SLC2A4RG Antibody (C-Term) Blocking Peptide Synthetic Peptide Catalog # Bp14519b

Total Page:16

File Type:pdf, Size:1020Kb

Load more

10320 Camino Santa Fe, Suite G San Diego, CA 92121 Tel: 858.875.1900 Fax: 858.622.0609 SLC2A4RG Antibody (C-term) Blocking Peptide Synthetic peptide Catalog # BP14519b Specification SLC2A4RG Antibody (C-term) Blocking SLC2A4RG Antibody (C-term) Blocking Peptide - Peptide - Background Product Information The protein encoded by this gene is a Primary Accession Q9NR83 nucleartranscription factor involved in the activation of the solutecarrier family 2 member 4 gene. The encoded protein interacts SLC2A4RG Antibody (C-term) Blocking Peptide - Additional Information withanother transcription factor, myocyte enhancer factor 2, toactivate transcription of this gene. Gene ID 56731 SLC2A4RG Antibody (C-term) Blocking Other Names Peptide - References SLC2A4 regulator, GLUT4 enhancer factor, GEF, Huntington disease gene regulatory Jones, M.R., et al. Fertil. Steril. region-binding protein 1, HDBP-1, 90(6):2298-2303(2008)McGee, S.L., et al. SLC2A4RG, HDBP1 FASEB J. 20(2):348-349(2006)Tanaka, K., et al. Format J. Biol. Chem. 279(8):7275-7286(2004)Knight, Peptides are lyophilized in a solid powder J.B., et al. Proc. Natl. Acad. Sci. U.S.A. format. Peptides can be reconstituted in 100(25):14725-14730(2003)Deloukas, P., et al. solution using the appropriate buffer as Nature 414(6866):865-871(2001) needed. Storage Maintain refrigerated at 2-8°C for up to 6 months. For long term storage store at -20°C. Precautions This product is for research use only. Not for use in diagnostic or therapeutic procedures. SLC2A4RG Antibody (C-term) Blocking Peptide - Protein Information Name SLC2A4RG Synonyms HDBP1 Function Transcription factor involved in SLC2A4 and HD gene transactivation. Binds to the consensus sequence 5'-GCCGGCG-3'. Cellular Location Cytoplasm. Nucleus. Note=Shuttles Page 1/2 10320 Camino Santa Fe, Suite G San Diego, CA 92121 Tel: 858.875.1900 Fax: 858.622.0609 between the cytoplasm and the nucleus Tissue Location According to PubMed:14630949, expressed in heart, skeletal muscle, liver, kidney and pancreas; undetectable in lung, placenta or brain. According to PubMed:14625278, ubiquitously expressed, with lowest expression in brain and ileum SLC2A4RG Antibody (C-term) Blocking Peptide - Protocols Provided below are standard protocols that you may find useful for product applications. • Blocking Peptides Page 2/2 Powered by TCPDF (www.tcpdf.org).
Recommended publications
  • The Genetics of Bipolar Disorder

    The Genetics of Bipolar Disorder

    Molecular Psychiatry (2008) 13, 742–771 & 2008 Nature Publishing Group All rights reserved 1359-4184/08 $30.00 www.nature.com/mp FEATURE REVIEW The genetics of bipolar disorder: genome ‘hot regions,’ genes, new potential candidates and future directions A Serretti and L Mandelli Institute of Psychiatry, University of Bologna, Bologna, Italy Bipolar disorder (BP) is a complex disorder caused by a number of liability genes interacting with the environment. In recent years, a large number of linkage and association studies have been conducted producing an extremely large number of findings often not replicated or partially replicated. Further, results from linkage and association studies are not always easily comparable. Unfortunately, at present a comprehensive coverage of available evidence is still lacking. In the present paper, we summarized results obtained from both linkage and association studies in BP. Further, we indicated new potential interesting genes, located in genome ‘hot regions’ for BP and being expressed in the brain. We reviewed published studies on the subject till December 2007. We precisely localized regions where positive linkage has been found, by the NCBI Map viewer (http://www.ncbi.nlm.nih.gov/mapview/); further, we identified genes located in interesting areas and expressed in the brain, by the Entrez gene, Unigene databases (http://www.ncbi.nlm.nih.gov/entrez/) and Human Protein Reference Database (http://www.hprd.org); these genes could be of interest in future investigations. The review of association studies gave interesting results, as a number of genes seem to be definitively involved in BP, such as SLC6A4, TPH2, DRD4, SLC6A3, DAOA, DTNBP1, NRG1, DISC1 and BDNF.
  • SLC2A4RG (NM 020062) Human Tagged ORF Clone – RC208570

    SLC2A4RG (NM 020062) Human Tagged ORF Clone – RC208570

    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC208570 SLC2A4RG (NM_020062) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: SLC2A4RG (NM_020062) Human Tagged ORF Clone Tag: Myc-DDK Symbol: SLC2A4RG Synonyms: GEF; HDBP-1; HDBP1; Si-1-2; Si-1-2-19 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RC208570 representing NM_020062 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGAGCGCCCCCCGCCCCGCGCCGCCGGCCGGGACCCCAGTGCGCTGCGGGCCGAGGCGCCGTGGCTGC GCGCGGAGGGTCCGGGGCCGCGCGCCGCGCCCGTGACGGTGCCCACGCCGCCGCAGGGCTCTTCCGTGGG CGGCGGCTTCGCGGGCTTGGAGTTCGCGCGGCCGCAGGAGTCGGAGCCGCGGGCCTCGGACCTGGGGGCC CCCCGGACGTGGACGGGGGCGGCGGCGGGGCCCCGGACTCCGTCGGCGCACATCCCCGTCCCAGCGCAGA GAGCCACCCCAGGAAAAGCCCGGCTGGACGAGGTCATGGCTGCCGCTGCCCTTACAAGCCTGTCCACCAG CCCTCTCCTTCTGGGGGCCCCGGTTGCAGCCTTCAGCCCAGAGCCTGGCCTGGAGCCCTGGAAGGAGGCC CTGGTGCGGCCCCCAGGCAGCTACAGCAGCAGCAGCAACAGTGGAGACTGGGGATGGGACCTGGCCAGTG ACCAGTCCTCTCCGTCCACCCCGTCACCCCCACTGCCCCCCGAGGCAGCCCACTTTCTGTTTGGGGAGCC CACCCTGAGAAAAAGGAAGAGCCCGGCCCAGGTCATGTTCCAGTGTCTGTGGAAGAGCTGCGGGAAGGTG CTGAGCACGGCGTCGGCGATGCAGAGACACATCCGCCTGGTGCACCTGGGGAGGCAGGCAGAGCCTGAGC AGAGTGATGGTGAGGAGGACTTCTACTACACAGAGCTGGATGTTGGTGTGGACACGCTGACCGACGGGCT GTCCAGCCTGACTCCAGTGTCCCCCACGGCCTCCATGCCGCCTGCCTTCCCCCGCCTGGAGCTGCCAGAG
  • Genomic Landscape of Metastatic Breast Cancer Identifies Preferentially Dysregulated Pathways and Targets

    Genomic Landscape of Metastatic Breast Cancer Identifies Preferentially Dysregulated Pathways and Targets

    Genomic landscape of metastatic breast cancer identifies preferentially dysregulated pathways and targets Matt R. Paul, … , Angela DeMichele, Lewis A. Chodosh J Clin Invest. 2020. https://doi.org/10.1172/JCI129941. Research Article Genetics Oncology Graphical abstract Find the latest version: https://jci.me/129941/pdf The Journal of Clinical Investigation RESEARCH ARTICLE Genomic landscape of metastatic breast cancer identifies preferentially dysregulated pathways and targets Matt R. Paul,1,2,3 Tien-chi Pan,1,2,3 Dhruv K. Pant,1,2,3 Natalie N.C. Shih,1,4 Yan Chen,1,2,3 Kyra L. Harvey,1,2,3 Aaron Solomon,1,2,3 David Lieberman,4 Jennifer J.D. Morrissette,4 Danielle Soucier-Ernst,1,5 Noah G. Goodman,1,5 S. William Stavropoulos,1,6 Kara N. Maxwell,1,5 Candace Clark,1,5 George K. Belka,1,2,3 Michael Feldman,1,4 Angela DeMichele,1,5,7 and Lewis A. Chodosh1,2,3,5 1Secondary Prevention through Surveillance and Intervention (2-PREVENT) Translational Center of Excellence, 2Abramson Family Cancer Research Institute, 3Department of Cancer Biology, 4Department of Pathology and Laboratory Medicine, 5Department of Medicine, 6Department of Radiology, and 7Department of Biostatistics, Epidemiology and Informatics, Perelman School of Medicine at the University of Pennsylvania, Philadelphia, Pennsylvania, USA. Nearly all breast cancer deaths result from metastatic disease. Despite this, the genomic events that drive metastatic recurrence are poorly understood. We performed whole-exome and shallow whole-genome sequencing to identify genes and pathways preferentially mutated or copy-number altered in metastases compared with the paired primary tumors from which they arose.
  • The DNA Sequence and Comparative Analysis of Human Chromosome 20

    The DNA Sequence and Comparative Analysis of Human Chromosome 20

    articles The DNA sequence and comparative analysis of human chromosome 20 P. Deloukas, L. H. Matthews, J. Ashurst, J. Burton, J. G. R. Gilbert, M. Jones, G. Stavrides, J. P. Almeida, A. K. Babbage, C. L. Bagguley, J. Bailey, K. F. Barlow, K. N. Bates, L. M. Beard, D. M. Beare, O. P. Beasley, C. P. Bird, S. E. Blakey, A. M. Bridgeman, A. J. Brown, D. Buck, W. Burrill, A. P. Butler, C. Carder, N. P. Carter, J. C. Chapman, M. Clamp, G. Clark, L. N. Clark, S. Y. Clark, C. M. Clee, S. Clegg, V. E. Cobley, R. E. Collier, R. Connor, N. R. Corby, A. Coulson, G. J. Coville, R. Deadman, P. Dhami, M. Dunn, A. G. Ellington, J. A. Frankland, A. Fraser, L. French, P. Garner, D. V. Grafham, C. Grif®ths, M. N. D. Grif®ths, R. Gwilliam, R. E. Hall, S. Hammond, J. L. Harley, P. D. Heath, S. Ho, J. L. Holden, P. J. Howden, E. Huckle, A. R. Hunt, S. E. Hunt, K. Jekosch, C. M. Johnson, D. Johnson, M. P. Kay, A. M. Kimberley, A. King, A. Knights, G. K. Laird, S. Lawlor, M. H. Lehvaslaiho, M. Leversha, C. Lloyd, D. M. Lloyd, J. D. Lovell, V. L. Marsh, S. L. Martin, L. J. McConnachie, K. McLay, A. A. McMurray, S. Milne, D. Mistry, M. J. F. Moore, J. C. Mullikin, T. Nickerson, K. Oliver, A. Parker, R. Patel, T. A. V. Pearce, A. I. Peck, B. J. C. T. Phillimore, S. R. Prathalingam, R. W. Plumb, H. Ramsay, C. M.
  • Supplementary Tables S1-S3

    Supplementary Tables S1-S3

    Supplementary Table S1: Real time RT-PCR primers COX-2 Forward 5’- CCACTTCAAGGGAGTCTGGA -3’ Reverse 5’- AAGGGCCCTGGTGTAGTAGG -3’ Wnt5a Forward 5’- TGAATAACCCTGTTCAGATGTCA -3’ Reverse 5’- TGTACTGCATGTGGTCCTGA -3’ Spp1 Forward 5'- GACCCATCTCAGAAGCAGAA -3' Reverse 5'- TTCGTCAGATTCATCCGAGT -3' CUGBP2 Forward 5’- ATGCAACAGCTCAACACTGC -3’ Reverse 5’- CAGCGTTGCCAGATTCTGTA -3’ Supplementary Table S2: Genes synergistically regulated by oncogenic Ras and TGF-β AU-rich probe_id Gene Name Gene Symbol element Fold change RasV12 + TGF-β RasV12 TGF-β 1368519_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 42.22 5.53 75.28 1373000_at sushi-repeat-containing protein, X-linked 2 (predicted) Srpx2 19.24 25.59 73.63 1383486_at Transcribed locus --- ARE 5.93 27.94 52.85 1367581_a_at secreted phosphoprotein 1 Spp1 2.46 19.28 49.76 1368359_a_at VGF nerve growth factor inducible Vgf 3.11 4.61 48.10 1392618_at Transcribed locus --- ARE 3.48 24.30 45.76 1398302_at prolactin-like protein F Prlpf ARE 1.39 3.29 45.23 1392264_s_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 24.92 3.67 40.09 1391022_at laminin, beta 3 Lamb3 2.13 3.31 38.15 1384605_at Transcribed locus --- 2.94 14.57 37.91 1367973_at chemokine (C-C motif) ligand 2 Ccl2 ARE 5.47 17.28 37.90 1369249_at progressive ankylosis homolog (mouse) Ank ARE 3.12 8.33 33.58 1398479_at ryanodine receptor 3 Ryr3 ARE 1.42 9.28 29.65 1371194_at tumor necrosis factor alpha induced protein 6 Tnfaip6 ARE 2.95 7.90 29.24 1386344_at Progressive ankylosis homolog (mouse)
  • Focus on B Cells[Version 1; Peer Review: 2 Approved]

    Focus on B Cells[Version 1; Peer Review: 2 Approved]

    F1000Research 2019, 8(F1000 Faculty Rev):245 Last updated: 06 AUG 2021 REVIEW Emerging small-molecule treatments for multiple sclerosis: focus on B cells [version 1; peer review: 2 approved] Aaron Gregson1, Kaitlyn Thompson2, Stella E Tsirka2, David L Selwood 1 1The Wolfson Institute for Biomedical Research, University College London, Gower Street, London, WC1E 6BT, UK 2Department of Pharmacological Sciences, Stony Brook University, Stony Brook, New York, 11794, USA v1 First published: 01 Mar 2019, 8(F1000 Faculty Rev):245 Open Peer Review https://doi.org/10.12688/f1000research.16495.1 Latest published: 01 Mar 2019, 8(F1000 Faculty Rev):245 https://doi.org/10.12688/f1000research.16495.1 Reviewer Status Invited Reviewers Abstract Multiple sclerosis (MS) is a major cause of disability in young adults. 1 2 Following an unknown trigger (or triggers), the immune system attacks the myelin sheath surrounding axons, leading to progressive version 1 nerve cell death. Antibodies and small-molecule drugs directed 01 Mar 2019 against B cells have demonstrated good efficacy in slowing progression of the disease. This review focusses on small-molecule Faculty Reviews are review articles written by the drugs that can affect B-cell biology and may have utility in disease prestigious Members of Faculty Opinions. The management. The risk genes for MS are examined from the drug articles are commissioned and peer reviewed target perspective. Existing small-molecule therapies for MS with B- cell actions together with new drugs in development are described. before publication to ensure that the final, The potential for experimental molecules with B-cell effects is also published version is comprehensive and considered.
  • Content Based Search in Gene Expression Databases and a Meta-Analysis of Host Responses to Infection

    Content Based Search in Gene Expression Databases and a Meta-Analysis of Host Responses to Infection

    Content Based Search in Gene Expression Databases and a Meta-analysis of Host Responses to Infection A Thesis Submitted to the Faculty of Drexel University by Francis X. Bell in partial fulfillment of the requirements for the degree of Doctor of Philosophy November 2015 c Copyright 2015 Francis X. Bell. All Rights Reserved. ii Acknowledgments I would like to acknowledge and thank my advisor, Dr. Ahmet Sacan. Without his advice, support, and patience I would not have been able to accomplish all that I have. I would also like to thank my committee members and the Biomed Faculty that have guided me. I would like to give a special thanks for the members of the bioinformatics lab, in particular the members of the Sacan lab: Rehman Qureshi, Daisy Heng Yang, April Chunyu Zhao, and Yiqian Zhou. Thank you for creating a pleasant and friendly environment in the lab. I give the members of my family my sincerest gratitude for all that they have done for me. I cannot begin to repay my parents for their sacrifices. I am eternally grateful for everything they have done. The support of my sisters and their encouragement gave me the strength to persevere to the end. iii Table of Contents LIST OF TABLES.......................................................................... vii LIST OF FIGURES ........................................................................ xiv ABSTRACT ................................................................................ xvii 1. A BRIEF INTRODUCTION TO GENE EXPRESSION............................. 1 1.1 Central Dogma of Molecular Biology........................................... 1 1.1.1 Basic Transfers .......................................................... 1 1.1.2 Uncommon Transfers ................................................... 3 1.2 Gene Expression ................................................................. 4 1.2.1 Estimating Gene Expression ............................................ 4 1.2.2 DNA Microarrays ......................................................
  • Therapeutic Mir-21 Silencing Reduces Cardiac Fibrosis and Modulates Inflammatory Response in Chronic Chagas Disease

    Therapeutic Mir-21 Silencing Reduces Cardiac Fibrosis and Modulates Inflammatory Response in Chronic Chagas Disease

    Therapeutic miR-21 silencing reduces cardiac fibrosis and modulates inflammatory response in chronic Chagas disease Carolina Kymie Vasques Nonaka1-3, Gabriela Louise Sampaio2,4, Luciana de Aragão França1,3, Bruno Raphael Ribeiro Cavalcante2, Katia Nunes Silva1-3, Ricardo Khouri2, Felipe Guimarães Torres2, Cássio Santana Meira2,4, Emanuelle de Souza Santos2,4, Carolina The Macedo2,4,5, Bruno Diaz Paredes1-3, Vinicius Pinto Costa Rocha2,4, Silvia Regina Rogatto5, Ricardo Ribeiro dos Santos2,4, Bruno Solano de Freitas Souza1-3, Milena Botelho Pereira Soares2,4* Supplementary material 1 Table S1. Predicted targets of miR-21-5p sorted by cumulative weighted context++ score by TargetScanHuman Total Ortholog of Gene name context++ target gene score C1orf143 chromosome 1 open reading frame 143 -0.85 ZNF367 zinc finger protein 367 -0.72 KHDC1L KH homology domain containing 1-like -0.71 ABHD12B abhydrolase domain containing 12B -0.69 CDR1as circular RNA CDR1as -0.68 KHDC1 KH homology domain containing 1 -0.68 HTN1 histatin 1 -0.66 KRIT1 KRIT1. ankyrin repeat containing -0.69 IL12A interleukin 12A (natural killer cell stimulatory factor 1. cytotoxic lymphocyte maturation factor 1. p35) -0.65 FASLG Fas ligand (TNF superfamily. member 6) -0.64 FGF18 fibroblast growth factor 18 -0.64 CCL1 chemokine (C-C motif) ligand 1 -0.64 CALCB calcitonin-related polypeptide beta -0.57 GPR64 G protein-coupled receptor 64 -0.55 AIM1L absent in melanoma 1-like -0.55 MTPN myotrophin -0.54 PLEKHA1 pleckstrin homology domain containing. family A (phosphoinositide binding specific) member 1 -0.54 RIOK1 RIO kinase 1 -0.52 RSAD2 radical S-adenosyl methionine domain containing 2 -0.52 TRAPPC2 trafficking protein particle complex 2 -0.53 ATXN10 ataxin 10 -0.57 LUM lumican -0.51 RPL36A ribosomal protein L36a -0.51 SCML2 sex comb on midleg-like 2 (Drosophila) -0.51 ALDH1A1 aldehyde dehydrogenase 1 family.
  • 1 Transcriptomic Responses to Hypoxia in Endometrial and Decidual Stromal Cells 2 3 Kalle T

    1 Transcriptomic Responses to Hypoxia in Endometrial and Decidual Stromal Cells 2 3 Kalle T

    bioRxiv preprint doi: https://doi.org/10.1101/2019.12.21.885657; this version posted December 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 Transcriptomic responses to hypoxia in endometrial and decidual stromal cells 2 3 Kalle T. Rytkönen 1,2,3,4, Taija Heinosalo 1, Mehrad Mahmoudian 2,5, Xinghong Ma 3,4, Antti 4 Perheentupa 1,6, Laura L. Elo 2, Matti Poutanen 1 and Günter P. Wagner 3,4,7,8 5 6 1 Institute of Biomedicine, Research Centre for Integrative Physiology and Pharmacology, 7 University of Turku, Kiinamyllynkatu 10, 20014, Finland 8 2 Turku Bioscience Centre, University of Turku and Åbo Akademi University, Tykistökatu 6, 9 20520, Turku, Finland 10 3 Yale Systems Biology Institute, West Haven, Connecticut 06516, USA 11 4 Department of Ecology and Evolutionary Biology, Yale University, New Haven, CT 06511, 12 USA 13 5 Department of Future Technologies, University of Turku, FI-20014 Turku, Finland 14 6 Department of Obstetrics and Gynecology, Turku University Hospital, Kiinamyllynkatu 4-8, 15 20521, Turku, Finland. 16 7 Department of Obstetrics, Gynecology and Reproductive Sciences, Yale Medical School, New 17 Haven 06510, USA 18 8 Department of Obstetrics and Gynecology, Wayne State University, Detroit, MI- 48201, USA 19 20 Correspondence should be addresses to K T Rytkönen; Email: [email protected]. Address: Institute 21 of Biomedicine, Research Centre for Integrative Physiology and Pharmacology, University of 22 Turku, Kiinamyllynkatu 10, 20014, Finland / Turku Bioscience Centre, University of Turku and 23 Åbo Akademi University, Tykistökatu 6, 20520, Turku, Finland.
  • High-Density Array Comparative Genomic Hybridization Detects Novel Copy Number Alterations in Gastric Adenocarcinoma

    High-Density Array Comparative Genomic Hybridization Detects Novel Copy Number Alterations in Gastric Adenocarcinoma

    ANTICANCER RESEARCH 34: 6405-6416 (2014) High-density Array Comparative Genomic Hybridization Detects Novel Copy Number Alterations in Gastric Adenocarcinoma ALINE DAMASCENO SEABRA1,2*, TAÍSSA MAÍRA THOMAZ ARAÚJO1,2*, FERNANDO AUGUSTO RODRIGUES MELLO JUNIOR1,2, DIEGO DI FELIPE ÁVILA ALCÂNTARA1,2, AMANDA PAIVA DE BARROS1,2, PAULO PIMENTEL DE ASSUMPÇÃO2, RAQUEL CARVALHO MONTENEGRO1,2, ADRIANA COSTA GUIMARÃES1,2, SAMIA DEMACHKI2, ROMMEL MARIO RODRÍGUEZ BURBANO1,2 and ANDRÉ SALIM KHAYAT1,2 1Human Cytogenetics Laboratory and 2Oncology Research Center, Federal University of Pará, Belém Pará, Brazil Abstract. Aim: To investigate frequent quantitative alterations gastric cancer is the second most frequent cancer in men and of intestinal-type gastric adenocarcinoma. Materials and the third in women (4). The state of Pará has a high Methods: We analyzed genome-wide DNA copy numbers of 22 incidence of gastric adenocarcinoma and this disease is a samples and using CytoScan® HD Array. Results: We identified public health problem, since mortality rates are above the 22 gene alterations that to the best of our knowledge have not Brazilian average (5). been described for gastric cancer, including of v-erb-b2 avian This tumor can be classified into two histological types, erythroblastic leukemia viral oncogene homolog 4 (ERBB4), intestinal and diffuse, according to Laurén (4, 6, 7). The SRY (sex determining region Y)-box 6 (SOX6), regulator of intestinal type predominates in high-risk areas, such as telomere elongation helicase 1 (RTEL1) and UDP- Brazil, and arises from precursor lesions, whereas the diffuse Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5 type has a similar distribution in high- and low-risk areas and (B4GALT5).
  • Genetic Association Studies of Alterations in Protein Function Expose Recessive Effects on Cancer Predisposition

    Genetic Association Studies of Alterations in Protein Function Expose Recessive Effects on Cancer Predisposition

    www.nature.com/scientificreports OPEN Genetic association studies of alterations in protein function expose recessive efects on cancer predisposition Nadav Brandes1, Nathan Linial1 & Michal Linial2* The characterization of germline genetic variation afecting cancer risk, known as cancer predisposition, is fundamental to preventive and personalized medicine. Studies of genetic cancer predisposition typically identify signifcant genomic regions based on family-based cohorts or genome-wide association studies (GWAS). However, the results of such studies rarely provide biological insight or functional interpretation. In this study, we conducted a comprehensive analysis of cancer predisposition in the UK Biobank cohort using a new gene-based method for detecting protein-coding genes that are functionally interpretable. Specifcally, we conducted proteome- wide association studies (PWAS) to identify genetic associations mediated by alterations to protein function. With PWAS, we identifed 110 signifcant gene-cancer associations in 70 unique genomic regions across nine cancer types and pan-cancer. In 48 of the 110 PWAS associations (44%), estimated gene damage is associated with reduced rather than elevated cancer risk, suggesting a protective efect. Together with standard GWAS, we implicated 145 unique genomic loci with cancer risk. While most of these genomic regions are supported by external evidence, our results also highlight many novel loci. Based on the capacity of PWAS to detect non-additive genetic efects, we found that 46% of the PWAS-signifcant cancer regions exhibited exclusive recessive inheritance. These results highlight the importance of recessive genetic efects, without relying on familial studies. Finally, we show that many of the detected genes exert substantial cancer risk in the studied cohort determined by a quantitative functional description, suggesting their relevance for diagnosis and genetic consulting.
  • Facteur De Risque Génétique Aux Maladies Inflammatoires De L’Intestin Et Modulateur D’Inflammation

    Facteur De Risque Génétique Aux Maladies Inflammatoires De L’Intestin Et Modulateur D’Inflammation

    Université de Montréal MAST3 : facteur de risque génétique aux maladies inflammatoires de l’intestin et modulateur d’inflammation par Catherine Labbé Département de sciences biomédicales Faculté de médecine Thèse présentée à la Faculté de médecine en vue de l’obtention du grade de doctorat en sciences biomédicales 5 août, 2011 © Catherine Labbé, 2011 Université de Montréal Faculté de médecine Cette thèse intitulée : MAST3 : facteur de risque génétique aux maladies inflammatoires de l’intestin et modulateur d’inflammation Présentée par : Catherine Labbé a été évaluée par un jury composé des personnes suivantes : Daniel Sinnett, président-rapporteur John D. Rioux, directeur de recherche Zoha Kibar, membre du jury Yohan Bossé, examinateur externe Gaëtan Mayer, représentant du doyen de la FES i Résumé La maladie de Crohn (MC) et la colite ulcéreuse (CU) sont des maladies inflammatoires chroniques du tube digestif qu’on regroupe sous le terme maladies inflammatoires de l’intestin (MII). Les mécanismes moléculaires menant au développement des MII ne sont pas entièrement connus, mais des études génétiques et fonctionnelles ont permis de mettre en évidence des interactions entre des prédispositions génétiques et des facteurs environnementaux - notamment la flore intestinale – qui contribuent au développement d’une dérégulation de la réponse immunitaire menant à l’inflammation de la muqueuse intestinale. Des études d’association pangénomiques et ciblées ont permis d’identifier plusieurs gènes de susceptibilité aux MII mais les estimations de la contribution de ces gènes à l’héritabilité suggèrent que plusieurs gènes restent à découvrir. Certains d’entre eux peuvent se trouver dans les régions identifiées par des études de liaison génétique.