DOCSLIB.ORG

Promotion of Neurite Outgrowth and Axon Guidance in Spiral Ganglion Cells by Netrin-1

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Promotion of Neurite Outgrowth and Axon Guidance in Spiral Ganglion Cells by Netrin-1 ORIGINAL ARTICLE Promotion of Neurite Outgrowth and Axon Guidance in Spiral Ganglion Cells by Netrin-1 Kenneth H. Lee, MD, PhD; Mark E. Warchol, PhD Objective: To identify the expression of netrin-1, a Results: Netrin-1 and DCC mRNA expression were found diffusible chemoattractive molecule, and its receptor, in the mouse organ of Corti and spiral ganglion cells by deleted in colorectal carcinoma (DCC), in the devel- RT-PCR. Application of exogenous netrin-1 led to a dos- opmentally mature inner ear, and to determine its age-dependent increase in neurite length in cultured spi- effects on axon length and guidance in cultured auditory ral ganglion cells. Chick acoustic ganglion cells cocul- neurons. tured with netrin-1–secreting cells demonstrated statistically significant preferential extension toward the source of netrin-1 (P =.04). Design: Messenger RNA (mRNA) and protein expres- sion of netrin-1 and DCC were identified in the organ of Conclusions: Netrin-1 and DCC are expressed in the or- Corti and spiral ganglion cells using reverse transcription– gan of Corti and spiral ganglion cells of developmen- polymerase chain reaction (RT-PCR) and fluorescence tally mature mice. Exogenous netrin-1 promotes dosage- immunohistochemical analysis. In vitro experiments ex- dependent neurite growth in vitro. Mature auditory amined the effects of exogenous netrin-1 on spiral gan- neurons preferentially direct neurite extension toward glion cell axon length. Auditory neurons were cocul- netrin-1 released in culture. These findings may lead to tured with a cell line secreting netrin-1 to determine the the development of strategies to optimize the interface effect on direction of axon extension. between electrode arrays and spiral ganglion cells, re- sulting in improved cochlear implant performance. Subjects: Young C57 mice and posthatched white leghorn chicks. Arch Otolaryngol Head Neck Surg. 2008;134(2):146-151 ECENT ADVANCES IN COCH- glion neurite outgrowth may lead to ran- lear implant hardware dom patterns of axon extension, result- design have included strat- ing in decreased cochlear implant function. egies to position the elec- An understanding of the innate molecu- trode array more medially lar mechanisms that establish and main- Rto hug the modiolus and bring the stimu- tain the precise tonotopic organization of lating electrodes closer to the spiral gan- the inner ear may be essential to develop glion cells. In theory, this would lower strategies for highly controlled neurite out- stimulation thresholds, improve battery life growth necessary to achieve improved by decreasing power consumption, and ex- cochlear implant function. pand the dynamic range of the stimu- Netrin-1 is a member of a family of se- lus.1-3 Implementing such strategies has led creted laminin-related proteins and has to improved cochlear implant function.4,5 been shown to attract commissural axons Author Affiliations: Stimulating the outgrowth of spiral gan- to the midline of the spinal cord during de- Departments of 6,7 Otolaryngology–Head and Neck glion cell axons would be another means velopment. The family of peptides known Surgery (Drs Lee and Warchol) to achieve this objective. Decreasing the as netrins are highly conserved across sev- and Anatomy and Neurobiology distance between the electrodes and their eral species and can act both at short range (Dr Warchol), Washington stimulus targets may provide a mecha- as well as long range to guide growing axons University School of Medicine, nism that would enhance frequency se- to appropriate innervation targets.8,9 Net- St Louis, Missouri. Dr Lee is lectivity and dynamic range. Such ben- rins are bifunctional molecules in that they now with the Department of efits would not only augment speech can mediate either attraction or repulsion, Otolaryngology–Head and Neck Surgery, University of Texas recognition but may also improve the tonal based on their interactions with different 10,11 Southwestern Medical Center at quality of sound and potentially allow im- receptor families or based on levels of Dallas, and Children’s Medical plant users to better appreciate music. second messengers such as cyclic adeno- Center Dallas. However, simple stimulation of spiral gan- sine monophosphate.12 (REPRINTED) ARCH OTOLARYNGOL HEAD NECK SURG/ VOL 134 (NO. 2), FEB 2008 WWW.ARCHOTO.COM 146 ©2008 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 09/23/2021 Deleted in Colorectal Carcinoma (DCC) is a gene that 25mM Hepes. Each ganglion was further dissected into has shown to be mutated in metastatic human colorec- smaller fragments, pooled, and digested in trypsin, 25%, tal cancer.13 This gene encodes a receptor that binds ne- (Sigma) for 25 minutes at 37°C. Digested tissue isolates were trin-1 and confers an axon-attracting response.10 In ad- resuspended in M199 with Earle salts, supplemented with dition to the attractive response of this interaction, netrin-1 10% fetal bovine serum (Invitrogen, Carlsbad, California). Samples were then triturated in this solution to generate sus- and the DCC gene product (hereinafter, DCC) also lead 14-16 pensions of individual neuronal and glial cells and plated on to axon outgrowth mediated by second messengers. culture dishes precoated with laminin (Sigma). Subse- Although most of the studies of netrin-1 have fo- quently, the cells were cultured for 48 to 120 hours with cused on the central nervous system, some investiga- 50% fresh medium changes every 2 days for cells cultured tions17,18 have also demonstrated its activity in the pe- longer than 48 hours. riphery. Netrin-1 has been implicated in the guidance of retinal ganglion cells to appropriate central targets in the IMMUNOHISTOCHEMICAL visual system. Additional data suggest that netrin-1 is in- ANALYSIS FOR DCC volved in the embryogenesis of the otic epithelium8 as well as in the development of the semicircular canals.19 Following 48 hours in culture, the neurons were fixed with 4% Recently, netrin-1 protein has been shown to be ex- paraformaldehyde for 15 minutes, incubated in 90% metha- pressed in early postnatal rat cochlea.20 nol and 0.3% hydrogen peroxide, and blocked with 2% nor- In the present study, we investigated the expression mal horse serum, 1% bovine serum albumin, and 0.2% Triton of DCC in the inner ear of developmentally mature mice X-100 detergent (Sigma). The cultured cells were then incu- bated with mouse monoclonal anti-DCC antibody (5 µg/mL) at both the messenger RNA (mRNA) and protein levels (Oncogene Research Products, Boston, Massachusetts) di- and netrin-1 expression at the mRNA level. We also show luted 1:500 in phosphate-buffered saline with 2% normal horse functional data indicating that the auditory neurons of serum and 0.2% Triton X-100 detergent overnight at 4°C, then young developmentally mature animals maintain their in biotinylated antimouse IgG (Vector Laboratories, Burlin- ability to elongate and change the direction of axon ex- game, California) for 2 hours at room temperature, followed tension in response to netrin-1 in vitro. Our results may by streptavidin Alexa Fluor 488 (Molecular Probes) for 2 hours be the basis for further investigation leading to new strat- at room temperature. A no–primary antibody negative control egies to advance cochlear implant function. was performed with each experiment. The labeled neurons were viewed with an epifluorescence microscope (Nikon Instru- ments, Melville, New York). METHODS EXOGENOUS NETRIN-1 IN VITRO EXPERIMENTAL ANIMALS All experiments were performed using tissue from C57 mice, Dissociated spiral ganglion cells were prepared as described postnatal day 28 to 35 (P28-P35) obtained from Charles River in the “Ganglion Cell Cultures” subsection and cultured for Laboratories (Wilmington, Massachusetts) and acoustic gan- 120 hours with 1-, 10-, 100-, 200-, or 500-ng/mL recombi- glia from white leghorn chickens, posthatch day 10 to 14 from nant chick netrin-1 (R&D Systems, Minneapolis, Minne- Spafas (Preston, Connecticut). sota), or with no exogenous netrin-1 (negative control). The neurons were fixed and immunolabeled with the neuron- specific ßIII tubulin antibody marker TuJ-1 (2 µg/mL REVERSE TRANSCRIPTION–POLYMERASE diluted 1:500, mouse monoclonal anti-ßIII tubulin antibody; REACTION Covance, Berkeley, California), followed by biotinylated sec- ondary antibody and the ABC Elite Kit with diaminobenzi- Total RNA was isolated from pooled samples of spiral ganglia dine detection (Vector Laboratories). These specimens were and organs of Corti microdissected from 5 to 6 C57 mice using viewed with an Axiovert 135 inverted microscope (Zeiss Ultraspec RNA (Biotecx Laboratories, Houston, Texas) and con- MicroImaging, Thornwood, New York). All images were taminating genomic DNA was removed with RNase-free DNase digitized with a Nikon Coolpix 990 digital camera, and neu- I. Published sequences for netrin-1 (Serafini et al7) and DCC rite lengths were quantified using National Institutes of (Fearon et al13) in mice were used to design the following prim- Health Image J free downloadable software. ers: 5ЈAGTSTGTCTCAACTGCCGCC3Ј (netrin-1 sense), 5ЈTACACGGAGATGATGTTCACGG3Ј (netrin-1 antisense), 5ЈAGTGCCTCTCATTCAGGTCAGG3Ј (DCC sense), and HEK293–NETRIN-1 CELLS AND ACOUSTIC 5ЈTCACAGACTGAGTTCTTCCTGC3Ј (DCC antisense). Re- GANGLION CELL COCULTURES verse transcription–polymerase chain reaction (RT-PCR) was performed using the RNA Gene Amp kit (Applied Biosystems, Human embryonic kidney (HEK293) cells stably transfected Foster
Load more

Recommended publications
  • UNIVERSITY of CALIFORNIA, IRVINE Netrin-Mediated Signaling
    UNIVERSITY OF CALIFORNIA, IRVINE Netrin-mediated signaling directs central neuron dendrite growth and connectivity in the developing vertebrate visual system DISSERTATION submitted in partial satisfaction of the requirements for the degree of DOCTOR OF PHILOSOPHY in Biological Sciences by Anastasia Nicole Nagel Dissertation Committee: Professor Susana Cohen-Cory, Chair Associate Professor Karina S. Cramer Professor Georg F. Striedter 2015 © 2015 Anastasia Nicole Nagel DEDICATION To those who have supported me in my pursuit of understanding the natural world: my husband, family, friends and those who we have lost along the way but who remain present in spirit. “There are naive questions, tedious questions, ill-phrased questions, questions put after inadequate self-criticism. But every question is a cry to understand the world. There is no such thing as a dumb question.” Carl Sagan, The Demon-Haunted World: Science as a Candle in the Dark ii TABLE OF CONTENTS Page LIST OF FIGURES iv ACKNOWLEDGMENTS vi CURRICULUM VITAE vii ABSTRACT OF THE DISSERTATION x INTRODUCTION 1 CHAPTER 1: Molecular signals regulate visual system development 4 Netrin regulates neurodevelopment through diverse receptor binding 9 The role of netrin-1 in retinotectal circuit formation 19 Summary and objectives 27 CHAPTER 2: Netrin directs dendrite growth and connectivity in vivo 29 Introduction 29 Materials and Methods 31 Results 36 Discussion 64 CHAPTER 3: DCC and UNC5 Netrin receptor signaling guides dendritogenesis 70 Introduction 70 Materials and Methods 72 Results 77 Discussion 102 CHAPTER 4: Decreases in Netrin signaling impact visual system function 113 Introduction 113 Materials and Methods 114 Results 116 Discussion 121 CHAPTER 5: Summary and Conclusions 122 REFERENCES 129 iii LIST OF FIGURES Page Figure 1.1 Neuron during general developmental processes 5 Figure 1.2 Signaling molecules that direct visual system formation 8 Figure 1.3 Schematic representation of a netrin-1 gradient in the spinal cord 13 Figure 1.4 Diagram of the X.
    [Show full text]
  • Integrinɑ3 Is Required for Late Postnatal Stability of Dendrite
    6742 • The Journal of Neuroscience, April 17, 2013 • 33(16):6742–6752 Cellular/Molecular Integrin ␣3 Is Required for Late Postnatal Stability of Dendrite Arbors, Dendritic Spines and Synapses, and Mouse Behavior Meghan E. Kerrisk,1 Charles A. Greer,2,3,4 and Anthony J. Koleske1,2,4,5 Departments of 1Molecular Biophysics and Biochemistry, 2Neurobiology, and 3Neurosurgery, and 4Interdepartmental Neuroscience Program, Yale University, New Haven, Connecticut 06520, and 5Program in Cellular Neuroscience, Neurodegeneration, and Repair, Yale University, New Haven, Connecticut 06536 Most dendrite branches and a large fraction of dendritic spines in the adult rodent forebrain are stable for extended periods of time. Destabilization of these structures compromises brain function and is a major contributing factor to psychiatric and neurodegenerative diseases. Integrins are a class of transmembrane extracellular matrix receptors that function as ␣␤ heterodimers and activate signaling cascades regulating the actin cytoskeleton. Here we identify integrin ␣3 as a key mediator of neuronal stability. Dendrites, dendritic spines, and synapses develop normally in mice with selective loss of integrin ␣3 in excitatory forebrain neurons, reaching their mature sizes and densities through postnatal day 21 (P21). However, by P42, integrin ␣3 mutant mice exhibit significant reductions in hippocam- pal dendrite arbor size and complexity, loss of dendritic spine and synapse densities, and impairments in hippocampal-dependent behavior. Furthermore, gene-dosage experiments demonstrate that integrin ␣3 interacts functionally with the Arg nonreceptor tyrosine kinase to activate p190RhoGAP, which inhibits RhoA GTPase and regulates hippocampal dendrite and synapse stability and mouse behavior. Together, our data support a fundamental role for integrin ␣3 in regulating dendrite arbor stability, synapse maintenance, and proper hippocampal function.
    [Show full text]
  • Turning of Retinal Growth Cones in a Netrin-1 Gradient Mediated by the Netrin Receptor DCC
    Neuron, Vol. 19, 1211±1224, December, 1997, Copyright 1997 by Cell Press Turning of Retinal Growth Cones in a Netrin-1 Gradient Mediated by the Netrin Receptor DCC Jose R. de la Torre,* Veit H. HoÈ pker,² Guo-li Ming,² project to the midline (Harris et al., 1996; Mitchell et al., Mu-ming Poo,² Marc Tessier-Lavigne,*§ 1996). In addition to their apparent roles in attraction, ³ ² Ali Hemmati-Brivanlou, and Christine E. Holt k the netrins have been implicated as repellents of axons *Howard Hughes Medical Institute that migrate away from the midline in both C. elegans Departments of Anatomy and vertebrates (Colamarino and Tessier-Lavigne, 1995; and of Biochemistry and Biophysics Wadsworth et al., 1996; Varela-Echavarria et al., 1997). University of California Furthermore, genetic and biochemical evidence sug- San Francisco, California 94143-0452 gests that the attractive and repulsive actions of netrin ² Department of Biology proteins might involve different functional domains of University of California the netrin molecules and may be mediated by distinct San Diego, California 92039 receptor mechanisms (Hedgecock et al., 1990; Leung- ³ The Rockefeller University Hagesteijn et al., 1992; Chan et al., 1996; Keino-Masu New York, New York 10021-6399 et al., 1996; Kolodziej et al., 1996; Wadsworth et al., 1996; Ackerman et al., 1997; Leonardo et al., 1997). In addition to this role in midline guidance, studies in a Summary variety of vertebrate species have implicated netrins in guidance in many different regions of the nervous sys- Netrin-1 promotes outgrowth of axons in vitro through tem apart from midline regions (Kennedy et al., 1994; the receptor Deleted in Colorectal Cancer (DCC) and Serafini et al., 1996; Shirasaki et al., 1996; Lauderdale elicits turning of axons within embryonic explants et al., 1997; Livesey and Hunt, 1997; Me tin et al., 1997; when presented as a point source.
    [Show full text]
  • Phosphorylation of DCC by ERK2 Is Facilitated By&Nbsp;Direct Docking of the Receptor P1 Domain To&Nbsp;The&Nbsp;Kina
    Structure Article Phosphorylation of DCC by ERK2 Is Facilitated by Direct Docking of the Receptor P1 Domain to the Kinase Wenfu Ma,1,2 Yuan Shang,3 Zhiyi Wei,3 Wenyu Wen,1,2 Wenning Wang,1,2,* and Mingjie Zhang1,2,3,* 1Department of Chemistry 2Institute of Biomedical Sciences Fudan University, Shanghai, P.R. China 3Division of Life Science, Molecular Neuroscience Center, State Key Laboratory of Molecular Neuroscience, Hong Kong University of Science and Technology, Clearwater Bay, Kowloon, Hong Kong, P. R. China *Correspondence: [email protected] (W.W.), [email protected] (M.Z.) DOI 10.1016/j.str.2010.08.011 SUMMARY domains or catalytic activity have been identified thus far for the DCC cytoplasmic domain. Both in vitro and in vivo studies Netrin receptor DCC plays critical roles in many have demonstrated that the attractive response of DCC to cellular processes, including axonal outgrowth and netrins specifically originates from the cytoplasmic domain of migration, angiogenesis, and apoptosis, but the the receptor, as a chimera DCC in which the extracellular portion molecular basis of DCC-mediated signaling is largely of DCC is fused with the cytoplasmic part of UNC5 elicited unclear. ERK2, a member of the MAPK family, is one repulsive responses to netrin (Hong et al., 1999; Keleman and of the few proteins known to be involved in DCC- Dickson, 2001). Due to the lack of catalytic motifs in its intracel- lular domain, DCC is thought to transmit its signal by binding to mediated signaling. Here, we report that ERK2 its downstream proteins. Identification of DCC intracellular directly interacts with DCC, and the ERK2-binding domain binding partners has helped in understanding netrin/ region was mapped to the conserved intracellular DCC downstream signaling events.
    [Show full text]
  • Complete Loss of Netrin-1 Results in Embryonic Lethality and Severe Axon Guidance Defects Without Increased Neural Cell Death
    Report Complete Loss of Netrin-1 Results in Embryonic Lethality and Severe Axon Guidance Defects without Increased Neural Cell Death Graphical Abstract Authors Jenea M. Bin, Dong Han, Karen Lai Wing Sun, ..., Jean-Francois Cloutier, Artur Kania, Timothy E. Kennedy Correspondence [email protected] In Brief Bin et al. have generated a netrin-1 null mouse that displays phenotypes more severe than those of the reported netrin-1 gene-trap mouse, including embryonic lethality and exacerbated axon guidance defects. No increased apoptosis was detected, indicating that netrin-1 is not an essential dependence ligand, despite increased DCC and neogenin in netrin-1 nulls. Highlights d Generated netrin-1 floxed allele and complete netrin-1 null mouse lines d Complete netrin-1 loss-of-function causes embryonic lethality d Absence of netrin-1 increases DCC and neogenin protein expression d Netrin-1 is not an essential dependence ligand in the developing spinal cord Bin et al., 2015, Cell Reports 12, 1099–1106 August 18, 2015 ª2015 The Authors http://dx.doi.org/10.1016/j.celrep.2015.07.028 Cell Reports Report Complete Loss of Netrin-1 Results in Embryonic Lethality and Severe Axon Guidance Defects without Increased Neural Cell Death Jenea M. Bin,1,3,6 Dong Han,1,6 Karen Lai Wing Sun,1,3 Louis-Philippe Croteau,2,3,4,5 Emilie Dumontier,1 Jean-Francois Cloutier,1,3 Artur Kania,2,3,4,5 and Timothy E. Kennedy1,3,* 1Department of Neurology and Neurosurgery, Montreal Neurological Institute, McGill University, Montre´ al, QC H3A 2B4, Canada 2Institut
    [Show full text]
  • Netrin-1 Is a Novel Myelin-Associated Inhibitor to Axon Growth
    The Journal of Neuroscience, January 30, 2008 • 28(5):1099–1108 • 1099 Cellular/Molecular Netrin-1 Is a Novel Myelin-Associated Inhibitor to Axon Growth Karin Lo¨w,1 Maya Culbertson,1 Frank Bradke,2 Marc Tessier-Lavigne,2 and Mark H. Tuszynski1,3 1Department of Neurosciences, University of California-San Diego, La Jolla, California 92093, 2Department of Biological Sciences, Howard Hughes Medical Institute, Stanford University, Palo Alto, California 94305, and 3Veterans Affairs Medical Center, San Diego, California 92161 We investigated the influence of the bifunctional guidance molecule netrin-1 on axonal growth in the injured adult spinal cord. In the adult, netrin-1 is expressed on mature oligodendrocytes, cells of the central canal, and the meninges. Netrin-1 protein in white matter is selectively enriched adjacent to paranodal loops of myelin in nodes of Ranvier. The repulsion-mediating netrin-1 uncoordinated-5 (UNC5) receptors are expressed by neurons of the corticospinal and rubrospinal projections, and by intrinsic neurons of the spinal cord, both before and after spinal cord injury. Neutralization of netrin-1 in myelin prepared from adult rat spinal cord using UNC5 receptor bodies increases neurite outgrowth from UNC5-expressing spinal motor neurons in vitro. Furthermore, axon regeneration is inhibited in a netrin-1-enriched zone, devoid of other myelin-associated inhibitors, within spinal cord lesion sites in vivo. We conclude that netrin-1 is a novel oligodendrocyte-associated inhibitor that can contribute to axonal growth failure after adult spinal cord injury. Key words: spinal cord injury; axon regeneration; white matter inhibition; netrin-1; UNC5; DCC; nogo; MAG; OMgp; retrovirus; plasticity; corticospinal; rubrospinal; intraspinal Introduction nation of both UNC5 and DCC receptors is required to mediate Netrin-1 is a bifunctional ligand that can either attract or repel long range repulsion of axons in the presence of low concentra- axons.
    [Show full text]
  • Somamer Reagents Generated to Human Proteins Number Somamer Seqid Analyte Name Uniprot ID 1 5227-60
    SOMAmer Reagents Generated to Human Proteins The exact content of any pre-specified menu offered by SomaLogic may be altered on an ongoing basis, including the addition of SOMAmer reagents as they are created, and the removal of others if deemed necessary, as we continue to improve the performance of the SOMAscan assay. However, the client will know the exact content at the time of study contracting. SomaLogic reserves the right to alter the menu at any time in its sole discretion. Number SOMAmer SeqID Analyte Name UniProt ID 1 5227-60 [Pyruvate dehydrogenase (acetyl-transferring)] kinase isozyme 1, mitochondrial Q15118 2 14156-33 14-3-3 protein beta/alpha P31946 3 14157-21 14-3-3 protein epsilon P62258 P31946, P62258, P61981, Q04917, 4 4179-57 14-3-3 protein family P27348, P63104, P31947 5 4829-43 14-3-3 protein sigma P31947 6 7625-27 14-3-3 protein theta P27348 7 5858-6 14-3-3 protein zeta/delta P63104 8 4995-16 15-hydroxyprostaglandin dehydrogenase [NAD(+)] P15428 9 4563-61 1-phosphatidylinositol 4,5-bisphosphate phosphodiesterase gamma-1 P19174 10 10361-25 2'-5'-oligoadenylate synthase 1 P00973 11 3898-5 26S proteasome non-ATPase regulatory subunit 7 P51665 12 5230-99 3-hydroxy-3-methylglutaryl-coenzyme A reductase P04035 13 4217-49 3-hydroxyacyl-CoA dehydrogenase type-2 Q99714 14 5861-78 3-hydroxyanthranilate 3,4-dioxygenase P46952 15 4693-72 3-hydroxyisobutyrate dehydrogenase, mitochondrial P31937 16 4460-8 3-phosphoinositide-dependent protein kinase 1 O15530 17 5026-66 40S ribosomal protein S3 P23396 18 5484-63 40S ribosomal protein
    [Show full text]
  • Candidate SNP Analyses Integrated with Mrna Expression and Hormone
    bioRxiv preprint doi: https://doi.org/10.1101/259002; this version posted February 2, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Candidate SNP analyses integrated with mRNA expression and hormone levels reveal influence on mammographic density and breast cancer risk Biong M.1, Suderman M.2,3,4*, Haakensen VD.1,5*, Kulle B.6,7, Berg PR.8, Gram I.T.9,Dumeaux V.9, Ursin G.10,11,12, Helland Å1, H Hallett M.2, Børresen-Dale AL1,5, Kristensen V.N.1,5,13 Affiliations 1Department of Genetics, Institute for Cancer Research, The Norwegian Radium Hospital, Montebello 0310, Oslo, Norway 2Goodman Cancer Centre and McGill Centre for Bioinformatics, Montreal, Quebec, 3649 Sir William Osler, Montreal, Quebec, H3G 1Y6, Canada. 3Sackler Program for Epigenetics & Developmental Psychobiology at McGill University, McGill University, 3655 Promenade Sir William Osler, Montreal, Quebec, H3G 1Y6, Canada. 4Department of Pharmacology and Therapeutics, McGill University, 3655 Promenade Sir William Osler, Montreal, Quebec, H3G 1Y6, Canada. 5Institute for Clinical Medicine, Faculty of Medicine, University of Oslo, Oslo, NO-0315, Norway 6Epi-Gen, Institute of Clinical Medicine, Akershus University Hospital, University of Oslo Oslo, Norway 7Department of Biostatistics, Institute for Basic Medical Science, University of Oslo, Oslo, Norway 8Centre for Integrative Genetics, The Norwegian University of Life Sciences, Aas, Norway 9Institute of Community Medicine, Faculty of Health Sciences, University of Tromsø, Norway 10Cancer Registry of Norway, Oslo. Norway 11Department of Nutrition, School of Medicine, University of Oslo, Oslo, NO-0315, Norway 12Department of Preventive Medicine University of Southern California, Keck School of Medicine, Los Angeles, CA, USA 1 bioRxiv preprint doi: https://doi.org/10.1101/259002; this version posted February 2, 2018.
    [Show full text]
  • Differential Expression of Neurogenes Among Breast Cancer Subtypes Identifies High Risk Patients
    Differential expression of neurogenes among breast cancer subtypes identifies high risk patients The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation Fernández-Nogueira, Patricia, Paloma Bragado, Vanessa Almendro, Elisabet Ametller, Jose Rios, Sibgat Choudhury, Mario Mancino, and Pedro Gascón. 2016. “Differential expression of neurogenes among breast cancer subtypes identifies high risk patients.” Oncotarget 7 (5): 5313-5326. doi:10.18632/oncotarget.6543. http:// dx.doi.org/10.18632/oncotarget.6543. Published Version doi:10.18632/oncotarget.6543 Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:27320293 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA www.impactjournals.com/oncotarget/ Oncotarget, Vol. 7, No. 5 Differential expression of neurogenes among breast cancer subtypes identifies high risk patients Patricia Fernández-Nogueira1,3, Paloma Bragado1, Vanessa Almendro4, Elisabet Ametller1,2, Jose Rios5,6, Sibgat Choudhury4, Mario Mancino1,2,*, Pedro Gascón1,2,3,* 1Department of Medical Oncology, Hospital Clínic, Barcelona, Spain 2Institut d’Investigacions Biomediques August Pi i Sunyer Barcelona, Barcelona, Spain 3Department of Medicine, University of Barcelona, Barcelona, Spain 4 Division of Medical Oncology, Department of Medicine, Harvard
    [Show full text]
  • Widespread Expression of Netrin-1 by Neurons and Oligodendrocytes in the Adult Mammalian Spinal Cord
    The Journal of Neuroscience, June 1, 2001, 21(11):3911–3922 Widespread Expression of Netrin-1 by Neurons and Oligodendrocytes in the Adult Mammalian Spinal Cord Colleen Manitt,1 Michael A. Colicos,1 Katherine M. Thompson,1 Etienne Rousselle,1 Alan C. Peterson,2 and Timothy E. Kennedy1 1Centre for Neuronal Survival, Montreal Neurological Institute, and 2Molecular Oncology Group, Royal Victoria Hospital, McGill University, Montreal, Quebec, Canada, H3A 2B4 Netrins are a family of secreted proteins that function as che- spinal cord the majority of netrin-1 protein is not freely soluble motropic axon guidance cues during neural development. Here but is associated with membranes or the extracellular matrix. we demonstrate that netrin-1 continues to be expressed in the Fractionation of adult spinal cord white matter demonstrated adult rat spinal cord at a level similar to that in the embryonic that netrin-1 was absent from fractions enriched for compact CNS. In contrast, netrin-3, which is also expressed in the myelin but was enriched in fractions containing periaxonal embryonic spinal cord, was not detected in the adult. In situ myelin and axolemma, indicating that netrin-1 protein may be hybridization analysis demonstrated that cells in the white mat- localized to the periaxonal space. These findings suggest that ter and the gray matter of the adult spinal cord express netrin-1. in addition to its role as a long-range guidance cue for devel- Colocalization studies using the neuronal marker NeuN re- oping axons, netrin may have a short-range function associated vealed that netrin-1 is expressed by multiple classes of spinal with the cell surface that contributes to the maintenance of interneurons and motoneurons.
    [Show full text]
  • Netrin 1 Guides Neuronal Migration 1361 Previously Hybridised for Netrin 1 Expression, Were Immunolabeled Background Levels
    Development 127, 1359-1372 (2000) 1359 Printed in Great Britain © The Company of Biologists Limited 2000 DEV9687 Netrin 1 acts as an attractive or as a repulsive cue for distinct migrating neurons during the development of the cerebellar system S. Alcántara1,2,*, M. Ruiz1, F. De Castro2, E. Soriano1 and C. Sotelo2 1Department of Animal and Plant Cell Biology, Faculty of Biology, University of Barcelona, Barcelona E 08028, Spain 2Institut National de la Santé et de la Recherche Médicale U-106, Hôpital de la Salpétrière, 75651 Paris Cédex 13, France *Author for correspondence (e-mail: [email protected]) Accepted 14 January; published on WWW 7 March 2000 SUMMARY Netrin 1 is a long-range diffusible factor that exerts postnatal cerebellum, netrin 1 repels both the parallel chemoattractive or chemorepulsive effects on developing fibres and migrating granule cells growing out from axons growing to or away from the neural midline. Here explants taken from the external germinal layer. The we used tissue explants to study the action of netrin 1 in the developmental patterns of expression in vivo of netrin 1 and migration of several cerebellar and precerebellar cell its receptors are consistent with the notion that netrin 1 progenitors. We show that netrin 1 exerts a strong secreted in the midline acts as chemoattractive cue for chemoattractive effect on migrating neurons from the precerebellar neurons migrating circumferentially along embryonic lower rhombic lip at E12-E14, which give rise the extramural stream. Similarly, the pattern of expression to precerebellar nuclei. Netrin 1 promotes the exit of in the postnatal cerebellum suggests that netrin 1 could postmitotic migrating neurons from the embryonic lower regulate the tangential migration of postmitotic rhombic lip and upregulates the expression of TAG-1 in premigratory granule cells.
    [Show full text]
  • Receptors That Mediate Cellular Dependence
    Cell Death and Differentiation (2005) 12, 1031–1043 & 2005 Nature Publishing Group All rights reserved 1350-9047/05 $30.00 www.nature.com/cdd Review Receptors that mediate cellular dependence DE Bredesen*,1,2, P Mehlen1,3 and S Rabizadeh1 cell death (PCD) initiated by a loss of adhesion. Other cells may undergo PCD following the withdrawal of trophic factors 1 The Buck Institute for Age Research, Novato, CA 94945, USA (e.g., the neurotrophins), cytokines, hormonal support, 2 University of California, San Francisco, San Francisco, CA 94143, USA electrical activity, or other stimuli.2 3 Apoptose, Cancer et De´veloppement, Centre Le´on Be´rard – CNRS FRE2870, Depending on the cell type and its state of differentiation, 28 rue Laennec, 69008 Lyon, France cells require different supportive stimuli for survival. For * Corresponding author: DE Bredesen, The Buck Institute for Age Research, 8001 Redwood Blvd., Novato, CA 94945, USA. example, prostate epithelial cells may require testosterone for Tel: þ 1 415 209 2084; Fax: þ 1 415 209 2230; survival, and for such cells the withdrawal of testosterone leads E-mail: [email protected] to apoptosis. Therefore, prostate neoplasms are often treated by withdrawing testosterone because this induces apoptosis, Received 08.3.05; revised 30.3.05; accepted 26.4.05 and thus tumor shrinkage; unfortunately, the few remaining Edited by G Melino cells that are androgen independent typically repopulate the tumors, and therefore alternative therapy is required. Abstract For any given required stimulus, withdrawal leads to PCD; that is, the loss of trophic support somehow triggers an active Cells depend for their survival on stimulation by trophic process of cell suicide.
    [Show full text]