US009353390B2
(12) United States Patent (10) Patent No.: US 9,353,390 B2 Yan et al. (45) Date of Patent: May 31, 2016
(54) GENETICALLY ENGINEERED MICROBES National Center for Biotechnology Information, National Library of AND METHODS FOR PRODUCING Medicine, National Institutes of Health, GenBank Locus 4-HYDROXYCOUMARIN NP 252920. Accession No. NP 252920, "isochorismate-pyruvate lyase IPseudomonas aeruginosa PAO1),” online). Bethesda, MD (71) Applicant: University of Georgia Research retrieved on Aug. 3, 2015. Retrieved from the Internet:
(56) References Cited Matsumoto et al. “Molecular cloning and functional analysis of the Ortho-hydroxylases of p-coumaroyl coenzyme Afferuloyl coenzyme OTHER PUBLICATIONS A involved in formation of umbelliferone and scopoletin in Sweet Gaille et al. “Salicylate biosynthesis in Pseudomonas aeruginosa. potato, Ipomoea batatas (L.) Lam.” Phytochemistry, Feb. 2012; Purification and characterization of PohB, a novel bifunctional T4:49-57. enzyme displaying isochorismate pyruvate-lyase and chorismate Melnikova, “The anticoagulants market” Nat. Rev. Drug Discov. mutase activities”.J. Biol. Chem. 2002; 277(24):21768-75. 2009; 8(5):353-4. Gao et al. “Clean and Convenient One-Pot Synthesis of Murray et al., Natural Coumarins. Occurrence, chemistry and bio 4-Hydroxycoumarin and 4-Hydroxy-2-Quinolinone Derivatives' chemistry, John Wiley & Sons Ltd., Chichester, New York; 1982. Synthetic Commun. 2010; 40:732-8. Cover page, title page and table of contents. Geissler et al., “Purification and properties of benzoate-coenzyme A Nagachar et al. “Roles of tripE2, entC and entL) in salicylic acid ligase, a Rhodopseudomonas palustris enzyme involved in the biosynthesis in Mycobacterium smegmatis” FEMS Microbiol. Lett. anaerobic degradation of benzoate” J. Bacteriol. 1988; 170(4): 1709 2010; 308(2): 159-65. 14. Nakagawa et al. "Abacterial platform for fermentative production of Gerhardt et al., Methods for General and Molecular Bacteriology, plant alkaloids' Nat. Commun. 2011; 2:326.8 pages. American Society for Microbiology: Washington D.C.; 1994. Cover Payne et al. “Synthesis and evaluation of 2,5-dihydrochorismate page, title page, and table of contents, and Chapters 13-14 and 16-18. analogues as inhibitors of the chorismate-utilising enzymes' Org. Gibson et al. “Enzymatic assembly of DNA molecules up to several Biomol. Chem. 2009; 7(11):2421-9. hundred kilobases” Nat. Methods, 2009; 6(5):343-5. Pickens et al., “Biochemical analysis of the biosynthetic pathway of Heeb et al. "Quinolones: from antibiotics to autoinducers' FEMS an anticancer tetracycline SF2575” J. Am. Chem. Soc. 2009; Microbiol. Rev. 2011: 35(2):247-74. 131(48): 17677-89. Heit et al., “Estimated annual number of incident and recurrent, Ray et al., “Mutational analysis of the catalytic and feedback sites of non-fatal and fatal venous thromboembolism (VTE) events in the the tryptophan-sensitive 3-deoxy-D-arabino-heptuloSonate-7-phos US” Blood 106, 267a-267a (2005). phate synthase of Escherichia coli J. Bacteriol., 1988: 170:5500-6. Huo et al., "Conversion of proteins into biofuels by engineering Ro et al. “Production of the antimalarial drug precursor artemisinic nitrogen flux' Nat. Biotechnol., 2011; 29(4): 346-51. acid in engineered yeast” Nature, 2006:440(7086):940-3. Ishiyama et al., “Novel pathway of Salicylate degradation by Rogozinska et al. “Efficient "on water' organocatalytic protocol for Streptomyces sp. strain WA46” Appl. Environ. Microbiol. 2004; the synthesis of optically pure warfarin anticoagulant Green Chem. 70(3): 1297-306. 2011; 13:1155-7. Ivanov et al. “New Efficient Catalysts in the Synthesis of Warfarin Rueping et al. "A review of new developments in the Friedel-Crafts and Acenocoumarol' Arch. Pharm. (Weinheim) 1990;323(8):521-2. alkylation—From green chemistry to asymmetric catalysis' Jossek et al., “Characterization of a new feedback-resistant 3-deoxy Beilstein J. Org. Chem. 2010; 6:6. 24 pages. D-arabino-heptulosonate 7-phosphate synthase AroF of Escherichia Solis et al. "Automated design of synthetic ribosome binding sites to coli” FEMS Microbiol Lett., 2001; 202: 145-8. control protein expression” Nat. Biotechnol. 2009; 27(10):946-50. Kai et al. “Scopoletin is biosynthesized via Ortho-hydroxylation of Sambrook et al. Molecular Cloning. A Laboratory Manual. Cold feruloyl CoA by a 2-oxoglutarate-dependent dioxygenase in Spring Harbor Laboratory Press, Cold Spring Harbor, New York, Arabidopsis thaliana' Plant J. 2008; 55(6):989-9. 2012. Cover page, title page, table of contents. 34 pages. Kikuchi et al. “Mutational analysis of the feedback sites of Santos et al. "Optimization of a heterologous pathway for the pro phenylalanine-sensitive 3-deoxy-D-arabino-heptulo Sonate-7-phos duction of flavonoids from glucose' Metab. Eng. 2011; 13(4):392 phate synthase of Escherichia coli'' Appl. Environ. Microbiol. 1997; 400. 63(2):761-2. Serino et al., “Structural genes for salicylate biosynthesis from Leonard et al. “Engineering central metabolic pathways for high chorismate in Pseudomonas aeruginosa' Mol. Gen. Genet. 1995; level flavonoid production in Escherichia coli'' Appl. Environ. 249(2):217-28. Microbiol. 2007; 73(12):3877-86. Shen et al. “Driving forces enable high-titer anaerobic 1-butanol Lequesne et al., “The Natural Coumarins-Occurrence, Chemistry synthesis in Escherichia coli'' Appl. Environ. Microbiol. 2011; and Biochemistry”.J. Am. Chem. Soc. 1983; 105:6536. 77(9):2905-15. Li et al., "Bioprospecting metagenomes: glycosyl hydrolases for Tatusova et al., “BLAST 2 Sequences, a new tool for comparing converting biomass' Biotechnol Biofuels, May 18, 2009; 2:10. protein and nucleotide sequences” FEMS Microbiol Lett, 1999; Lim et al. “High-Yield Resveratrol Production in Engineered 174(2):247-50. Escherichia coli'' Appl. Environ. Microbiol. 2011; 77(10):3451-60. Vialart et al. A 2-oxoglutarate-dependent dioxygenase from Ruta Lin et al. “Biosynthesis of caffeic acid in Escherichia coli using its graveolens L. exhibits p-coumaroyl CoA 2'-hydroxylase activity endogenous hydroxylase complex” Microb. Cell. Fact. Apr. 4, 2012; (C2H): a missing step in the synthesis of umbelliferone in plants' 11:42, 9 pages. Plant J. May 2012; 70(3):460-70. Ling, et al., “Enediyne antitumor antibiotic maduropeptin Xu et al. “Modular optimization of multi-gene pathways for fatty biosynthesis featuring a C-methyltransferase that acts on a CoA acids production in E. coli.' Nat. Commun. 2013; 4:1409. tethered aromatic substrate”.J. Am. Chem. Soc. 2010; 132(36): 12534 Yan et al. “High-yield anthocyanin biosynthesis in engineered 6. Escherichia coli." Biotechnol. Bioeng. 2008; 100(1): 126-40. Liu et al., "Overexpression, purification, and characterization of Zhaetal. “Improving cellular malonyl-CoA level in Escherichia coli isochorismate synthase (EntC), the first enzyme involved in the via metabolic engineering” Metab. Eng. 2009; 11(3):192-8. biosynthesis of enterobactin from chorismate” Biochemistry (Mosc.) Zhang et al., “PgsD is responsible for the synthesis of 2,4- 1990: 29(6): 1417-25. dihydroxyquinoline, an extracellular metabolite produced by Liu et al. "A novel 4-hydroxycoumarin biosynthetic pathway' Plant Pseudomonas aeruginosa "J. Biol. Chem. 2008; 28.3(43):28788-94. Mol. Biol. 2010; 72(1-2):17-25. Zhang et al. “Design of a dynamic sensor-regulator system for pro Litke-Eversloh et al. “L-tyrosine production by deregulated strains duction of chemicals and fuels derived from fatty acids' Nat. of Escherichia coli'' Appl. Microbiol. Biotechnol. 2007: 75(1): 103 Biotechnol. Mar. 25, 2012:30(4):354-9. 10. Lin et al. “Microbial Biosynthesis of the Anticoagulant Precursor 4 Litke-Eversloh et al. “Combinatorial pathway analysis for improved Hydroxycoumarin'. Nature Communications, Accepted Sep. 12, L-tyrosine production in Escherichia coli: Identification of enzy 2013, published Oct. 16, 2013, pp. 1-8. matic bottlenecks by Systematic gene overexpression' Metab. Eng. Lin et al. “Microbial Biosynthesis of the Anticoagulant Precursor 4 2008: 10(2):69-77. Hydroxycoumarin'. Nature Communications, Accepted Sep. 12, Martin et al., “Engineering a mevalonate pathway in Escherichia coli 2013, published Oct. 16, 2013, Supplementary Information, 19 for production of terpenoids' Nat. Biotechnol. 2003: 21(7):796-802. pageS. U.S. Patent May 31, 2016 Sheet 1 of 17 US 9,353,390 B2
Figure 1.
^x- ^:- o o- or N 3.:::::::::::::::::::::: :::::::::::::::
*::::::::::::: *::::::::::::::::::: &:8:::::::::::::::::::
U.S. Patent May 31, 2016 Sheet 3 of 17 US 9,353,390 B2
Figure 3.
88-8-8-8-8-8-8-8-8-8-8-8 8 ------aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 83 {{} 23: 33:8::::::::: is: Sisstate {3:08::$tatio is88.
May 31, 2016 Sheet 5 Of 17 US 9,353,390 B2
*igurest e
A:
e
388838: is is:8:
------,
stage 8883:38
U.S. Patent May 31, 2016 Sheet 6 of 17 US 9,353,390 B2
Figure 6
:::::::::
Saic
iwa-six: f: 283 if
13 Sof 1.3 13.3 38 s 163 U.S. Patent May 31, 2016 Sheet 7 Of 17 US 9,353,390 B2
Figure 7.
8.8
8
4. 5 s 8, 8.
sittie Extract itrified Sciga Purified Stigs is $3 s : s pries: 3S3 {{ie Exis: 88 Ext:3C
U.S. Patent May 31, 2016 Sheet 9 Of 17 US 9,353,390 B2
Figure 9 (A) 3,388 2.3 Steficiari 4-C ------: s kix:rg:8: {3} tigii. w to: , ,588 , 288, 33:8 '. ^^-- 808 : ^ 28 \-/ v. Sg to Y. 5 228 is 36 32s 33 3 is 4. a. s i? " min. s 2.38 92 2,883 4-C
------was---a------ower-rower-ow-worror------3. a. & 8.0 33 38.9 2. S. S. Retention tine { min}
3888.3: 38: :8: 233 3:X 88: 4.x: AS six. 8 U.S. Patent May 31, 2016 Sheet 10 of 17 US 9,353,390 B2
Figure 10,
U.S. Patent May 31, 2016 Sheet 12 of 17 US 9,353,390 B2
igure 12
U.S. Patent May 31, 2016 Sheet 13 of 17 US 9,353,390 B2
~~~~~~~~…gºº
~~~~--~~~~~--~~~~** U.S. Patent May 31, 2016 Sheet 14 of 17 US 9,353,390 B2
Figure 4.
Pentose Phosphate Pathway Glycosysis
^-bre l :-...... & *x. y:38::8::s coors l Seoa 3. *x :::::::::8:y;33;x& airytak
Cisas ics CQA fes"; IPL X s-\ SCL -- *o-ex2°-S- (Ci-CAtt-C& ex- NS ^^ 93 is sciesis; 38 Saicyiate Saicoy coa, Y $hysioxycotaxi | Y& CoA :::::::::::38:3 U.S. Patent May 31, 2016 Sheet 15 Of 17 US 9,353,390 B2
Figure 15.
U.S. Patent May 31, 2016 Sheet 16 of 17 US 9,353,390 B2
Figure 16.
US 9,353,390 B2 1. 2 GENETICALLY ENGINEERED MICROBES acid (Lin et al. Microb. Cell. Fact. 11, 42 (2012), benzyliso AND METHODS FOR PRODUCING quinoline alkaloids (Nakagawa et al. Nat. Commun. 2 4-HYDROXYCOUMARIN (2011)), terpenoids (Martin et al. Nat. Biotechnol. 21, 796 802 (2003)), anthocyanin (Yan et al. Biotechnol. Bioeng. 100, CROSS-REFERENCE TO RELATED 126-140 (2008)), flavonoids (Santos et al. Metab. Eng. 13, APPLICATIONS 392–400 (2011)), and resveratrol (Lim et al. Appl. Environ. Microbiol. 77,3451-3460 (2011)). All these successful cases This application claims the benefit of U.S. Provisional were built on thorough understanding of the products native Application Ser. No. 61/834,546, filed Jun. 13, 2013, which is biosynthetic mechanisms, especially genetic and biochemi incorporated by reference herein. 10 cal properties of the involved enzymes. However, lack of knowledge in these aspects hindered the reconstitution of the SEQUENCE LISTING biosynthesis of pharmaceutically important 4HC. Although it was proposed that 4HC was formed when melilotoside-con This application contains a Sequence Listing electroni taining plant materials were fermented by molds and a bio cally submitted via EFS-Web to the United States Patent and 15 synthetic Scheme was described by isotopic labeling analysis Trademark Office as an ASCII text file entitled (Lequesne, P. W., J. Am. Chem. Soc. 105,6536-6536 (1983)), “US14304105 SequenceListing ST25.txt having a size of involved enzymes have not been identified (Bye et al. Bio 23 kilobytes and created on Aug. 6, 2014. The information chem. J. 117, 237-245 (1970)). Several recent studies contained in the Sequence Listing is incorporated by refer revealed that the ortho-hydroxylated cinnamoyl-CoA ana ence herein. logs can form coumarins by spontaneous trans/cis isomeriza tion and lactonization (Kaietal. Plant J. 55,989-999 (2008)), BACKGROUND (Vialart et al. Plant J. 70,460-470 (2012)), (Matsumoto et al. Phytochemistry 74, 49-57 (2012)), suggesting that the path Thromboembolic diseases including venous thromboem way might be shunted from trans-2-coumaroyl-CoA to gen bolism (VTE) and arterial thrombosis are a leading cause of 25 erate coumarin rather than 4HC. Recently, Liu etal identified patient morbidity and mortality worldwide. Annually, VTE several biphenyl synthases (BISs) from Sorbus aucuparia alone results in approximately 300,000 and 550,000 deaths in that catalyze the formation of 3,5-dihydroxybiphenyl through the US and Europe, respectively, and an evenlarger number of decarboxylative condensation of three malonyl-CoA mol non-fatal events (Heit et al., Blood 106, 267a-267a (2005), ecules with benzoyl-CoA. Surprisingly, when ortho-hy (Cohen et al. Thromb. Haemost. 98, 756-764 (2007). 4-Hy 30 droxybenzoyl-CoA (salicoyl-CoA) was used in place of ben droxycoumarin (4HC) type oral anticoagulant drugs have Zoyl-CoA as a Substrate, only one molecule of malonyl-CoA been playing significant roles against thromboembolic dis was condensed to form 4HC, suggesting that the ortho-hy eases. Interestingly, anticoagulant function of 4HC deriva droxyl group facilitates the intramolecular cyclization with tives was initially discovered due to its cause of a fetal animal out the condensation of another two malonyl-CoA molecules. disease manifesting as internal bleeding of the livestock fed 35 Accordingly, a biosynthetic pathway extended from plant with moldy sweet clover forage (called “sweet clover dis salicylate biosynthesis was proposed (Liu et al. Plant Mol. ease'). Indeed, fermentation of plant materials containing Biol. 72, 17-25 (2010)). However, the same study reported melilotoside by molds causes the formation of 4HC and its that S. aucuparia cells cannot produce 4HC natively even derivative dicoumarol. The latter demonstrates the blood anti with the presence of supplemented salicylate (Liu et al. Plant coagulant property by antagonism of vitamin Kand acted as 40 Mol. Biol. 72, 17-25 (2010)), indicating the absence of a CoA a forerunner of the synthetic anticoagulants typified by war ligase that can convert Salicylate to Salicoyl-CoA. In addition, farin (Murray, R. D. H., Méndez, J. & Brown, S. A. Wiley, salicylate biosynthesis in plants has not been fully elucidated Chichester (1982). Warfarin is one of the most prescribed oral (Chen et al. Plant Signal Behav. 4, 493-496 (2009)). anticoagulants worldwide with a $300 million global market in 2008 (Melnikova, I. Nat. Rev. Drug Discov. 8, 353-354 45 SUMMARY OF THE APPLICATION (2009)). Besides, acenocoumarol and phenprocoumon are commonly administered in Europe (Beinema et al. Thromb. Presented herein is the design and constitution of a novel Haemost. 100, 1052-1057 (2008)). These drugs share the biosynthetic mechanism affording the de novo biosynthesis 4HC core structure but differ in 3-substitution on the pyrone of 4HC. Remarkably, a FabH-like quinolone synthase was ring, and can be chemically synthesized using 4HC as an 50 identified by function-based bioprospecting which elimi immediate precursor (Ivanov et al. Arch. Pharm. (Weinheim) nated the bottleneck of the biosynthetic mechanism. Prelimi 323,521-522 (1990)), (Rueping et al. Beilstein.J. Org. Chem. nary optimization via metabolic engineering demonstrated its 6, 6 (2010)). scale-up potential, leading to efficient biosynthesis of 4HC In past decades, various strategies were developed to and in situ semi-synthesis of warfarin. The methods described chemically synthesize 4HC using petro-derived chemicals, 55 herein may also be used to produce other compounds for Such as phenol, acetosalicylate, methylsalicylate, or 2'-hy which 4HC is a precursor. droxyacetophenone as starting materials (Gao et al. Synthetic Provided herein are genetically engineered microbes. In Commun. 40,732-738 (2010)). Nevertheless, increasing con one embodiment, a genetically engineered microbe includes cerns on petroleum depletion and environmental issues have a metabolic pathway for the production of 4-hydroxycou stimulated greater efforts towards the development of bio 60 marin from a chorismate intermediate. The microbe, which logical processes utilizing renewable resources instead of may be E. coli, may be engineered to express an exogenous petro-based chemicals. The convergence of genetics, bioin isochorismate synthase, an isochorismate pyruvate lyase, a formatics, and metabolic engineering greatly promoted the salicylate:CoA ligase, a 4HC-forming protein, or a combina engineered biosynthesis of a variety of pharmaceutically tion thereof. In one embodiment, the 4HC-forming protein is important compounds in heterologous microbial hosts, e.g. 65 a FabH-like quinolone synthase. artemisinic acid (Ro., et al. Nature 440, 940-943 (2006)), In one embodiment, the genetically engineered microbe taxadiene (Ajikumaretal. Science 330, 70-74 (2010)), caffeic includes a first plasmid including a polynucleotide encoding US 9,353,390 B2 3 4 at least one enzyme of the metabolic pathway, where the they are naturally associated. Proteins and polynucleotides enzyme is selected from the group consisting of an isocho that are produced by recombinant, enzymatic, or chemical rismate synthase, an isochorismate pyruvate lyase, a salicy techniques are considered to be isolated and purified by defi late:CoA ligase, and a 4HC-forming protein. In one embodi nition, since they were never present in a cell. For instance, a ment, the genetically engineered microbe includes a first protein, a polynucleotide, or 4-hydroxycoumarin can be plasmid including a polynucleotide encoding an isochoris enriched, isolated, or purified. mate synthase and an isochorismate pyruvate lyase, and the A “regulatory sequence' is a nucleotide sequence that microbe further includes a second plasmid including a poly regulates expression of a coding sequence to which it is nucleotide encoding a salicylate:CoA ligase and a 4HC-form operably linked. Nonlimiting examples of regulatory ing protein. 10 sequences include promoters, enhancers, transcription initia tion sites, translation start sites, translation stop sites, tran In one embodiment, the genetically engineered microbe Scription terminators, and poly(A) signals. The term “oper further includes increased production of chorismate com ably linked refers to a juxtaposition of components such that pared to a control cell. In one embodiment, the genetically they are in a relationship permitting them to function in their engineered microbe may be further modified to express a intended manner. A regulatory sequence is "operably linked' feedback inhibition resistant 3-deoxy-D-arabino-heptu 15 to a coding region when it is joined in Such away that expres losonate-7-phosphate synthase, such as aroG', a phospho sion of the coding region is achieved under conditions com enolpyruvate synthase, a transketolase, a shikimate kinase, or patible with the regulatory sequence. a combination thereof, at an increased level compared to a As used herein, the term "exogenous protein’ and “exog control cell. enous polynucleotide' refer to a protein or polynucleotide, Also provided are methods of using the metabolic pathway respectively, which is not normally or naturally found in a described herein. In one embodiment, the method includes microbe. As used herein, the terms "endogenous protein’ and culturing a genetically engineered microbe described herein "endogenous polynucleotide' refer to a protein or polynucle under conditions suitable for the production of 4-hydroxy otide that is normally or naturally found in a cell microbe. An coumarin. In one embodiment, the method may further “endogenous polynucleotide' is also referred to as a “native include enriching the 4-hydroxycoumarin, for instance by 25 polynucleotide.” removing the cells from the culture. In one embodiment, the As used herein, "control cell refers to a cell that is the method may further include isolating the 4-hydroxycou same species as an engineered cell, but does not has include marin. In one embodiment, the method may further include the same modification as the engineered cell. converting the 4-hydroxycoumarin to another compound, Conditions that are "suitable' for an event to occur, or “suitable' conditions are conditions that do not prevent such such as warfarin, for instance by the addition of benzyldene 30 events from occurring. Thus, these conditions permit, acetone and (S,S)-1,2-diphenylethylenediamine to convert enhance, facilitate, and/or are conducive to the event. the 4-hydroxycoumarin to warfarin. The term “and/or” means one orall of the listed elements or As used herein, the term “protein’ refers broadly to a a combination of any two or more of the listed elements. polymer of two or more amino acids joined together by pep The words “preferred” and “preferably” refer to embodi tide bonds. The term “protein’ also includes molecules which 35 ments of the invention that may afford certain benefits, under contain more than one polypeptide joined by a disulfide bond, certain circumstances. However, other embodiments may or complexes of proteins that are joined together, covalently also be preferred, under the same or other circumstances. or noncovalently, as multimers (e.g., dimers, tetramers). Furthermore, the recitation of one or more preferred embodi Thus, the terms peptide, oligopeptide, and polypeptide are all ments does not imply that other embodiments are not useful, included within the definition of protein and these terms are 40 and is not intended to exclude other embodiments from the used interchangeably. Scope of the invention. As used herein, a protein may be “structurally similar to a The terms “comprises' and variations thereof do not have reference protein if the amino acid sequence of the protein a limiting meaning where these terms appear in the descrip possesses a specified amount of sequence similarity and/or tion and claims. sequence identity compared to the reference protein. Thus, a 45 Unless otherwise specified, “a,” “an.” “the and “at least protein may be “structurally similar to a reference protein if, one' are used interchangeably and mean one or more than OC. compared to the reference protein, it possesses a sufficient Also herein, the recitations of numerical ranges by end level of amino acid sequence identity, amino acid sequence points include all numbers Subsumed within that range (e.g., similarity, or a combination thereof. 1 to 5 includes 1, 1.5, 2, 2.75, 3, 3.80, 4, 5, etc.). As used herein, the term “polynucleotide' refers to a poly 50 For any method disclosed herein that includes discrete meric form of nucleotides of any length, either ribonucle steps, the steps may be conducted in any feasible order. And, otides, deoxynucleotides, peptide nucleic acids, or a combi as appropriate, any combination of two or more steps may be nation thereof, and includes both single-stranded molecules conducted simultaneously. and double-stranded duplexes. A polynucleotide can be The above summary of the present invention is not obtained directly from a natural source, or can be prepared 55 intended to describe each disclosed embodiment or every with the aid of recombinant, enzymatic, or chemical tech implementation of the present invention. The description that niques. In one embodiment, a polynucleotide is isolated. follows more particularly exemplifies illustrative embodi As used herein, the term "enriched,” means that the amount ments. In several places throughout the application, guidance of a Substance relative to the amount of one or more contami is provided through lists of examples, which examples can be nants has been increased at least 2 fold, at least 5 fold, at least 60 used in various combinations. In eachinstance, the recited list 10 fold, or at least 15 fold. Enrichment does not imply that all serves only as a representative group and should not be inter contaminants have been removed. As used herein, an "iso preted as an exclusive list. lated substance is one that has been removed from a cell and many of the polypeptides, nucleic acids, and other cellular BRIEF DESCRIPTION OF THE FIGURES material of its natural environment are no longer present. A 65 substance may be purified, i.e., at least 60% free, at least 75% FIG.1. Molecular structures of 4-hydroxycoumarin (4HC) free, or at least 90% free from other components with which class anticoagulants. Dicoumarol is a natural 4HC derivative US 9,353,390 B2 5 6 and served as the earliestanticoagulant; while warfarin, phen (DHQ). Under physiological conditions 4-hydroxy-2(1H)- procoumon, and acenocoumarol are the most widely pre quinolone is the dominant form. scribed synthetic 4HC anticoagulants. These compounds FIG.9. HPLC and ESI-MS analysis of the biosynthesized share the 4HC core structure but differ in substitution at 4HC. (A) HPLC analysis of the biosynthesized 4HC. The UV 3-position on the pyrone ring. absorption profiles of the standard and the biosynthesized FIG. 2. Schematic representations of natural and artificial 4HC are shown beside their peaks. (B) ESI-MS (negative ion 4HC biosynthetic pathways. (A) Previously proposed natural mode) analysis of the biosynthesized 4HC collected and puri 4HC biosynthetic routes. Scheme i describes the mold-medi fied by HPLC. The peak at 161 (M-H)— corresponds to the ated 4HC biosynthesis; scheme ii represents a proposed molecular weight 162 (molecular formula CHO). microbe-independent pathway in plant. Question mark indi 10 FIG. 10. "H NMR spectrum of the biosynthesized 4HC. The multiplet between 7.34 and 7.39 was determined to be the cates a questionable catalytic step that was not identified. (B) signal of two protons based on its integration value and the The artificial 4HC biosynthetic mechanism designed in this Subsequent gHSQC spectrum study. Arrows depicting reactions catalyzed by ICS, IPL, FIG. 11. C NMR spectrum of the biosynthesized 4HC. SCL, and BIS, including the production of PYR, CoA, and 15 The arrow indicates the solvent DMSO as the reference com CO2, and consumption of Coa and Malonyl-CoA indicate pound. non-native catalytic steps; all other arrows indicate the E. coli FIG. 12. gFISQC (gradient Heteronuclear Single Quantum endogenous metabolism. Enzymes ICS and IPL are high Coherence) NMR spectrum of the biosynthesized 4HC. fl lighted to represent the lower module ii in FIG.2(A), and SCL indicates chemical shift for carbon; f2 indicates chemical and BIS are highlighted to represent the upper module i in shift for proton. FIG. 2(A). E4P: D-erythrose-4-phosphate; PEP: phospho FIG. 13. Growth and production profiles of the constructed enolpyruvate: PYR: pyruvate; AcCoA:acetyl-CoA: 4HC producing E. coli Strains. (A) Strain A (E. coli carrying FIG. 3. Kinetic parameters of SdgA (A) and Mdpl32 (B). pZE-EP-PS) expresses the upper module (EP) and lower The K and V values were estimated with OriginPro8 module (PS) with 2 operons on the high-copy plasmid; (B) through non-linear regression of the Michaelis-Menten equa 25 and (C) indicate the modular optimization by adjusting gene tion. Protein concentrations E of SdgA and MdpB2 in the organization, copy number, and operon configuration. Strain reaction systems were 0.0332 uM and 0.0172 uM, respec B separately expresses upper module (EP) and lower module tively.k values of the two enzymes were calculated accord (PS) on the high-copy and the medium-copy plasmids, ing to the formula kV/IE. All data points are reported respectively, while Strain C expresses the full pathway within as meants.d. from two independent experiments (n=2). Error 30 the same operon on the high-copy plasmid; (D) and (E) indi bars are defined as S.d. cate improving precursor availability by over-expressing FIG. 4. HPLC analysis of 4HC produced by E. coli carry aroL, ppsA, thtA, and aroG" (APTA) on the high-copy and ing pZE-BIS3-SdgA in the presence of 1 mM of salicylic medium-copy plasmids, respectively. Characteristics of the acid. (A) A sample taken from the cell culture after 24 hours. plasmid(s) carried by E. coli are shown on the upper-left (B) 50 mg/L of 4HC standard. The retention time was about 35 corner of each graph. All data are reported as meants.d. from 9.0 min. UV absorbance profiles are shown beside the peaks three independent experiments (n=3). Error bars are defined marked with red-colored asterisks. as S.d. FIG. 5. Kinetic parameters of EntC (A), MenF (B), and FIG. 14. Artificial 4HC biosynthetic mechanism shunted PchA (C). The K, and V were generated with OriginPro8 from shikimate pathway. E4P: D-erythrose-4-phosphate: through non-linear regression of the Michaelis-Menten equa 40 PEP: phosphoenolpyruvate: PYR: pyruvate; AcCOA:acetyl tion. Protein concentrations E of EntC, MenF, and PchA in CoA: DAHP: 3-deoxy-D-arabino-heptulosonate-7-phos the reaction systems were all 0.1 uM, respectively. k of the phate; SHIK: shikimate; S3P: shikimate-3-phosphate. enzymes were calculated according to the formulak. V/ FIG. 15. HPLC analysis of the standard and semi-synthe E. All data points are reported as meants.d. from two inde sized warfarin. The red-colored asterisk indicates the peak of pendent experiments (n=2). Error bars are defined as S.d. 45 the semi-synthesized warfarin. Its retention time was about FIG. 6. Salicylate biosynthesis in E. coli and HPLC analy 12.2 min. UV absorption profiles are shown beside the war sis. (A) Time courses of cell growth and salicylate biosynthe farin peaks. The peaks of the precursors 4HC and benzylde sis for E. coli carrying pZE-EP. All data points are reported as neacetone were also indicated. meants.d. from three independent experiments (n=3). Error FIG. 16. Numbering of the assigned carbons and protons. bars are defined as S.d. (B) HPLC analysis of the biosynthe 50 The numbers indicate the carbons and protons in the NMR sized salicylate. The UV absorption profiles of the standard data. and the biosynthesized salicylate are shown beside their FIG. 17. Amino acid sequence of SEQID NO:1 (an iso peaks (indicated by asterisks). chorismate synthase), SEQID NO:2 (an isochorismate pyru FIG. 7. In vitro complementation assay for examining the vate lyase), SEQID NO:3 (a salicylate:CoA ligase), and SEQ rate-limiting enzyme. 4 combinations of enzymes were tested 55 ID NO:4 (a 4HC-forming enzyme). for in vitro 4HC formation. Crude Extract was prepared from the lysed cells of the E. coli strain expressing the full DETAILED DESCRIPTION OF ILLUSTRATIVE pathway (E. coli/pZE-EPBS). EMBODIMENTS FIG.8. Comparison of the reaction mechanisms of biphe nyl synthase (BIS) and Pseudomonas quinolone synthase 60 Described herein is an artificial method for the microbial (PdsD). BIS catalyzes the decarboxylative condensation of biosynthesis of 4-hydroxycoumarin (4HC), and genetically malonyl-CoA with salicoyl-CoA, after which intramolecular engineered microbes for producing 4HC. The pathway cyclization takes place to form 4HC. PasD was reported to scheme is shown in FIG.2B. Chorismate, an intermediate of condense malonyl-CoA/malonyl-ACP and anthraniloyl the shikimate pathway, can be used as a Substrate by an CoA. Then similar intramolecular cyclization takes place to 65 isochorismate synthase to produce isochorismate. The iso form 4-hydroxy-2(1H)-quinolone which is spontaneously chorismate produced can be converted to salicylate and pyru interchangeable to its tautomer 2,4-dihydroxyquinoline vate by the action of an isochorismate pyruvate lyase. The US 9,353,390 B2 7 8 salicylate can be converted to Salicoyl-CoA by a salicylate: rooxidans, Serratia fonticola, as well as other genera. Coding CoA ligase. The final step in the formation of 4-hydroxycou regions may be isolated using polymerase chain reaction marin is the condensation of a salicoyl-CoA and a malonyl (PCR) with primers designed by standard primer design soft CoA catalyzed by a 4HC forming enzyme. Such as a biphenyl ware which is commonly used in the art. Exemplary primers synthase. for use in isolating a coding region encoding a protein having The microbial pathway described herein for the production isochorismate pyruvate lyase activity are shown in Table 3. of 4HC from a chorismate intermediate includes an enzyme Suitable coding sequences are easily ligated into any standard having isochorismate synthase activity. As used herein, “iso expression vector by the skilled person. In one embodiment, chorismate synthase' and “ICS refer to a protein that, a protein having isochorismate pyruvate lyase activity is, or is regardless of its common name or native function, catalyses 10 structurally similar to, a reference protein that has the amino the conversion of chorismate to isochorismate (see FIG. 2B), acid sequence of SEQ ID NO:2 (GenBank number and a protein catalysing Such a conversion has isochorismate NP 252920.1). synthase activity. Methods for determining whether a protein The microbial pathway described herein for the production has isochorismate synthase activity are described in Example of 4HC from a chorismate intermediate includes an enzyme 1. 15 having salicylate:CoA ligase activity. As used herein, "sali Enzymes having isochorismate synthase activity are cylate:CoA ligase' and “SCL refer to a protein that, regard known to the skilled worker and are easily obtained. A coding less of its common name or native function, catalyses the region encoding a protein having isochorismate synthase conversion of salicylate to salicoyl-CoA (see FIG. 2B), and a activity may be obtained from a suitable biological source, protein catalysing Such a conversion has salicylate:CoA Such as a microbial cell, using standard molecular cloning ligase activity. Methods for determining whether a protein techniques. Examples of coding regions include, but are not has salicylate:CoA ligase activity are described in Example 1. limited to, those that encode PChA (Serino et al., Mol. Gen. Enzymes having salicylate:CoA ligase activity are known Genet. 249,217-228 (1995)), EntC (Liu et al., Biochemistry to the skilled worker and are easily obtained. A coding region (Mosc.) 29, 1417-1425 (1990)) and MenF (Daruwala et al., J. encoding a protein having salicylate:CoA ligase activity may Bacteriol. 179, 3133-3138 (1997)). Suitable microbes that 25 be obtained from a suitable biological source, such as a may harbor coding regions encoding enzymes having isocho microbial cell, using standard molecular cloning techniques. rismate synthase activity include, but are not limited to, Examples of coding regions include, but are not limited to, Mycobacterium species, Pseudomonas species including P those that encode SdgA (involved in salicylate degradation in aeruginosa, E. coli, Bacillus subtilis, Klebsiella pneumonia, Streptomyces sp. WA46, Ishiyama et al., 2004, Appl. Environ. Bacillus cereus, Salmonella enteric, Staphylococcus aureus, 30 Microbiol. 70: 1297-1306), MdpB2 (involved in maduropep Mycobacterium tuberculosis, Acinetobacter baumannii, List tin biosynthesis in Actinomadura madurae ATCC39144, eria monocytogenes, Yersinia pestis, as well as other genera. Ling, et al., 2010, J. Am. Chem. Soc. 132:12534-12536), and Coding regions may be isolated using polymerase chain reac SsfL 1 (involved intetracycline SF2575 biosynthesis in Strep tion (PCR) with primers designed by standard primer design tomyces sp. SF2575, Pickens et al., 2009, J. Am. Chem. Soc. Software which is commonly used in the art. Exemplary prim 35 131:17677-17689). Other examples of enzymes having sali ers for use in isolating a coding region encoding a protein cylate:CoA ligase activity include Some benzoate:CoA having isochorismate synthase activity are shown in Table 3. ligases (Geissler et al., 1988, J. Bacteriol. 170: 1709-1714, Suitable coding sequences are easily ligated into any standard and Beuerle et al., 2002, Arch. Biochem. Biophys. 400:258 expression vector by the skilled person. In one embodiment, 264). Suitable microbes that may harbor coding regions a protein having isochorismate synthase activity is, or is struc 40 encoding enzymes having salicylate:CoA ligase activity turally similar to, a reference protein that has the amino acid include, but are not limited to, Streptomyces sp., Actinoma sequence of SEQIDNO:1 (GenBank number NP 415125.1). dura sp., Rhodopseudomonas sp., Magnetospirillum sp., The microbial pathway described herein for the production Clarkia breweri, Thauera aromatics, Geobacter metallire of 4HC from a chorismate intermediate includes an enzyme ducens, as well as other genera. Coding regions may be iso having isochorismate pyruvate lyase activity. As used herein, 45 lated using polymerase chain reaction (PCR) with primers "isochorismate pyruvate lyase' and “IPL refer to a protein designed by standard primer design software which is com that, regardless of its common name or native function, monly used in the art. Exemplary primers for use in isolating catalyses the conversion of isochorismate to salicylate and a coding region encoding a protein having salicylate:CoA pyruvate (see FIG. 2B), and a protein catalysing such a con ligase activity are shown in Table 3. Suitable coding version has isochorismate pyruvate lyase activity. Methods 50 sequences are easily ligated into any standard expression for determining whether aprotein has isochorismate pyruvate vector by the skilled person. In one embodiment, a protein lyase activity are described in Example 1. having salicylate:CoA ligase activity is, or is structurally Enzymes having isochorismate pyruvate lyase activity are similar to, a reference protein that has the amino acid known to the skilled worker and are easily obtained. A coding sequence of SEQID NO:3 (GenBank number BAC78380.1). region encoding a protein having isochorismate pyruvate 55 The microbial pathway described herein for the production lyase activity may be obtained from a suitable biological of 4HC from a chorismate intermediate includes an enzyme Source. Such as a microbial cell, using standard molecular having 4HC-forming activity. As used herein, “4HC-form cloning techniques. Examples of coding regions include, but ing and “BIS' refer to a protein that, regardless of its com are not limited to, those that encode PChB from Paeruginosa mon name or native function, catalyses the condensation of a (PaPchB, Serino et al., Mol. Gen. Genet. 249, 217-228 60 salicoyl-CoA and a malonyl-CoA to form 4HC (see FIG. 2B), (1995)) and Pfluorescence (PfPchB). Suitable microbes that and a protein catalysing Such a conversion has 4HC-forming may harbor coding regions encoding enzymes having isocho activity. Methods for determining whether a protein has 4HC rismate pyruvate lyase activity include, but are not limited to, forming activity are described in Example 1. Mycobacterium species, other Pseudomonas species, Enzymes having 4HC-forming activity are known to the Burkholderia pseudomallei, Mycobacterium tuberculosis, 65 skilled worker and are easily obtained. A coding region Vibrio nigripulchritudo, Burkholderia cenocepacia, Vibrio encoding a protein having 4HC-forming activity may be nigripulchritudo, Serratia ply muthica, Acidithiobacillus fer obtained from a suitable biological source. Such as a micro US 9,353,390 B2 9 10 bial cell, using standard molecular cloning techniques. selected from other members of the class to which the amino Examples of coding regions include, but are not limited to, acid belongs. For example, it is known in the art of protein those encoding biphenyl synthases, such as BIS3 from Sorbus biochemistry that an amino acid belonging to a grouping of aucuparia (Liu et al., Plant Mol. Biol. 72, 17-25 (2010)), and amino acids having a particular size or characteristic (such as a FabH-like quinolone synthase (B-ketoacyl-ACP synthase charge, hydrophobicity and hydrophilicity) can be substi III (FabH)-type quinolone synthase) PasD from P. aerugi tuted for another amino acid without altering the activity of a nosa (Zhanget al., J. Biol. Chem. 283, 28788-28794 (2008)). protein, particularly in regions of the protein that are not Suitable microbes that may harbor coding regions encoding directly associated with biological activity. For example, non enzymes having 4HC-forming activity include, but are not polar (hydrophobic) amino acids include alanine, leucine, limited to, Sorbus aucupari and P aeruginosa, as well as 10 isoleucine, Valine, proline, phenylalanine, tryptophan, and other genera. Coding regions may be isolated using poly tyrosine. Polar neutral amino acids include glycine, serine, merase chain reaction (PCR) with primers designed by stan threonine, cysteine, tyrosine, asparagine and glutamine. The dard primer design Software which is commonly used in the positively charged (basic) amino acids include arginine, art. Exemplary primers for use in isolating a coding region lysine and histidine. The negatively charged (acidic) amino encoding a protein having 4HC-forming activity are shown in 15 acids include aspartic acid and glutamic acid. Conservative Table 3. Suitable coding sequences are easily ligated into any Substitutions include, for example, Lys for Arg and vice versa standard expression vector by the skilled person. In one to maintain a positive charge; Glu for Asp and vice versa to embodiment, a protein having 4HC-forming activity is, or is maintain a negative charge; Serfor Thr so that a free —OH is structurally similar to, a reference protein that has the amino maintained; and Glin for ASn to maintain a free —NH2. acid sequence of SEQ ID NO:4 (GenBank number Thus, as used herein, a candidate protein useful in the NP 249690.1). methods described herein includes those with at least 50%, at Other examples of proteins useful in the methods described least 55%, at least 60%, at least 65%, at least 70%, at least herein include those that are structurally similar to the amino 75%, at least 80%, at least 85%, at least 86%, at least 87%, at acid sequence of SEQ ID NO:1, SEQ ID NO:2, SEQ ID least 88%, at least 89%, at least 90%, at least 91%, at least NO:3, or SEQ ID NO:4. An isochorismate synthase that is 25 92%, at least 93%, at least 94%, at least 95%, at least 96%, at structurally similar to the amino acid sequence of SEQ ID least 97%, at least 98%, or at least 99% amino acid sequence NO:1 has isochorismate synthase activity. An isochorismate similarity to a reference amino acid sequence. pyruvate lyase that is structurally similar to the amino acid Alternatively, as used herein, a candidate protein useful in sequence of SEQID NO: 2 has isochorismate pyruvate lyase the methods described herein includes those with at least activity. A salicylate:CoA ligase that is structurally similar to 30 50%, at least 55%, at least 60%, at least 65%, at least 70%, at the amino acid sequence of SEQID NO:3 has salicylate:CoA least 75%, at least 80%, at least 85%, at least 86%, at least ligase activity. A 4HC-forming enzyme that is structurally 87%, at least 88%, at least 89%, at least 90%, at least 91%, at similar to the amino acid sequence of SEQ ID NO:4 has least 92%, at least 93%, at least 94%, at least 95%, at least 4HC-forming activity. 96%, at least 97%, at least 98%, or at least 99% amino acid Structural similarity of two proteins can be determined by 35 sequence identity to the reference amino acid sequence. aligning the residues of the two proteins (for example, a Optionally, the microbe may be further genetically engi candidate protein and any appropriate reference protein neered to increase the amount of chorismate and/or malonyl described herein) to optimize the number of identical amino CoA compared to a control cell. Rate limiting steps in the acids along the lengths of their sequences; gaps in either or production of chorismate and malonyl-CoA are known and both sequences are permitted in making the alignment in 40 can be manipulated to result in more of those intermediates. order to optimize the number of identical amino acids, Regarding chorismate production, the 3-deoxy-D-arabino although the amino acids in each sequence must nonetheless heptuloSonate-7-phosphate synthases encoded by aroG, aroF. remain in their proper order. A reference protein may be a and aroH in E. coli are feedback-inhibited by phenylalanine, protein described herein. A candidate protein is the protein tyrosine, and tryptophan, respectively (Kikuchi et al. Appl. being compared to the reference protein. A candidate protein 45 Environ. Microbiol. 63,761-762 (1997). Feedback inhibition may be isolated, for example, from a microbe, or can be resistant (fbr) variants of these enzymes can be engineered, produced using recombinant techniques, or chemically or for example, by introducing point mutations. For instance, a enzymatically synthesized. feedback inhibition resistant variant aroG" can be generated Unless modified as otherwise described herein, a pair-wise by introducing a point mutation that results in an Asp-146 comparison analysis of amino acid sequences can be carried 50 Asn mutation in the enzyme. Erythrose-4-phosphate (E4P) is out using the Blastp program of the BLAST 2 search algo a rate limiting intermediate in the shikimate pathway for the rithm, as described by Tatiana et al., (FEMS Microbiol Lett, production of chorismate, and the availability of E4P can be 174, 247-250 (1999)), and available on the National Center alleviated by over-expressing transketolase (encoded by for Biotechnology Information (NCBI) website. The default tktA). Phosphoenolpyruvate (PEP) is also a rate limiting values for all BLAST 2 search parameters may be used, 55 intermediate in the shikimate pathway for the production of including matrix=BLOSUM62; open gap penalty=11, exten chorismate, and the availability of PEP can be alleviated by sion gap penalty=1, gap X dropoff 50, expect-10, word over-expressing PEP synthase (encoded by ppsA), (Lutke size=3, and filter on. Alternatively, polypeptides may be com Eversloh et al. Appl. Microbiol. Biotechnol. 75, 103-110 pared using the BESTFIT algorithm in the GCG package (2007)). Shikimate kinase (encoded by aroK/aroL) is another (version 10.2, Madison Wis.). 60 bottleneck which can be eliminated by the over-expression of In the comparison of two amino acid sequences, structural aroL (Luetke-Eversloh et al. Metab. Eng. 10, 69-77 (2008)). similarity may be referred to by percent “identity” or may be The coding regions encoding these enzymes may be isolated referred to by percent “similarity.” “Identity” refers to the using polymerase chain reaction (PCR) with primers presence of identical amino acids. “Similarity” refers to the designed by standard primer design software which is com presence of not only identical amino acids but also the pres 65 monly used in the art. Exemplary primers for use in isolating ence of conservative Substitutions. A conservative Substitu Such coding regions are shown in Table 3. Thus, an engi tion for an amino acid in a protein described herein may be neered cell described herein may optionally include a muta US 9,353,390 B2 11 12 tion conferring feedback inhibition resistance in one or more codon at its 5' end and a translation stop codon at its 3' end. As of the 3-deoxy-D-arabino-heptulosonate-7-phosphate syn used herein, "heterologous nucleotides’ refers to a nucleotide thases encoded by aroG, aroF, and aroH, such as aroG'. sequence that is not normally or naturally found flanking an increased expression of a PEP synthase encoded by ppsA, open reading frame in a cell encoding an ICS, IPL, SCL, or increased expression of a transketolase encoded by thtA, BIS protein. Examples of heterologous nucleotides include, increased expression of a shikimate kinase encoded by aroK/ but are not limited to, a regulatory sequence. The number of aroL, or a combination thereof. In one embodiment, the engi heterologous nucleotides may be, for instance, at least 10, at neered cell includes aroL, ppsA, thitA, and aroG'. least 100, or at least 1000. A protein useful in the methods described herein may A polynucleotide described herein, such as an ICS, IPL, include other amino acid residues. In one embodiment, the 10 additional amino acids are heterologous amino acids. As used SCL, or BIS protein, can be present in a vector. A vector is a herein, "heterologous amino acids’ refers to amino acids that replicating polynucleotide. Such as a plasmid, phage, or are not normally or naturally found flanking the amino acid cosmid, to which another polynucleotide may be attached so sequence of an ICS, IPL, SCL, or BIS protein in a microbial as to bring about the replication of the attached polynucle cell. A protein that includes heterologous amino acids may be 15 otide. Construction of vectors containing a polynucleotide of referred to as a fusion polypeptide. the invention employs standard ligation techniques known in In one embodiment, the additional amino acid sequence the art. See, e.g., Sambrook et al. Molecular Cloning. A may be useful for purification of the fusion polypeptide by Laboratory Manual., Cold Spring Harbor Laboratory Press affinity chromatography. Various methods are available for (1989). A vector can provide for further cloning (amplifica the addition of such affinity purification moieties to proteins. tion of the polynucleotide), i.e., a cloning vector, or for Representative examples include, for instance, polyhistidine expression of the polynucleotide, i.e., an expression vector. tag (His-tag) and maltose-binding protein (see, for instance, The term vector includes, but is not limited to, plasmid vec Hopp et al. (U.S. Pat. No. 4,703,004), Hopp et al. (U.S. Pat. tors, viral vectors, cosmid vectors, and transposon vectors. A No. 4,782,137), Sgarlato (U.S. Pat. No. 5,935.824), and vector may be replication-proficient or replication-deficient. Sharma (U.S. Pat. No. 5,594,115)). In one embodiment, the 25 A vector may result in integration into a cell's genomic DNA. additional amino acid sequence may be a carrier polypeptide. Typically, a vector is capable of replication in a host cell. Such The carrier polypeptide may be used to increase the immu as E. coli. nogenicity of the fusion polypeptide to increase production of Selection of a vector depends upon a variety of desired antibodies that specifically bind to a protein described herein. characteristics in the resulting construct, Such as a selection In another embodiment, the additional amino acid sequence 30 marker, vector replication rate, and the like. Suitable host may be a fluorescent polypeptide (e.g., green, yellow, blue, or cells for cloning or expressing the vectors herein are prokary red fluorescent proteins) or other amino acid sequences that otic or eukaryotic cells. Suitable eukaryotic cells include can be detected in a cell or in vitro. If a protein described mammalian cells, such as yeast cells, murine cells, and herein includes an additional amino acid sequence not nor human cells. Suitable prokaryotic cells include eubacteria, mally or naturally associated with the polypeptide, the addi 35 Such as gram-negative organisms, for example, E. coli. tional amino acids are not considered when percent structural An expression vector optionally includes regulatory similarity to a reference amino acid sequence is determined. sequences operably linked to a polynucleotide encoding a Proteins described herein can be produced using recombi protein, such as an ICS, IPL, SCL, or BIS protein. An example nant DNA techniques, such as an expression vector present in of a regulatory sequence is a promoter. A promoter may be a cell. Such methods are routine and known in the art. The 40 functional in a host cell used, for instance, in the construction proteins may also be synthesized in vitro, e.g., by Solid phase and/or characterization of a polynucleotide encoding a pro peptide synthetic methods. The solid phase peptide synthetic tein described herein, and/or may be functional in the ultimate methods are routine and known in the art. A protein produced recipient of the vector. A promoter may be inducible, repress using recombinant techniques or by Solid phase peptide Syn ible, or constitutive, and examples of each type are known in thetic methods can be further purified by routine methods, 45 the art. A polynucleotide encoding a protein described herein Such as fractionation on immunoaffinity or ion-exchange col may also include a transcription terminator. Suitable tran umns, ethanol precipitation, reverse phase HPLC, chroma Scription terminators are known in the art. tography on silica or on an anion-exchange resin Such as The four coding regions (ICS, IPL, SCL, and BIS) may be DEAE, chromatofocusing, SDS-PAGE, ammonium sulfate on separate plasmids, all four coding regions may be on one precipitation, gel filtration using, for example, Sephadex 50 plasmid, or different coding regions may be grouped together G-75, or ligand affinity. in some combination thereof. Likewise, the four coding Also provided are polynucleotides encoding an ICS, IPL, regions may be integrated into a cells genomic DNA at four SCL, or BIS protein. Given the amino acid sequence of an different locations, at one location, or different coding ICS, IPL, SCL, or BIS protein described herein, a person of regions may be grouped together in Some combination ordinary skill in the art can determine the full scope of poly 55 thereof. For instance, a plasmid may include one coding nucleotides that encode that amino acid sequence using con region and a second plasmid may include the other three ventional, routine methods. The class of nucleotide coding regions, or in another embodiment one plasmid may sequences encoding a selected protein sequence is large but include two of the coding regions and a second plasmid may finite, and the nucleotide sequence of each member of the include the other two coding regions. In one embodiment, one class may be readily determined by one skilled in the art by 60 plasmid includes a coding region encoding an ICS and reference to the standard genetic code, wherein different another coding region encoding an IPL, while a second plas nucleotide triplets (codons) are known to encode the same mid includes a coding region encoding a SCL and another amino acid. coding region encoding a BIS. The plasmid may be high copy An ICS, IPL, SCL, and/or a BIS polynucleotide described number (copies in a cell in the 100's) or low copy number (2-5 herein may include heterologous nucleotides flanking the 65 copies in a cell). In one embodiment, two or more coding coding region encoding the protein. The boundaries of a regions may be expressed as an operon, e.g., a single pro coding region are generally determined by a translation start moter drives expression of more than one coding region. US 9,353,390 B2 13 14 Polynucleotides described herein can be produced in vitro binant proteins. Examples of recombination may include or in vivo. For instance, methods for in vitro synthesis inserting foreign polynucleotides into a cell, inserting Syn include, but are not limited to, chemical synthesis with a thetic polynucleotides into a cell, or relocating or rearranging conventional DNA/RNA synthesizer. Commercial suppliers polynucleotides within a cell. Any form of recombination of synthetic polynucleotides and reagents for in vitro synthe may be considered to be genetic engineering and therefore sis are known. Methods for in vitro synthesis also include, for any recombinant cell may also be considered to be a geneti instance, in vitro transcription using a circular or linear cally engineered cell. expression vector in a cell free system. Expression vectors Genetically engineered cells are also referred to as “meta can also be used to produce a polynucleotide in a cell, and the bolically engineered” cells when the genetic engineering polynucleotide may then be isolated from the cell. 10 modifies or alters one or more particular metabolic pathways The coding regions encoding proteins for production of So as to cause a change in metabolism. The goal of metabolic 4HC may be introduced into a microbial cell using genetic engineering is to improve the rate and conversion of a Sub engineering techniques. The term “microbe' is used inter strate into a desired product. General laboratory methods for changeably with the term “microorganism' and means any introducing and expressing or overexpressing native and nor microscopic organism existing as a single cell, cell clusters, 15 mative proteins such as enzymes in many different cell types or multicellular relatively complex organisms. While certain (including bacteria, archaea, and yeasts.) are routine and embodiments are described using E. coli, the microbes and known in the art; see, e.g., Sambrook et al. Molecular Clon methods of use are not limited to E. coli and there are a ing: A Laboratory Manual., Cold Spring Harbor Laboratory number of other options for microbes Suitable for engineering Press (1989), and Methods for General and Molecular Bac to synthesize 4HC and for use in the methods described teriology, (eds. Gerhardt et al.) American Society for Micro herein. The suitable microbial hosts for the synthesis of 4HC biology, chapters 13-14 and 16-18 (1994). as described herein include, but are not limited to, a wide The introduction of coding regions encoding the enzymes variety of bacteria, archaea, and yeast including members of of the metabolic pathway for the production of 4HC from a the genera Escherichia (such as E. coli), Pseudomonas spp. chorismate intermediate into a cell involves expression or (such as P. putida). Thermus thermophilus, Salmonella, 25 overexpression of the enzymes. An enzyme is "overex Clostridium, Zymomonas, Bacillus (such as B. subtilis and B. pressed in a recombinant cell when the enzyme is expressed licheniformis), Rhodococcus (such as R. erythropolis), at a level higher than the level at which it is expressed in a Alcaligenes (such as A. eutrophus), Klebsiella, Paenibacillus comparable wild-type cell. In cells that do not express a (such as P macerans), Lactobacillus (such as L. plantarum), particular endogenous enzyme, or in cells in which the Enterococcus (such as E. gallinarium, E. faecalis, and E. 30 enzyme is not endogenous (i.e., the enzyme is not native to the faecium), Arthrobacter, Brevibacterium, Corynebacterium cell), any level of expression of that enzyme in the cell is Candida, Hansenula, Pichia, cyanobacteria, and Saccharo deemed an "overexpression” of that enzyme for purposes of myces (such as S. cerevisiae). Other suitable microbial hosts the present invention. include algae, protozoa, microscopic plants such as green As will be appreciated by a person of skill in the art, algae, and microscopic animals such as rotifers and planar 35 overexpression of an enzyme can be achieved through a num ians. If necessary, a coding region encoding an enzyme ber of molecular biology techniques. For example, overex described herein can be modified using routine methods to pression can be achieved by introducing into the host cell one reflect the codon usage bias of a microbial host cell to opti or more copies of a polynucleotide encoding the desired mize expression of a polypeptide. enzyme. The polynucleotide encoding the desired enzyme A cell that has been genetically engineered to produce 4HC 40 may be endogenous or exogenous to the host cell. Typically, from a chorismate intermediate may be referred to as a “host' the polynucleotide is introduced into the cell using a vector. cell, a “recombinant cell, a “metabolically engineered” cell, The polynucleotide may be circular or linear, single-stranded a "genetically engineered” cell or simply an “engineered or double stranded, and can be DNA, RNA, or any modifica cell. These and similar terms are used interchangeably. A tion or combination thereof. The vector can be any molecule genetically engineered cell refers to a microbe that has been 45 that may be used as a vehicle to transfer genetic material into altered by the hand of man by the introduction of at least one a cell. Examples of molecular biology techniques used to exogenous polynucleotide. Thus, in one embodiment, a transfer nucleotide sequences into a microorganism include, genetically engineered cell contains one or more exogenous without limitation, transfection, electroporation, transduc polynucleotides which have been created through standard tion, and transformation. These methods are routine and molecular cloning techniques to bring together genetic mate 50 known in the art. Insertion of a vector into a target cell is rial that is not natively found together. For example, a microbe usually called transformation for bacterial cells and transfec is a genetically engineered microbe by virtue of introduction tion for eukaryotic cells, however insertion of a viral vector is of an exogenous polynucleotide. "Engineered also includes often called transduction. The terms transformation, transfec a microbe that has been genetically manipulated Such that one tion, and transduction, for the purpose of the present inven or more endogenous nucleotides have been altered. For 55 tion, are used interchangeably herein. example, a microbe is an engineered microbe by virtue of Also provided herein are methods for producing 4HC introduction of an alteration of endogenous nucleotides into a using the engineered cells described herein. Briefly, and as Suitable microbe. For instance, a regulatory region, such as a described and illustrated in more detail elsewhere herein, the promoter, could be altered to result in increased or decreased host cell is engineered to contain a novel biosynthetic path expression of an operably linked endogenous coding region. 60 way. Specifically, the host cell is engineered to overexpress an DNA sequences used in the construction of recombinant enzyme having isochorismate synthase activity, isochoris DNA molecules can originate from any species. For example, mate pyruvate lyase activity, salicylate:CoA ligase activity, bacterial DNA may be joined with fungal DNA. Alterna 4HC-forming activity, or a combination thereof. In one tively, DNA sequences that do not occur anywhere in nature embodiment, the method includes culturing the engineered may be created by the chemical synthesis of DNA, and incor 65 microbe under conditions suitable for the production of 4-hy porated into recombinant molecules. Proteins that result from droxycoumarin. The cell may be one expressing an endog the expression of recombinant DNA are often termed recom enous isochorismate synthase, an endogenous isochorismate US 9,353,390 B2 15 16 pyruvate lyase, an endogenous salicylate:CoA ligase, a 4HC The present invention is illustrated by the following forming protein, or a combination thereof. Alternatively, the examples. It is to be understood that the particular examples, cell may be a recombinant cell that has been engineered to materials, amounts, and procedures are to be interpreted express isochorismate synthase, isochorismate pyruvate broadly in accordance with the scope and spirit of the inven lyase, Salicylate:CoA ligase, and/or 4HC-forming protein at a tion as set forth herein. level greater than a control cell. In one embodiment, the amount of 4HC produced by an engineered cell described Example 1 herein after 24 hours incubation in a shake flask kept under constant agitation is at least 0.1 gram/liter (g/L), at least 0.25 4-Hydroxycoumarin (4HC) type anticoagulants (e.g. war g/L, at least 0.5g/L, or at least 0.75 g/L. In one embodiment, 10 farin) are known to play a significant role in the treatment of the amount of 4HC produced by an engineered cell described thromboembolic diseases—a leading cause of patient mor herein after 24 hours incubation in a shake flask kept under bidity and mortality worldwide. 4HC serves as an immediate constant agitation is no greater than 2 g/L, no greater than precursor of these synthetic anticoagulants. Although 4HC 1.75g/L, no greater than 1.5 g/L, or no greater than 1.25 g/L. was initially identified as a naturally occurring product, its In one embodiment, the method includes incubating iso 15 lated isochorismate synthase, isochorismate pyruvate lyase, biosynthesis has not been fully elucidated. Here we present salicylate:CoA ligase, and 4HC-forming proteins with cho the design, validation, in vitro diagnosis, and optimization of rismate under conditions suitable to produce 4HC. The cell an artificial biosynthetic mechanism leading to the microbial used as a source of the proteins may be a recombinant cell that biosynthesis of 4HC. Remarkably, function-based enzyme expresses one or more of the proteins at a level greater than a bioprospecting leads to the identification of a characteristic control cell. Alternatively, one or more of the proteins may be FabH-like quinolone synthase from Pseudomonas aerugi produced chemically or synthetically. nosa with high efficiency on the 4HC-forming reaction, The 4HC produced via the novel biosynthetic pathway can which promotes the high-level de novo biosynthesis of 4HC be isolated and optionally purified from any genetically engi in Escherichia coli (-500 mg/L in shake flasks) and further in neered cell described herein. It can be isolated directly from 25 situ Semi-synthesis of warfarin. This work holds scale-up the cells, or from the culture medium, for example, during an potential for microbial production of 4HC and opens up the aerobic or anaerobic fermentation process. Isolation and/or possibility of biosynthesizing diverse coumarin molecules purification can be accomplished using known and routine with pharmaceutical importance. methods. The 4HC may be used in any application, including Materials and Methods as the starting point for the synthesis of other compounds. 30 Strains, Plasmids, and Media. The methods described herein also include using the 4-hy E. coli strain XL1-Blue was used for plasmid propagation droxycoumarin produced by the microbe as the starting point and gene cloning; BL21 StarTM (DE3) was used for recom for the synthesis of other compounds. Accordingly, provided binant protein expression and purification: BW25113 con herein are methods for producing compounds that include a taining F" from XL1-Blue was used as the host strain for the 4-hydroxycoumarin structure. In one embodiment, a com 35 biosynthesis of salicylate and 4HC. The characteristics of all pound that includes a 4-hydroxycoumarin structure is an anti the strains and plasmids used in this study were described in coagulant. Examples of other compounds that include the Table 1. Luria-Bertani (LB) medium was used to grow E. coli 4-hydroxycoumarin structure include, for instance, wayfarin, cells for plasmid construction, propagation, and inoculum dicoumarol, and synthtic 4-hydroxycoumarins such as phen preparation. The biosynthesis medium M9Y contains (per procoumon and acenocoumarol. Wayfarin may be produced 40 liter): glycerol (20 g), yeast extract (5 g). NHCl (1 g). by, for instance, adding the precursorbenzyldeneacetone and NaHPO (6 g), KHPO (3 g), NaCl (0.5 g), MgSO.7HO (2 the catalyst (S,S)-1,2-diphenylethylenediamine to the 4-hy mmol), CaCl2.H2O (0.1 mmol), vitamin B1 (1.0 mg). 100 droxycoumarin produced by a microbe as described herein. ug/ml of amplicillin, 50 g/ml of kanamycin and/or 30 ug/ml The 4-hydroxycoumarin may be present in the culture with of chloramphenicol were added when necessary. the microbes, or may be enriched or isolated. 45 The genetically engineered cells described herein can be TABLE 1 cultured aerobically or anaerobically, or in a multiple phase fermentation that makes use of periods of anaerobic and Strains and plasmids used in this study aerobic fermentation. The decision on whether to use anaero Plasmid and bic and aerobic fermentation depends on variables familiar to 50 Strain Characteristics Source the skilled person. Fed-batch fermentation, batch fermenta tion, continuous fermentation, or any other fermentation Plasmid method may be used. pZE12-luc ColE1 ori; Amp: PlacO-1; luc Ref. 1 In various embodiments different supplements may be CS27 p15A ori: Kan: PlacO-1; MCS* Ref. 1 55 SA74 pSC101* ori; Cm: PlacO-1; MCS Ref.2 included in the medium in which the engineered cells are pETDUET-1 pBR322 ori; Amp' two T7 promoters; two MCS Nowagen grown. In one embodiment, the medium may be supple pZE-BIS3- From pZE12-luc, PlacO-1; bis3-sdgA This study mented with yeast extract from 1 to 20 grams per liter to ScigA improve cell growth and 4HC production. The method may ZE-PS From pZE12-luc, PlacO-1; pasD-sdga This study ZE-EP From pZE12-luc, PlacO-1; entC-pfpchB This study also include Supplying at least one carbon Source Such as pZE-EP-PS From pZE12-luc, dual operons entC-pfpchB This study glucose, Xylose, Sucrose, arabinose, glycerol, and/or galac 60 and pqsD-SdgA, both with PlacO-1 tOSe. CS-PS From pCS27, PlacO-1; pgsD-sdgA This study Importantly, the present invention permits a “total synthe pZE-EPBS From pZE12-luc, PlacO-1; entC-pfpchB- This study sis” or “de novo’ biosynthesis of 4HC in the genetically bis3-sdgA pZE-EPPS From pZE12-luc, PlacO-1; entC-pfpchB- This study engineered cell. In other words, it is not necessary to Supply pqsD-SdgA the genetically engineered cells with precursors or interme 65 pCS-APTA From pCS27, PlacO-1; aroL-ppsA-tktA- This study diates; 4HC can be produced using ordinary inexpensive car aroGr bon Sources such as glucose and the like. US 9,353,390 B2 17 18 TABLE 1-continued MG1655. The coding sequences of PdsD, PchA, and PaPchB were cloned from the P. aeruginosa PAO1 genomic DNA. Strains and plasmids used in this study The PfPchB gene was cloned from the Pfluorescence Pf5 genomic DNA. To purify the proteins, the genes of SdgA, Plasmid and MdpB2, EntC, MenF, PchA, PaPchB, PfPchB, and BIS3 were Strain Characteristics Source separately sub-cloned into pETDUET-1. All the genes were pZE-EP- From pZE12-luc, dual operons entC-pfpchB This study fused in frame with the his-tag DNA sequence using BamHI APTA and aroL-ppsA-tktA-aroG', both with and PstI, except for PchA (using BamHI and SalI) and PlacO-1 pSA-ACCB From pSA74, PlacO-1; accA-accD-accB- This study MdpB2 (using BamHI and HindIII). To construct pZE-BIS3 accC-birA 10 SdgA, the genes of BIS3 and SdgA were digested with KpnI/ Strain Ndel and NdeI/Xbal, respectively, and then ligated with the KpnI/Xbal digested pZE12-luc fragment via simultaneous E. coi recA1 endA1 gyra 96 thi-1 hsdR17 SupE44 Stratagene XL1-Blue relA1 lac F" proAB lacIZ AM15 Tn10 (Tet) three-piece ligation. To construct pZE-PS, the BIS3 gene was E. coi A(ara-araB), Alacz (::rrnB-3), -, rph-1, Yale replaced with the PdsD cDNA using the same restriction sites. BW251.13 A(rhaD-rhaB), hsdR CGSC 15 For pCS-PS, the same strategy was employed but using Strain A BW25113/F harboring pZE-EP-PS This study pCS27 as the backbone and different restriction enzymes Strain B BW25113/F harboring pZE-EP and pCS-PS This study Strain C BW25113/F'harboring pzE-EPPS This study AccG5I, Ndel, and BamHI. To construct pZE-EP, the genes of Strain D BW25113/F harboring pZE-EP-APTA and This study EntC and PfPchB were digested with KpnI/Ndel and Ndel/ pCS-PS SphI, respectively, and then ligated with the KpnI/SphI Strain E BW25113/F harboring pZE-EPPS and This study digested pZE 12-luc fragment via three-piece ligation. The pCS-APTA plasmid pZE-EP-PS harboring two operons, PlacO1-EntC *MCS: multiple cloning sites, PfPchB and PlacO1-Pas D-SdgA, was assembled as Reference 1, Lin and Yan, Microb. Ceil. Fact. 11, 42 (2012); described by Gilson using the plasmids pZE-EP and pZE-PS Reference 2, Huo et al., Nat. Biotechnoi. 29, 346-351 (2011). as templates and pZE 12-luc as the backbone (Gibson et al. Nat. Methods 6,343-345 (2009)). pZE-EPBS and pZE-EPPS DNA Manipulation. 25 were generated by inserting the BIS3/PdsD and SdgA genes The plasmids were generated via either regular cloning or into pZE-EP using the restriction sites SphI, Ndel, and Xbal Gibson assembly (Gibson et al. Nat. Methods 6, 343-345 via three-piece ligation. pCS-APTA was constructed by (2009)). The plasmid pETDUET-1 was used for the over inserting aroL. ppsAtlktA, and aroG' through two rounds of expression and purification of recombinant proteins with an three-piece ligation using KpnI/Ndel/SalI and XhoI/SphI/ N-terminal His tag; while pZE 12-luc, pCS27, and pSA74 are 30 HindIII. The similar strategy was used to construct pSA compatible plasmids used for expressing multiple enzymes ACCB using AccG5I/PstI/SalI and SalI/EcoRI/BamHI. The involved in the biosynthetic mechanism. The codon-opti plasmid pZE-EP-APTA was constructed by inserting the mized BIS3 cDNA was synthesized by Eurofins MWG PlacO1-APTA operon from pCS-APTA into pZE-EP using Operon. The cDNAs of SdgA and MdpB2 obtained from Dr. SaCI and Spel. Julian Davies and Dr. Ben Shen, respectively. Genes of EntC 35 Information of the pathway enzymes used in this study is and MenF were cloned from the genomic DNA of E. coli summarized in Table 2. The primers used are listed in Table 3. TABLE 2 Information of the pathway enzymes investigated as described herein.
Enzyme Activity information SdgA Salicylate:CoA From Streptomyces sp. Strain WA46. Previously reported by Ishiyama ligase etal (Ref1). MdpB2 We determined its kinetic parameters in this study for the first time. From Actinomadura madurae ATCC39144. Previously characterized by Ling et al (Ref 2). EntC Isochorismate From E. coli MG1655. Previously characterized by Liu et al (Ref3). MenF synthase From E. coli MG1655. Previously characterized by Daruwala etal (Ref 4). PchA From Pseudomonas aeruginosa PAO1. Previously characterized by Serino et al (Ref 5). PaPohB Isochorismate From Pseudomonas aeruginosa PAO1. Previously characterized by pyruvate lyase Serino et al (Ref 5). PfPCB From Pseudomonas fluorescence Pf-5. A putative IPL was not characterized before, sharing 62% identity with PaPchB. BIS3 4HC-forming Previously characterized as a biphenyl synthase from Sorbus enzyme aucuparia, also has the activity to form 4HC (Ref 6). PoSD From Pseudomonas aeruginosa PAO1. Previously identified as a quinolone synthase (Ref 7). We identified its 4HC-forming activity in vivo for the first time.
eference 1, Ishiyama et al. Appi. Environ. Microbiol. 70, 1297-1306 (2004); eference 2, Ling et al. J. Am. Chem. Soc. 132, 12534-12536 (2010); eference 3, Liu et al., Biochemistry (Mosc.) 29, 1417-1425 (1990); eference 4, Daruwala et al., J. Bacteriol. 179, 3133-3138 (1997); eference 5, Serino et al., Moi. Gen. Genet. 249,217-228 (1995); eference 6, Liu et al., Piant Moi. Biol. 72, 17-25 (2010); eference 7, Zhanget al., J. Bioi. Chem. 283, 28788-28794 (2008).
US 9,353,390 B2
TABLE 3 - continued
Primers used as described herein. Primer Sequence (SEQ ID NO) Use yy299 (Sall) gggaaagt cacaggagatataccatggatatt cqtaagattaaaaaactgat cqag (55) To amplify accBC for pSA yy3 OO (EcoRI) gggaaagaattct tatttitt.cctgaag accoagtttitt to tcc (56) ACCB yy301 (EcoRI) gggaaagaatticaggagatataccatgaaggata acac cqtgccac (57) To amplify birA for pSA yy302 (BamHI) gggaaaggat.cct tatttittctgcactacgcagggatattitc (58) ACCB
Enzyme Assays of SCLs. Feeding Experiments. To evaluate the activity of SCLS (SdgA and MdpB2), the E. Feeding experiments were conducted to examine the con coli strain BL21 StarTM (DE3) was transformed with pET 15 version of salicylate to 4HC. The E. coli strain carrying pZE SdgA and pET-MdpB2 separately. The obtained transfor BIS3-SdgA or p7E-PS was inoculated in 3 ml LB medium and grown overnight at 37°C. Subsequently, 200 ul overnight mants were pre-inoculated in Luria-Bertani (LB) medium cultures were re-inoculated into 20 ml of M9Y medium and containing 100 ug/ml of amplicillin and grown aerobically at grown at 37°C. with shaking (250rpm). The expression of the 37° C. overnight. Next day, the pre-inoculums were trans enzymes was induced by adding IPTG to a final concentration ferred into 50 ml of fresh LB medium at a volume ratio of of 0.5 mM when the ODoo values reached 0.6-0.7. At the 1:100. The cultures were left to grow at 37° C. till the OD same time, 1 mM of salicylate was added into the cultures and values reached 0.6-0.8 and then induced with 1.0 mM IPTG. the cultures were shaken at 30° C. for several hours, which Protein expression was conducted at 30° C. for another 5 h. was followed by HPLC analysis. The cells were harvested and the proteins were purified with 25 De Novo Biosynthesis of Salicylate and 4HC. the His-Spin Protein MiniprepTM kit (ZYMO RESEARCH). Overnight cultures (100 ul) of salicylate or 4HC producing The BCA kit (Pierce Chemicals) was used to estimate protein strains were inoculated into M9Y medium (10 ml) containing concentrations. The SCL enzyme assays were performed appropriate antibiotics and cultivated at 37°C. with shaking according to the method described by Ishiyama et al. with at 300 rpm. When the ODoo values of the cultures reached modifications (Ishiyama et al. Appl. Environ. Microbiol. 70, 30 around 0.6, IPTG was added to the cultures to a final concen 1297-1306 (2004)). The 1 ml reaction system contained 785 tration of 0.5 mM. Then the cultures were transferred to 30° ul of Tris-HCl (pH-7.5, 100 mM), 5ul of the purified enzyme C. for salicylate and 4HC biosynthesis. Samples were taken (SdgA or MdpB2), 10ul of MgCl, (0.5 M), 50 ul of ATP (100 every other hour and analyzed by HPLC. mM), 50 ul of coenzyme A (5 mM), 100 ul of salicylate (100 In Vitro Complementation Assay. uM,200 uM,500 uM, 1 mM). The reactions lasted 0.5 minfor 35 The E. coli strain carrying the plasmid pZE-EPBS was SdgA and 2.5 min for MdpB2, respectively, and then were pre-inoculated into 3 ml LB liquid medium containing 100 terminated by acidification with 20 uL of HCl (20%). The ug/ml of amplicillin and grown at 37°C. overnight with shak reaction rates were calculated according to the salicylate con ing at 300 rpm. In the following day, 1 ml of the preinoculum sumption at 30°C., which was measured by HPLC. was added to 50 ml of fresh M9Y medium. The culture was 40 left to grow at 37°C. till the ODoo value reached around 0.6 Enzyme Assays of ICSs. and then induced with 0.5 mM IPTG. The expression of the The kinetic parameters of the ICSs: EntC, MenF, and PchA pathway enzymes was conducted at 30° C. for another 5 were determined using coupled assays (Payne et al. Org. hours. The cells were harvested and re-suspended in 2 ml of Biomol. Chem. 7,2421-2429 (2009)). IPL from Paeruginosa Tris-HCl buffer (100 mM, pH=7.5), and then lysed by French (PaPchB) was used to convert isochorismate to salicylate 45 Press. The soluble fraction was collected by ultra-centrifuga which was quantified by HPLC. The 1 ml reaction system tion and used as the crude enzyme extract for the complemen contained 866 ul of Tris-HCl (pH-7.5, 100 mM), 20 ul of tation assay. The 1 ml reaction system firstly contained Tris MgCl, (0.5 M), 0.1 M of purified ICS (EntC, MenF, or HC1 (100 mM, pH=7.5), MgCl, (5 mM), ATP (5 mM), PchA), 0.5uM of purified PaPchB, 100 ul of chorismic acid coenzyme A (0.25 mM), salicylate (0.2 mM), crude extract (100 uM,200 uM, 500 uM, 1 mM). The reactions lasted 1 min 50 (50 ul) with/without purified SdgA (20 ul). After 30 min for EntC, and 5 min for MenF and PchA, respectively, and reaction, 100 ul of malonyl-CoA (2 mM) and 50 ul of crude then were terminated by acidification with 20 uL of HCl extract with/withoutpurified BIS3 (20 ul) were supplemented (20%). The reaction rates were calculated according to the into the reaction system. The reactions were finally termi salicylate accumulation at 30°C. The kinetic parameters were nated in another 0.5-2 h by acidification. The reaction rates estimated by using OriginPro8 through non-linear regression 55 were calculated according to the generation of 4HC that was of the Michaelis-Menten equation. measured by HPLC. The protein concentrations of purified Coupled Enzyme Assays for IPLs. BIS3 and SdgA were 1200 and 395 mg/L, respectively. First, purified enzyme EntC was used to convert an excess Semi-Synthesis of Warfarin. amount of chorismic acid into IPL's substrate isochorismate. The culture containing about 500 mg/L of produced 4HC The 1 ml reaction system containing Tris-HCl (100 mM, 60 was centrifuged to remove the cells. Then 1 g/L of benzylde pH-7.5), MgCl, (5 mM), purified EntC (0.5 M), Chorismic neacetone and 100 mg/L of catalyst (S,S)-1,2-diphenylethyl acid (100 uM) was incubated at 30° C. for 30 min. Then the enediamine were added into the supernatant followed by purified PaPchB or PfPchB was added into the reaction sys incubation in the sonication bath for 3 hours. The production tem and incubated for 30 seconds, after which the reactions of warfarin was analyzed by HPLC. were terminated by acidification with 20 ul of HCl (20%). The 65 HPLC Quantitative Analysis. enzyme turnover numbers were estimated according to the 4-Hydroxycoumarin (from ACROS ORGANICS), salicy generation of salicylate, which was measured by HPLC. late (from ACROS ORGANICS), and warfarin (from MP US 9,353,390 B2 23 24 Biomedicals) were purchased as the standards. Both the stan Lett. 308, 159-165 (2010). Compared with the intricate plant dards and samples were quantitatively analyzed by HPLC pathways, bacteria generate Salicylate using more straightfor (Dionex Ultimate 3000) with a reverse-phase ZORBAXSB ward strategies. For instance, in Pseudomonas and Mycobac C18 column and an Ultimate 3000 Photodiode Array Detec terium species, Salicylate formation requires only two tor. Solvent A was sodium acetate solution (20 mM, pH=5.5), 5 enzymes that are isochorismate synthase (ICS) and isocho and solvent B was 100% methanol. The following gradient rismate pyruvate lyase (IPL) by shunting chorismate from was used for 4HC and salicylate analysis at a flow rate of 1 shikimate pathway (Gaille et al. J. Biol. Chem. 277, 21768 ml/min: 5 to 50% solvent B for 15 min, 50 to 5% solvent B for 21775 (2002)), (Nagachar et al. FEMS Microbiol. Lett. 308, 1 min, and 5% solvent B for additional 4 min, For warfarin 159-165 (2010)). Taken together, a novel biosynthetic mecha analysis, the gradient was from 20% to 80% solvent B. Quan- 10 nism for 4HC was established by grafting the enzymatic tification was based on the peak areas referring to the com reactions catalyzed by ICS, IPL, SCL, and BIS onto the mercial standards at the wavelength of 285 nm. Samples shikimate pathway (FIG. 2B). containing over 200 mg/L of products were diluted before Conversion of Salicylate to 4HC. running HPLC to maintain a linear concentration-peak area Conversion of salicylate to 4HC (the lower module) by relationship. 15 SCL and BIS is a non-natural pathway. The three identified ESI-MS and NMR Analysis. BISs were reported to show different preferences towards For ESI-MS analysis, the peak corresponding to 4HC was salicoyl-CoA: BIS3 was selected for pathway construction collected from HPLC, extracted with acetyl acetate, and dis due to its higher k value (Liu et al. Plant Mol. Biol. 72, solved in H.O. ESI-MS analysis was conducted using the 17-25 (2010)). To obtain an optimal SCL, we measured the Perkin Elmer Sciex APII plus mass spectrometer. For NMR 20 catalytic parameters of SdgA and MdpB2 after evaluating all analysis, the biosynthesized 4HC was extracted from the the reported SCLs. The enzyme assays revealed that SdgA culture with the same volume of acetyl acetate. Then the (K 4.05 uM, k=10.63 s') possesses about 2-fold higher extract was dried by a vacuum evaporator, dissolved with substrate affinity and 10-fold higher activity than MdpB2 DMSO, and diluted with water. Further purification was per (K–8.53 uM, k=1.18 s') (FIG.3 and Table 4). To further formed by collecting the 4HC fraction from HPLC. The col- 25 test their biosynthetic potential in Vivo, an expression vector lected fraction was extracted again with acetyl acetate, dried, (pZE-BIS3-SdgA) carrying the genes of BIS3 and SdgA was and re-dissolved in DMSO. Then the purified 4HC (roughly constructed and introduced into E. coli. The strain was cul 0.2-0.3 mg in around 50 ul DMSO) was diluted in 600 ul tured in the presence of 1 mM salicylate for 24 hours. HPLC DMSO-d6. The NMR analysis was conducted using 500 analysis showed that the strain produced 2.3+0.2 mg/L of MHz Varian Unity Inova with a 5 mm Broad Band Detection 30 Probe at 25°C. The Solvent DMSO was used as the reference 4HC with around 3-6 mg/L salicylate consumed (FIG. 4). compound. 'H, C, and g|ISQC (gradient Heteronuclear Single Quantum Coherence) analysis were conducted (FIGS. TABLE 4 10-12). The carbons and protons were assigned by referring Kinetic parameters of the enzymes measured as described herein. to the data from Spectral Database for Organic Compounds 35 (SDBS No.: 6281) (FIG.16). Kinetic Parameters* Results K. kcar kca?k, Retro-Design of 4HC Biosynthesis. Enzyme (IM) (S-) (S-M-1) 4HC is a direct precursor of natural and synthetic antico ScigA 4.05 - 1.18 10.63 - 0.48 2624691 agulants (FIG. 1). Its biosynthesis has not been fully under- 40 MdpB2 853 - 0.94 1.18 O.O3 138335 stood as mentioned above (FIG. 2A). However, identification EntC 11.93 + 1.37 2.12 O.O7 177703 of the 4HC-forming reaction catalyzed by BIS provided an MenF 6.75 2.99 O.13 O.O1 19259 opportunity to explore the combinatorial biosynthesis of PchA 3.69 0.53 O.2O, O.O1 S42O1 4HC. The design was firstly focused on the establishment of a reaction that can provide the substrate salicoyl-CoA for 45 All data are reported as meants, d. from two independent experiments (n = 2), BIS. We speculated that esterification of salicylate with coen Biosynthesis of Salicylate. Zyme A is a reaction that might be catalyzed by certain CoA We borrowed the biosynthetic strategy from Pseudomonas transferase/ligase. By searching the enzyme database involving ICS and IPL to establish the salicylate biosynthesis (BRENDA) and literature, we found only a few enzymes with (the upper module) in E. coli. First, to screen for a potent ICS, salicylate:CoA ligase (SCL) activity, including SdgA (in- 50 the enzymes PChA (from P. aeruginosa), EntC, and MenF Volved in Salicylate degradation in Streptomyces sp. WA46), (from E. coli) were overexpressed and purified for enzyme MdpB2 and SsfL 1 (involved in maduropeptin and tetracy kinetic studies. The enzyme assays indicated that EntC cline SF2575 biosynthesis in Actinomadura madurae (Ki-11.93 uM and k=2.12es s') is much more active than ATCC39144 and Streptomyces sp. SF2575, respectively) MenF (K-6.75uM and k=0.13es s) and PchA (K–3.69 (Ishiyama et al. J. Appl. Environ. Microbiol. 70, 1297-1306 55 uM and k=0.20s') (FIG.5 and Table 4). Then the activity (2004)), (Ling et al. J. Am. Chem. Soc. 132, 12534-12536 of IPLS from Pseudomonas fluorescence and P. aeruginosa (2010)), (Pickens et al. J. Am. Chem. Soc. 131, 17677-17689 were estimated by coupled enzyme assays since the Substrate (2009)). Besides, some benzoate:CoA ligases also exhibited isochorismate is neither commercially available nor chemi weak side activity towards salicylate (Geissler et al. J. Bac cally stable. The results showed that the former enzyme (Pf teriol. 170, 1709-1714 (1988)), (Beuerleet al. Arch. Biochem. 60 PchB, estimated turnover number 15.8 s') is slightly more Biophys. 400, 258-264 (2002)). To further achieve de novo active than the latter one (PaPchB, estimated turnover num biosynthesis of 4HC, a metabolic connection has to be estab ber=11.2s'). Therefore, EntC and PfPchB were selected for lished between salicylate and the hosts metabolism. In the test of salicylate biosynthesis in vivo. We consecutively nature, Salicylate is produced not only by plants as a signal cloned the genes of EntC and PfPchB into the vector pZE12 molecule but also by Some bacteria as an intermediate in 65 luc as an operon, generating pZE-EP. As we expected, E. coli siderophore biosynthesis (Gaille et al. J. Biol. Chem. 277, strain harboring pZE-EP obtained the capability to produce 21768-21775 (2002)), (Nagachar et al. FEMS Microbiol. salicylate. By the end of 32 h, 158.5-2.5 mg/L of salicylate US 9,353,390 B2 25 26 was accumulated in the cultures following a growth-depen TABLE 5 dent production pattern (FIG. 6). Validation and Diagnosis of the 4HC Biosynthetic Mecha NMR data of 4HC nism. Chemical Shift Splitting J-Value With the validated upper and lower modules, further efforts 5 Atom (ppm) Pattern (Hz) were directed to the validation of the complete 4HC biosyn C 133.17 thetic mechanism. The genes encoding EntC, PfPchB, BIS3, 7.65 t 7.8 and SdgA were consecutively cloned into the vector pZE12 2 C 124.39 luc as an operon, generating a plasmid pZE-EPBS. However, 7.35 t* 7.9 10 3 C 123.66 the E. coli strain harboring pZE-EPBS only produced a trace 7.83 d 7.8 amount of 4HC (<0.2 mg/L), but accumulated a large amount 4 C 116.27 5 C 153.98 of salicylate (156.2+18.7 mg/L) after 48 h production in 6 C 116.84 shake flasks. The result Suggested that the upper module 7.37 d's ND performed well in the full pathway; while the bottleneck was 15 7 O in the lower module. 8 C 162.32 9 C 91.44 To locate the rate-limiting step, we designed and per 5.60 S formed an in vitro complementation assay in which excess OC 166.11 amounts of purified SdgA and/or BIS3 were supplemented 1 O into the crude extract of the E. coli cells expressing the full 20 2 O pathway. As shown in FIG. 7, without supplemented 12.S2 s, br enzymes, the crude extract can only convert Salicylate to 4HC s: singlet; d: doublet: at a very low rate (0.18 mg/L/h) in the presence of required t; triplet; cofactors; while the presence of purified SdgA and BIS3 br: broad peak; significantly improved the rate (8.82 mg/L/h), indicating that 25 ND: not determined due to the overlap. the purified enzymes functioned well in this assay system *The multiplet between 7.34 and 7.39 was determined as the overlap of a tripletanda doublet (positive control). When purified SdgA was supplemented based on the gHSQC spectrum and previously reported data, alone into the crude extract, the conversion rate was not Metabolic Engineering for Improved 4HC Biosynthesis. obviously increased (0.24 mg/L/h). Noticeably, when puri We first reconstituted the improved biosynthetic mecha fied BIS3 was added alone, the 4HC formation was recovered 30 nism in E. coli by introducing the two modules as dual oper to a rate (7.83 mg/L/h) comparable with that of the positive ons using the high-copy plasmid pZE-EP-PS. The E. coli control, indicating that BIS3 was a major bottleneck in the strain carrying p7E-EP-PS (Strain A, FIG. 13A) produced pathway. We speculated that the low in vivo activity of BIS3 42.3 mg/L of 4HC without addition of any intermediates. might result from the slow kinetics, Sub-optimal expression, Meanwhile, a trace amount of salicylate was detected in the instability, or cross-species incompatibility issues. To over- 35 cultures, indicating that the lower module functioned well come this bottleneck, searching for a Superior Substitute was with this expression strategy and almost completely con our first choice. verted endogenous salicylate to 4HC. However, this expres Bioprospecting for a Superior Substitute to BIS. sion strategy decreased the efficiency of the upper module. BIS is a subclass of chalcone synthase (CHS)-like type III According to the stoichiometry, 42.3 mg/L of 4HC should be polyketide synthases (PKS). However, no other type III PKS 40 generated from 36.1 mg/L salicylate which is much less than with sequence similarity has been identified to catalyze the the production obtained with the E. coli strain only expressing 4HC-forming reaction. By structure-based examination of the upper module (pZE-EP). We speculated that the decrease bacterial secondary metabolites, we identified that 4-hy in salicylate-producing capability might be attributed to the droxy-2(1H)-quinolone in P. aeruginosa shares high struc following two reasons: 1) the two adjacent operons on the tural similarity with 4HC (Zhang et al. J. Biol. Chem. 283, 45 same plasmid might interfere with each other; 2) the incon 28788-28794 (2008)). The formation of 4-hydroxy-2(1H)- gruous expression of the upper and lower modules may have quinolone is catalyzed by a B-ketoacyl-ACP synthase III caused metabolic imbalance. To test this hypothesis, we co (FabH)-type quinolone synthase (PdsD) via decarboxylative expressed the lower module operon (PdSD-SdgA) using a condensation of malonyl-CoA or -ACP with anthraniloyl medium-copy plasmid (pCS-PS) together with p7E-EP in E. CoA and spontaneous intramolecular cyclization (Zhang et 50 coli (Strain B, FIG. 13B). Strain B produced 108.9 mg/L 4HC al. J. Biol. Chem. 283, 28788-28794 (2008)), Bera et al. in 18 hours with no measurable salicylate accumulated. Fur Biochemistry (Most.) 48,8644-8655 (2009)). Despite having thermore, we explored the performance of another construct a tautomer 2,4-dihydroxyquinoline (DHQ), 4-hydroxy-2 pZE-EPPS in which the genes encoding the full pathway (1H)-quinolone is the predominant form at physiological pH enzymes were consecutively cloned as one operon. E. coli (Heeb et al. FEMS Microbiol. Rev. 35,247-274 (2011)) (FIG. 55 harboring pZE-EPPS (Strain C, FIG. 13C) produced 207.7 8B). We reasoned that PasD may also accept salicoyl-CoA as mg/L 4HC in 24 h with 21.6 mg/L salicylate left unconverted. a substrate to form 4HC, as BIS does (FIG. 8A). To test this With this expression strategy, the production of 4HC was hypothesis, we replaced the BIS3 gene with PasD coding improved by 5 folds compared with the initial construct, sequence in the lower module, generating the plasmid pZE Suggesting that gene organization and operon configuration PasD-SdgA (pZE-PS). The E. coli strain carrying pZE-PS 60 may influence the biosynthetic capability of heterologous completely converted 2 mM of salicylate (276 mg/L) into pathways. 4HC within about 7 h with a yield of over 99%, indicating the We further speculated that boosting the availability of cho high activity of Pas) towards salicoyl-CoA. The produced rismate and/or malonyl-CoA, the two major intermediates of 4HC has identical HPLC retention time and UV absorption 4HC biosynthesis, may divert more metabolic flux towards profile with its commercial standard. Its identity was further 65 product formation. Chorismate is an intermediate in the shiki confirmed by ESI-MS and NMR analysis (FIGS. 9-12 and mate pathway, of which the rate-limiting steps have been Table 5). identified and the regulation mechanism has been well stud US 9,353,390 B2 27 28 ied. As shown in FIG. 14, the 3-deoxy-D-arabino-heptu Although the design principles for constituting a productive losonate-7-phosphate synthases (DAHPS) in E. coli encoded pathway are explored and yet to be well-established, recruit by aroG, aroF, and aroH are feedback-inhibited by phenyla ment of catalytically Superior and host-suitable enzymes lanine, tyrosine, and tryptophan, respectively (Kikuchi et al. should be the primary one in the principles, which is evi Appl. Environ. Microbiol. 63,761-762 (1997). Moreover, the denced by this work and previous studies (Atsumi et al. erythrose-4-phosphate (E4P) and phosphoenolpyruvate Nature 451, 86-89 (2008)), (Bond-Watts et al. Nat. Chem. (PEP) availability limit can be alleviated by over-expressing Biol. 7, 222-227 (2011)), (Shen et al. Appl. Environ. Micro transketolase (encoded by thatA) and PEP synthase (encoded biol. 77. 2905-2915 (2011). Conventionally, sequence-based by ppsA), respectively (Lutke-Eversloh et al. Appl. Micro bioprospecting aided by bioinformatics and computational biol. Biotechnol. 75, 103-110 (2007)). Besides, shikimate 10 kinase (encoded by aroK/aroL) was proved to be another tools is an effective approach in searching for Such candi bottleneck which can be eliminated by the over-expression of dates. For instance, BLAST search using the sequence infor aroL (Luetke-Eversloh et al. Metab. Eng. 10, 69-77 (2008)). mation of an enzyme with known function as a query may be Based on this knowledge, we cloned aroL. ppSA, tRtA, and employed to identify homologous enzymes from various the feedback-inhibition-resistant aroG (aroG') into pCS27 15 organisms capable of catalyzing the same type of reaction but generating a chorismate-boosting plasmid pCS-APTA. The exhibiting enhanced activity and desired Substrate specificity E. coli strain carrying pZE-EPPS and pCS-APTA (Strain E, (Dhamankar et al. Curr. Opin. Struct. Biol. 21, 488-494 FIG. 13E) produced 283.9 mg/L 4HC in 18 h, a 37% increase (2011)). In our work, we first developed an in vitro comple compared with its parent Strain C. Meanwhile, we created mentation assay to accurately locate the rate-limiting step in another construct by inserting PlacO1-APTA operon into the 4HC biosynthesis. To eliminate the bottleneck, we further pZE-EP generating a dual-operon plasmid pZE-EP-APTA, employed a function-based bioprospecting strategy to search which was co-transferred together with pCS-PS into E. coli for a more suitable enzyme. We successfully identified 4-hy (Strain D, FIG. 13D). Remarkably, Strain D produced 483.1 droxy-2(1H)-quinolone synthase for efficient microbial bio mg/L 4HC in 24 h, reflecting 4.4- and 11.4-fold increases synthesis of 4HC totally based on the similarity in catalytic compared with its parent (Strain B) and StrainA, respectively. 25 mechanisms and substrate/product structures between BIS Meanwhile, we detected the accumulation of salicylate at the and 4-hydroxy-2(1H)-quinolone synthase. Indeed, 4-hy concentrations of 197.6 and 222.3 mg/L at 24h for Strains D droxy-2(1H)-quinolone synthase shares low sequence iden and E. respectively, due to the boosting of shikimate pathway. tity with BIS (around 25%), but exhibits functional and cata Furthermore, we examined the impact of malonyl-CoA on lytic attributes of both CHS and FabH-like enzymes. On one the production of 4HC. Since it has been reported that over 30 hand, it can catalyze the condensation of malonyl-CoA as expression of acetyl-CoA carboxylase (accABCD) and biotin well as intra-molecular cyclization, which are the properties ligase (birA) can increase the availability of malonyl-CoA of CHS-like PKS; on the other hand, it can also condense (Leonard et al. Appl. Environ. Microbiol. 73, 3877-3886 malonyl-ACP in a manner of FabH (Bera et al. Biochemistry (2007)), (Zha et al. Metab. Eng. 11, 192-198 (2009)), we (Mosc.) 48, 8644-8655 (2009)). So far, the function-based cloned genes accADBC and birA into pSAT4 generating a 35 bioprospecting can only be performed manually through ana malonyl-CoA-enhancing plasmidpSA-ACCB. The introduc lyzing and comparing enzyme catalytic mechanisms. How tion of pSA-ACCB into Strain E led to slightly improved ever, we envision the development of computational tools that production of 4HC (313.4 mg/L, 11% higher than Strain E). can effectively predict the catalytic substitutability of However, the pSA-ACCB exerted negative influence to Strain enzymes with low sequence correlation will further enhance D (E. coli/pZE-EP-APTA and pCS-PS), manifesting a dra 40 our capability of engineering combinatorial biosynthesis. matic fall in the 4HC production (184.1 mg/L). The results With efficient enzymes available for each catalytic step, indicated that: 1) malonyl-CoA availability might not be a optimization of the pathway by adjusting expression level of dominant limiting factor in 4HC production; 2) the over individual enzymes is also critical for the pathways overall expression of accADBC and birA could improve malonyl performance. First, inharmonious expression of pathway CoA availability but might cause metabolic burden in strain 45 enzymes may waste cellular resources for the formation of D, which offset their benefit in boosting malonyl-CoA avail unnecessary RNAS, proteins, or intermediates. Besides, over ability. expression of some exotic enzymes is stressful or toxic to host Semi-Synthesis of Warfarin. cells, which may result in growth retardation and undesired With tentative optimization, the resulting E. coli strain adaptive responses, hence reducing yield and productivity demonstrated great scale-up potential for 4HC production. 50 (Zhang et al. Nat. Biotechnol. 30, 354-359 (2012)). Method Then we explored the feasibility of in situ semi-synthesis of ologies have been developed to determine the ideal expres warfarin via a green chemistry approach (Rogozinska et al. sion level and have been successfully applied by fine-tuning Green Chem. 13, 1155-1157 (2011)). To this end, the other the expression level of pathway enzymes and modules. Such precursor benzyldeneacetone and the catalyst (S,S)-1,2- as the use of plasmids with different copy numbers, promot diphenylethylenediamine were added into the supernatant of 55 ers with various transcription strengths, and synthetic RBSs the strain D culture (containing about 500 mg/L 4HC) and with different translation efficiencies (Ajikumaretal. Science incubated in a sonication bath for 3 hours. Quantitative HPLC 330, 70-74 (2010)), (Salis et al. Nat. Biotechnol. 27,946-950 analysis indicated that 43.7t2.6 mg/L warfarin was generated (2009), (Xu et al. Nat. Commun. 4, 1409 (2013)), (Anthony et in the Supernatant corresponding to a molar yield of 4.6% al. Metab. Eng. 11, 13-19 (2009)). In our case, modular opti (FIG. 15). The low yield might be due to the facts that: 1) the 60 mization by adjusting gene organization, copy number, and aqueous condition is not optimal for the Michael addition operon configuration also led to around 5-fold increase in the reaction; 2) 4HC concentration is lower than the optimal 4HC titer (Strain C vs. Strain A). concentration for warfarin synthesis. In conclusion, this work achieves microbial production of Discussion the pharmaceutically important drug precursor 4HC for the Recent advances of metabolic engineering have allowed 65 first time and demonstrates great Scale-up potential. The find microorganisms to be engineered to enable the efficient and ings provide a new insight into the non-natural 4HC biosyn environmental-friendly production of valuable molecules. thesis, which can serve as a starting point for expanding the US 9,353,390 B2 29 30 molecular diversity of coumarin compounds through syn Unless otherwise indicated, all numbers expressing quan thetic chemistry and biology approaches. tities of components, molecular weights, and so forth used in The complete disclosure of all patents, patent applications, the specification and claims are to be understood as being and publications, and electronically available material (in modified in all instances by the term “about.” Accordingly, unless otherwise indicated to the contrary, the numerical cluding, for instance, nucleotide sequence Submissions in, parameters set forth in the specification and claims are e.g., GenBank and RefSeq, and amino acid sequence Submis approximations that may vary depending upon the desired sions in, e.g., SwissProt, PIR, PRF, PDB, and translations properties sought to be obtained by the present invention. At from annotated coding regions in GenBank and RefSeq) cited the very least, and not as an attempt to limit the doctrine of herein are incorporated by reference in their entirety. Supple 10 equivalents to the Scope of the claims, each numerical param mentary materials referenced in publications (such as Supple eter should at least be construed in light of the number of mentary tables, Supplementary figures, Supplementary mate reported significant digits and by applying ordinary rounding rials and methods, and/or supplementary experimental data) techniques. are likewise incorporated by reference in their entirety. In the Notwithstanding that the numerical ranges and parameters event that any inconsistency exists between the disclosure of 15 setting forth the broad scope of the invention are approxima the present application and the disclosure(s) of any document tions, the numerical values set forth in the specific examples incorporated herein by reference, the disclosure of the present are reported as precisely as possible. All numerical values, application shall govern. The foregoing detailed description however, inherently contain a range necessarily resulting and examples have been given for clarity of understanding from the standard deviation found in their respective testing only. No unnecessary limitations are to be understood there measurementS. from. The invention is not limited to the exact details shown All headings are for the convenience of the reader and and described, for variations obvious to one skilled in the art should not be used to limit the meaning of the text that follows will be included within the invention defined by the claims. the heading, unless so specified.
SEQUENCE LISTING
<16 Os NUMBER OF SEO ID NOS: 58
SEO ID NO 1 LENGTH: 391 TYPE PRT ORGANISM: Escherichia coli
<4 OOs SEQUENCE: 1
Met Asp Thr Ser Leu Ala Glu Glu Wall Glin Gn. Thir Met Ala Thir Lell 1. 5 15
Ala Pro Asn Arg Phe Phe Phe Met Ser Pro Tyr Arg Ser Phe Th Thir 25 3 O
Ser Gly Cys Phe Ala Arg Phe Asp Glu Pro Ala Wall Asn Gly Asp Ser 35 4 O 45
Pro Asp Ser Pro Phe Glin Glin Lell Ala Ala Lieu. Phe Ala Asp Ala SO 55 60
Lys Ala Glin Gly Ile Lys Asn. Pro Wal Met Wall Gly Ala le Pro Phe 65 70 8O
Asp Pro Arg Glin Pro Ser Ser Leu. Tyr Ile Pro Glu Ser Trp Glin Ser 85 90 95
Phe Ser Arg Glin Glu Glin Ala Ser Ala Arg Arg Phe Thir Arg Ser 105 110
Glin Ser Lieu. Asn. Wal Wall Glu Arg Glin Ala Ile Pro Glu Glin Th Thir 115 12O 125
Phe Glu Gln Met Wall Ala Arg Ala Ala Ala Luell Thir Ala Thir Pro Glin 13 O 135 14 O
Wall Asp Wal Wall Lieu. Ser Arg Lieu. Ile Asp Ile Thir Thir Asp Ala 145 15 O 155 16 O
Ala Ile Ser Gly Val Lieu. Lieu. Glu Arg Lieu. Ile Ala Glin Asn. Pro 1.65 17 O 17s
Wall Ser Asn Phe His Wall Pro Lieu Ala Asp Gly Gly Wall Lieu. Luell 18O 185 190
Gly Ala Ser Pro Glu Lieu. Luell Lell Arg Lys Asp Gly Glu Arg Phe Ser 195 2 OO 2O5
Ser Ile Pro Lieu Ala Gly Ser Ala Arg Arg Glin Pro Asp Glu Wall Lieu US 9,353,390 B2 31 32 - Continued
21 O 215 22O
Asp Arg Glu Ala Gly Asn Arg Luell Lieu Ala Ser Glu Asp Arg His 225 23 O 235 24 O
Glu His Glu Luell Wall Thir Glin Ala Met Lys Glu Val Lell Arg Glu Arg 245 250 255
Ser Ser Glu Luell His Wall Pro Ser Ser Pro Glin Leu Ile Thir Thir Pro 26 O 265 27 O
Thir Luell Trp His Lell Ala Thir Pro Phe Glu Gly Lys Ala Asn Ser Glin 285
Glu Asn Ala Luell Thir Lell Ala Lieu. Lieu. His Pro Thir Pro Ala Luell 29 O 295 3 OO
Ser Gly Phe Pro His Glin Ala Ala Thr Glin Wall Ile Ala Glu Luell Glu 3. OS 310 315
Pro Phe Asp Arg Glu Lell Phe Gly Gly Ile Val Gly Trp Asp Ser 3.25 330 335
Glu Gly Asn Gly Glu Trp Wall Wall Thir Ile Arg Cys Ala Lys Luell Arg 34 O 345 35. O
Glu Asn Glin Wall Arg Lell Phe Ala Gly Ala Gly Ile Wall Pro Ala Ser 355 360 365
Ser Pro Luell Gly Glu Trp Arg Glu Thr Gly Val Lys Lell Ser Thir Met 37 O 375 38O
Lell Asn Wall Phe Gly Lell His 385 390
SEQ ID NO 2 LENGTH: TYPE : PRT ORGANISM: Pseudomonas aeruginosa
< 4 OOs SEQUENCE: 2 Met Lys Thr Pro Glu Asp Thir Gly Lieu Ala Asp Ile Arg Glu Ala 1. 1O 15
Ile Asp Arg Ile Asp Lell Asp Ile Wall Glin Ala Lieu Gly Arg Arg Met 25
Asp Wall Lys Ala Ala Ser Arg Phe Lys Ala Ser Glu Ala Ala Ile 35 4 O 45
Pro Ala Pro Glu Arg Wall Ala Ala Met Lieu. Pro Glu Arg Ala Arg Trp SO 55 6 O
Ala Glu Glu Asn Gly Lell Asp Ala Pro Phe Wall Glu Gly Luell Phe Ala 65 70 7s
Glin Ile Ile His Trp Ile Ala Glu Glin Ile Llys Trp Arg Glin 85 90 95
Thir Arg Gly Ala Ala 1OO
SEQ ID NO 3 LENGTH: 553 TYPE : PRT ORGANISM: Streptomyces sp. WA46
< 4 OOs SEQUENCE: 3
Met Thr Arg Glu Gly Phe Val Pro Trp Pro Lys Glu Ala Ala Asp Arg 1. 5 1O 15
Tyr Arg Glu Ala Gly Tyr Trp Arg Gly Arg Pro Lieu. Gly Ser Tyr Lieu. 25
His Glu Trp Ala Glu Thr Tyr Gly Asp Thr Val Ala Wall Val Asp Gly US 9,353,390 B2 33 34 - Continued
35 4 O 45
Asp Thir Arg Lieu. Thir Arg Glin Luell Wall Asp Arg Ala Asp Gly Luell SO 55 6 O
Ala Arg Lieu. Luell Asp Ser Gly Luell Asn Pro Gly Asp Ala Met Luell 65 70
Wall Glin Luell Pro Asn Gly Trp Glu Phe Wall Thir Lell Thir Luell Ala 85 90 95
Lell Arg Ala Gly Ile Ala Pro Wall Met Ala Met Pro Ala His Arg Gly 1OO 105 11 O
His Glu Luell Arg Tyr Lell Ala Ala His Ala Glu Wall Thir Ser Ile Ala 115 12 O 125
Wall Pro Asp Arg Lieu. Gly Asp Phe Asp His Glin Ala Lell Gly Arg Glu 13 O 135 14 O
Wall Ala Glu Asp Thr Pro Ser Wall Gly Luell Luell Lell Wall Ala Gly Gly 145 150 155 160
Thir Wall Gly Thir Asp Ala Thir Asp Luell Arg Ala Lell Ala Glu Pro Ala 1.65 17s
Asp Asp Pro Wall. Thir Ala Arg Ala Arg Luell Asp Arg Ile Ala Pro Asp 18O 185 19 O
Ser Gly Asp Ile Ala Wall Phe Luell Luell Ser Gly Gly Thir Thir Gly Luell 195
Pro Lys Luell Ile Thr Arg Thir His Asp Asp Tyr Glu Tyr Asn Ala Arg 21 O 215
Arg Ser Ala Glu Wall Cys Gly Luell Asp Ser Asp Ser Wall Luell Wall 225 23 O 235 24 O
Ala Luell Pro Ala Gly His Asn Phe Pro Luell Ala Pro Gly Ile Luell 245 250 255
Gly Thir Luell Met Asn Gly Gly Arg Wall Wall Luell Ala Arg Thir Pro Glu 26 O 265 27 O
Pro Gly Lys Wall Lieu. Pro Lell Met Ala Ala Gly Wall Thir Ala Thir 27s 285
Ala Ala Wall Pro Ala Wall Wall Glin Arg Trp Asp Ala Wall Ala Ser 29 O 295 3 OO
Gly Arg His Pro Ala Pro Pro Ala Luell Arg Lell Glin Wall Gly Gly 3. OS 310
Ala Arg Luell Ala Pro Glu Wall Ala Arg Arg Glu Pro Wall Luell Gly 3.25 330 335
Gly Thir Luell Glin Glin Wall Phe Gly Met Ala Gly Lell Luell Asn 34 O 345 35. O
Thir Arg Pro Asp Asp Pro Asp Asp Ile Glu Thir Glin Gly Arg 355 360 365
Pro Met Pro Asp Asp Glu Ile Luell Wall Wall Asp Ala Ser Asp Asn 37 O 375
Pro Wall Pro Pro Gly Glu Met Gly Ala Luell Luell Thir Arg Gly Pro Tyr 385 390 395 4 OO
Thir Pro Arg Gly Tyr Arg Ala Ala Glu His Asn Ala Arg Ala Phe 4 OS 41O 415
Thir Pro Asp Gly Trp Arg Thir Gly Asp Wall Wall Arg Luell His Pro 42O 425 43 O
Ser Gly Asn Lieu Wall Wall Glu Gly Arg Asp Lys Asp Lell Ile Asn Arg 435 44 O 445
Gly Gly Glu Lys Ile Ser Ala Glu Glu Wall Glu Asn Lell Ile 450 45.5 460 US 9,353,390 B2 35 36 - Continued
Lell Pro Gly Wall Ala Arg Wall Ala Ala Wall Ala Lys Ala Asp Pro Asp 465 470
Lell Gly Glu Arg Wall Ala Wall Wall Wall Wall Glu Pro Gly Thir Glin 485 490 495
Lell Ser Luell Glu Ser Wall Arg Ala Ala Luell Thir Ala Met Glin Wall Ala SOO 505
Arg Lys Luell Pro Glu Asp Luell Luell Wall Wall Asp Glu Luell Pro Luell 515 525
Thir Lys Wall Gly Ile Asp Luell Arg Asp Wall Wall Arg 53 O 535 54 O
Gly Lys Ala Asp Ser Wall Glu Ala Wall 5.45 550
<210s, SEQ ID NO 4 &211s LENGTH: 337 212. TYPE : PRT &213s ORGANISM: Pseudomonas aeruginosa
<4 OOs, SEQUENCE: 4.
Met Gly Asn Pro Ile Lell Ala Gly Luell Gly Phe Ser Lell Pro Lys Arg 1. 15
Glin Wall Ser Asn His Asp Lell Wall Gly Arg Ile Asn Thir Ser Asp Glu 25
Phe Ile Wall Glu Arg Thir Gly Wall Arg Thir Arg His Wall Glu Pro 35 4 O 45
Glu Gln Ala Wall Ser Ala Lieu Met Wall Pro Ala Ala Arg Gln Ala Ile SO 55 6 O
Glu Ala Ala Gly Lell Lell Pro Glu Asp Ile Asp Lell Lell Luell Wall Asn 65 70
Thir Luell Ser Pro Asp His His Asp Pro Ser Glin Ala Luell Ile Glin 85 90 95
Pro Luell Luell Gly Lell Arg His Ile Pro Wall Luell Asp Ile Arg Ala Glin 105 11 O
Ser Gly Luell Lell Tyr Gly Luell Glin Met Ala Arg Gly Glin Ile Luell 115 12 O 125
Ala Gly Luell Ala Arg His Wall Luell Wall Wall Gly Glu Wall Luell Ser 13 O 135 14 O
Lys Arg Met Asp Ser Asp Arg Gly Arg ASn Lell Ser Ile Luell Luell 145 150 155 160
Gly Asp Gly Ala Gly Ala Wall Wall Wall Ser Ala Gly Glu Ser Luell Glu 1.65 17O 17s
Asp Gly Luell Luell Asp Lell Arg Luell Gly Ala Asp Gly Asn Tyr Phe Asp 18O 185 19 O
Lell Luell Met Thir Ala Ala Pro Gly Ser Ala Ser Pro Thir Phe Luell Asp 195
Glu Asn Wall Luell Arg Glu Gly Gly Gly Glu Phe Lell Met Arg Gly Arg 21 O 215
Pro Met Phe Glu His Ala Ser Glin Thir Luell Wall Arg Ile Ala Gly Glu 225 23 O 235 24 O
Met Luell Ala Ala His Glu Lell Thir Luell Asp Asp Ile Asp His Wall Ile 245 250 255
His Glin Pro Asn Lell Arg Ile Luell Asp Ala Wall Glin Glu Glin Luell 26 O 265 27 O
Gly Ile Pro Glin His Phe Ala Wall Thir Wall Asp Arg Luell Gly Asn US 9,353,390 B2 37 38 - Continued
27s 28O 285 Met Ala Ser Ala Ser Thr Pro Val Thr Lieu Ala Met Phe Trp Pro Asp 29 O 295 3 OO Ile Glin Pro Gly Glin Arg Val Lieu Val Lieu. Thr Tyr Gly Ser Gly Ala 3. OS 310 315 32O Thir Trp Gly Ala Ala Lieu. Tyr Arg Llys Pro Glu Glu Val Asn Arg Pro 3.25 330 335 Cys
<210s, SEQ ID NO 5 &211s LENGTH: 38 &212s. TYPE: DNA <213> ORGANISM; artificial 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic oligonucleotide primer
<4 OOs, SEQUENCE: 5 gggaaaggat CC9gatacgt cactggctga ggaagtac 38
<210s, SEQ ID NO 6 &211s LENGTH: 44 &212s. TYPE: DNA <213> ORGANISM; artificial 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic oligonucleotide primer
<4 OOs, SEQUENCE: 6 gggaaactgc agittaatgca atccaaaaac gttcaac atg gtag 44
<210s, SEQ ID NO 7 &211s LENGTH: 35 &212s. TYPE: DNA <213> ORGANISM; artificial 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic oligonucleotide primer
<4 OO > SEQUENCE: 7 gggaaaggat ccdcaatcac ttact acggc gctgg 35
<210s, SEQ ID NO 8 &211s LENGTH: 42 &212s. TYPE: DNA <213> ORGANISM; artificial 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic oligonucleotide primer
<4 OOs, SEQUENCE: 8 gggaaactgc agctatto.ca tttgtaataa agtacgcago Cc 42
<210s, SEQ ID NO 9 &211s LENGTH: 38 &212s. TYPE: DNA <213> ORGANISM; artificial 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic oligonucleotide primer
<4 OOs, SEQUENCE: 9 gggaaaggat C cago.cggc tiggcgc.ccct gagc.cagt 38
<210s, SEQ ID NO 10 &211s LENGTH: 33 &212s. TYPE: DNA <213> ORGANISM; artificial 22 Os. FEATURE: US 9,353,390 B2 39 40 - Continued <223> OTHER INFORMATION: synthetic oligonucleotide primer
<4 OOs, SEQUENCE: 10 gggaaagtic act caggcga cqc.cgc.gctg. Caa 33
<210s, SEQ ID NO 11 &211s LENGTH: 34 &212s. TYPE: DNA <213> ORGANISM; artificial 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic oligonucleotide primer
<4 OOs, SEQUENCE: 11 gggaaaggat C caaaactic ccgaagactg. Cacc 34
<210s, SEQ ID NO 12 &211s LENGTH: 32 &212s. TYPE: DNA <213> ORGANISM; artificial 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic oligonucleotide primer
<4 OOs, SEQUENCE: 12 gggaaactgc agt catgcgg caccc.cgtgt ct 32
<210s, SEQ ID NO 13 &211s LENGTH: 35 &212s. TYPE: DNA <213> ORGANISM; artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide primer
<4 OOs, SEQUENCE: 13 gggaaaggat C cqctggcct tcgaccc.cat gaatt 35
<210s, SEQ ID NO 14 &211s LENGTH: 36 &212s. TYPE: DNA <213> ORGANISM; artificial 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic oligonucleotide primer
<4 OOs, SEQUENCE: 14 gggaaactgc agt cactic at Cttgggct Co ttgat C 36
<210s, SEQ ID NO 15 &211s LENGTH: 35 &212s. TYPE: DNA <213> ORGANISM; artificial 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic oligonucleotide primer
<4 OOs, SEQUENCE: 15 gggaaaggat C cacgcgtgagggatt.cgit gcc ct 35
<210s, SEQ ID NO 16 &211s LENGTH: 34 &212s. TYPE: DNA <213> ORGANISM; artificial 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic oligonucleotide primer
<4 OOs, SEQUENCE: 16 gggaaactgc agt cacaccg cct cacgga gtct 34 US 9,353,390 B2 41 42 - Continued
<210s, SEQ ID NO 17 &211s LENGTH: 35 &212s. TYPE: DNA <213> ORGANISM; artificial 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic oligonucleotide primer
<4 OOs, SEQUENCE: 17 gggaaaggat ccaccagca tt.ccgc.gcat gatcc 35
<210s, SEQ ID NO 18 &211s LENGTH: 38 &212s. TYPE: DNA <213> ORGANISM; artificial 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic oligonucleotide primer
<4 OOs, SEQUENCE: 18 gggaaaaagc titt Cagcggg togggg.cggit gacgaggit 38
<210s, SEQ ID NO 19 &211s LENGTH: 37 &212s. TYPE: DNA <213> ORGANISM; artificial 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic oligonucleotide primer
<4 OOs, SEQUENCE: 19 gggaaaggat CC9gcc cct ttcaagaa cagc ct 37
<210 SEQ ID NO 20 &211s LENGTH: 36 &212s. TYPE: DNA <213> ORGANISM; artificial 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic oligonucleotide primer
<4 OOs, SEQUENCE: 2O gggaaactgc agt cagtagg tatgaactic gctacg 36
<210s, SEQ ID NO 21 &211s LENGTH: 34 &212s. TYPE: DNA <213> ORGANISM; artificial 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic oligonucleotide primer
<4 OOs, SEQUENCE: 21 gggaaaggta C catggcc cc ttggtcaag aacg 34
<210s, SEQ ID NO 22 &211s LENGTH: 39 &212s. TYPE: DNA <213> ORGANISM; artificial 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic oligonucleotide primer
<4 OOs, SEQUENCE: 22 gggaalacata t t cagtagg tatgaactic gctacgcag 39
<210s, SEQ ID NO 23 &211s LENGTH: 46 &212s. TYPE: DNA <213> ORGANISM; artificial 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic oligonucleotide primer US 9,353,390 B2 43 44 - Continued
<4 OOs, SEQUENCE: 23 gggaalacata taggagata taccatgacg C9tgagggat tctgc 46
<210s, SEQ ID NO 24 &211s LENGTH: 33 &212s. TYPE: DNA <213> ORGANISM; artificial 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic oligonucleotide primer
<4 OOs, SEQUENCE: 24 gggaaatcta gat cacaccg cct cacgga gtc 33
<210s, SEQ ID NO 25 &211s LENGTH: 4 O &212s. TYPE: DNA <213> ORGANISM; artificial 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic oligonucleotide primer
<4 OOs, SEQUENCE: 25 gggaaaggta C catggatac git cactggct gaggaagtac 4 O
<210s, SEQ ID NO 26 &211s LENGTH: 44 &212s. TYPE: DNA <213> ORGANISM; artificial 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic oligonucleotide primer < 4 OO SEQUENCE: 26 gggaalacata tittaatgca atccaaaaac gttcaac atg gtag 44
<210s, SEQ ID NO 27 &211s LENGTH: 45 &212s. TYPE: DNA <213> ORGANISM; artificial 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic oligonucleotide primer
<4 OOs, SEQUENCE: 27 gggaalacata taggagata taccatgctg gcctt.cgacC ccatg 45
<210s, SEQ ID NO 28 &211s LENGTH: 39 &212s. TYPE: DNA <213> ORGANISM; artificial 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic oligonucleotide primer
<4 OOs, SEQUENCE: 28 gggaaagcat gct cactic at Cttgggct Co ttgat CC ag 39
<210s, SEQ ID NO 29 &211s LENGTH: 46 &212s. TYPE: DNA <213> ORGANISM; artificial 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic oligonucleotide primer
<4 OOs, SEQUENCE: 29 gggaaagcat gcaggagata taccatggcc cct gtggtca agaacg 46
<210s, SEQ ID NO 3 O &211s LENGTH: 39 US 9,353,390 B2 45 46 - Continued
&212s. TYPE: DNA <213> ORGANISM; artificial 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic oligonucleotide primer
<4 OOs, SEQUENCE: 30 gggaalacata t t cagtagg tatgaactic gctacgcag 39
<210s, SEQ ID NO 31 &211s LENGTH: 34 &212s. TYPE: DNA <213> ORGANISM; artificial 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic oligonucleotide primer
<4 OOs, SEQUENCE: 31 gggaaaggta C catgggtaa ticcgatcCtg gcc.g 34
<210s, SEQ ID NO 32 &211s LENGTH: 33 &212s. TYPE: DNA <213> ORGANISM; artificial 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic oligonucleotide primer
<4 OOs, SEQUENCE: 32 gggaalacata ttcaa.catg gcc.ggttcac ctic 33
<210s, SEQ ID NO 33 &211s LENGTH: 25 & 212 TYPE DNA <213> ORGANISM; artificial 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic oligonucleotide primer
<4 OOs, SEQUENCE: 33 aaggcggtaa tacggittatc. cacag 25
<210s, SEQ ID NO 34 &211s LENGTH: 22 &212s. TYPE: DNA <213> ORGANISM; artificial 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic oligonucleotide primer
<4 OOs, SEQUENCE: 34 tgagtgagct gat accgctic gc 22
<210s, SEQ ID NO 35 &211s LENGTH: 44 &212s. TYPE: DNA <213> ORGANISM; artificial 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic oligonucleotide primer
<4 OOs, SEQUENCE: 35 gcgagcggta t cagct cact Caaggcgt at Cacgaggc.cc titt C 44
<210s, SEQ ID NO 36 &211s LENGTH: 47 &212s. TYPE: DNA <213> ORGANISM; artificial 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic oligonucleotide primer
<4 OOs, SEQUENCE: 36 US 9,353,390 B2 47 48 - Continued
Ctgtggataa ccg tattacc gcc tittaggg C9gcggattt gtc.ctac 47
<210s, SEQ ID NO 37 &211s LENGTH: 46 &212s. TYPE: DNA <213> ORGANISM; artificial 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic oligonucleotide primer
<4 OO > SEQUENCE: 37 gggaalacata taggagata taccatgacg C9tgagggat tctgc 46
<210s, SEQ ID NO 38 &211s LENGTH: 33 &212s. TYPE: DNA <213> ORGANISM; artificial 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic oligonucleotide primer
<4 OOs, SEQUENCE: 38 gggaaaggat cct cacaccg cct cacgga gtc 33
<210s, SEQ ID NO 39 &211s LENGTH: 46 &212s. TYPE: DNA <213> ORGANISM; artificial 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic oligonucleotide primer
<4 OOs, SEQUENCE: 39 gggaaag.cat gcaggagata tac Catgggit aatc.cgatcc tigCCg 46
<210s, SEQ ID NO 4 O &211s LENGTH: 33 &212s. TYPE: DNA <213> ORGANISM; artificial 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic oligonucleotide primer
<4 OOs, SEQUENCE: 4 O gggaalacata ttcaa.catg gcc.ggttcac ctic 33
<210s, SEQ ID NO 41 &211s LENGTH: 4 O &212s. TYPE: DNA <213> ORGANISM; artificial 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic oligonucleotide primer
<4 OOs, SEQUENCE: 41 gggaaaggta C catgacaca acct Ctttitt Ctgat cqggc 4 O
<210s, SEQ ID NO 42 &211s LENGTH: 39 &212s. TYPE: DNA <213> ORGANISM; artificial 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic oligonucleotide primer
<4 OOs, SEQUENCE: 42 gggaalacata ttcaacaat tdatcgtctg. tccagggc 39
<210s, SEQ ID NO 43 &211s LENGTH: 46 &212s. TYPE: DNA <213> ORGANISM; artificial US 9,353,390 B2 49 50 - Continued
22 Os. FEATURE: <223> OTHER INFORMATION: synthetic oligonucleotide primer
<4 OOs, SEQUENCE: 43 gggaalacata taggagata taccatgtcc aacaatggct cqt cac 46
<210s, SEQ ID NO 44 &211s LENGTH: 4 O &212s. TYPE: DNA <213> ORGANISM; artificial 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic oligonucleotide primer
<4 OOs, SEQUENCE: 44 gggaaagt cd act tatttct t cagttcago caggcttaac 4 O
<210s, SEQ ID NO 45 &211s LENGTH: 48 &212s. TYPE: DNA <213> ORGANISM; artificial 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic oligonucleotide primer
<4 OOs, SEQUENCE: 45 gggaaact cq agaggagata taccatgtcc ticacgtaaag agcttgcc 48
<210s, SEQ ID NO 46 &211s LENGTH: 39 &212s. TYPE: DNA <213> ORGANISM; artificial & 22 O FEATURE; <223> OTHER INFORMATION: synthetic oligonucleotide primer
<4 OOs, SEQUENCE: 46 gggaaag.cat gcttacagca gttcttittgc titt cqcaac 39
<210s, SEQ ID NO 47 &211s LENGTH: 51 &212s. TYPE: DNA <213> ORGANISM; artificial 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic oligonucleotide primer
<4 OOs, SEQUENCE: 47 gggaaagcat gcaggagata taccatgaat it at Cagaacg acgatttacg C 51
<210s, SEQ ID NO 48 &211s LENGTH: 33 &212s. TYPE: DNA <213> ORGANISM; artificial 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic oligonucleotide primer
<4 OOs, SEQUENCE: 48 gggaaaaagc titt taccc.gc gacgc.gcttt tac 33
<210s, SEQ ID NO 49 &211s LENGTH: 36 &212s. TYPE: DNA <213> ORGANISM; artificial 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic oligonucleotide primer
<4 OOs, SEQUENCE: 49 gggaaagagc tict citt Cacc ticgagaattig tagcg 36 US 9,353,390 B2 51 52 - Continued
<210s, SEQ ID NO 50 &211s LENGTH: 34 &212s. TYPE: DNA <213> ORGANISM; artificial 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic oligonucleotide primer
<4 OOs, SEQUENCE: 50 gggaaaacta gtc tacticag gagagcgttc accg 34
<210s, SEQ ID NO 51 &211s LENGTH: 43 &212s. TYPE: DNA <213> ORGANISM; artificial 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic oligonucleotide primer
<4 OOs, SEQUENCE: 51 gggaaaggta C catgagt ct gaattitcCtt gattittgaac agc 43
<210s, SEQ ID NO 52 &211s LENGTH: 36 &212s. TYPE: DNA <213> ORGANISM; artificial 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic oligonucleotide primer
<4 OOs, SEQUENCE: 52 gggaaactgc agttacgc.gt aaccgtagct cat cag 36
<210s, SEQ ID NO 53 &211s LENGTH: 51 &212s. TYPE: DNA <213> ORGANISM; artificial 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic oligonucleotide primer
<4 OOs, SEQUENCE: 53 gggaaactgc agaggagata taccatgagc tiggattgaac gaattaaaag C 51
<210s, SEQ ID NO 54 &211s LENGTH: 33 &212s. TYPE: DNA <213> ORGANISM; artificial 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic oligonucleotide primer
<4 OOs, SEQUENCE: 54 gggaaagtic act caggcct CaggttcCtg atc 33
<210s, SEQ ID NO 55 &211s LENGTH: 57 &212s. TYPE: DNA <213> ORGANISM; artificial 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic oligonucleotide primer
<4 OO > SEQUENCE: 55 gggaaagtic acaggagata taccatggat attcgtaaga ttaaaaaact gatcgag
<210s, SEQ ID NO 56 &211s LENGTH: 43 &212s. TYPE: DNA <213> ORGANISM; artificial 22 Os. FEATURE: <223> OTHER INFORMATION: synthetic oligonucleotide primer US 9,353,390 B2 53 54 - Continued
<4 OOs, SEQUENCE: 56 gggaaagaat t cittatttitt cct galagacc gagtttitttc. tcc 43
SEO ID NO 57 LENGTH: 46 TYPE: DNA ORGANISM: artificial FEATURE: OTHER INFORMATION: synthetic oligonucleotide primer
< 4 OOs SEQUENCE: f gggaaagaat t caggagata taccatgaag gatalacaccg. tccac 46
SEO ID NO 58 LENGTH: 42 TYPE: DNA ORGANISM: artificial FEATURE: OTHER INFORMATION: synthetic oligonucleotide primer
< 4 OOs SEQUENCE: 58 gggaaaggat cottatttitt citgcactacg cagggatatt to 42
What is claimed is: 9. The microbe of claim 1 further comprising increased 1. A genetically engineered microbe that comprises a meta production of chorismate compared to a control cell. bolic pathway for the production of 4-hydroxycoumarin from 30 10. The microbe of claim 9 wherein the microbe expresses a feedback inhibition resistant 3-deoxy-D-arabino-heptu a chorismate intermediate, wherein the metabolic pathway losonate-7-phosphate synthase. comprises a salicylate:CoA ligase and an enzyme catalyzing 11. The microbe of claim 10 wherein the feedback inhibi the condensation of a salicoyl-CoA and a malonyl-CoA to tion resistant 3-deoxy-D-arabino-heptuloSonate-7-phosphate form 4-hydroxycoumarin. synthase is encoded by aroG. 2. The microbe of claim 1 wherein the microbe is E. coli. 35 12. The microbe of claim 9 wherein the microbe expresses 3. The microbe of claim 1 wherein the microbe expresses a phosphoenolpyruvate synthase at an increased level com an isochorismate synthase. pared to a control cell. 4. The microbe of claim 1 wherein the microbe expresses 13. The microbe of claim 9 wherein the microbe expresses an isochorismate pyruvate lyase. a transketolase at an increased level compared to a control 5. The microbe of claim 1 wherein the enzyme catalyzing 40 cell. the condensation of a salicoyl-CoA and a malonyl-CoA to 14. The microbe of claim 9 wherein the microbe expresses a shikimate kinase at an increased level compared to a control form 4-hydroxycoumarin is a Pseudomonas quinolone syn cell. thase (PdsD). 15. A method comprising: 6. The microbe of claim 1 wherein at least one enzyme of 45 culturing the genetically engineered microbe of claim 1 the metabolic pathway is exogenous with respect to the under conditions suitable for the production of 4-hy microbe. droxycoumarin, wherein 4-hydroxycoumarin is pro 7. The microbe of claim 6 comprising a first plasmid com duced. prising a polynucleotide encoding the at least one enzyme of 16. The method of claim 15 further comprising enriching the metabolic pathway, the enzyme selected from isochoris the 4-hydroxycoumarin produced during the culturing. mate synthase, isochorismate pyruvate lyase, Salicylate:CoA 50 17. The method of claim 16 wherein the enriching com ligase, and a Pseudomonas quinolone synthase (PdSD). prises removing the cells from the culture. 8. The microbe of claim 6 comprising a first plasmid com 18. The method of claim 15 wherein the 4-hydroxycou prising a polynucleotide encoding an isochorismate synthase marin is isolated. and an isochorismate pyruvate lyase, and the microbe further 19. The method of claim 15 further comprising adding comprising second plasmid comprising a polynucleotide 55 benzyldeneacetone and (S,S)-1,2-diphenylethylenediamine encoding a salicylate:CoA ligase and a Pseudomonas qui to convert the 4-hydroxycoumarin to warfarin. nolone synthase (PdSD). k k k k k