Promotion of Neurite Outgrowth and Axon Guidance in Spiral Ganglion Cells by Netrin-1

ORIGINAL ARTICLE Promotion of Neurite Outgrowth and Axon Guidance in Spiral Ganglion Cells by Netrin-1

Kenneth H. Lee, MD, PhD; Mark E. Warchol, PhD

Objective: To identify the expression of netrin-1, a Results: Netrin-1 and DCC mRNA expression were found diffusible chemoattractive molecule, and its receptor, in the mouse organ of Corti and spiral ganglion cells by deleted in colorectal carcinoma (DCC), in the devel- RT-PCR. Application of exogenous netrin-1 led to a dos- opmentally mature inner ear, and to determine its age-dependent increase in neurite length in cultured spi- effects on axon length and guidance in cultured auditory ral ganglion cells. Chick acoustic ganglion cells cocul- neurons. tured with netrin-1–secreting cells demonstrated statistically significant preferential extension toward the source of netrin-1 (P =.04). Design: Messenger RNA (mRNA) and protein expression of netrin-1 and DCC were identified in the organ of Conclusions: Netrin-1 and DCC are expressed in the or- Corti and spiral ganglion cells using reverse transcription– gan of Corti and spiral ganglion cells of developmen- polymerase chain reaction (RT-PCR) and fluorescence tally mature mice. Exogenous netrin-1 promotes dosage- immunohistochemical analysis. In vitro experiments ex- dependent neurite growth in vitro. Mature auditory amined the effects of exogenous netrin-1 on spiral gan- neurons preferentially direct neurite extension toward glion cell axon length. Auditory neurons were cocul- netrin-1 released in culture. These findings may lead to tured with a cell line secreting netrin-1 to determine the the development of strategies to optimize the interface effect on direction of axon extension. between electrode arrays and spiral ganglion cells, re- sulting in improved cochlear implant performance. Subjects: Young C57 mice and posthatched white leghorn chicks. Arch Otolaryngol Head Neck Surg. 2008;134(2):146-151

ECENT ADVANCES IN COCH- glion neurite outgrowth may lead to ran- lear implant hardware dom patterns of axon extension, result- design have included strat- ing in decreased cochlear implant function. egies to position the elec- An understanding of the innate molecu- trode array more medially lar mechanisms that establish and main- toR hug the modiolus and bring the stimu- tain the precise tonotopic organization of lating electrodes closer to the spiral gan- the inner ear may be essential to develop glion cells. In theory, this would lower strategies for highly controlled neurite out- stimulation thresholds, improve battery life growth necessary to achieve improved by decreasing power consumption, and ex- cochlear implant function. pand the dynamic range of the stimu- Netrin-1 is a member of a family of se- lus.1-3 Implementing such strategies has led creted laminin-related proteins and has to improved cochlear implant function.4,5 been shown to attract commissural axons Author Affiliations: Stimulating the outgrowth of spiral gan- to the midline of the spinal cord during de- Departments of 6,7 Otolaryngology–Head and Neck glion cell axons would be another means velopment. The family of peptides known Surgery (Drs Lee and Warchol) to achieve this objective. Decreasing the as netrins are highly conserved across sev- and Anatomy and Neurobiology distance between the electrodes and their eral species and can act both at short range (Dr Warchol), Washington stimulus targets may provide a mecha- as well as long range to guide growing axons University School of Medicine, nism that would enhance frequency se- to appropriate innervation targets.8,9 Net- St Louis, Missouri. Dr Lee is lectivity and dynamic range. Such ben- rins are bifunctional molecules in that they now with the Department of efits would not only augment speech can mediate either attraction or repulsion, Otolaryngology–Head and Neck Surgery, University of Texas recognition but may also improve the tonal based on their interactions with different 10,11 Southwestern Medical Center at quality of sound and potentially allow im- receptor families or based on levels of Dallas, and Children’s Medical plant users to better appreciate music. second messengers such as cyclic adeno- Center Dallas. However, simple stimulation of spiral gan- sine monophosphate.12

(REPRINTED) ARCH OTOLARYNGOL HEAD NECK SURG/ VOL 134 (NO. 2), FEB 2008 WWW.ARCHOTO.COM 146

©2008 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 09/23/2021 Deleted in Colorectal Carcinoma (DCC) is a gene that 25mM Hepes. Each ganglion was further dissected into has shown to be mutated in metastatic human colorec- smaller fragments, pooled, and digested in trypsin, 25%, tal cancer.13 This gene encodes a receptor that binds ne- (Sigma) for 25 minutes at 37°C. Digested tissue isolates were trin-1 and confers an axon-attracting response.10 In ad- resuspended in M199 with Earle salts, supplemented with dition to the attractive response of this interaction, netrin-1 10% fetal bovine serum (Invitrogen, Carlsbad, California). Samples were then triturated in this solution to generate sus- and the DCC gene product (hereinafter, DCC) also lead 14-16 pensions of individual neuronal and glial cells and plated on to axon outgrowth mediated by second messengers. culture dishes precoated with laminin (Sigma). Subse- Although most of the studies of netrin-1 have fo- quently, the cells were cultured for 48 to 120 hours with cused on the central nervous system, some investiga- 50% fresh medium changes every 2 days for cells cultured tions17,18 have also demonstrated its activity in the pe- longer than 48 hours. riphery. Netrin-1 has been implicated in the guidance of retinal ganglion cells to appropriate central targets in the IMMUNOHISTOCHEMICAL visual system. Additional data suggest that netrin-1 is in- ANALYSIS FOR DCC volved in the embryogenesis of the otic epithelium8 as well as in the development of the semicircular canals.19 Following 48 hours in culture, the neurons were fixed with 4% Recently, netrin-1 protein has been shown to be ex- paraformaldehyde for 15 minutes, incubated in 90% metha- pressed in early postnatal rat cochlea.20 nol and 0.3% hydrogen peroxide, and blocked with 2% nor- In the present study, we investigated the expression mal horse serum, 1% bovine serum albumin, and 0.2% Triton of DCC in the inner ear of developmentally mature mice X-100 detergent (Sigma). The cultured cells were then incubated with mouse monoclonal anti-DCC antibody (5 µg/mL) at both the messenger RNA (mRNA) and protein levels (Oncogene Research Products, Boston, Massachusetts) di- and netrin-1 expression at the mRNA level. We also show luted 1:500 in phosphate-buffered saline with 2% normal horse functional data indicating that the auditory neurons of serum and 0.2% Triton X-100 detergent overnight at 4°C, then young developmentally mature animals maintain their in biotinylated antimouse IgG (Vector Laboratories, Burlin- ability to elongate and change the direction of axon ex- game, California) for 2 hours at room temperature, followed tension in response to netrin-1 in vitro. Our results may by streptavidin Alexa Fluor 488 (Molecular Probes) for 2 hours be the basis for further investigation leading to new strat- at room temperature. A no–primary antibody negative control egies to advance cochlear implant function. was performed with each experiment. The labeled neurons were viewed with an epifluorescence microscope (Nikon Instru- ments, Melville, New York). METHODS EXOGENOUS NETRIN-1 IN VITRO EXPERIMENTAL ANIMALS All experiments were performed using tissue from C57 mice, Dissociated spiral ganglion cells were prepared as described postnatal day 28 to 35 (P28-P35) obtained from Charles River in the “Ganglion Cell Cultures” subsection and cultured for Laboratories (Wilmington, Massachusetts) and acoustic gan- 120 hours with 1-, 10-, 100-, 200-, or 500-ng/mL recombi- glia from white leghorn chickens, posthatch day 10 to 14 from nant chick netrin-1 (R&D Systems, Minneapolis, Minne- Spafas (Preston, Connecticut). sota), or with no exogenous netrin-1 (negative control). The neurons were fixed and immunolabeled with the neuron- specific ßIII tubulin antibody marker TuJ-1 (2 µg/mL REVERSE TRANSCRIPTION–POLYMERASE diluted 1:500, mouse monoclonal anti-ßIII tubulin antibody; REACTION Covance, Berkeley, California), followed by biotinylated sec- ondary antibody and the ABC Elite Kit with diaminobenzi- Total RNA was isolated from pooled samples of spiral ganglia dine detection (Vector Laboratories). These specimens were and organs of Corti microdissected from 5 to 6 C57 mice using viewed with an Axiovert 135 inverted microscope (Zeiss Ultraspec RNA (Biotecx Laboratories, Houston, Texas) and con- MicroImaging, Thornwood, New York). All images were taminating genomic DNA was removed with RNase-free DNase digitized with a Nikon Coolpix 990 digital camera, and neu- I. Published sequences for netrin-1 (Serafini et al7) and DCC rite lengths were quantified using National Institutes of (Fearon et al13) in mice were used to design the following prim- Health Image J free downloadable software. ers: 5ЈAGTSTGTCTCAACTGCCGCC3Ј (netrin-1 sense), 5ЈTACACGGAGATGATGTTCACGG3Ј (netrin-1 antisense), 5ЈAGTGCCTCTCATTCAGGTCAGG3Ј (DCC sense), and HEK293–NETRIN-1 CELLS AND ACOUSTIC 5ЈTCACAGACTGAGTTCTTCCTGC3Ј (DCC antisense). Re- GANGLION CELL COCULTURES verse transcription–polymerase chain reaction (RT-PCR) was performed using the RNA Gene Amp kit (Applied Biosystems, Human embryonic kidney (HEK293) cells stably transfected Foster City, California). Thirty-five cycles of amplification were with human netrin-1 were obtained as a gift from Yi Rao, PhD. performed with 95°C denaturing, 55°C annealing, both for 30 The HEK293–netrin-1–secreting cells were suspended in 10 µL seconds, and 72°C extension for 60 seconds. Each experiment growth factor–reduced matrix gel (Matrigel; Becton- included a no-RT negative control. Reaction products (10 µL) Dickenson, Bedford, Massachusetts). The cell suspensions were were then analyzed on an agarose gel, 2%, with 100–base pair placed along the edges of 35-mm culture dishes (MatTek Corp, DNA ladder size standard and stained with Cybergreen (Mo- Ashland, Massachusetts) and warmed to 37°C to allow Matri- lecular Probes, Eugene, Oregon). gel polymerization. Subsequently, dissociated chick acoustic ganglion cells were prepared as described in the previous sub- GANGLION CELL CULTURES section and plated on laminin-coated culture dishes. The ganglion cells were cocultured with the HEK293-netrin-1 cells for Spiral ganglia were microdissected and placed in M199 48 hours in M199 with Earl salts and 10% fetal bovine serum, medium (Sigma, St Louis, Missouri) with Hank salts and and the neurons were then processed for labeling with TuJ-1,

(REPRINTED) ARCH OTOLARYNGOL HEAD NECK SURG/ VOL 134 (NO. 2), FEB 2008 WWW.ARCHOTO.COM 147

©2008 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 09/23/2021 ral ganglion RNA. In addition, netrin-1 mRNA was de- Netrin-1 DCC tected in spiral ganglion cells and DCC mRNA in the or- +RT – RTM +RT – RT gan of Corti (Figure 1). Negative-control PCR without RT showed no products, demonstrating that the bands seen reflect amplification of mRNA and not contaminat- ing genomic DNA. These results indicate that the genes for netrin-1 and DCC are actively transcribed in postnatal mouse inner ear. Organ of Corti Spiral Ganglion LOCALIZATION OF DCC PROTEIN Figure 1. Netrin-1 and deleted in colorectal carcinoma (DCC) messenger IN CULTURED SPIRAL GANGLION CELLS RNA are identified by reverse transcription (RT)-polymerase chain reaction amplification from total RNA isolated from the organ of Corti and spiral Spiral ganglion cell suspensions were prepared from post- ganglia of postnatal C57 mice, respectively. A total of 10 µL of each reaction product was analyzed on agarose gel, 2%, and stained with Cybergreen natal mice and cultured for 48 hours. These cultures were (Molecular Probes, Eugene, Oregon). Reaction with netrin-1 primers on the then processed for immunohistochemical localization of organ of Corti RNA target shows the expected 464–base pair (bp) product DCC, a receptor that interacts with netrin-1 leading to and with DCC primers on spiral ganglion RNA target shows expected 300-bp its axon-attracting activity. Positive immunostaining of product (ϩRT). The 100-bp ladder size marker bands (M) seen in the gel represent 300, 400, and 500 bp. Each reaction set contained a no-RT cultured spiral ganglion cells with the anti-DCC anti- negative control (−RT) toward the source of netrin-1 (PϽ.05). body was observed in both the cell bodies and axons (Figure 2). Negative controls with no primary antibody showed no DCC immunolabeling in the neurons (data not shown). This finding demonstrated that in addition to gene transcription, DCC protein is expressed and further suggests that netrin-1 may have an active role in postnatal mouse spiral ganglion cell function.

EXOGENOUS NETRIN-1 PROMOTES NEURITE OUTGROWTH

To determine the effect of netrin-1 on the neurite length of mouse spiral ganglion cells, dissociated neurons were cultured for 120 hours with recombinant chick netrin-1 at concentrations of 1, 10, 100, 200, or 500 ng/mL. The cells were then immunolabeled with TuJ-1, a neuron- specific marker. Neurite lengths were determined by trac- ing digitized images of the axons. These lengths were com- pared with those of control neurons cultured similarly, but without any addition of netrin-1. Exogenous netrin-1 led to a dosage-dependent increase (SEM) in neurite length in cultured spiral ganglion cells with lengths at 115%(4.4%), 130%(6.3%), and 146% (7.0%) of controls at 100 ng/mL (P=.01), 200 ng/mL (P=.01), and 500 Figure 2. The DCC protein was identified in mouse spiral ganglion cells. Immunohistochemical staining of DCC in cultured postnatal mouse spiral ng/mL (P=.001), respectively (Figure 3). This demon- ganglion cells demonstrated localization in both the cell bodies and axons of strates that netrin-1 promotes axon outgrowth in cul- these cells. The bar indicates 50 µm. tured postnatal mouse spiral ganglion cells.

PREFERENTIAL EXTENTION OF AXONS as described in the previous subsection, and analyzed for over- TOWARD A SOURCE OF NETRIN-1 BY CHICK all direction of neurite extension. Cocultures with nontrans- ACOUSTIC GANGLION CELLS fected HEK293 were performed in parallel as controls. The HEK293 cells were transfected with human net- RESULTS rin-1 to stably secrete this protein in culture. These HEK293–netrin-1 cells were cultured in a collagen ma- mRNA FOR NETRIN-1 AND ITS RECEPTOR DCC trix to produce a localized continuous source of net- EXPRESSED IN MOUSE INNER EAR rin-1. These localized cell suspensions were cocultured with dissociated chick acoustic ganglion cells (avian ana- Total RNA was extracted from mouse spiral ganglia and logue of mammalian spiral ganglion cells) to assess the from mouse organ of Corti. Next, RT-PCR was used to influence of localized netrin-1 on the direction of out- amplify specific regions of netrin-1 and DCC mRNA. growth (Figure 4). The ganglion cells in these cocul- Analysis by agarose gel electrophoresis demonstrated the tures were analyzed for the overall direction of neurite expected 464-bp netrin-1 product from organ of Corti extension after immunolabeling the cells with TuJ-1. This RNA and the expected 300-bp DCC product from the spi- analysis showed a significant preference of acoustic gan-

(REPRINTED) ARCH OTOLARYNGOL HEAD NECK SURG/ VOL 134 (NO. 2), FEB 2008 WWW.ARCHOTO.COM 148

150

100

Neurite Length, CSGCs, No. 50

0 Control 1 10 100 200 500 Exogenous Netrin-1, ng/mL

Figure 3. Netrin-1 promotes neurite extension in cultured spiral ganglion cells (CSGCs). Mouse spiral ganglion cell axons were cultured with varying concentrations of recombinant netrin-1, and neurite lengths were measured. The bars show the mean length of neurites plotted as a function of the B percentage of control neurons cultured without added netrin-1. At least 50 neurons were measured per concentration of netrin-1 added. Axon lengths were significantly larger for ganglion cells cultured with netrin-1 at 100 (P=.01), 200 (P=.01), and 500 ng/mL (P=.001) (115%, 130%, and 146%, respectively). The error bars represent the SEM.

glion cells for neurite extension toward a defined source of netrin-1 (P=.04; Figure 5). In contrast, control cocultures containing nontransfected HEK293 cells (negative controls) did not show this preferential direction of neurite outgrowth. This indicates that netrin-1 may play a role in axon guidance of developmentally mature auditory neurons.

COMMENT

Netrin-1 is a secreted protein that is well characterized for its activity in neurite lengthening and axon guidance by attraction when interacting with the receptor DCC. In our study, we have shown that netrin-1 mRNA is expressed in the organ of Corti of developmentally mature mice and that DCC is expressed both at the mRNA and protein levels in the spiral ganglion cells of these animals. In addition, we have demonstrated that exogenous netrin-1 promotes spiral ganglion cell axon extension in a dosage-dependent manner in vitro. Lastly, with coculture experiments, we have shown that Figure 4. Human embryonic kidney cells (HEK293)–netrin-1–secreting cells. acoustic ganglion cells of young chickens preferentially A, Schematic drawing of HEK293–netrin-1–secreting cells embedded in extend their axons toward a localized source of growth factor–reduced Matrigel (Becton-Dickenson, Bedford, netrin-1. Massachusetts) (arrow) cocultured with chick acoustic ganglion cells. B, Photomicrograph of HEK293–netrin-1–secreting cells embedded in growth We found that both netrin-1 and DCC are expressed factor–reduced Matrigel (black arrow) and cocultured with chick acoustic in both the organ of Corti and spiral ganglion cells at the ganglion cells. The white arrows point to cell bodies of 2 acoustic ganglion mRNA level. This indicates that, in addition to the ex- cells with axons (arrowheads) extending toward netrin-1–secreting cells pected findings that netrin-1 is expressed in the organ (black arrow). The bar indicates 100 µm. of Corti and DCC is expressed in spiral ganglion cells, the spiral ganglion neurons also express the ligand and an autocrine feedback mechanism in netrin-1–medi- the organ of Corti expresses the receptor. This is con- ated guidance of cochlear innervation. sistent with previous findings that netrin-1 is expressed A previous study21 reported expression of netrin-1 in in adult mammalian spinal cord neurons.20 Expression the early postnatal Wistar rat cochlea. Semiquantitative of DCC in organ of Corti cells suggests the possibility of Western immunoblotting was used to show stable lev-

(REPRINTED) ARCH OTOLARYNGOL HEAD NECK SURG/ VOL 134 (NO. 2), FEB 2008 WWW.ARCHOTO.COM 149

©2008 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 09/23/2021 harvested from mice immediately following sacrifice, did indicate active transcription of DCC. Therefore, assum- 40 ing that DCC is not translationally regulated, it can be inferred that the mature protein is expressed in vivo. Ad- ditional immunohistochemical experiments to localize 30 DCC in spiral ganglia immediately after the animals were killed would elucidate the expression patterns of DCC peptide in vivo.

20 The addition of exogenous netrin-1 led to an increase in neurite length of cultured mouse spiral ganglion cells. Specifically, recombinant chick netrin-1 (R&D Neurite Count, No. Systems) was used for these experiments. Chick and 10 mouse netrin-1 have 86% amino acid homology, and thus the recombinant chick peptide has bioactivity in mouse tissue. Recombinant mouse netrin-1 is now available, and

0 similar experiments using this protein with mouse spi- +–0 +–0 ral ganglion cells may demonstrate a more pronounced Netrin-1 Control effect. The effect of promoting neurite length with netrin-1 in our experiments demonstrated a dosage- Figure 5. Cultured spiral ganglion cells extend axons toward netrin-1. dependent response at concentrations of 100, 200, and Quantitative analysis of direction of neurite extension in chick acoustic 500 ng/mL. These concentrations coincide with the range ganglion cells cocultured with human embryonic kidney cells (HEK293)–netrin-1–secreting cells. Neurites were classified as extending at which the peptide demonstrates a linear bioactivity toward (ϩ), away from (−), or neutral (0) relative to the source of netrin-1, curve based on functional enzyme-linked immunosor- based on their overall direction of growth. The means of these classifications bent assay measuring of binding to DCC (R&D Re- from 4 independent neuronal preparations and coculture experiments were calculated and plotted in the graph with bars representing the mean number search specification sheet). of neurites in each category and error bars representing the SEM. Ganglion All data reported in this study were from spiral gan- cells in the cocultures with HEK293–netrin-1 cells showed a significant glion cells of young postnatal C57 mice with the excep- preference for extending their axons toward the source of netrin-1 (P=.04). tion of the coculture experiments with the HEK293–netrin- 1–expressing cells. The neurons used in these experiments els of netrin-1 peptide expression at P1 to P7, with de- were from acoustic ganglia of chicks. Initial coculture ex- creasing levels at P10 and P15. At P22, neither netrin-1 periments were also performed with C57 mice spiral gan- nor DCC protein was detected in rat cochlear tissue. Our glion cells, but the neuronal yields from these prepara- studies were performed in early postnatal C57 mice (P28- tions were extremely low and not sufficient for quantitative P35); netrin-1 mRNA was detected from total RNA iso- analysis. In contrast, cell preparations from the chick acous- lated from organ of Corti tissue, and expression of DCC tic ganglia were much higher. Owing to the high amino mRNA was identified in preparations isolated from spi- acid sequence homology of netrin-1 across species, the hu- ral ganglia. We also found positive immunoreactivity for man peptide secreted by the HEK293–netrin-1 cells is ac- DCC localized in both the cell bodies as well as axons of tive in cultures of chick neurons.22 cultured spiral ganglion harvested from animals of the In summary, we have shown that netrin-1 can pro- same age. mote spiral ganglion cell neurite outgrowth and guide Multiple factors could account for these differences. their axons by attraction in vitro in postnatal mice. Fur- Species differences (rat vs mouse) could be a simple ex- ther investigations of the axon-guidance activity of ne- planation for the discrepancies in results. Also, in our stud- trin-1 and other peptides with similar function may lead ies, netrin-1 expression was detected only at the mRNA to an understanding of the molecular mechanisms that level by RT-PCR, so it is possible that at later stages in guide spiral ganglion cells to appropriate innervation tar- the early postnatal period, netrin-1 is transcribed but not gets during embryonic development. Studies performed translated to mature protein. The use of different tech- in developing mice prior to cochlear hair cell innerva- niques and preparations of the target tissue, as well as tion may provide additional insight to this understand- antibodies from different sources (Oncogene, as used by ing. Application of these mechanisms would allow for the Gillespie et al,21 and R&D Systems in our studies), can development of strategies to promote controlled out- account for our detection of DCC expression in postna- growth of spiral ganglion cell axons toward specific elec- tal rodents. Finally, our functional studies demonstrat- trodes on the array of a cochlear implant. The result of ing that the spiral ganglion cells respond to netrin-1 by this would potentially improve speech understanding and both axon extension and directional guidance support the tonal quality of sound perceived by cochlear im- our finding of expression of DCC in these cells. plant users and take us to the next level in treating pa- One caveat of the immunolocalization of DCC in both tients with considerable hearing losses. cell bodies and axons of spiral ganglion cells is that these studies were performed on neurons that had been cul- Submitted for Publication: June 7, 2006; final revision tured for 48 hours. Thus, we cannot determine with cer- received May 24, 2007; accepted July 3, 2007. tainty if this expression pattern occurs in vivo or if it re- Correspondence: Kenneth H. Lee, MD, PhD, Depart- sults from culturing the cells. The RT-PCR experiments ment of Otolaryngology–Head and Neck Surgery, Uni- amplifying DCC mRNA from isolated spiral ganglion cells, versity of Texas Southwestern Medical Center at Dallas,

(REPRINTED) ARCH OTOLARYNGOL HEAD NECK SURG/ VOL 134 (NO. 2), FEB 2008 WWW.ARCHOTO.COM 150

©2008 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 09/23/2021 Children’s Medical Center Dallas, 5323 Harry Hines Blvd, chemotropic factors for commissural axons in the embryonic spinal cord. Cell. Dallas, TX 75390-9035 (kenneth.lee@utsouthwestern 1994;78(3):425-435. 7. Serafini T, Colamarino SA, Leonardo ED, et al. Netrin-1 is required for commis- .edu). sural axon guidance in the developing vertebrate nervous system. Cell. 1996; Author Contributions: Drs Lee and Warchol had full ac- 87(6):1001-1014. cess to all the data in the study and take responsibility 8. Livesey FJ, Hunt SP. Netrin and netrin receptor expression in the embryonic mam- for the integrity of the data and the accuracy of the data malian nervous system suggests roles in retinal, striatal, nigral, and cerebellar analysis. Study concept and design: Lee and Warchol. Ac- development. Mol Cell Neurosci. 1997;8(6):417-429. 9. Kennedy TE. Cellular mechanisms of netrin function: long-range and short- quisition of data: Lee. Analysis and interpretation of data: range actions. Biochem Cell Biol. 2000;78(5):569-575. Lee and Warchol. Drafting of the manuscript: Lee. Criti- 10. Tessier-Lavigne M, Goodman CS. The molecular biology of axon guidance. Science. cal revision of the manuscript for important intellectual con- 1996;274(5290):1123-1133. tent: Lee and Warchol. Obtained funding: Lee and War- 11. Ackerman SL, Kozak LP, Przyborski SA, et al. The mouse rostral cerebellar malfor- chol. Administrative, technical, and material support: mation gene encodes an UNC-5-like protein. Nature. 1997;386(6627):838-842. 12. Nishiyama M, Hoshino A, Tsai L, et al. Cyclic AMP/GMP-dependent modulation Warchol. Study supervision: Warchol. of Ca2ϩ channels sets the polarity of nerve growth-cone turning. Nature. 2003; Financial Disclosure: None reported. 423(6943):990-995. Funding/Support: This study was supported by Na- 13. Fearon ER, Cho KR, Nigro JM, et al. Identification of a chromosome 18q gene tional Institutes of Health grants NIH-NIDCD No. that is altered in colorectal cancers. Science. 1990;247(4938):49-56. 1F32DC0043501 to Dr Lee, NIH-NIDCD grant No. 14. Corset V, Nguyen-Ba-Charvet KT, Forcet C, et al. Netrin-1-mediated axon outgrowth and cAMP production requires interaction with adenosine A2b receptor. DC03576 to Dr Warchol, and an Otologic Research Grant Nature. 2000;407(6805):747-750. from the Deafness Research Foundation to Drs Lee and 15. Forcet C, Stein E, Pays L, et al. Netrin-1-mediated axon outgrowth requires de- Warchol. leted in colorectal cancer-dependent MAPK activation. Nature. 2002;417(6887): 443-447. 16. Xie Y, Hong Y, Ma XY, et al. DCC-dependent phospholipase C signaling in netrin- REFERENCES 1-induced neurite elongation. J Biol Chem. 2006;281(5):2605-2611. 17. Deiner MS, Kennedy TE, Fazeli A, et al. Netrin-1 and DCC mediate axon guidance 1. Shepherd RK, Hatsushika S, Clark GM. Electrical stimulation of the auditory nerve: locally at the optic disc: loss of function leads to optic nerve hypoplasia. Neuron. the effect of electrode position on neural excitation. Hear Res. 1993;66(1): 1997;19(3):575-589. 108-120. 18. de la Torre JR, Hopker VH, Ming GL, et al. Turning of retinal growth cones in a 2. Frijns JH, de Snoo SL, ten Kate JH. Spatial selectivity in a rotationally symmetric netrin-1 gradient mediated by the netrin receptor DCC. Neuron. 1997;19(6): model of the electrically stimulated cochlea. Hear Res. 1996;95(1-2):33-48. 1211-1224. 3. Rebscher SJ, Snyder RL, Leake PA. The effect of electrode configuration and 19. Salminen M, Meyer BI, Bober E, et al. Netrin 1 is required for semicircular canal duration of deafness on threshold and selectivity of responses to intracochlear formation in the mouse inner ear. Development. 2000;127(1):13-22. electrical stimulation. J Acoust Soc Am. 2001;109(5, pt 1):2035-2048. 20. Manitt C, Colicos MA, Thompson KM, et al. Widespread expression of netrin-1 4. Tykocinski M, Saunders E, Cohen LT, et al. The contour electrode array: safety by neurons and oligodendrocytes in the adult mammalian spinal cord. J Neurosci. study and initial patient trials of a new perimodiolar design. Otol Neurotol. 2001; 2001;21(11):3911-3922. 22(1):33-41. 21. Gillespie LN, Marzella PL, Clark GM, et al. Netrin-1 as a guidance molecule in the 5. Saunders E, Cohen L, Aschendorff A, et al. Threshold, comfortable level and im- postnatal rat cochlea. Hear Res. 2005;199(1-2):117-123. pedance changes as a function of electrode-modiolar distance. Ear Hear. 2002; 22. Liu G, Beggs H, Jurgensen C, et al. Netrin requires focal adhesion kinase and 23(1)(suppl):28S-40S. Src family kinases for axon outgrowth and attraction. Nat Neurosci. 2004;7 6. Kennedy TE, Serafini T, de la Torre JR, Tessier-Lavigne M. Netrins are diffusible (11):1222-1232.

(REPRINTED) ARCH OTOLARYNGOL HEAD NECK SURG/ VOL 134 (NO. 2), FEB 2008 WWW.ARCHOTO.COM 151