Epigenetic Mechanisms Are Involved in the Oncogenic Properties of ZNF518B in Colorectal Cancer
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
The Landscape of Human Mutually Exclusive Splicing
bioRxiv preprint doi: https://doi.org/10.1101/133215; this version posted May 2, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. The landscape of human mutually exclusive splicing Klas Hatje1,2,#,*, Ramon O. Vidal2,*, Raza-Ur Rahman2, Dominic Simm1,3, Björn Hammesfahr1,$, Orr Shomroni2, Stefan Bonn2§ & Martin Kollmar1§ 1 Group of Systems Biology of Motor Proteins, Department of NMR-based Structural Biology, Max-Planck-Institute for Biophysical Chemistry, Göttingen, Germany 2 Group of Computational Systems Biology, German Center for Neurodegenerative Diseases, Göttingen, Germany 3 Theoretical Computer Science and Algorithmic Methods, Institute of Computer Science, Georg-August-University Göttingen, Germany § Corresponding authors # Current address: Roche Pharmaceutical Research and Early Development, Pharmaceutical Sciences, Roche Innovation Center Basel, F. Hoffmann-La Roche Ltd., Basel, Switzerland $ Current address: Research and Development - Data Management (RD-DM), KWS SAAT SE, Einbeck, Germany * These authors contributed equally E-mail addresses: KH: [email protected], RV: [email protected], RR: [email protected], DS: [email protected], BH: [email protected], OS: [email protected], SB: [email protected], MK: [email protected] - 1 - bioRxiv preprint doi: https://doi.org/10.1101/133215; this version posted May 2, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. -
The Genetics of Bipolar Disorder
Molecular Psychiatry (2008) 13, 742–771 & 2008 Nature Publishing Group All rights reserved 1359-4184/08 $30.00 www.nature.com/mp FEATURE REVIEW The genetics of bipolar disorder: genome ‘hot regions,’ genes, new potential candidates and future directions A Serretti and L Mandelli Institute of Psychiatry, University of Bologna, Bologna, Italy Bipolar disorder (BP) is a complex disorder caused by a number of liability genes interacting with the environment. In recent years, a large number of linkage and association studies have been conducted producing an extremely large number of findings often not replicated or partially replicated. Further, results from linkage and association studies are not always easily comparable. Unfortunately, at present a comprehensive coverage of available evidence is still lacking. In the present paper, we summarized results obtained from both linkage and association studies in BP. Further, we indicated new potential interesting genes, located in genome ‘hot regions’ for BP and being expressed in the brain. We reviewed published studies on the subject till December 2007. We precisely localized regions where positive linkage has been found, by the NCBI Map viewer (http://www.ncbi.nlm.nih.gov/mapview/); further, we identified genes located in interesting areas and expressed in the brain, by the Entrez gene, Unigene databases (http://www.ncbi.nlm.nih.gov/entrez/) and Human Protein Reference Database (http://www.hprd.org); these genes could be of interest in future investigations. The review of association studies gave interesting results, as a number of genes seem to be definitively involved in BP, such as SLC6A4, TPH2, DRD4, SLC6A3, DAOA, DTNBP1, NRG1, DISC1 and BDNF. -
SLC2A4RG (NM 020062) Human Tagged ORF Clone – RC208570
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC208570 SLC2A4RG (NM_020062) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: SLC2A4RG (NM_020062) Human Tagged ORF Clone Tag: Myc-DDK Symbol: SLC2A4RG Synonyms: GEF; HDBP-1; HDBP1; Si-1-2; Si-1-2-19 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RC208570 representing NM_020062 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGAGCGCCCCCCGCCCCGCGCCGCCGGCCGGGACCCCAGTGCGCTGCGGGCCGAGGCGCCGTGGCTGC GCGCGGAGGGTCCGGGGCCGCGCGCCGCGCCCGTGACGGTGCCCACGCCGCCGCAGGGCTCTTCCGTGGG CGGCGGCTTCGCGGGCTTGGAGTTCGCGCGGCCGCAGGAGTCGGAGCCGCGGGCCTCGGACCTGGGGGCC CCCCGGACGTGGACGGGGGCGGCGGCGGGGCCCCGGACTCCGTCGGCGCACATCCCCGTCCCAGCGCAGA GAGCCACCCCAGGAAAAGCCCGGCTGGACGAGGTCATGGCTGCCGCTGCCCTTACAAGCCTGTCCACCAG CCCTCTCCTTCTGGGGGCCCCGGTTGCAGCCTTCAGCCCAGAGCCTGGCCTGGAGCCCTGGAAGGAGGCC CTGGTGCGGCCCCCAGGCAGCTACAGCAGCAGCAGCAACAGTGGAGACTGGGGATGGGACCTGGCCAGTG ACCAGTCCTCTCCGTCCACCCCGTCACCCCCACTGCCCCCCGAGGCAGCCCACTTTCTGTTTGGGGAGCC CACCCTGAGAAAAAGGAAGAGCCCGGCCCAGGTCATGTTCCAGTGTCTGTGGAAGAGCTGCGGGAAGGTG CTGAGCACGGCGTCGGCGATGCAGAGACACATCCGCCTGGTGCACCTGGGGAGGCAGGCAGAGCCTGAGC AGAGTGATGGTGAGGAGGACTTCTACTACACAGAGCTGGATGTTGGTGTGGACACGCTGACCGACGGGCT GTCCAGCCTGACTCCAGTGTCCCCCACGGCCTCCATGCCGCCTGCCTTCCCCCGCCTGGAGCTGCCAGAG -
Genomic Landscape of Metastatic Breast Cancer Identifies Preferentially Dysregulated Pathways and Targets
Genomic landscape of metastatic breast cancer identifies preferentially dysregulated pathways and targets Matt R. Paul, … , Angela DeMichele, Lewis A. Chodosh J Clin Invest. 2020. https://doi.org/10.1172/JCI129941. Research Article Genetics Oncology Graphical abstract Find the latest version: https://jci.me/129941/pdf The Journal of Clinical Investigation RESEARCH ARTICLE Genomic landscape of metastatic breast cancer identifies preferentially dysregulated pathways and targets Matt R. Paul,1,2,3 Tien-chi Pan,1,2,3 Dhruv K. Pant,1,2,3 Natalie N.C. Shih,1,4 Yan Chen,1,2,3 Kyra L. Harvey,1,2,3 Aaron Solomon,1,2,3 David Lieberman,4 Jennifer J.D. Morrissette,4 Danielle Soucier-Ernst,1,5 Noah G. Goodman,1,5 S. William Stavropoulos,1,6 Kara N. Maxwell,1,5 Candace Clark,1,5 George K. Belka,1,2,3 Michael Feldman,1,4 Angela DeMichele,1,5,7 and Lewis A. Chodosh1,2,3,5 1Secondary Prevention through Surveillance and Intervention (2-PREVENT) Translational Center of Excellence, 2Abramson Family Cancer Research Institute, 3Department of Cancer Biology, 4Department of Pathology and Laboratory Medicine, 5Department of Medicine, 6Department of Radiology, and 7Department of Biostatistics, Epidemiology and Informatics, Perelman School of Medicine at the University of Pennsylvania, Philadelphia, Pennsylvania, USA. Nearly all breast cancer deaths result from metastatic disease. Despite this, the genomic events that drive metastatic recurrence are poorly understood. We performed whole-exome and shallow whole-genome sequencing to identify genes and pathways preferentially mutated or copy-number altered in metastases compared with the paired primary tumors from which they arose. -
The DNA Sequence and Comparative Analysis of Human Chromosome 20
articles The DNA sequence and comparative analysis of human chromosome 20 P. Deloukas, L. H. Matthews, J. Ashurst, J. Burton, J. G. R. Gilbert, M. Jones, G. Stavrides, J. P. Almeida, A. K. Babbage, C. L. Bagguley, J. Bailey, K. F. Barlow, K. N. Bates, L. M. Beard, D. M. Beare, O. P. Beasley, C. P. Bird, S. E. Blakey, A. M. Bridgeman, A. J. Brown, D. Buck, W. Burrill, A. P. Butler, C. Carder, N. P. Carter, J. C. Chapman, M. Clamp, G. Clark, L. N. Clark, S. Y. Clark, C. M. Clee, S. Clegg, V. E. Cobley, R. E. Collier, R. Connor, N. R. Corby, A. Coulson, G. J. Coville, R. Deadman, P. Dhami, M. Dunn, A. G. Ellington, J. A. Frankland, A. Fraser, L. French, P. Garner, D. V. Grafham, C. Grif®ths, M. N. D. Grif®ths, R. Gwilliam, R. E. Hall, S. Hammond, J. L. Harley, P. D. Heath, S. Ho, J. L. Holden, P. J. Howden, E. Huckle, A. R. Hunt, S. E. Hunt, K. Jekosch, C. M. Johnson, D. Johnson, M. P. Kay, A. M. Kimberley, A. King, A. Knights, G. K. Laird, S. Lawlor, M. H. Lehvaslaiho, M. Leversha, C. Lloyd, D. M. Lloyd, J. D. Lovell, V. L. Marsh, S. L. Martin, L. J. McConnachie, K. McLay, A. A. McMurray, S. Milne, D. Mistry, M. J. F. Moore, J. C. Mullikin, T. Nickerson, K. Oliver, A. Parker, R. Patel, T. A. V. Pearce, A. I. Peck, B. J. C. T. Phillimore, S. R. Prathalingam, R. W. Plumb, H. Ramsay, C. M. -
Supplementary Tables S1-S3
Supplementary Table S1: Real time RT-PCR primers COX-2 Forward 5’- CCACTTCAAGGGAGTCTGGA -3’ Reverse 5’- AAGGGCCCTGGTGTAGTAGG -3’ Wnt5a Forward 5’- TGAATAACCCTGTTCAGATGTCA -3’ Reverse 5’- TGTACTGCATGTGGTCCTGA -3’ Spp1 Forward 5'- GACCCATCTCAGAAGCAGAA -3' Reverse 5'- TTCGTCAGATTCATCCGAGT -3' CUGBP2 Forward 5’- ATGCAACAGCTCAACACTGC -3’ Reverse 5’- CAGCGTTGCCAGATTCTGTA -3’ Supplementary Table S2: Genes synergistically regulated by oncogenic Ras and TGF-β AU-rich probe_id Gene Name Gene Symbol element Fold change RasV12 + TGF-β RasV12 TGF-β 1368519_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 42.22 5.53 75.28 1373000_at sushi-repeat-containing protein, X-linked 2 (predicted) Srpx2 19.24 25.59 73.63 1383486_at Transcribed locus --- ARE 5.93 27.94 52.85 1367581_a_at secreted phosphoprotein 1 Spp1 2.46 19.28 49.76 1368359_a_at VGF nerve growth factor inducible Vgf 3.11 4.61 48.10 1392618_at Transcribed locus --- ARE 3.48 24.30 45.76 1398302_at prolactin-like protein F Prlpf ARE 1.39 3.29 45.23 1392264_s_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 24.92 3.67 40.09 1391022_at laminin, beta 3 Lamb3 2.13 3.31 38.15 1384605_at Transcribed locus --- 2.94 14.57 37.91 1367973_at chemokine (C-C motif) ligand 2 Ccl2 ARE 5.47 17.28 37.90 1369249_at progressive ankylosis homolog (mouse) Ank ARE 3.12 8.33 33.58 1398479_at ryanodine receptor 3 Ryr3 ARE 1.42 9.28 29.65 1371194_at tumor necrosis factor alpha induced protein 6 Tnfaip6 ARE 2.95 7.90 29.24 1386344_at Progressive ankylosis homolog (mouse) -
Novel IQCE Variations Confirm Its Role in Postaxial Polydactyly and Cause
Novel IQCE variations confirm its role in postaxial polydactyly and cause ciliary defect phenotype in zebrafish Alejandro Estrada-Cuzcano, Christelle Etard, Clarisse Delvallée, Corinne Stoetzel, Elise Schaefer, Sophie Scheidecker, Véronique Geoffroy, Aline Schneider, Fouzia Studer, Francesca Mattioli, et al. To cite this version: Alejandro Estrada-Cuzcano, Christelle Etard, Clarisse Delvallée, Corinne Stoetzel, Elise Schaefer, et al.. Novel IQCE variations confirm its role in postaxial polydactyly and cause ciliary defect phenotype in zebrafish. Human Mutation, Wiley, 2019, 10.1002/humu.23924. hal-02304111 HAL Id: hal-02304111 https://hal.archives-ouvertes.fr/hal-02304111 Submitted on 2 Oct 2019 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Page 1 of 125 Human Mutation Novel IQCE variations confirm its role in postaxial polydactyly and cause ciliary defect phenotype in zebrafish. Alejandro Estrada-Cuzcano1*, Christelle Etard2*, Clarisse Delvallée1*, Corinne Stoetzel1, Elise Schaefer1,3, Sophie Scheidecker1,4, Véronique Geoffroy1, Aline Schneider1, Fouzia Studer5, Francesca Mattioli6, Kirsley Chennen1,7, Sabine Sigaudy8, Damien Plassard9, Olivier Poch7, Amélie Piton4,6, Uwe Strahle2, Jean Muller1,4* and Hélène Dollfus1,3,5* 1. Laboratoire de Génétique médicale, UMR_S INSERM U1112, IGMA, Faculté de Médecine FMTS, Université de Strasbourg, Strasbourg, France. -
Focus on B Cells[Version 1; Peer Review: 2 Approved]
F1000Research 2019, 8(F1000 Faculty Rev):245 Last updated: 06 AUG 2021 REVIEW Emerging small-molecule treatments for multiple sclerosis: focus on B cells [version 1; peer review: 2 approved] Aaron Gregson1, Kaitlyn Thompson2, Stella E Tsirka2, David L Selwood 1 1The Wolfson Institute for Biomedical Research, University College London, Gower Street, London, WC1E 6BT, UK 2Department of Pharmacological Sciences, Stony Brook University, Stony Brook, New York, 11794, USA v1 First published: 01 Mar 2019, 8(F1000 Faculty Rev):245 Open Peer Review https://doi.org/10.12688/f1000research.16495.1 Latest published: 01 Mar 2019, 8(F1000 Faculty Rev):245 https://doi.org/10.12688/f1000research.16495.1 Reviewer Status Invited Reviewers Abstract Multiple sclerosis (MS) is a major cause of disability in young adults. 1 2 Following an unknown trigger (or triggers), the immune system attacks the myelin sheath surrounding axons, leading to progressive version 1 nerve cell death. Antibodies and small-molecule drugs directed 01 Mar 2019 against B cells have demonstrated good efficacy in slowing progression of the disease. This review focusses on small-molecule Faculty Reviews are review articles written by the drugs that can affect B-cell biology and may have utility in disease prestigious Members of Faculty Opinions. The management. The risk genes for MS are examined from the drug articles are commissioned and peer reviewed target perspective. Existing small-molecule therapies for MS with B- cell actions together with new drugs in development are described. before publication to ensure that the final, The potential for experimental molecules with B-cell effects is also published version is comprehensive and considered. -
Mutation in a Primate-Conserved Retrotransposon Reveals a Noncoding RNA As a Mediator of Infantile Encephalopathy
Mutation in a primate-conserved retrotransposon reveals a noncoding RNA as a mediator of infantile encephalopathy François Cartaulta,b,1, Patrick Muniera, Edgar Benkoc, Isabelle Desguerred, Sylvain Haneinb, Nathalie Boddaerte, Simonetta Bandierab, Jeanine Vellayoudoma, Pascale Krejbich-Trototf, Marc Bintnerg, Jean-Jacques Hoarauf, Muriel Girardb, Emmanuelle Géninh, Pascale de Lonlayb, Alain Fourmaintrauxa,i, Magali Navillej, Diana Rodriguezk, Josué Feingoldb, Michel Renouili, Arnold Munnichb,l, Eric Westhofm, Michael Fählingc,2, Stanislas Lyonnetb,l,2, and Alexandra Henrion-Caudeb,1 aDépartement de Génétique and fGroupe de Recherche Immunopathologies et Maladies Infectieuses, Université de La Réunion, Centre Hospitalier Régional de La Réunion, 97405 Saint-Denis, La Réunion, France; bInstitut National de la Santé et de la Recherche Médicale (INSERM) U781 and Imagine Foundation, Hôpital Necker-Enfants Malades, Université Paris Descartes, 75015 Paris, France; cInstitut für Vegetative Physiologie, Charité-Universitätsmedizin Berlin, D-10115 Berlin, Germany; dDépartement de Neurologie Pédiatrique, eDépartement de Radio-Pédiatrie and INSERM Unité Mixte de Recherche (UMR)-1000, and lDépartement de Génétique, Hôpital Necker-Enfants Malades, Assistance Publique Hôpitaux de Paris, 75015 Paris, France; gDépartement de Neuroradiologie and iDépartement de Pédiatrie, Centre de Maladies Neuromusculaires et Neurologiques Rares, Centre Hospitalier Régional de La Réunion, 97448 Saint-Pierre, La Réunion, France; hINSERM U946, Fondation Jean Dausset, Centre -
A Thirteen‑Gene Set Efficiently Predicts the Prognosis of Glioblastoma
MOLECULAR MEDICINE REPORTS 19: 1613-1621, 2019 A thirteen‑gene set efficiently predicts the prognosis of glioblastoma HUYIN YANG, LUHAO JIN and XIAOYANG SUN Department of Neurosurgery, Affiliated Huaian No. 1 People's Hospital of Nanjing Medical University, Huai'an, Jiangsu 223300, P.R. China Received January 21, 2018; Accepted September 6, 2018 DOI: 10.3892/mmr.2019.9801 Abstract. Glioblastoma multiforme (GBM) is the most Introduction common type of brain cancer; it usually recurs and patients have a short survival time. The present study aimed to construct Glioblastoma multiforme (GBM) is the most common and the a gene expression classifier and to screen key genes associated most invasive subtype of brain cancer; it is characterized by with GBM prognosis. GSE7696 microarray data set included symptoms that include personality changes, headaches, nausea samples from 10 recurrent GBM tissues, 70 primary GBM and unconsciousness (1,2). GBM originates from normal brain tissues and 4 normal brain tissues. Seed genes were identi- cells or low-grade astrocytoma, and may be induced by genetic fied by the ‘survival’ package in R and subjected to pathway disorders and radiation exposure (3,4). Clinical techniques for enrichment analysis. Prognostic genes were selected from the the treatment of GBM include surgery combined with radia- seed genes using the ‘rbsurv’ package in R, unsupervised hier- tion therapy or chemotherapy; however, the survival benefit archical clustering, survival analysis and enrichment analysis. is limited to ~12-15 months, or even shorter if the disease Multivariate survival analysis was performed for the prog- recurs (4). nostic genes, and the GBM data set from The Cancer Genome Gene therapy is a novel strategy for treating cancers (5). -
Agricultural University of Athens
ΓΕΩΠΟΝΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΤΩΝ ΖΩΩΝ ΤΜΗΜΑ ΕΠΙΣΤΗΜΗΣ ΖΩΙΚΗΣ ΠΑΡΑΓΩΓΗΣ ΕΡΓΑΣΤΗΡΙΟ ΓΕΝΙΚΗΣ ΚΑΙ ΕΙΔΙΚΗΣ ΖΩΟΤΕΧΝΙΑΣ ΔΙΔΑΚΤΟΡΙΚΗ ΔΙΑΤΡΙΒΗ Εντοπισμός γονιδιωματικών περιοχών και δικτύων γονιδίων που επηρεάζουν παραγωγικές και αναπαραγωγικές ιδιότητες σε πληθυσμούς κρεοπαραγωγικών ορνιθίων ΕΙΡΗΝΗ Κ. ΤΑΡΣΑΝΗ ΕΠΙΒΛΕΠΩΝ ΚΑΘΗΓΗΤΗΣ: ΑΝΤΩΝΙΟΣ ΚΟΜΙΝΑΚΗΣ ΑΘΗΝΑ 2020 ΔΙΔΑΚΤΟΡΙΚΗ ΔΙΑΤΡΙΒΗ Εντοπισμός γονιδιωματικών περιοχών και δικτύων γονιδίων που επηρεάζουν παραγωγικές και αναπαραγωγικές ιδιότητες σε πληθυσμούς κρεοπαραγωγικών ορνιθίων Genome-wide association analysis and gene network analysis for (re)production traits in commercial broilers ΕΙΡΗΝΗ Κ. ΤΑΡΣΑΝΗ ΕΠΙΒΛΕΠΩΝ ΚΑΘΗΓΗΤΗΣ: ΑΝΤΩΝΙΟΣ ΚΟΜΙΝΑΚΗΣ Τριμελής Επιτροπή: Aντώνιος Κομινάκης (Αν. Καθ. ΓΠΑ) Ανδρέας Κράνης (Eρευν. B, Παν. Εδιμβούργου) Αριάδνη Χάγερ (Επ. Καθ. ΓΠΑ) Επταμελής εξεταστική επιτροπή: Aντώνιος Κομινάκης (Αν. Καθ. ΓΠΑ) Ανδρέας Κράνης (Eρευν. B, Παν. Εδιμβούργου) Αριάδνη Χάγερ (Επ. Καθ. ΓΠΑ) Πηνελόπη Μπεμπέλη (Καθ. ΓΠΑ) Δημήτριος Βλαχάκης (Επ. Καθ. ΓΠΑ) Ευάγγελος Ζωίδης (Επ.Καθ. ΓΠΑ) Γεώργιος Θεοδώρου (Επ.Καθ. ΓΠΑ) 2 Εντοπισμός γονιδιωματικών περιοχών και δικτύων γονιδίων που επηρεάζουν παραγωγικές και αναπαραγωγικές ιδιότητες σε πληθυσμούς κρεοπαραγωγικών ορνιθίων Περίληψη Σκοπός της παρούσας διδακτορικής διατριβής ήταν ο εντοπισμός γενετικών δεικτών και υποψηφίων γονιδίων που εμπλέκονται στο γενετικό έλεγχο δύο τυπικών πολυγονιδιακών ιδιοτήτων σε κρεοπαραγωγικά ορνίθια. Μία ιδιότητα σχετίζεται με την ανάπτυξη (σωματικό βάρος στις 35 ημέρες, ΣΒ) και η άλλη με την αναπαραγωγική -
Content Based Search in Gene Expression Databases and a Meta-Analysis of Host Responses to Infection
Content Based Search in Gene Expression Databases and a Meta-analysis of Host Responses to Infection A Thesis Submitted to the Faculty of Drexel University by Francis X. Bell in partial fulfillment of the requirements for the degree of Doctor of Philosophy November 2015 c Copyright 2015 Francis X. Bell. All Rights Reserved. ii Acknowledgments I would like to acknowledge and thank my advisor, Dr. Ahmet Sacan. Without his advice, support, and patience I would not have been able to accomplish all that I have. I would also like to thank my committee members and the Biomed Faculty that have guided me. I would like to give a special thanks for the members of the bioinformatics lab, in particular the members of the Sacan lab: Rehman Qureshi, Daisy Heng Yang, April Chunyu Zhao, and Yiqian Zhou. Thank you for creating a pleasant and friendly environment in the lab. I give the members of my family my sincerest gratitude for all that they have done for me. I cannot begin to repay my parents for their sacrifices. I am eternally grateful for everything they have done. The support of my sisters and their encouragement gave me the strength to persevere to the end. iii Table of Contents LIST OF TABLES.......................................................................... vii LIST OF FIGURES ........................................................................ xiv ABSTRACT ................................................................................ xvii 1. A BRIEF INTRODUCTION TO GENE EXPRESSION............................. 1 1.1 Central Dogma of Molecular Biology........................................... 1 1.1.1 Basic Transfers .......................................................... 1 1.1.2 Uncommon Transfers ................................................... 3 1.2 Gene Expression ................................................................. 4 1.2.1 Estimating Gene Expression ............................................ 4 1.2.2 DNA Microarrays ......................................................