DOCSLIB.ORG

Deciphering the Genetic Basis of Spanish Familial Testicular Cancer

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Deciphering the Genetic Basis of Spanish Familial Testicular Cancer Departamento de Bioquímica Deciphering the genetic basis of Spanish familial testicular cancer Tesis doctoral Beatriz Paumard Hernández Madrid, 2017 Departamento de Bioquímica Facultad de Medicina Universidad Autónoma de Madrid Deciphering the genetic basis of Spanish familial testicular cancer Tesis doctoral presentada por: Beatriz Paumard Hernández Licenciada en Biología por la Universidad Autónoma de Madrid (UAM) Director de la Tesis: Dr. Javier Benítez Director del Programa de Genética del Cáncer Humano (CNIO) Jefe del Grupo de Genética Humana (CNIO) Grupo de Genética Humana Programa de Genética del Cáncer Humano Centro Nacional de Investigaciones Oncológicas (CNIO) Dr. Javier Benítez Ortiz, Director del grupo de Genética del Cáncer Humano del Centro Nacional de Investigaciones Oncológicas (CNIO) CERTIFICA: Que Doña Beatriz Paumard Hernández, Licenciada en Biología por la Universidad Autónoma de Madrid, ha realizado la presente Tesis Doctoral “Deciphering the genec basis of Spanish familial testicular cáncer” y que a su juicio reúne plenamente todos los requisitos necesarios para optar al Grado de Doctor en Bioquímica, Biología Molecular, Biomedicina y Biotecnología, a cuyos efectos será presentada en la Universidad Autónoma de Madrid. El trabajo ha sido realizado bajo mi dirección, autorizando su presentación ante el Tribunal calificador. Y para que así conste, se extiende el presente certificado, Madrid, Junio 2017 Fdo: Director de la Tesis Fdo: Tutor de la Tesis VoBo del Director Dr.Javier Benítez Ortiz La presente Tesis Doctoral se realizó en el Grupo de Genética Humana en el Centro Nacional de Investigaciones Oncológicas (CNIO) de Madrid durante los años 2013 y 2017 bajo la supervisión del Dr. Javier Benítez Las siguientes becas, ayudas y proyectos han permitido la realización de esta Tesis Doctoral: “La Caixa”- Severo Ochoa International Phd Programmme at CNIO Proyecto FIS PI12/0070 BRIDGES Project (H2020) Summary / Resumen SUMMARY Testicular cancer is a frequently occurring disease among adult males, and it accounts for 1-2% of all male tumors. It can be classified into different types of cancer: germ cell tumors (GCT), which represent 98% of all cases, and tumors involving the gonadal stromal tumors and secondary tumors of the testes. The incidence of Testicular Germ Cell Tumors (TGCTs) has been increasing for the past decades, although the etiology of the disease and the reasons of its increased incidence remain unknown. Environmental factors, in particular exposure to endocrine disruptors during embryogenesis and perinatal life are suspected culprits. It is likely that genetic factors also play an important role in TGCT formation, as the estimated heritability, 48.9%, is the third highest among all cancers, and the Familial Testicular Germ Cell Tumor (FTGCT) risk is 2-fold higher than what is typical for more common cancers such as breast, colorectal and prostate cancer. Several candidate gene approaches failed to identify high susceptibility genes. In fact, in the last years scientists have come to believe that a polygenic model fits better with the genetic landscape of the disease, although the idea of polygenic susceptibility does not fit in with a history of familial aggregations in a disease. Due to the absence of information about the genetic basis of this disease, our objective was to identify high/moderate or low susceptibility genes using whole exome sequencing (WES) and case-control studies considering both monogenic and polygenic models of inheritance. These studies will help to increase our knowledge about the genetic basis of the disease and may have a significant impact on its prevention, early diagnosis and a possible treatment. The hypothesis of the monogenic model was tested using a pipeline previously described by our group, while the polygenic model was studied by performing family-based association tests in which we evaluated the level of additive and cumulative effects our variants could have in the familial aggregation of the disease. DNA of a group of 19 families (71 individuals) was sequenced with an Illumina HiSeq 2000 sequencer. Based on the analysis assuming both patterns of inheritance, a total of 120 candidate variants were evaluated in the case-control study performed in 391 sporadic cases and 382 healthy Spanish controls. In order to increase the size sample, we used data from the public database of the Spanish Center for Biomedical Research on Rare Diseases (CIBERER), which contains WES data of 788 unaffected individuals, and to perform statistical analysis. In this discovery analysis, 27 variants gave significant results and two of them (located in the VNN1 and SLC22A16 genes, which are both involved in spermatogenesis) were later on replicated in a large series studied in the English population. Moreover, the variant of the SLC22A16 gene appears to be specifically associated with the development of Seminoma germ cell tumors. In summary, our results present two new susceptibility risk genes whose variants are potential candidates for being associated with the development of familial testicular cancer. RESUMEN El cáncer de testículo es una enfermedad frecuente en hombres adultos, representa en torno al 1-2% de todos los tumores masculinos. Existen diferentes tipos de cáncer testicular: los tumores germinales que representan el 98% de todos los casos, los tumores estromales y secundarios. La incidencia de tumores germinales de testículo se ha incrementado en las últimas décadas, aunque su etiología y causas son desconocidas. Los factores ambientales, y en particular la exposición a factores endocrinos durante el proceso de embriogénesis en la etapa perinatal, son los más señalados como responsables. Además, es probable que los factores genéticos, desempeñen también un papel importante en la formación de este tipo de tumores, ya que la herencia estimada es del 48.9%, la tercera más alta de todos los canceres, y el riesgo de los casos familiares, es 2 veces superior al de los canceres más comunes, como mama, colon o próstata. Varios estudios de aproximación a genes candidatos han fracasado en la identificación de genes de alta susceptibilidad. De hecho, durante los últimos años se ha fomentado la idea de que un modelo poligénico sería el que mejor se ajustaría para explicar el entorno genético de la enfermedad, aunque este modelo en principio no contempla una posible agregación familiar. La carencia de información acerca de las bases genéticas de esta enfermedad, es la razón por la que nos planteamos el estudio para la identificación de genes de alta, moderada y baja susceptibilidad mediante la técnica de secuenciación masiva de exoma y estudios de asociación de caso control, para ambos modelos de herencia monogénico y poligénico. Estos estudios nos ayudaran a mejorar nuestro conocimiento acerca de las bases genéticas de la enfermedad, así como para la prevención, diagnóstico temprano y posible tratamiento de los pacientes. La hipótesis del modelo monogénico fue analizada mediante un sistema de filtrado descrito previamente por nuestro grupo, mientras que, para el estudio del modelo poligénico, se utilizaron estudios de asociación basados en patrones familiares, en los que evaluamos el efecto aditivo y acumulativo que nuestras variantes podían tener sobre la agregación familiar. Un grupo de 19 familias (71 individuos) fue secuenciado con el HiSeq2000. Del análisis de ambos patrones de herencia se obtuvieron un total de 120 variantes candidatas que se estudiaron en el ensayo de caso control realizado en 391 casos esporádicos y 382 controles sanos españoles. Con el fin de incrementar nuestro tamaño muestral, decidimos utilizar la información de la base de datos pública española del Centro de Investigación Biomédica en Red Enfermedades raras (CIBERER,) que contiene datos de secuenciación de exoma de 788 individuos, y llevar acabo los análisis estadísticos. De este primer estudio, 27 variantes resultaron significativas, pero de estas, solo de dos se replicaron los resultados en población inglesa. Las dos variantes, se encuentran en los genes VNN1 y SLC22A16, ambos implicados en el proceso de espermatogénesis, y una de ellas asociada específicamente al diagnóstico clínico de tumor germinal seminomatoso. En conclusión, nuestro estudio demuestra que existen dos nuevos genes de susceptibilidad cuyas variantes son posibles candidatas de conferir riesgo al desarrollo del cáncer familiar testicular Table of contents ABBREVIATIONS……………………………………………………………………………...21 INTRODUCTION…………………………………………………………………………….....31 1. DEVELOPMENT OF THE TESTES………………………………………………………….33 1.1 Gonadal development.…………………………………………...…………………...33 1.2 Genetic differentiation program…………………………...………………………....34 1.3 Differentiation during testis organogenesis…………………………………………..36 1.4 Function…………………………………..………………………………….……….38 1.4.1 Reproductive system……………………………………………………….38 1.4.2 Endocrine system…………………………………………………………..39 2. TESTICULAR CANCER……………………………………………………………………...40 2.1 Testicular germ cells tumors (TGCT)..…………………………………………........40 2.2 Types of TGCT……………………………………………………………………….42 2.3 Epidemiology…………………………………………………………………………42 2.4 Risk factors…………………………………………………………………………...44 3. GENETIC LANDSCAPE……………………………………………………………………...46 3.1 Family and Twin Studies ……………………………………………………………46 3.2 Approaches to find out the genetic predisposition to TGCT ………………………..47 3.3 Mutational spectrum…………………………………………………………………48 OBJECTIVES………………………………………………………………………………...….53 MATERIALS AND METHODS………………………………………………………………..57 1. PATIENTS
Load more

Recommended publications
  • DNA Methylation of GHSR, GNG4, HOXD9 and SALL3 Is a Common Epigenetic Alteration in Thymic Carcinoma
    INTERNATIONAL JOURNAL OF ONCOLOGY 56: 315-326, 2020 DNA methylation of GHSR, GNG4, HOXD9 and SALL3 is a common epigenetic alteration in thymic carcinoma REINA KISHIBUCHI1, KAZUYA KONDO1, SHIHO SOEJIMA1, MITSUHIRO TSUBOI2, KOICHIRO KAJIURA2, YUKIKIYO KAWAKAMI2, NAOYA KAWAKITA2, TORU SAWADA2, HIROAKI TOBA2, MITSUTERU YOSHIDA2, HIROMITSU TAKIZAWA2 and AKIRA TANGOKU2 1Department of Oncological Medical Services, Graduate School of Biomedical Sciences, Tokushima University, Tokushima 770-8509; 2Department of Thoracic, Endocrine Surgery and Oncology, Graduate School of Biomedical Sciences, Tokushima University, Tokushima 770-8503, Japan Received August 17, 2019; Accepted October 25, 2019 DOI: 10.3892/ijo.2019.4915 Abstract. Thymic epithelial tumors comprise thymoma, promoter methylation of the 4 genes was not significantly thymic carcinoma and neuroendocrine tumors of the thymus. higher in advanced-stage tumors than in early-stage tumors in Recent studies have revealed that the incidence of somatic all thymic epithelial tumors. Among the 4 genes, relapse-free non‑synonymous mutations is significantly higher in thymic survival was significantly worse in tumors with a higher DNA carcinoma than in thymoma. However, limited information methylation than in those with a lower DNA methylation in all is currently available on epigenetic alterations in these types thymic epithelial tumors. Moreover, relapse-free survival was of cancer. In this study, we thus performed genome-wide significantly worse in thymomas with a higher DNA methyla- screening of aberrantly methylated CpG islands in thymoma tion of HOXD9 and SALL3 than in those with a lower DNA and thymic carcinoma using Illumina HumanMethylation450 methylation. On the whole, the findings of this study indicated K BeadChip. We identified 92 CpG islands significantly that the promoter methylation of cancer-related genes was hypermethylated in thymic carcinoma in relation to thymoma significantly higher in thymic carcinoma than in thymoma and and selected G protein subunit gamma 4 (GNG4), growth the thymus.
    [Show full text]
  • Prenatal Diagnosis of Sex Chromosome Mosaicism with Two Marker Chromosomes in Three Cell Lines and a Review of the Literature
    MOLECULAR MEDICINE REPORTS 19: 1791-1796, 2019 Prenatal diagnosis of sex chromosome mosaicism with two marker chromosomes in three cell lines and a review of the literature JIANLI ZHENG1, XIAOYU YANG2, HAIYAN LU1, YONGJUAN GUAN1, FANGFANG YANG1, MENGJUN XU1, MIN LI1, XIUQING JI3, YAN WANG3, PING HU3 and YUN ZHOU1 1Department of Prenatal Diagnosis, Laboratory of Clinical Genetics, Maternity and Child Health Care Hospital, Yancheng, Jiangsu 224001; 2Department of Clinical Reproductive Medicine, State Key Laboratory of Reproductive Medicine, The First Affiliated Hospital of Nanjing Medical University, Nanjing, Jiangsu 210029; 3Department of Prenatal Diagnosis, State Key Laboratory of Reproductive Medicine, Obstetrics and Gynecology Hospital Affiliated to Nanjing Medical University, Nanjing, Jiangsu 210004, P.R. China Received March 31, 2018; Accepted November 21, 2018 DOI: 10.3892/mmr.2018.9798 Abstract. The present study described the diagnosis of a fetus identifying the karyotype, identifying the origin of the marker with sex chromosome mosaicism in three cell lines and two chromosome and preparing effective genetic counseling. marker chromosomes. A 24-year-old woman underwent amniocentesis at 21 weeks and 4 days of gestation due to Introduction noninvasive prenatal testing identifying that the fetus had sex chromosome abnormalities. Amniotic cell culture revealed a Abnormalities involving sex chromosomes account for karyotype of 45,X[13]/46,X,+mar1[6]/46,X,+mar2[9], and approximately 0.5% of live births. Individuals with mosaic prenatal ultrasound was unremarkable. The woman underwent structural aberrations of the X and Y chromosomes exhibit repeat amniocentesis at 23 weeks and 4 days of gestation for complicated and variable phenotypes. The phenotypes of molecular detection.
    [Show full text]
  • Computational Genome-Wide Identification of Heat Shock Protein Genes in the Bovine Genome [Version 1; Peer Review: 2 Approved, 1 Approved with Reservations]
    F1000Research 2018, 7:1504 Last updated: 08 AUG 2021 RESEARCH ARTICLE Computational genome-wide identification of heat shock protein genes in the bovine genome [version 1; peer review: 2 approved, 1 approved with reservations] Oyeyemi O. Ajayi1,2, Sunday O. Peters3, Marcos De Donato2,4, Sunday O. Sowande5, Fidalis D.N. Mujibi6, Olanrewaju B. Morenikeji2,7, Bolaji N. Thomas 8, Matthew A. Adeleke 9, Ikhide G. Imumorin2,10,11 1Department of Animal Breeding and Genetics, Federal University of Agriculture, Abeokuta, Nigeria 2International Programs, College of Agriculture and Life Sciences, Cornell University, Ithaca, NY, 14853, USA 3Department of Animal Science, Berry College, Mount Berry, GA, 30149, USA 4Departamento Regional de Bioingenierias, Tecnologico de Monterrey, Escuela de Ingenieria y Ciencias, Queretaro, Mexico 5Department of Animal Production and Health, Federal University of Agriculture, Abeokuta, Nigeria 6Usomi Limited, Nairobi, Kenya 7Department of Animal Production and Health, Federal University of Technology, Akure, Nigeria 8Department of Biomedical Sciences, Rochester Institute of Technology, Rochester, NY, 14623, USA 9School of Life Sciences, University of KwaZulu-Natal, Durban, 4000, South Africa 10School of Biological Sciences, Georgia Institute of Technology, Atlanta, GA, 30032, USA 11African Institute of Bioscience Research and Training, Ibadan, Nigeria v1 First published: 20 Sep 2018, 7:1504 Open Peer Review https://doi.org/10.12688/f1000research.16058.1 Latest published: 20 Sep 2018, 7:1504 https://doi.org/10.12688/f1000research.16058.1 Reviewer Status Invited Reviewers Abstract Background: Heat shock proteins (HSPs) are molecular chaperones 1 2 3 known to bind and sequester client proteins under stress. Methods: To identify and better understand some of these proteins, version 1 we carried out a computational genome-wide survey of the bovine 20 Sep 2018 report report report genome.
    [Show full text]
  • Human Germ/Stem Cell-Specific Gene TEX19 Influences Cancer Cell
    Planells-Palop et al. Molecular Cancer (2017) 16:84 DOI 10.1186/s12943-017-0653-4 RESEARCH Open Access Human germ/stem cell-specific gene TEX19 influences cancer cell proliferation and cancer prognosis Vicente Planells-Palop1, Ali Hazazi1, Julia Feichtinger2,3, Jana Jezkova1, Gerhard Thallinger2,3, Naif O. Alsiwiehri1, Mikhlid Almutairi1,5, Lee Parry4, Jane A. Wakeman1 and Ramsay J. McFarlane1* Abstract Background: Cancer/testis (CT) genes have expression normally restricted to the testis, but become activated during oncogenesis, so they have excellent potential as cancer-specific biomarkers. Evidence is starting to emerge to indicate that they also provide function(s) in the oncogenic programme. Human TEX19 is a recently identified CT gene, but a functional role for TEX19 in cancer has not yet been defined. Methods: siRNA was used to deplete TEX19 levels in various cancer cell lines. This was extended using shRNA to deplete TEX19 in vivo. Western blotting, fluorescence activated cell sorting and immunofluorescence were used to study the effect of TEX19 depletion in cancer cells and to localize TEX19 in normal testis and cancer cells/tissues. RT-qPCR and RNA sequencing were employed to determine the changes to the transcriptome of cancer cells depleted for TEX19 and Kaplan-Meier plots were generated to explore the relationship between TEX19 expression and prognosis for a range of cancer types. Results: Depletion of TEX19 levels in a range of cancer cell lines in vitro and in vivo restricts cellular proliferation/ self-renewal/reduces tumour volume, indicating TEX19 is required for cancer cell proliferative/self-renewal potential. Analysis of cells depleted for TEX19 indicates they enter a quiescent-like state and have subtle defects in S-phase progression.
    [Show full text]
  • Table S1 the Four Gene Sets Derived from Gene Expression Profiles of Escs and Differentiated Cells
    Table S1 The four gene sets derived from gene expression profiles of ESCs and differentiated cells Uniform High Uniform Low ES Up ES Down EntrezID GeneSymbol EntrezID GeneSymbol EntrezID GeneSymbol EntrezID GeneSymbol 269261 Rpl12 11354 Abpa 68239 Krt42 15132 Hbb-bh1 67891 Rpl4 11537 Cfd 26380 Esrrb 15126 Hba-x 55949 Eef1b2 11698 Ambn 73703 Dppa2 15111 Hand2 18148 Npm1 11730 Ang3 67374 Jam2 65255 Asb4 67427 Rps20 11731 Ang2 22702 Zfp42 17292 Mesp1 15481 Hspa8 11807 Apoa2 58865 Tdh 19737 Rgs5 100041686 LOC100041686 11814 Apoc3 26388 Ifi202b 225518 Prdm6 11983 Atpif1 11945 Atp4b 11614 Nr0b1 20378 Frzb 19241 Tmsb4x 12007 Azgp1 76815 Calcoco2 12767 Cxcr4 20116 Rps8 12044 Bcl2a1a 219132 D14Ertd668e 103889 Hoxb2 20103 Rps5 12047 Bcl2a1d 381411 Gm1967 17701 Msx1 14694 Gnb2l1 12049 Bcl2l10 20899 Stra8 23796 Aplnr 19941 Rpl26 12096 Bglap1 78625 1700061G19Rik 12627 Cfc1 12070 Ngfrap1 12097 Bglap2 21816 Tgm1 12622 Cer1 19989 Rpl7 12267 C3ar1 67405 Nts 21385 Tbx2 19896 Rpl10a 12279 C9 435337 EG435337 56720 Tdo2 20044 Rps14 12391 Cav3 545913 Zscan4d 16869 Lhx1 19175 Psmb6 12409 Cbr2 244448 Triml1 22253 Unc5c 22627 Ywhae 12477 Ctla4 69134 2200001I15Rik 14174 Fgf3 19951 Rpl32 12523 Cd84 66065 Hsd17b14 16542 Kdr 66152 1110020P15Rik 12524 Cd86 81879 Tcfcp2l1 15122 Hba-a1 66489 Rpl35 12640 Cga 17907 Mylpf 15414 Hoxb6 15519 Hsp90aa1 12642 Ch25h 26424 Nr5a2 210530 Leprel1 66483 Rpl36al 12655 Chi3l3 83560 Tex14 12338 Capn6 27370 Rps26 12796 Camp 17450 Morc1 20671 Sox17 66576 Uqcrh 12869 Cox8b 79455 Pdcl2 20613 Snai1 22154 Tubb5 12959 Cryba4 231821 Centa1 17897
    [Show full text]
  • Seq2pathway Vignette
    seq2pathway Vignette Bin Wang, Xinan Holly Yang, Arjun Kinstlick May 19, 2021 Contents 1 Abstract 1 2 Package Installation 2 3 runseq2pathway 2 4 Two main functions 3 4.1 seq2gene . .3 4.1.1 seq2gene flowchart . .3 4.1.2 runseq2gene inputs/parameters . .5 4.1.3 runseq2gene outputs . .8 4.2 gene2pathway . 10 4.2.1 gene2pathway flowchart . 11 4.2.2 gene2pathway test inputs/parameters . 11 4.2.3 gene2pathway test outputs . 12 5 Examples 13 5.1 ChIP-seq data analysis . 13 5.1.1 Map ChIP-seq enriched peaks to genes using runseq2gene .................... 13 5.1.2 Discover enriched GO terms using gene2pathway_test with gene scores . 15 5.1.3 Discover enriched GO terms using Fisher's Exact test without gene scores . 17 5.1.4 Add description for genes . 20 5.2 RNA-seq data analysis . 20 6 R environment session 23 1 Abstract Seq2pathway is a novel computational tool to analyze functional gene-sets (including signaling pathways) using variable next-generation sequencing data[1]. Integral to this tool are the \seq2gene" and \gene2pathway" components in series that infer a quantitative pathway-level profile for each sample. The seq2gene function assigns phenotype-associated significance of genomic regions to gene-level scores, where the significance could be p-values of SNPs or point mutations, protein-binding affinity, or transcriptional expression level. The seq2gene function has the feasibility to assign non-exon regions to a range of neighboring genes besides the nearest one, thus facilitating the study of functional non-coding elements[2]. Then the gene2pathway summarizes gene-level measurements to pathway-level scores, comparing the quantity of significance for gene members within a pathway with those outside a pathway.
    [Show full text]
  • The Human Y Chromosome's Azoospermia Factor B (Azfb) Region
    18 ORIGINAL ARTICLE J Med Genet: first published as 10.1136/jmg.40.1.18 on 1 January 2003. Downloaded from The human Y chromosome’s azoospermia factor b (AZFb) region: sequence, structure, and deletion analysis in infertile men A Ferlin, E Moro, A Rossi, B Dallapiccola, C Foresta ............................................................................................................................. J Med Genet 2003;40:18–24 See end of article for authors’ affiliations Microdeletions of the Y chromosome long arm are the most common mutations in infertile males, where ....................... they involve one or more “azoospermia factors” (AZFa, b, and c). Understanding of the AZF structure and gene content and mapping of the deletion breakpoints in infertile men are still incomplete. We Correspondence to: Professor C Foresta, have assembled a complete 4.3 Mb map of AZFb and surrounding regions by means of 38 BAC University of Padova, clones. The proximal part of AZFb consists of large repeated sequences organised in palindromes, but Department of Medical and most of it is single copy sequence. A number of known and novel genes and gene families map in this Surgical Sciences, Clinica interval, and most of them are testis specific or have testis specific transcripts. STS mapping allowed us Medica 3, Via Ospedale to identify four severely infertile subjects with a deletion in AZFb with similar breakpoints, therefore 105, 35128 Padova, Italy; [email protected] suggesting a common deletion mechanism. This deletion includes at least five single copy genes and two duplicated genes, but does not remove the historical AZFb candidate gene RBMY1. These data Revised version received suggest that other genes in AZFb may have important roles in spermatogenesis.
    [Show full text]
  • Supplementary Table 3 Complete List of RNA-Sequencing Analysis of Gene Expression Changed by ≥ Tenfold Between Xenograft and Cells Cultured in 10%O2
    Supplementary Table 3 Complete list of RNA-Sequencing analysis of gene expression changed by ≥ tenfold between xenograft and cells cultured in 10%O2 Expr Log2 Ratio Symbol Entrez Gene Name (culture/xenograft) -7.182 PGM5 phosphoglucomutase 5 -6.883 GPBAR1 G protein-coupled bile acid receptor 1 -6.683 CPVL carboxypeptidase, vitellogenic like -6.398 MTMR9LP myotubularin related protein 9-like, pseudogene -6.131 SCN7A sodium voltage-gated channel alpha subunit 7 -6.115 POPDC2 popeye domain containing 2 -6.014 LGI1 leucine rich glioma inactivated 1 -5.86 SCN1A sodium voltage-gated channel alpha subunit 1 -5.713 C6 complement C6 -5.365 ANGPTL1 angiopoietin like 1 -5.327 TNN tenascin N -5.228 DHRS2 dehydrogenase/reductase 2 leucine rich repeat and fibronectin type III domain -5.115 LRFN2 containing 2 -5.076 FOXO6 forkhead box O6 -5.035 ETNPPL ethanolamine-phosphate phospho-lyase -4.993 MYO15A myosin XVA -4.972 IGF1 insulin like growth factor 1 -4.956 DLG2 discs large MAGUK scaffold protein 2 -4.86 SCML4 sex comb on midleg like 4 (Drosophila) Src homology 2 domain containing transforming -4.816 SHD protein D -4.764 PLP1 proteolipid protein 1 -4.764 TSPAN32 tetraspanin 32 -4.713 N4BP3 NEDD4 binding protein 3 -4.705 MYOC myocilin -4.646 CLEC3B C-type lectin domain family 3 member B -4.646 C7 complement C7 -4.62 TGM2 transglutaminase 2 -4.562 COL9A1 collagen type IX alpha 1 chain -4.55 SOSTDC1 sclerostin domain containing 1 -4.55 OGN osteoglycin -4.505 DAPL1 death associated protein like 1 -4.491 C10orf105 chromosome 10 open reading frame 105 -4.491
    [Show full text]
  • Taf7l Cooperates with Trf2 to Regulate Spermiogenesis
    Taf7l cooperates with Trf2 to regulate spermiogenesis Haiying Zhoua,b, Ivan Grubisicb,c, Ke Zhengd,e, Ying Heb, P. Jeremy Wangd, Tommy Kaplanf, and Robert Tjiana,b,1 aHoward Hughes Medical Institute and bDepartment of Molecular and Cell Biology, Li Ka Shing Center for Biomedical and Health Sciences, California Institute for Regenerative Medicine Center of Excellence, University of California, Berkeley, CA 94720; cUniversity of California Berkeley–University of California San Francisco Graduate Program in Bioengineering, University of California, Berkeley, CA 94720; dDepartment of Animal Biology, University of Pennsylvania School of Veterinary Medicine, Philadelphia, PA 19104; eState Key Laboratory of Reproductive Medicine, Nanjing Medical University, Nanjing 210029, People’s Republic of China; and fSchool of Computer Science and Engineering, The Hebrew University of Jerusalem, Jerusalem 91904, Israel Contributed by Robert Tjian, September 11, 2013 (sent for review August 20, 2013) TATA-binding protein (TBP)-associated factor 7l (Taf7l; a paralogue (Taf4b; a homolog of Taf4) (9), TBP-related factor 2 (Trf2) (10, of Taf7) and TBP-related factor 2 (Trf2) are components of the core 11), and Taf7l (12, 13). For example, mice bearing mutant or promoter complex required for gene/tissue-specific transcription deficient CREM showed decreased postmeiotic gene expression of protein-coding genes by RNA polymerase II. Previous studies and defective spermiogenesis (14). Mice deficient in Taf4b, reported that Taf7l knockout (KO) mice exhibit structurally abnor- a testis-specific homolog of Taf4, are initially normal but undergo mal sperm, reduced sperm count, weakened motility, and compro- progressive germ-cell loss and become infertile by 3 mo of age −/Y mised fertility.
    [Show full text]
  • Supplementary Table 1: Adhesion Genes Data Set
    Supplementary Table 1: Adhesion genes data set PROBE Entrez Gene ID Celera Gene ID Gene_Symbol Gene_Name 160832 1 hCG201364.3 A1BG alpha-1-B glycoprotein 223658 1 hCG201364.3 A1BG alpha-1-B glycoprotein 212988 102 hCG40040.3 ADAM10 ADAM metallopeptidase domain 10 133411 4185 hCG28232.2 ADAM11 ADAM metallopeptidase domain 11 110695 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 195222 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 165344 8751 hCG20021.3 ADAM15 ADAM metallopeptidase domain 15 (metargidin) 189065 6868 null ADAM17 ADAM metallopeptidase domain 17 (tumor necrosis factor, alpha, converting enzyme) 108119 8728 hCG15398.4 ADAM19 ADAM metallopeptidase domain 19 (meltrin beta) 117763 8748 hCG20675.3 ADAM20 ADAM metallopeptidase domain 20 126448 8747 hCG1785634.2 ADAM21 ADAM metallopeptidase domain 21 208981 8747 hCG1785634.2|hCG2042897 ADAM21 ADAM metallopeptidase domain 21 180903 53616 hCG17212.4 ADAM22 ADAM metallopeptidase domain 22 177272 8745 hCG1811623.1 ADAM23 ADAM metallopeptidase domain 23 102384 10863 hCG1818505.1 ADAM28 ADAM metallopeptidase domain 28 119968 11086 hCG1786734.2 ADAM29 ADAM metallopeptidase domain 29 205542 11085 hCG1997196.1 ADAM30 ADAM metallopeptidase domain 30 148417 80332 hCG39255.4 ADAM33 ADAM metallopeptidase domain 33 140492 8756 hCG1789002.2 ADAM7 ADAM metallopeptidase domain 7 122603 101 hCG1816947.1 ADAM8 ADAM metallopeptidase domain 8 183965 8754 hCG1996391 ADAM9 ADAM metallopeptidase domain 9 (meltrin gamma) 129974 27299 hCG15447.3 ADAMDEC1 ADAM-like,
    [Show full text]
  • Izumo1 (NM 001018013) Mouse Untagged Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MC211426 Izumo1 (NM_001018013) Mouse Untagged Clone Product data: Product Type: Expression Plasmids Product Name: Izumo1 (NM_001018013) Mouse Untagged Clone Tag: Tag Free Symbol: Izumo1 Synonyms: 1700058F15Rik; Izumo Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin Fully Sequenced ORF: >MC211426 representing NM_001018013 Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGGCCGCATTTTACACTCTTGCTGGCAGCTCTTGCCAACTGCCTGTGTCCAGGGAGGCCCTGCATCA AATGTGACCAGTTTGTGACAGATGCGCTAAAGACTTTCGAAAACACTTACCTGAATGACCACCTGCCACA CGACATTCACAAAAATGTAATGAGGATGGTGAACCATGAAGTATCGAGCTTCGGCGTAGTCACTTCGGCT GAGGATTCCTATTTGGGGGCCGTGGACGAGAACACACTGGAACAAGCAACCTGGAGTTTTCTGAAGGATC TGAAGCGTATTACAGACAGTGACTTAAAAGGAGAGCTCTTTATAAAGGAACTATTGTGGATGCTTCGTCA TCAAAAGGACATCTTTAACAATCTTGCTAGACAGTTCCAAAAGGAAGTTCTTTGTCCCAACAAATGCGGA GTGATGTCGCAGACTTTGATCTGGTGTCTTAAGTGCGAAAAGCAGTTGCACATTTGTCGGAAATCCCTAG ATTGTGGAGAGCGCCACATAGAGGTACATCGCTCGGAAGACCTGGTCCTGGACTGTCTGCTCAGTTGGCA TCGTGCTTCTAAGGGACTTACAGATTACAGTTTTTACAGGGTTTGGGAGAACAGTTCTGAGACCTTGATT GCCAAGGGGAAAGAACCATATCTGACCAAGTCGATGGTGGGTCCAGAGGATGCTGGCAACTACCGCTGTG TGCTAGATACCATCAACCAAGGTCATGCCACCGTCATCCGCTACGATGTCACAGTATTGCCCCCAAAGCA TTCAGAGGAAAACCAACCACCGAACATCATAACCCAAGAGGAGCACGAGACTCCTGTCCACGTGACTCCA CAGACACCACCGGGGCAGGAGCCAGAGTCGGAGCTGTACCCGGAGCTGCACCCAGAGTTGTACCCGGAGC
    [Show full text]
  • HMGB1 in Health and Disease R
    Donald and Barbara Zucker School of Medicine Journal Articles Academic Works 2014 HMGB1 in health and disease R. Kang R. C. Chen Q. H. Zhang W. Hou S. Wu See next page for additional authors Follow this and additional works at: https://academicworks.medicine.hofstra.edu/articles Part of the Emergency Medicine Commons Recommended Citation Kang R, Chen R, Zhang Q, Hou W, Wu S, Fan X, Yan Z, Sun X, Wang H, Tang D, . HMGB1 in health and disease. 2014 Jan 01; 40():Article 533 [ p.]. Available from: https://academicworks.medicine.hofstra.edu/articles/533. Free full text article. This Article is brought to you for free and open access by Donald and Barbara Zucker School of Medicine Academic Works. It has been accepted for inclusion in Journal Articles by an authorized administrator of Donald and Barbara Zucker School of Medicine Academic Works. Authors R. Kang, R. C. Chen, Q. H. Zhang, W. Hou, S. Wu, X. G. Fan, Z. W. Yan, X. F. Sun, H. C. Wang, D. L. Tang, and +8 additional authors This article is available at Donald and Barbara Zucker School of Medicine Academic Works: https://academicworks.medicine.hofstra.edu/articles/533 NIH Public Access Author Manuscript Mol Aspects Med. Author manuscript; available in PMC 2015 December 01. NIH-PA Author ManuscriptPublished NIH-PA Author Manuscript in final edited NIH-PA Author Manuscript form as: Mol Aspects Med. 2014 December ; 0: 1–116. doi:10.1016/j.mam.2014.05.001. HMGB1 in Health and Disease Rui Kang1,*, Ruochan Chen1, Qiuhong Zhang1, Wen Hou1, Sha Wu1, Lizhi Cao2, Jin Huang3, Yan Yu2, Xue-gong Fan4, Zhengwen Yan1,5, Xiaofang Sun6, Haichao Wang7, Qingde Wang1, Allan Tsung1, Timothy R.
    [Show full text]