sapiens GN=VWF PE=1 SV=4 81 6 P02675 FIBB_HUMAN Fibrinogen beta chain OS=Homo sapiens GN=FGB PE=1 SV=2 78 7 P01031 CO5_HUMAN Complement C5 OS=Homo sapiens GN=C5 PE=1 SV=4 66 8 P02768 ALBU_HUMAN Serum albumin OS=Homo sapiens GN=ALB PE=1 SV=2 66 9 P00450 CERU_HUMAN Ceruloplasmin OS=Homo sapiens GN=CP PE=1 SV=1 64 10 P02671 FIBA_HUMAN Fibrinogen alpha chain OS=Homo sapiens GN=FGA PE=1 SV=2 58 11 P08603 CFAH_HUMAN Complement factor H OS=Homo sapiens GN=CFH PE=1 SV=4 56 12 P02787 TRFE_HUMAN Serotransferrin OS=Homo sapiens GN=TF PE=1 SV=3 54 13 P00747 PLMN_HUMAN Plasminogen OS=Homo sapiens GN=PLG PE=1 SV=2 48 14 P02679 FIBG_HUMAN Fibrinogen gamma chain OS=Homo sapiens GN=FGG PE=1 SV=3 47 15 P01871 IGHM_HUMAN Ig mu chain C region OS=Homo sapiens GN=IGHM PE=1 SV=3 41 16 P04003 C4BPA_HUMAN C4b-binding protein alpha chain OS=Homo sapiens GN=C4BPA PE=1 SV=2 37 17 Q9Y6R7 FCGBP_HUMAN IgGFc-binding protein OS=Homo sapiens GN=FCGBP PE=1 SV=3 30 18 O43866 CD5L_HUMAN CD5 antigen-like OS=Homo
    [Show full text]
  • Unique Signatures of Natural Background Radiation on Human Y Chromosomes from Kerala, India
    Unique Signatures of Natural Background Radiation on Human Y Chromosomes from Kerala, India Sanjay Premi, Jyoti Srivastava, Sebastian Padinjarel Chandy, Sher Ali* Molecular Genetics Laboratory, National Institute of Immunology, Aruna Asaf Ali Marg, New Delhi, India Abstract Background: The most frequently observed major consequences of ionizing radiation are chromosomal lesions and cancers, although the entire genome may be affected. Owing to its haploid status and absence of recombination, the human Y chromosome is an ideal candidate to be assessed for possible genetic alterations induced by ionizing radiation. We studied the human Y chromosome in 390 males from the South Indian state of Kerala, where the level of natural background radiation (NBR) is ten-fold higher than the worldwide average, and that from 790 unexposed males as control. Results: We observed random microdeletions in the Azoospermia factor (AZF) a, b and c regions in .90%, and tandem duplication and copy number polymorphism (CNP) of 11 different Y-linked genes in about 80% of males exposed to NBR. The autosomal homologues of Y-linked CDY genes largely remained unaffected. Multiple polymorphic copies of the Y-linked genes showing single Y-specific signals suggested their tandem duplication. Some exposed males showed unilocus duplication of DAZ genes resulting in six copies. Notably, in the AZFa region, approximately 25% of exposed males showed deletion of the DBY gene, whereas flanking genes USP9Y and UTY remained unaffected. All these alterations were detected in blood samples but not in the germline (sperm) samples. Conclusions: Exposure to high levels of NBR correlated with several interstitial polymorphisms of the human Y chromosome.
    [Show full text]
  • Male Infertility G.R
    Guidelines on Male Infertility G.R. Dohle, A. Jungwirth, G. Colpi, A. Giwercman, T. Diemer, T.B. Hargreave © European Association of Urology 2008 TABLE OF CONTENTS PAGE 1. INTRODUCTION 6 1.1 Definition 1.2 Epidemiology and aetiology 6 1.3 Prognostic factors 6 1.4 Recommendations 7 1.5 References 7 2. INVESTIGATIONS 7 2.1 Semen analysis 7 2.1.1 Frequency of semen analysis 7 2.2 Recommendations 8 2.3 References 8 3. PRIMARY SPERMATOGENIC FAILURE 8 3.1 Definition 8 3.2 Aetiology 8 3.3 History and physical examination 8 3.4 Investigations 9 3.4.1 Semen analysis 9 3.4.2 Hormonal determinations 9 3.4.3 Testicular biopsy 9 3.5 Treatment 9 3.6 Conclusions 10 3.7 Recommendations 10 3.8 References 10 4. GENETIC DISORDERS IN INFERTILITY 14 4.1 Introduction 14 4.2 Chromosomal abnormalities 14 4.2.1 Sperm chromosomal abnormalities 14 4.2.2 Sex chromosome abnormalities (Klinefelter’s syndrome and variants [mosaicism] 14 4.2.3 Autosomal abnormalities 14 4.2.4 Translocations 15 4.3 Genetic defects 15 4.3.1 X-linked genetic disorders and male fertility 15 4.3.2 Kallmann’s syndrome 15 4.3.3 Androgen insensitivity: Reifenstein’s syndrome 15 4.3.4 Other X-disorders 15 4.3.5 X-linked disorders not associated with male infertility 15 4.4. Y genes and male infertility 15 4.4.1 Introduction 15 4.4.2 Clinical implications of Y microdeletions 16 4.4.2.1 Testing for Y microdeletions 16 4.4.2.2 Recommendations 16 4.4.3 Autosomal defects with severe phenotypic abnormalities as well as infertility 16 4.5 Cystic fibrosis mutations and male infertility 17 4.6 Unilateral or bilateral absence/abnormality of the vas and renal anomalies 17 4.7 Other single gene disorders 18 4.8 Unknown genetic disorders 18 4.9 Genetic and DNA abnormalities in sperm 18 4.10 Genetic counselling and ICSI 18 4.11 Conclusions 19 4.12 Recommendations 19 4.13 References 19 2 UPDATE MARCH 2007 5.
    [Show full text]
  • 2Fbm Lichtarge Lab 2006
    Pages 1–8 2fbm Evolutionary trace report by report maker September 19, 2008 4.3.1 Alistat 7 4.3.2 CE 7 4.3.3 DSSP 7 4.3.4 HSSP 7 4.3.5 LaTex 7 4.3.6 Muscle 7 4.3.7 Pymol 7 4.4 Note about ET Viewer 7 4.5 Citing this work 7 4.6 About report maker 8 4.7 Attachments 8 1 INTRODUCTION From the original Protein Data Bank entry (PDB id 2fbm): Title: Acetyltransferase domain of cdy1 Compound: Mol id: 1; molecule: y chromosome chromodomain protein 1, telomeric isoform b; chain: a, b, c; engineered: yes Organism, scientific name: Homo Sapiens; 2fbm contains a single unique chain 2fbmA (251 residues long) and its homologues 2fbmC and 2fbmB. CONTENTS 2 CHAIN 2FBMA 1 Introduction 1 2.1 Q9Y6F8 overview 2 Chain 2fbmA 1 From SwissProt, id Q9Y6F8, 100% identical to 2fbmA: Description: 2.1 Q9Y6F8 overview 1 Testis-specific chromodomain protein Y 1. Organism, scientific name: 2.2 Multiple sequence alignment for 2fbmA 1 Homo sapiens (Human). Taxonomy: 2.3 Residue ranking in 2fbmA 1 Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; 2.4 Top ranking residues in 2fbmA and their position on Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; the structure 2 Catarrhini; Hominidae; Homo. Subcellular location: 2.4.1 Clustering of residues at 25% coverage. 2 Nuclear (By similarity). Alternative products: 2.4.2 Overlap with known functional surfaces at 25% coverage. 2 Event=Alternative splicing; Named isoforms=2; Name=1; 2.4.3 Possible novel functional surfaces at 25% IsoId=Q9Y6F8-1; Sequence=Displayed; Name=2; IsoId=Q9Y6F8- coverage.
    [Show full text]
  • Obstructive Azoospermia
    Int J Reprod BioMed Vol. 14. No. 6. pp: 383-388, June 2016 Original article Expression level of chromodomain Y (CDY): potential marker for prediction of sperm recovery in non- obstructive azoospermia Neda Heydarian1, 2 M.Sc., Raha Favaedi2 M.Sc., Mohammad Ali Sadighi Gilani3, 4 M.D., Maryam Shahhoseini2 Ph.D. 1. Department of Biology, Faculty Abstract of Science, Science and Research Branch, Islamic Azad Background: The availability of testis specific genes will be of help in choosing the University, Tehran, Iran. most promising biomarkers for the detection of testicular sperm retrieval in patients 2. Department of Genetics, with non-obstructive azoospermia (NOA). Testis specific chromodomain protein Y Reproductive Biomedicine 1 CDY1) is a histone acetyltransferase which concentrates in the round spermatid Research Center, Royan Institute ( for Reproductive Biomedicine, nucleus, where histone hyperacetylation occurs and causes the replacement of ACECR, Tehran, Iran. histones by the sperm-specific DNA packaging proteins, TNPs and PRMs. 3. Department of Andrology, Objective: The aim was to evaluate CDY1 gene as a marker for predicting of Reproductive Biomedicine successful sperm retrieval in NOA patients. Research Center, Royan Institute for Reproductive Biomedicine, Materials and Methods: This research was conducted on 29 patients with NOA ACECR, Tehran, Iran. who had undergone testicular sperm extraction (TESE) procedure. NOA patients 4. Department of Urology, Shariati were subdivided into patients with successful sperm retrieval (NOA+, n=12) and Hospital, Tehran University of patients with unsuccessful sperm retrieval (NOA-, n=17). Relative expression of Medical Sciences, Tehran, Iran. CDY1 gene and chromatin incorporation of CDY1 protein were measured by quantitative real-time polymerase chain reaction (qRT-PCR) and ELISA assay, respectively.
    [Show full text]
  • Positive Carfilzomibresistant Myeloma Subpopulation by the Pluripotent
    Research Article Identification of an ABCB1 (P-glycoprotein)-positive carfilzomib-resistant myeloma subpopulation by the pluripotent stem cell fluorescent dye CDy1 Teresa S. Hawley,1 Irene Riz,2 Wenjing Yang,3 Yoshiyuki Wakabayashi,4 Louis DePalma,2,5 Young-Tae Chang,6,7 Weiqun Peng,2,3 Jun Zhu,4 and Robert G. Hawley2,8* Multiple myeloma (MM) is characterized by the malignant expansion of differentiated plasma cells. Although many chemotherapeutic agents display cytotoxic activity toward MM cells, patients inevitably succumb to their disease because the tumor cells become resistant to the anticancer drugs. The cancer stem cell hypothesis postulates that a small subpopulation of chemotherapy-resistant cancer cells is responsible for propagation of the tumor. Herein we report that efflux of the pluripotent stem cell dye CDy1 identifies a subpopulation in MM cell lines characterized by increased expression of P-glycoprotein, a member of the ABC (ATP-binding cas- sette) superfamily of transporters encoded by ABCB1. We also demonstrate that ABCB1-overexpressing MM cells are resistant to the second-generation proteasome inhibitor carfilzomib that recently received accelerated approval for the treatment of therapy-refractive MM by the U.S. Food and Drug Administration. Moreover, increased resistance to carfilzomib in sensitive MM cells following drug selection was associated with upregu- lation of ABCB1 cell-surface expression which correlated with increased transporter activity as measured by CDy1 efflux. We further show that chemosensitization of MM cells to carfilzomib could be achieved in vitro by cotreatment with vismodegib, a hedgehog pathway antagonist which is currently in MM clinical trials. CDy1 efflux may therefore be a useful assay to determine whether high expression of ABCB1 is predictive of poor clinical responses in MM patients treated with carfilzomib.
    [Show full text]
  • A Cellular Chemical Probe Targeting the Chromodomains of Polycomb
    ARTICLE PUbliShED oNliNE: 25 JANUARy 2016 | Doi: 10.1038/NchEmbio.2007 A cellular chemical probe targeting the chromodomains of Polycomb repressive complex 1 Jacob I Stuckey1, Bradley M Dickson1, Nancy Cheng1, Yanli Liu2, Jacqueline L Norris1, Stephanie H Cholensky1, Wolfram Tempel2, Su Qin2, Katherine G Huber1, Cari Sagum3, Karynne Black3, Fengling Li2, Xi-Ping Huang4,5, Bryan L Roth4,5, Brandi M Baughman1, Guillermo Senisterra2, Samantha G Pattenden1, Masoud Vedadi2, Peter J Brown2, Mark T Bedford3, Jinrong Min2, Cheryl H Arrowsmith2, Lindsey I James1,* & Stephen V Frye1,* We report the design and characterization of UNC3866, a potent antagonist of the methyllysine (Kme) reading function of the Polycomb CBX and CDY families of chromodomains. Polycomb CBX proteins regulate gene expression by targeting Polycomb repressive complex 1 (PRC1) to sites of H3K27me3 via their chromodomains. UNC3866 binds the chromodomains of CBX4 and CBX7 most potently, with a Kd of ~100 nM for each, and is 6- to 18-fold selective as compared to seven other CBX and CDY chromodo- mains while being highly selective over >250 other protein targets. X-ray crystallography revealed that UNC3866’s interactions with the CBX chromodomains closely mimic those of the methylated H3 tail. UNC4195, a biotinylated derivative of UNC3866, was used to demonstrate that UNC3866 engages intact PRC1 and that EED incorporation into PRC1 is isoform dependent in PC3 prostate cancer cells. Finally, UNC3866 inhibits PC3 cell proliferation, consistent with the known ability of CBX7 overexpression to confer a growth advantage, whereas UNC4219, a methylated negative control compound, has negligible effects. ethylation of lysine residues on histones critically contrib- the complexity of PRC1, it was recently reported that EED, the utes to chromatin regulation1,2.
    [Show full text]
  • Copy Number Variation in the Human Y Chromosome in the UK Population
    Hum Genet DOI 10.1007/s00439-015-1562-5 ORIGINAL INVESTIGATION Copy number variation in the human Y chromosome in the UK population Wei Wei1 · Tomas Fitzgerald1 · Qasim Ayub1 · Andrea Massaia1 · Blair B. Smith2 · Anna A. Dominiczak3 · Andrew A. Morris4 · David D. Porteous5 · Matthew E. Hurles1 · Chris Tyler-Smith1 · Yali Xue1 Received: 15 February 2015 / Accepted: 28 April 2015 © The Author(s) 2015. This article is published with open access at Springerlink.com Abstract We have assessed copy number variation that probably has no phenotypic effect, partial deletions of (CNV) in the male-specific part of the human Y chromo- the TSPY cluster and AZFc region that may influence sper- some discovered by array comparative genomic hybridi- matogenesis, and other variants with unknown functional zation (array-CGH) in 411 apparently healthy UK males, implications, including abundant variation in the number and validated the findings using SNP genotype intensity of RBMY genes and/or pseudogenes, and a novel complex data available for 149 of them. After manual curation tak- duplication of two segments overlapping the AZFa region ing account of the complex duplicated structure of Y-chro- and including the 3′ end of the UTY gene. mosomal sequences, we discovered 22 curated CNV events considered validated or likely, mean 0.93 (range 0–4) per individual. 16 of these were novel. Curated CNV events Introduction ranged in size from <1 kb to >3 Mb, and in frequency from 1/411 to 107/411. Of the 24 protein-coding genes or gene Copy number variation (CNV) in the human genome con- families tested, nine showed CNV.
    [Show full text]
  • Download Validation Data
    PrimePCR™Assay Validation Report Gene Information Gene Name chromodomain protein, Y-linked, 1 Gene Symbol CDY1 Organism Human Gene Summary This gene encodes a protein containing a chromodomain and a histone acetyltransferase catalytic domain. Chromodomain proteins are components of heterochromatin-like complexes and can act as gene repressors. This protein is localized to the nucleus of late spermatids where histone hyperacetylation takes place. Histone hyperacetylation is thought to facilitate the transition in which protamines replace histones as the major DNA-packaging protein. The human chromosome Y has two identical copies of this gene within a palindromic region; this record represents the more telomeric copy. Chromosome Y also contains a pair of closely related genes in another more telomeric palindrome as well as several related pseudogenes. Two protein isoforms are encoded by transcript variants of this gene. Additional transcript variants have been described but their full-length nature has not been determined. Gene Aliases CDY, CDY1A, FLJ77185 RefSeq Accession No. NC_000024.9, NG_004755.2, NG_011754.1, NT_011903.12 UniGene ID Hs.159281 Ensembl Gene ID ENSG00000172288 Entrez Gene ID 9085 Assay Information Unique Assay ID qHsaCEP0039873 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENST00000382867, ENST00000544303, ENST00000426790, ENST00000250838, ENST00000306882, ENST00000382407, ENST00000306609, ENST00000361963 Amplicon Context Sequence TGGTGCAGAACAGACTGGAATACAGAACAAGACTCAGATACACCCACTAATGTC
    [Show full text]