ORIGINAL ARTICLE Promotion of Neurite Outgrowth and Axon Guidance in Spiral Ganglion Cells by Netrin-1 Kenneth H. Lee, MD, PhD; Mark E. Warchol, PhD Objective: To identify the expression of netrin-1, a Results: Netrin-1 and DCC mRNA expression were found diffusible chemoattractive molecule, and its receptor, in the mouse organ of Corti and spiral ganglion cells by deleted in colorectal carcinoma (DCC), in the devel- RT-PCR. Application of exogenous netrin-1 led to a dos- opmentally mature inner ear, and to determine its age-dependent increase in neurite length in cultured spi- effects on axon length and guidance in cultured auditory ral ganglion cells. Chick acoustic ganglion cells cocul- neurons. tured with netrin-1–secreting cells demonstrated statistically significant preferential extension toward the source of netrin-1 (P =.04). Design: Messenger RNA (mRNA) and protein expres- sion of netrin-1 and DCC were identified in the organ of Conclusions: Netrin-1 and DCC are expressed in the or- Corti and spiral ganglion cells using reverse transcription– gan of Corti and spiral ganglion cells of developmen- polymerase chain reaction (RT-PCR) and fluorescence tally mature mice. Exogenous netrin-1 promotes dosage- immunohistochemical analysis. In vitro experiments ex- dependent neurite growth in vitro. Mature auditory amined the effects of exogenous netrin-1 on spiral gan- neurons preferentially direct neurite extension toward glion cell axon length. Auditory neurons were cocul- netrin-1 released in culture. These findings may lead to tured with a cell line secreting netrin-1 to determine the the development of strategies to optimize the interface effect on direction of axon extension. between electrode arrays and spiral ganglion cells, re- sulting in improved cochlear implant performance. Subjects: Young C57 mice and posthatched white leghorn chicks. Arch Otolaryngol Head Neck Surg. 2008;134(2):146-151 ECENT ADVANCES IN COCH- glion neurite outgrowth may lead to ran- lear implant hardware dom patterns of axon extension, result- design have included strat- ing in decreased cochlear implant function. egies to position the elec- An understanding of the innate molecu- trode array more medially lar mechanisms that establish and main- Rto hug the modiolus and bring the stimu- tain the precise tonotopic organization of lating electrodes closer to the spiral gan- the inner ear may be essential to develop glion cells. In theory, this would lower strategies for highly controlled neurite out- stimulation thresholds, improve battery life growth necessary to achieve improved by decreasing power consumption, and ex- cochlear implant function. pand the dynamic range of the stimu- Netrin-1 is a member of a family of se- lus.1-3 Implementing such strategies has led creted laminin-related proteins and has to improved cochlear implant function.4,5 been shown to attract commissural axons Author Affiliations: Stimulating the outgrowth of spiral gan- to the midline of the spinal cord during de- Departments of 6,7 Otolaryngology–Head and Neck glion cell axons would be another means velopment. The family of peptides known Surgery (Drs Lee and Warchol) to achieve this objective. Decreasing the as netrins are highly conserved across sev- and Anatomy and Neurobiology distance between the electrodes and their eral species and can act both at short range (Dr Warchol), Washington stimulus targets may provide a mecha- as well as long range to guide growing axons University School of Medicine, nism that would enhance frequency se- to appropriate innervation targets.8,9 Net- St Louis, Missouri. Dr Lee is lectivity and dynamic range. Such ben- rins are bifunctional molecules in that they now with the Department of efits would not only augment speech can mediate either attraction or repulsion, Otolaryngology–Head and Neck Surgery, University of Texas recognition but may also improve the tonal based on their interactions with different 10,11 Southwestern Medical Center at quality of sound and potentially allow im- receptor families or based on levels of Dallas, and Children’s Medical plant users to better appreciate music. second messengers such as cyclic adeno- Center Dallas. However, simple stimulation of spiral gan- sine monophosphate.12 (REPRINTED) ARCH OTOLARYNGOL HEAD NECK SURG/ VOL 134 (NO. 2), FEB 2008 WWW.ARCHOTO.COM 146 ©2008 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 09/23/2021 Deleted in Colorectal Carcinoma (DCC) is a gene that 25mM Hepes. Each ganglion was further dissected into has shown to be mutated in metastatic human colorec- smaller fragments, pooled, and digested in trypsin, 25%, tal cancer.13 This gene encodes a receptor that binds ne- (Sigma) for 25 minutes at 37°C. Digested tissue isolates were trin-1 and confers an axon-attracting response.10 In ad- resuspended in M199 with Earle salts, supplemented with dition to the attractive response of this interaction, netrin-1 10% fetal bovine serum (Invitrogen, Carlsbad, California). Samples were then triturated in this solution to generate sus- and the DCC gene product (hereinafter, DCC) also lead 14-16 pensions of individual neuronal and glial cells and plated on to axon outgrowth mediated by second messengers. culture dishes precoated with laminin (Sigma). Subse- Although most of the studies of netrin-1 have fo- quently, the cells were cultured for 48 to 120 hours with cused on the central nervous system, some investiga- 50% fresh medium changes every 2 days for cells cultured tions17,18 have also demonstrated its activity in the pe- longer than 48 hours. riphery. Netrin-1 has been implicated in the guidance of retinal ganglion cells to appropriate central targets in the IMMUNOHISTOCHEMICAL visual system. Additional data suggest that netrin-1 is in- ANALYSIS FOR DCC volved in the embryogenesis of the otic epithelium8 as well as in the development of the semicircular canals.19 Following 48 hours in culture, the neurons were fixed with 4% Recently, netrin-1 protein has been shown to be ex- paraformaldehyde for 15 minutes, incubated in 90% metha- pressed in early postnatal rat cochlea.20 nol and 0.3% hydrogen peroxide, and blocked with 2% nor- In the present study, we investigated the expression mal horse serum, 1% bovine serum albumin, and 0.2% Triton of DCC in the inner ear of developmentally mature mice X-100 detergent (Sigma). The cultured cells were then incu- bated with mouse monoclonal anti-DCC antibody (5 µg/mL) at both the messenger RNA (mRNA) and protein levels (Oncogene Research Products, Boston, Massachusetts) di- and netrin-1 expression at the mRNA level. We also show luted 1:500 in phosphate-buffered saline with 2% normal horse functional data indicating that the auditory neurons of serum and 0.2% Triton X-100 detergent overnight at 4°C, then young developmentally mature animals maintain their in biotinylated antimouse IgG (Vector Laboratories, Burlin- ability to elongate and change the direction of axon ex- game, California) for 2 hours at room temperature, followed tension in response to netrin-1 in vitro. Our results may by streptavidin Alexa Fluor 488 (Molecular Probes) for 2 hours be the basis for further investigation leading to new strat- at room temperature. A no–primary antibody negative control egies to advance cochlear implant function. was performed with each experiment. The labeled neurons were viewed with an epifluorescence microscope (Nikon Instru- ments, Melville, New York). METHODS EXOGENOUS NETRIN-1 IN VITRO EXPERIMENTAL ANIMALS All experiments were performed using tissue from C57 mice, Dissociated spiral ganglion cells were prepared as described postnatal day 28 to 35 (P28-P35) obtained from Charles River in the “Ganglion Cell Cultures” subsection and cultured for Laboratories (Wilmington, Massachusetts) and acoustic gan- 120 hours with 1-, 10-, 100-, 200-, or 500-ng/mL recombi- glia from white leghorn chickens, posthatch day 10 to 14 from nant chick netrin-1 (R&D Systems, Minneapolis, Minne- Spafas (Preston, Connecticut). sota), or with no exogenous netrin-1 (negative control). The neurons were fixed and immunolabeled with the neuron- specific ßIII tubulin antibody marker TuJ-1 (2 µg/mL REVERSE TRANSCRIPTION–POLYMERASE diluted 1:500, mouse monoclonal anti-ßIII tubulin antibody; REACTION Covance, Berkeley, California), followed by biotinylated sec- ondary antibody and the ABC Elite Kit with diaminobenzi- Total RNA was isolated from pooled samples of spiral ganglia dine detection (Vector Laboratories). These specimens were and organs of Corti microdissected from 5 to 6 C57 mice using viewed with an Axiovert 135 inverted microscope (Zeiss Ultraspec RNA (Biotecx Laboratories, Houston, Texas) and con- MicroImaging, Thornwood, New York). All images were taminating genomic DNA was removed with RNase-free DNase digitized with a Nikon Coolpix 990 digital camera, and neu- I. Published sequences for netrin-1 (Serafini et al7) and DCC rite lengths were quantified using National Institutes of (Fearon et al13) in mice were used to design the following prim- Health Image J free downloadable software. ers: 5ЈAGTSTGTCTCAACTGCCGCC3Ј (netrin-1 sense), 5ЈTACACGGAGATGATGTTCACGG3Ј (netrin-1 antisense), 5ЈAGTGCCTCTCATTCAGGTCAGG3Ј (DCC sense), and HEK293–NETRIN-1 CELLS AND ACOUSTIC 5ЈTCACAGACTGAGTTCTTCCTGC3Ј (DCC antisense). Re- GANGLION CELL COCULTURES verse transcription–polymerase chain reaction (RT-PCR) was performed using the RNA Gene Amp kit (Applied Biosystems, Human embryonic kidney (HEK293) cells stably transfected Foster