University of Calgary PRISM: University of Calgary's Digital Repository

Graduate Studies The Vault: Electronic Theses and Dissertations

2014-04-30 Syntrophic hydrocarbon metabolism under methanogenic conditions

Fowler, Susan Jane

Fowler, S. J. (2014). Syntrophic hydrocarbon metabolism under methanogenic conditions (Unpublished doctoral thesis). University of Calgary, Calgary, AB. doi:10.11575/PRISM/27962 http://hdl.handle.net/11023/1450 doctoral thesis

University of Calgary graduate students retain copyright ownership and moral rights for their thesis. You may use this material in any way that is permitted by the Copyright Act or through licensing that has been assigned to the document. For uses that are not allowable under copyright legislation or licensing, you are required to seek permission. Downloaded from PRISM: https://prism.ucalgary.ca UNIVERSITY OF CALGARY

Syntrophic hydrocarbon metabolism under methanogenic conditions

by

Susan Jane Fowler

A THESIS

SUBMITTED TO THE FACULTY OF GRADUATE STUDIES

IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE

DEGREE OF DOCTOR OF PHILOSOPHY

DEPARTMENT OF BIOLOGICAL SCIENCES

CALGARY, ALBERTA

APRIL, 2014

© SUSAN JANE FOWLER 2014 Abstract

Methanogenic metabolism of organic matter is a key process in both natural and engineered systems. Methanogenic hydrocarbon degradation is an important biogeochemical process in the deep subsurface, and subsurface hydrocarbon contamination is frequently remediated by methanogenic processes. Despite the importance of methanogenic processes in hydrocarbon-impacted systems, we currently have an incomplete understanding of the hydrocarbon activation and degradation pathways used by the syntrophic , the roles of the non-hydrocarbon degrading syntrophs, which are often present in high abundance, and the ways in which syntrophic bacteria and methanogenic archaea establish and maintain relationships that allow them to coordinate their metabolism. By studying methanogenic hydrocarbon degrading enrichment cultures, we remove many complicating features of natural systems and can gain a basic understanding of the primary factors governing hydrocarbon metabolism under methanogenic conditions. In this dissertation, we describe several methanogenic hydrocarbon degrading enrichment cultures with a major focus on a toluene degrading methanogenic enrichment culture. Methanogenic hydrocarbon degrading communities consist of a diverse assemblage of Archaea and Bacteria dominated by members of the

Methanomicrobia, Firmicutes, , Chloroflexi, Spirochaetes and other bacterial phyla in smaller proportions. Using stable isotope probing, key organisms involved in the degradation of toluene were identified, including Desulfosporosinus sp., which is associated with toluene activation as well as - like organisms and Desulfovibrio sp. Metabolite and metagenomic analysis indicate that fumarate addition is involved in toluene activation in this culture and results from this and other cultures suggest that fumarate addition is a key mechanism involved in the activation of alkanes, monoaromatic and polyaromatic hydrocarbons

ii under methanogenic conditions. Comparative metagenomic analysis suggests that key functional features that distinguish methanogenic hydrocarbon degrading cultures include enrichment of archaeal and bacterial hydrogenases, as well as functions related to the regulation of redox conditions, energy conservation and methanogenesis. Hydrogen and/or formate transfer appears to play a major role in metabolite and electron transfer in these cultures. A better understanding of the processes involved in methanogenic hydrocarbon metabolism may provide us with the knowledge to develop new tools to monitor, control and harness these technologies to the benefit of ourselves and our environment.

iii Acknowledgements

One of the joys of writing this dissertation is to look back to where I started and remember those who have helped me over the course of this journey. First and foremost, I would like to express my deepest gratitude to Dr. Lisa Gieg who has been an incredible mentor. You have given me the space and flexibility to grow, while all the while being patient, supportive and encouraging. Never lose your enduring sense of wonder for what we still don’t understand as this inspires many of us. I’d also like to thank my co-supervisor Dr. Gerrit Voordouw for his encouragement and support. His vast knowledge of seemingly everything always makes trips to his office enjoyable and enlightening. My sincerest thanks to my committee, Dr. Ray Turner and

Dr. Peter Dunfield for your support, suggestions and your valuable time. I’d also like to thank my examiners Dr. Marc Strous and Dr. Tariq Siddique for giving their time and insight to improve this dissertation. My time as a graduate student was funded by NSERC and AI and as such I’d like to thank them for keeping a roof over my head and food in my cupboards. Best wishes to members of the Gieg lab and the rest of the PMRG, both past and present. To my friends Esther, Carolina, Sylvain, Shawna and Marcy, thank you for all the fun times and revealing discussions, both science-related and not. Also, a special thanks to Dr. Rhonda Clark, the PMRG would be lost without you. Thanks also to my collaborators and fellow scientists from the University of Calgary, University of Alberta, University of British Columbia and University of New South Wales, without whom this work wouldn’t have been possible.

Brandon & Erin, thanks for the continued support and assistance in navigating the vast maze that is graduate school. Your friendship, humpdays and homebrew have made the past five years fly by. Finally, to Will, thanks for the unwavering love and support and especially for bringing me coffee on those dark, cold, winter mornings. If it weren’t for that I might still be in bed.

iv Dedication

For my mother,

without whom I would not be here

in more ways than one.

v Table of Contents

Abstract ...... ii Dedication ...... v Table of Contents ...... vi List of Tables ...... x List of Figures ...... xii List of Symbols, Abbreviations and Nomenclature ...... xviii

CHAPTER ONE: INTRODUCTION ...... 1 1.1 Historical context and rationale ...... 1 1.2 Research objectives ...... 2 1.3 Organization of the thesis and contributions of co-authors ...... 3

CHAPTER TWO: LITERATURE REVIEW ...... 6 2.1 Syntrophy and methanogenesis ...... 6 2.1.1 Interspecies metabolite and electron transfer ...... 7 2.1.1.1 Hydrogen and formate ...... 8 2.1.1.2 Acetate ...... 10 2.1.1.3 Direct interspecies electron transfer (DIET) ...... 11 2.1.1.4 Other compounds ...... 12 2.1.1.5 Summary ...... 13 2.2 Methanogenic hydrocarbon metabolism ...... 14 2.2.1 Anaerobic hydrocarbon activation ...... 16 2.2.1.1 Fumarate addition ...... 16 2.2.1.2 ...... 19 2.2.1.3 Methylation ...... 20 2.2.1.4 Hydroxylation ...... 21 2.2.2 Detailed pathway of anaerobic toluene metabolism by fumarate addition .....22 2.3 Syntrophic hydrocarbon degrading microorganisms ...... 26 2.4 Current research focus ...... 29

CHAPTER THREE: METHANOGENIC TOLUENE METABOLISM: COMMUNITY STRUCTURE AND INTERMEDIATES...... 31 3.1 Abstract ...... 32 3.2 Introduction ...... 32 3.3 Experimental procedures ...... 35 3.3.1 Culture incubations ...... 35 3.3.2 DNA extraction ...... 35 3.3.3 16S rRNA gene amplification, sequencing and analysis ...... 36 3.3.4 Benzylsuccinate synthase gene amplification and sequencing...... 38 3.3.5 Metabolite experiments and abiotic controls ...... 38 13 3.3.5.1 Unlabelled and labelled C7-toluene ...... 38 3.3.5.2 18O-labelled water...... 39 3.3.5.3 Abiotic controls ...... 40 3.3.6 Analytical procedures ...... 40 3.4 Results ...... 42

vi 3.4.1 Toluene bioconversion to methane ...... 42 3.4.2 Microbial community analysis ...... 44 3.4.3 Compounds detected during methanogenic toluene metabolism ...... 45 3.4.4 Abiotic controls ...... 49 3.4.5 Detection of benzylsuccinate synthase gene ...... 51 3.5 Discussion ...... 53 3.6 Acknowledgments ...... 57 3.7 References ...... 57

CHAPTER FOUR: IDENTIFICATION OF TOLUENE DEGRADERS IN A METHANOGENIC ENRICHMENT CULTURE ...... 63 4.1 Abstract ...... 64 4.2 Introduction ...... 64 4.3 Materials and Methods ...... 66 4.3.1 Culture incubations ...... 66 4.3.2 RNA extraction, density gradient centrifugation and fractionation ...... 67 4.3.3 RNA precipitation, quantification, reverse transcription and amplification ...67 4.3.4 Denaturing gradient gel electrophoresis ...... 68 4.3.5 Sequencing and phylogenetic analysis ...... 68 4.3.6 Quantification of key organisms identified in RNA-SIP ...... 69 4.3.7 Primer selection, design and optimization and qRT-PCR ...... 69 4.4 Results ...... 72 13 4.4.1 Exposure to C7-toluene and RNA gradient ultracentrifugation ...... 72 4.4.2 Bacterial diversity of toluene degrading enrichment determined by DGGE ..74 4.4.3 Identification of bacteria involved in toluene degradation by RNA-SIP ...... 74 4.4.4 Quantification of key organisms involved in methanogenic toluene degradation ...... 77 4.5 Discussion ...... 80 4.6 Acknowledgements ...... 86 4.7 References ...... 87

CHAPTER FIVE: COMPARATIVE METAGENOMIC ANALYSIS OF THREE METHANOGENIC HYDROCARBON DEGRADING ENRICHMENT CULTURES ...... 92 5.1 Abstract ...... 93 5.2 Introduction ...... 94 5.3 Materials and methods ...... 96 5.3.1 Incubation conditions ...... 96 5.3.2 DNA extraction and 16S rRNA gene pyrotag sequencing ...... 98 5.3.3 Total DNA extraction for metagenomic sequencing ...... 98 5.3.4 Quality control, de novo assembly and annotation of metagenomic data ...... 99 5.3.5 Taxonomic classification of metagenomic data ...... 99 5.3.6 Comparative analysis of functional categories in metagenomic datasets ...... 99 5.3.7 Phylogenetic analysis of putative fumarate addition ...... 101 5.4 Results and Discussion ...... 101 5.4.1 Description of the methanogenic hydrocarbon degrading enrichment cultures101 5.4.2 General features of NAPDC, SCADC and TOLDC metagenomes ...... 102

vii 5.4.3 Microbial community composition of methanogenic hydrocarbon degrading cultures ...... 104 5.4.4 Key metabolic and anaerobic hydrocarbon-degrading pathways ...... 109 5.4.4.1 Putative genes associated with hydrocarbon-degrading pathways ...... 109 5.4.4.2 Downstream anaerobic hydrocarbon degradation pathways ...... 116 5.4.4.3 Alternative anaerobic hydrocarbon activation mechanisms ...... 118 5.4.4.4 Methanogenesis ...... 120 5.4.5 Functional comparison of methanogenic hydrocarbon degrading cultures to other environments ...... 123 5.5 Conclusions ...... 129 5.6 References ...... 130

CHAPTER SIX: METAGENOMIC ANALYSIS OF A TOLUENE DEGRADING METHANOGENIC ENRICHMENT CULTURE ...... 138 6.1 Introduction ...... 138 6.2 Methods ...... 139 6.2.1 Culture incubations, DNA extraction and sequencing ...... 139 6.2.2 Quality control, assembly, ORF prediction and annotation ...... 140 6.2.3 Binning and pathway analysis ...... 141 6.3 Results and discussion ...... 142 6.3.1 Assembly and general features ...... 142 6.3.2 Binning and taxonomic composition of the TOLDC culture ...... 143 6.3.3 Anaerobic hydrocarbon metabolism ...... 146 6.3.3.1 Fumarate addition ...... 147 6.3.3.2 Alternate hydrocarbon activation mechanisms ...... 153 6.3.3.3 Downstream aromatic hydrocarbon metabolism ...... 155 6.3.3.4 Downstream alkane metabolism ...... 159 6.3.4 Syntrophic processes ...... 160 6.3.4.1 Hydrogen and formate formation and reverse electron transfer ...... 161 6.3.4.2 Direct interspecies electron transfer ...... 165 6.3.5 Pathway analysis and putative roles of community members ...... 166 6.3.5.1 Methanogens and methanogenic pathways ...... 166 6.3.5.2 Alternative carbon sources for syntrophic bacteria ...... 167 6.3.5.3 Establishment and maintenance of syntrophic interactions ...... 170 6.3.5.4 Model for syntrophic toluene metabolism by TOLDC ...... 171 6.4 Conclusions ...... 173

CHAPTER SEVEN: COMMUNITY ANALYSIS AND METHANE PRODUCTION FROM OTHER METHANOGENIC CULTURES ...... 176 7.1 Introduction ...... 176 7.2 Methods ...... 177 7.2.1 Culture incubations ...... 177 7.2.2 Methane measurement ...... 178 7.2.3 DNA extraction, PCR and pyrotag sequencing ...... 178 7.2.4 Sequencing and bioinformatics analysis ...... 180 7.3 Results and discussion ...... 180 7.3.1 Methane production ...... 181

viii 7.3.2 Microbial community analysis ...... 186

CHAPTER EIGHT: CONCLUSIONS AND FUTURE DIRECTIONS FOR RESEARCH195 8.1 Summary of key findings ...... 195 8.2 Future directions for research ...... 198

REFERENCES ...... 201

APPENDIX A: SUPPLEMENTARY MATERIAL FROM CHAPTER THREE: METHANOGENIC TOLUENE METABOLISM: COMMUNITY STRUCTURE AND INTERMEDIATES...... 213

APPENDIX B: SUPPLEMENTARY MATERIAL FROM CHAPTER FOUR: IDENTIFICATION OF TOLUENE DEGRADERS IN A METHANOGENIC ENRICHMENT CULTURE ...... 218

APPENDIX C: SUPPLEMENTARY MATERIAL FROM CHAPTER FIVE: COMPARATIVE METAGENOMIC ANALYSIS OF THREE METHANOGENIC HYDROCARBON DEGRADING ENRICHMENT CULTURES ...... 229

APPENDIX D: SUPPLEMENTARY MATERIAL FROM CHAPTER SIX: METAGENOMIC ANALYSIS OF A TOLUENE DEGRADING METHANOGENIC ENRICHMENT CULTURE ...... 235

APPENDIX E: SYNTROPHIC BIODEGRADATION OF HYDROCARBON CONTAMINANTS...... 244

APPENDIX F: STABLE ISOTOPE PROBING IN ENVIRONMENTAL MICROBIOLOGY STUDIES ...... 254

APPENDIX G: COPYRIGHT PERMISSIONS ...... 278

ix List of Tables

Table 2-1. Stoichiometry and Gibbs free energy for reactions involved in syntrophic hydrocarbon degradation coupled to methane production ...... 7

Table 3-1. Taxonomic affiliation of the ten most abundant bacterial reads in a toluene- degrading methanogenic culture...... 45

Table 3-2. Abiotic controls showing reactions of toluene under different redox conditions ...... 50

Table 4-1. Primers used in this study ...... 71

Table 5-1. Enrichment and incubation conditions of methanogenic hydrocarbon degrading cultures ...... 97

Table 5-2. Features of the metagenomes of three methanogenic hydrocarbon degrading enrichments cultures generated by 454 pyrosequencing...... 103

Table 5-3. The five most abundant bacterial and archaeal OTUs in methanogenic hydrocarbon degrading enrichment cultures determined by 16S rRNA gene pyrotag sequencing. Percentages represent the proportion of reads associated with each taxon relative to the domain...... 105

Table 6-1. General features and statistics of the metagenome of the methanogenic toluene degrading enrichment culture TOLDC ...... 143

Table 6-2. Details of curated taxonomic bins from contigs greater than 10 kbp from the TOLDC hybrid assembly ...... 145

Table 6-3. Comparison of genes from the putative benzene carboxylase operon from TOLDC contig 5585 with the putative benzene carboxylase from Clostridia BF clone ...... 154

Table 7-1. Ten most abundant lineages as assessed by 16S rRNA gene pyrotag sequencing of a residual oil degrading cultures (R1, R2), a palmitate degrading culture (P1, P2) and a stearate degrading culture (S1, S2). Pyrotag sequencing was performed twice, at two separate time points, for each culture...... 188

Table 7-2. Alpha-diversity statistics from 16S rRNA gene pyrotag sequencing of residual oil, palmitate, and stearate degrading methanogenic cultures ...... 191

Table A-1. Taxonomic distribution of bacterial and archaeal sequences. Values are shown as the number of sequence reads out of 6241 sequences that were assigned by at least 90% similarity to a 16S rRNA gene sequence in the BLAST database...... 213

Table B-1. Bacterial diversity present in a methanogenic toluene degrading culture determined by DGGE and similarity to cultured microbes ...... 218

x Table C-1. Lists of metagenomes from MG-RAST used in comparative metagenomic analysis representing a variety of different environments ...... 229

Table C-2. Summary of recruitment of quality filtered 454 raw datasets to selected reference genomes...... 231

Table D-1. Genes found in assA2 operon from the toluene degrading methanogenic culture located on contig 7287...... 237

Table D-2. Comparison of putative bbs operons on contig 456 with putative bbs operons from contig 1060 and Desulfobacula toluolica TOL2...... 238

Table D-3. Putative genes associated with reductive dearomatization of benzoyl-CoA identified in the genome of a toluene degrading methanogenic culture and their similarity to previously characterized proteins...... 238

Table D-4. Putative genes involved in fumarate regeneration from alkane activation via the methylmalonyl-CoA pathway...... 241

Table D-5. Models used to identify genes and complexes associated with reverse electron transfer, hydrogen and formate transfer, and DIET...... 242

xi List of Figures

Figure 2-1. Pathways of methanogenesis from (1) acetate, (2) H2 and CO2 or formate, and (3) C1 compounds. The enzymes shown are as follows: Fmd/Fwd, Formylmethanofuran dehydrogenase; Ftr, Formylmethanofuran formyltransferase; Mch, Methenyl- tetrahydromethanopterin (H4MPT) cyclohydrolase; Mtd, F420-dependent methylene- H4MPT dehydrogenase; Hmd, H2-dependent methylene-H4MPT dehydrogenase; Mer, Methylene-H4MPT reductase; Mtr, methyl-H4MPT methyltransferase; Mcr, Methyl- coenzyme M methylreductase; Hdr, Heterodisulfide reductase; CODH/ACS, Carbon- monoxide dehydrogenase/Acetyl-CoA synthase; AK, Acetate kinase; Pta, Phosphotransacetylase; Mta, Methanol:coenzyme M methyltransferase. (Thauer, 1998, Liu & Whitman, 2008) ...... 15

Figure 2-2. Fumarate addition to toluene catalyzed by the benzylsuccinate synthase (Bss) encoded by bss genes...... 16

Figure 2-3. Maximum likelihood tree showing the separation of fumarate addition alpha subunits bssA, nmsA and assA. Predicted full-length amino acid sequences from cultured and uncultured hydrocarbon degrading organisms were used to generate the tree. Pyruvate formate from Clostridium beijerinckii was used as an outgroup. Bootstrap values are based on 100 replicates...... 18

Figure 2-4. Characterized pathways for anaerobic hydrocarbon metabolism. Degradation of 1. Ethylbenzene by hydroxylation and fumarate addition. 2. Xylenes by fumarate addition (m- xylene is shown, also applies to o-xylene and p-xylene). 3. Toluene by fumarate addition. 4. Benzene by carboxylation. 5. 2-methylnaphthalene by fumarate addition. 6. Naphthalene by carboxylation. 7. Alkanes by fumarate addition...... 23

Figure 2-5. Pathway of toluene metabolism by fumarate addition. Toluene is activated by addition of fumarate to the methyl group of toluene catalyzed by Bss. Benzylsuccinate undergoes modified beta-oxidation to benzoyl-CoA catalyzed by the Bbs multi-enzyme complex. Reductive dearomatization is carried out by benzoyl-CoA reductase and is further degraded by beta-oxidation (for details see text). Fumarate is regenerated from succinyl-CoA produced by BbsABCD by coA (BbsEF) and succinate dehydrogenase (Sdh). BamR – cyclohexadienoyl-CoA hydratase, BamQ – hydroxyenoyl-CoA dehydrogenase, BamA – oxoenoyl-CoA . (Wischgoll et al., 2005, Carmona et al., 2009)...... 25

Figure 3-1. Toluene consumption (closed symbols) and methane production (open symbols) by a mixed methanogenic consortium incubated with approximately 56 µmol of 12C- toluene (triangles, ▲, Δ), 13C-toluene (squares, ■, □), or an equal mixture of the two isotopes (circles, ●, ○)...... 43

Figure 3-2. Distribution of bacterial and archaeal 16S rRNA gene pyrotag sequences by phylum in toluene-degrading methanogenic consortium. Values are shown as the percentage of sequences per domain based on 5698 bacterial sequences and 543 archaeal sequences. Phyla included in ‘Other’ make up less than 0.2% of bacterial reads

xii each and include Thermotogae (0.14%), Candidate division OP8 (0.09%), Verrucomicrobia (0.07%), Candidate division OP11 (0.04%) and Candidate division BRC1 (0.02%)...... 44

Figure 3-3. Formation of putative metabolites by a mixed methanogenic consortium 13 incubated with C7-toluene showing A) the loss of toluene coupled with the transient accumulation of benzylsuccinate and benzoate and B) these putative metabolites and other hydroxylated compounds that also transiently appeared during the time-course experiments. HQ, hydroquinone; MeHQ, methylhydroquinone...... 48

Figure 3-4. Neighbour-joining cladogram showing the affiliation of a bssA gene fragment from a methanogenic toluene degrading culture with previously published bssA sequences. The tree was constructed using nucleotide sequences of aligned partial bssA genes of about 650 bp using PHYLIP. Bootstrapping was performed in seqboot using 100 datasets and distance matrices were calculated using dnadist. Sequences were clustered using neighbour and consense was used to select a consensus tree. Pyruvate formate lyase from Clostridium beijerinckii was used to root the tree...... 52

Figure 4-1. Denaturing gradient gel electrophoresis (DGGE) community from density- 13 12 13 resolved C7- and C7-toluene incubated samples. A. Day 1 C7-toluene incubated 13 13 sample. B. Day 3 C7-toluene incubated sample. C. Day 7 C7-toluene incubated 12 sample. D. Day 1 C7-toluene incubated sample. Numbers indicate buoyant density of CsTFA gradient fractions with values ranging from approximately 1.78-1.80 g/mL typically representing unlabelled (12C) RNA and 1.81-1.83 g/mL representing labelled (13C) RNA. Arrows indicate the enrichment of specific DGGE bands in heavy fractions (refer to text for details)...... 73

Figure 4-2. Maximum likelihood tree using Jones-Taylor-Thornton model showing affiliation of 16S rRNA gene fragments from DGGE bands with reference sequences from cultured relatives and select microbes associated with anaerobic hydrocarbon metabolism. Bootstrap values greater than 50 are shown (based on 100 datasets). The scale bar represents the number of nucleotide substitutions...... 76

Figure 4-3. Fold change in expression of 16S rRNA of dominant community members and bssA in response to toluene amendment. Total bacterial rDNA is also shown to indicate cell growth that occurred over a 20 day period. A value of one indicates no change, while a value greater than one indicates an increase in expression and a value less than one indicates a decrease in expression. Dsp- Desulfosporosinus, Clos- Clostridium, Dsv- Desulfovibrio, Syn- Syntrophaceae, bssA- benzylsuccinate synthase alpha subunit, Bac- Bacteria. Error bars show standard error of the mean. For each time point, RNA from triplicate biological replicates was extracted, and qRT-PCR was then performed in triplicate for each taxa for each biological replicate. Paired T-test: *p < 0.05; **p < 0.01 .. 79

Figure 4-4. Proposed pathway of methanogenic toluene metabolism in the culture under study. It is proposed that toluene is degraded to glutaryl-CoA or crotonyl-CoA by the Desulfosporosinus sp. identified. Subsequent metabolism may be carried out by the Desulfovibrionales and Syntrophus/Smithella-like organisms, Chloroflexi and/or

xiii organisms that were not labelled by day 7 convert the intermediated shown into methanogenic substrates acetate and hydrogen. Structures marked with an asterisk have previously been detected in culture fluids. Hydrogen production is indicated as it is an important intermediate in fermentative and methanogenic metabolism...... 85

Figure 5-1. Proportion of microbial communities at the taxonomic class level in NAPDC, TOLDC, and SCADC and eight other metagenomes based on assignment of 454 metagenomic reads using best hit classification against the M5NR database in MG- RAST. All metagenomes are available on MG-RAST and the associated identifications are reported in Table C-1. TP6 = Tailings Pond 6, GoM = Gulf of Mexico...... 107

Figure 5-2. Enzymes involved in anaerobic hydrocarbon-degradation and corresponding genes detected in the metagenomes of NAPDC, SCADC, and TOLDC. (A) Pathways for anaerobic hydrocarbon metabolism and associated enzymes. 1= Ethylbenzene, 2= xylenes, 3= toluene, 4= benzene, 5= 2-methylnaphthalene, 6= naphthalene 7= alkanes (B) Heatmap showing the abundance of various genes and putative genes involved in anaerobic hydrocarbon metabolism in the metagenomes. The scale indicates the inferred enzyme completeness. The enzymes shown are as follows: EbdABC, ethylbenzene dehydrogenase; Ped, (S)-1-phenylethanol dehydrogenase; Apc1 to Apc5, acetophenone carboxylase; Bal, benzoylacetate-CoA ; BssABC, benzylsuccinate synthase; BbsEF, succinyl-CoA:(R)-benzylsuccinate CoA transferase; BbsG, (R)-benzylsuccinyl- CoA dehydrogenase; BbsH, phenylitaconyl-CoA hydratase; BbsCD, 2- [hydroxyl(phenyl)methyl]- succinyl-CoA dehydrogenase; BbsAB, benzoylsuccinyl-CoA thiolase; AbcDA, anaerobic benzene carboxylase; BzlA/BamY, Benzoate-CoA ligase; BcrABCD, Benzoyl-CoA reductase (ATP-dependent); BamB to I, Benzoyl-CoA reductase (ATP-independent); NmsABC, Naphthyl-2-methyl-succinate synthase; BnsEF, Naphthyl-2-methyl-succinate CoA transferase; BnsG, Naphthyl-2-methyl- succinate dehydrogenase; BnsH, Naphthyl-2-methylene-succinyl CoA hydratase; BnsCD, Naphthyl-2-hydroxymethyl-succinyl CoA dehydrogenase; BnsAB naphthyl-2- oxomethyl-succinyl CoA thiolase; NcrABC, 2-naphthoyl CoA reductase; AncA, Anaerobic naphthalene carboxylase; AssABC, Alkylsuccinate synthase; AssK, AMP- dependent synthetase and ligase; Mcm, Methylmalonyl CoA mutase...... 112

Figure 5-3. Maximum likelihood tree of translated assA/bssA/nmsA homologs recovered from TOLDC, SCADC, and NAPDC. Closely related sequences were recovered from the NCBI nr-database through BLASTX searches. All sequences were aligned using Muscle 3.3 (Edgar, 2004), followed by manual adjustment of poorly aligned regions and deletion of indels. Maximum likelihood tree was constructed using PhyML (Guindon et al., 2010) with WAG model and 100 bootstrap replicates. Bootstrap values ≥60 are indicated. Full length translated pyruvate formate lyase (PFL) were used as an outgroup. Sequence length of genes recovered from TOLDC, SCADC and NAPDC, and their corresponding GenBank accession numbers are indicated in brackets. A tree with the same overall topology was obtained when including only full-length sequences with gaps...... 114

Figure 5-4. Enzymes involved in methanogenesis and corresponding genes detected in the metagenomes of NAPDC, SCADC and TOLDC. (A) Pathways for acetotrophic,

xiv hydrogenotrophic, and methylotrophic methanogenesis (Thauer et al., 1998) (B) Heatmap showing the relative abundance of genes and putative genes detected in dominant members of the methanogenic enrichment culture metagenomes. Mc; Methanoculleus spp., Ms; Methanosaeta spp., Mr; Methanoregula spp., Oth; other methanogens. The scale indicates the inferred pathway completeness. The enzymes shown are as follows: Fmd/Fwd, Formylmethanofuran dehydrogenase; Ftr, Formylmethanofuran formyltransferase; Mch, Methenyl-H4MPT cyclohydrolase; Mtd, F420-dependent methylene-H4MPT dehydrogenase; Hmd, H2-dependent methylene- H4MPT dehydrogenase; Mer, Methylene-H4MPT reductase; Mtr, methyl-H4MPT methyltransferase; Mcr, Methyl-coenzyme M methylreductase; Hdr, Heterodisulfide reductase; CODH/ACS, Carbon-monoxide dehydrogenase/Acetyl-CoA synthase; AK, Acetate kinase; Pta, Phosphotransacetylase; Mta, Methanol:coenzyme M methyltransferase...... 122

Figure 5-5. Principal component analysis of 45 metagenomes available in MG-RAST including TOLDC, SCADC and NAPDC (Table C-1). Symbols are colored according to the environment of origin. All counts were normalized against total annotated sequences of each metagenome. Metagenomes from related environments are circled in dotted lines...... 125

Figure 5-6. Ternary plot showing three-way comparisons of functional categories in SEED subsystems level 3 for different groups of metagenomes: methanogenic hydrocarbon- degrading cultures (TOLDC, SCADC, and NAPDC); GM (three metagenomes from Gulf of Mexico marine sediments); and, TP (Two metagenomes of oil sands tailings ponds) (see Table C-1 for details of metagenomes). Each point on the ternary plot represents a subsystem category of the three groups of pooled metagenomes, with the proportion of each being normalized to a value of 1.0. Data points that are coloured represent functions that are significantly enriched in a given group of metagenomes, while points in gray are not significantly enriched in any of the groups...... 127

Figure 6-1. Maximum likelihood tree showing the affiliation of fumarate addition gene sequences identified in the assembled metagenome of the toluene degrading methanogenic enrichment (shown in bold) relative to cultivated isolates or enriched cultures. The tree was constructed using near full-length predicted amino acid sequences of fumarate addition and glycyl-radical enzyme genes using PHYLIP with the Jones- Taylor-Thornton model. Bootstrap values, based on 100 replicates, are shown if they are greater than 60. Pyruvate formate lyase from Clostridium beijerinckii and from the toluene degrading culture were used to root the tree...... 148

Figure 6-2. Comparison of putative assA1 operon from TOLDC (contig 86) with assA1 operon from Desulfatibacillum alkenivorans AK-01. Red/pink lines indicate degree of amino acid sequence similarity between connected genes. Constructed using genoplotR. 151

Figure 6-3. Comparison of putative bss and bbs operons from contig 1060 with bss and bbs operons from Desulfobacula toluolica Tol2...... 156

xv Figure 6-4. Heatmap showing the distribution of genes or operons associated with H2 and formate formation, reverse electron transfer, and DIET among various taxa in TOLDC. Values have been normalized based on the total number of hits in each category, which are shown below the heatmap. Thus, each column shows the relative abundance of the given gene or complex in each of the taxa. Hits that could not be classified below the domain level are included in the total count, but are not shown in the heatmap. In cases where classification is redundant, lower level taxonomic categories do not include hits assigned to higher-order categories that are presented here. (e.g. Deltaproteobacteria does not include hits that were assigned to Desulfuromonadales or Geobacter, and Desulfuromonadales does not include hits assigned to Geobacter). MB = membrane bound, H2ase = hydrogenase, FDH = formate dehydrogenase ...... 164

Figure 6-5. Presence and absence of metabolic pathways or processes in individual binned datasets from the toluene degrading methanogenic culture. Cases where 25% or less of enzymes in a pathway were identified are only shown if a partial pathway can serve a biological function (e.g. nitrate reduction)...... 169

Figure 7-1. Production of methane by palmitate (▲) and stearate (■) degrading cultures over 340 days. Cultures were transferred and amended with 30 µmol of substrate. Methane production is the average of 5 (palmitate) or 6 (stearate) cultures from the most recent culture transfer. Dotted lines show methane production from substrate unamended control. Error bars show ± 1 standard error of the mean...... 182

Figure 7-2. Production of methane from (A) hexadecane degrading culture (B) octadecane degrading culture over 300 days. Methane production from unamended controls is shown as dotted lines, while solid lines represent individual replicates of cultures amended with hexadecane (♦) or octadecane (■). Note that methane production from each replicate is shown individually because of the large differences in methane production rates between replicates...... 184

Figure 7-3. Microbial communities of residual oil (R1, R2), stearate (S1, S2), and palmitate (P1, P2) degrading methanogenic cultures by comparison at the phylum level...... 189

Figure A-1. Mass spectral profiles of some metabolites (as TMS derivatives) found to 12 13 transiently accumulate during C-toluene (upper panel) and C7-toluene degradation (lower panel) under methanogenic conditions; (a) benzylsuccinate-diTMS, (b) hydroxybenzylsuccinate-diTMS, (c) benzoate-TMS, (d) m-cresol-TMS, (e) methylhydroquinone-diTMS, (f) hydroquinone-diTMS. 13C-Labeled carbon atoms on the structures (lower panel) are indicated by black dot...... 217

Figure C-1. Methane production by NAPDC culture incubated with naphtha over 100 days of incubation (a) and substrate usage of naphtha components by NAPDC after 120 days as determined by GC-MS (b) ...... 232

Figure C-2. Rarefaction curves from 454 pyrosequenced metagenomes of NAPDC, SCADC and TOLDC based on taxonomic classification in MG-RAST with M5NR ...... 233

xvi Figure C-3. Three-way comparison of functional categories (SEED subsystems level 3) from NAPDC, SCADC, and TOLDC...... 234

Figure D-1. Percent hydrocarbon loss from incubations of the toluene degrading methanogenic culture with alternate hydrocarbon substrates. Measurements of hydrocarbon loss were made at day 261 of incubation. Data collected by Courtney Toth. 235

Figure D-2. Production of methane from toluene degrading methanogenic culture incubated with alternate hydrocarbon substrates over 342 days. Hydrocarbon substrates from which methane production was observed include ben ene (black line, ■), ethylben ene (black line, ♦), o-xylene (black line, ▲), m-xylene (black line, ), hexane and decane (black line, ●), 2-methylnaphthalene (gray line, ■), hexadecane and octadecane (gray line, ♦). Unamended control is shown as a dotted line...... 236

xvii List of Symbols, Abbreviations and Nomenclature

Symbol Definition

Abc/abc Anaerobic naphthalene carboxylase (enzyme/gene) AHL Acyl homoserine lactone AI-2 Autoinducer-2 Anc/anc Anaerobic naphthalene carboxylase (enzyme/gene) Ass/ass Alkylsuccinate synthase ATP Adenosine triphosphate Bam/bam Benzoyl-CoA reductase, ATP-independent Bbs/ bbs Beta-oxidation of benzylsuccinate (enzyme/gene) Bcr/bcr Benzoyl-CoA reductase, ATP-dependent BESA Bromoethane sulfonic acid BLAST Basic local alignment search tool BLAST Basic local alignment search tool Bss/bss Benzylsuccinate synthase (enzyme/gene) BSTFA N,O,bis-(trimethylsilyl)trifluoroacetamide CoA Coenzyme A COG Clusters of orthologous groups DGGE Denaturing gradient gel electrophoresis DIET Direct interspecies electron transfer DMSP Dimethylsulfoniopropionate DNA Deoxyribonucleic acid Ebd/ebd Ethylbenzene dehydrogenase (enzyme/gene) FAD/FADH2 Flavin adenine dinucleotide – oxidized/ reduced Fd Ferredoxin FDH Formate dehydrogenase GC Gas chromatography/ gas chromatograph GC-MS Gas chromatography mass spectrometry H2ase hydrogenase H4MPT Tetrahydromethanopterin HMM Hidden Markov model HQ Hydroquinone i.d. Internal diameter IMG/M Integrated microbial genomes database / Metagenomes LCFA Long chain fatty acid MADCOR Methanogenic alkane degradation dominated by CO2 reduction MB Membrane bound MG-RAST Metagenomics- Rapid annotation using subsystems technology MHQ/ MeHQ Methylhydroquinone MLSB Mildred Lake Settling Basin MS Mass spectrometry NAD+/NADH Nicotinamide adenine dinucleotide – oxidized/reduced NAPDC Methanogenic naphtha-degrading culture NMS Naphthylmethyl succinate synthase

xviii NR Non-redundant Omc/omc Outer membrane cytochrome (protein/gene) OTU Operational taxonomic unit PAH Polycyclic aromatic hydrocarbon PCA Principal component analysis PCR Polymerase chain reaction Pfam Protein families QC Quality control qRT-PCR Quantitative reverse transcription polymerase chain reaction RDP Ribosomal database project RNA Ribonucleic acid RNA-SIP Ribonucleic acid based stable isotope probing SCADC Methanogenic short chain alkane degrading culture Sdh Succinate dehydrogenase SIP Stable isotope probing SSU Small subunit TiNTA Titanium nitrilotriacetate TMS Trimethylsilyl TOLDC Methanogenic toluene degrading culture

xix

Chapter one: Introduction

1.1 Historical context and rationale

Since the dawn of the industrial age, widespread use of hydrocarbons and increased industrial processing has led to the contamination of a wide range of environments. Though the pathways governing hydrocarbon metabolism under aerobic conditions are well understood, contamination of the subsurface with heavy organic loads quickly leads to the depletion of oxygen resulting in anoxic conditions. Thus, an improved understanding of anaerobic hydrocarbon degradation would help us to better understand the fate of hydrocarbon contaminants in the subsurface.

Not long ago, it was believed that oxygen was required for the activation of hydrocarbon substrates as a strong oxidizing agent was believed to be necessary to destabilize the inert hydrocarbon structure. Despite some evidence for anaerobic hydrocarbon metabolism prior to the late 20th century (Muller, 1957, Ekzertsev, 1960), it wasn’t until the 1980s-1990s that the anaerobic biodegradation of hydrocarbons began to be accepted by the scientific community (e.g.

Vogel & Grbić-Galić, 1986, Zengler et al., 1999). Since this time, it has been shown that hydrocarbon degradation can occur under a number of anaerobic electron accepting conditions including nitrate-, iron-, and sulfate-reducing as well as methanogenic conditions. The role that methanogenic hydrocarbon metabolism plays in the Earth’s subsurface has been unveiled as a key biogeochemical process that has led to the formation of heavy and ultra-heavy oil deposits in certain reservoirs and to biogenic methane production in shales and coal seams over the course of geologic time (Jones et al., 2008).

In the present day, we are just beginning to uncover the mechanisms and microorganisms that mediate hydrocarbon activation under strictly anoxic and methanogenic conditions.

1

Methanogenic hydrocarbon metabolism requires the presence of at least two groups of organisms, the syntrophic bacteria that catalyze the activation and subsequent degradation of hydrocarbons to methanogenic substrates, and the methanogens that convert acetate, CO2, H2 and a limited range of C1 compounds (e.g. methanol, methylamine, methane thiol), to methane.

Methanogenic hydrocarbon degrading cultures have been observed to be comprised of very diverse communities, and it is not well understood how these organisms coordinate their metabolisms to degrade hydrocarbons, nor how they conserve sufficient energy to support life

(Gieg et al., 2014). Furthermore, the mechanisms involved in methanogenic hydrocarbon activation are not fully understood, though fumarate addition has emerged as a key mechanism for the activation of aliphatic, substituted aromatic and polycyclic aromatic hydrocarbons

(PAHs) in recent years under a variety of anaerobic conditions (Foght, 2008).

A better understanding of methanogenic hydrocarbon metabolism could lead to the development of biotechnological applications for in-situ bioremediation and for the bioconversion of residual oil to methane as a tertiary energy recovery strategy from fossil-energy reservoirs. Furthermore, insight into the syntrophic lifestyle may shed light on novel mechanisms for interspecies communication or coordination, interspecies electron and metabolite transfer, and energy conservation in low energy-yielding environments.

1.2 Research objectives

The overarching goal of my PhD research was to characterize the syntrophic microorganisms involved in the methanogenic biodegradation of hydrocarbons and to provide a better understanding of their unique metabolism by using methanogenic enrichment cultures. The following objectives served as a guide:

2

i) Identify the microorganisms present in methanogenic hydrocarbon degrading

enrichment cultures;

ii) Identify and characterize the metabolic pathways that are utilized by syntrophic

microorganisms for the initial activation and subsequent degradation of aromatic and

straight chain hydrocarbons;

iii) Associate the activation of hydrocarbon substrates with specific microorganisms

present in the cultures.

1.3 Organization of the thesis and contributions of co-authors

This thesis is presented as a series of manuscripts (chapters 3, 4, and 5), and traditional- style thesis chapters (chapters 6 and 7), the research for which has been carried out by myself and in collaboration with a number of other contributors over the past five years. Supplementary information related to these chapters are included as appendices (Appendices A-D), and copyright permissions, where required, can be found in Appendix G. In addition, included in

Appendices E and F are other contributions that I have made to the field over the course of my studies. These include a review paper on syntrophic hydrocarbon metabolism and a book chapter overviewing stable-isotope probing methods in microbial ecology:

Appendix E: Gieg LM, Fowler SJ, Berdugo-Clavijo C (2014) Syntrophic biodegradation of hydrocarbon contaminants. Current Opinion in Biotechnology 27: 21-29

Appendix F: Fowler SJ, Gieg LM (2014) Stable isotope probing in environmental microbiology studies. Molecular methods and applications in microbiology. (Skovhus TL, Caffrey S & Hubert

C, eds) pp. 171-179. Caister Academic Press, Norfolk, UK.

3

Chapter 2 presents a literature review describing the current state of the art, and provides the background information necessary to understand the work described herein. Specific background information is also provided in each of the chapters.

Chapter 3 consists of a manuscript published in Environmental Microbiology in 2012 describing a toluene-degrading methanogenic culture including metabolite analysis, microbial community analysis, and an examination of analytical methods used for metabolite analysis in anaerobic cultures. Co-authors Xiaoli Dong and Dr. Christoph Sensen provided bioinformatics support. My supervisor Dr. Lisa Gieg established this enrichment culture while working as a post-doctoral fellow in the laboratory of Dr. Joseph Suflita at the University of Oklahoma. I conducted the physiological experiments and interpretations described in this work.

Chapter 4 describes RNA stable isotope probing (SIP) and quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) experiments conducted in order to identify the organisms involved in toluene activation and subsequent degradation steps en route to methane formation in the toluene degrading methanogenic culture. RNA-SIP was performed at the laboratory of Dr. Mike Manefield at the University of New South Wales where Dr. Maria-

Luisa Gutierrez-Zamora kindly instructed me in the ways of RNA-SIP and assisted me with this experiment. This manuscript was submitted to FEMS Microbiology Ecology on January 29,

2014 and was returned on March 21, 2014 with suggestions for revision.

Chapter 5 consists of a manuscript comparing metagenomes from three methanogenic hydrocarbon degrading enrichment cultures that were sequenced as a part of the Genome Canada

Hydrocarbon Metagenomics project. The comparative approach and analyses performed were conceived of by myself, Dr. Boonfei Tan and Dr. Nidal Abu Laban. I carried out the pathway and gene analysis including HMM construction, while Dr. Boonfei Tan carried out the

4

comparative anlaysis with metagenomes from diverse envrionments. I composed the first draft of the manuscript which has subsequently been edited by all authors. Xiaoli Dong and Dr.

Christoph Sensen provided bioinformatics support. Drs. Julia Foght and Lisa Gieg supported, both scientifically and financially, the collaboration between the primary authors and provided critical reviews of the manuscript. Dr. Boonfei Tan and I are co-first authors on this work. This manuscript is currently under revision after a rejection with request to resubmit from ISME

Journal.

Chapter 6 contains the analysis of the 454 and Illumina sequenced genome of the toluene degrading enrichment including the identification of genes and organisms associated with hydrocarbon activation, and an investigation into the putative roles of dominant community members. This manuscript will be submitted in the coming weeks.

Chapter 7 presents data related to other methanogenic hydrocarbon and LCFA degrading cultures that I have been working with over the course of my PhD. It includes microbial community analysis and methane production data from both previously established and newly established methanogenic cultures. Chapters 6 & 7 will be reformatted and prepared for publication in the coming months.

Chapter 8 summarizes the key findings of the research, providing a broad overview of what has been accomplished, and a discussion of directions for future research.

5

Chapter Two: Literature Review

2.1 Syntrophy and methanogenesis

Syntrophy is a specialized form of microbial mutualism in which interspecies metabolite and electron transfer allow reactions that are endergonic under standard conditions to become energetically favourable and support microbial growth (McInerney et al., 2009). In the case of the methanogenic biodegradation of organic compounds such as hydrocarbons, syntrophic bacteria catalyze the breakdown of complex organic molecules into methanogenic substrates such as H2, carbon dioxide, formate and acetate which are then converted by the methanogens to methane. Under standard conditions, the reactions catalyzed by the syntrophs are endergonic.

However, the maintenance of low H2 partial pressure and acetate concentration by the activity of methanogens (or other partners) makes these reactions energetically favourable (Table 2-1,

McInerney et al., 2009). The energy produced through these reactions is shared between all syntrophic partners and is often at the limit of energy required to sustain life. The mechanisms governing the establishment and maintenance of syntrophic relationships are not well understood, but interspecies metabolite and electron transfer are evidently key components in this process. Recent studies examining hydrocarbon degrading mixed cultures under nitrate, sulfate and iron reducing conditions also suggest that syntrophy can be involved in the anaerobic biodegradation of hydrocarbons by complex communities under non-methanogenic conditions

(Kunapuli et al., 2007, Herrmann et al., 2010, van der Zaan et al., 2012).

6

Table 2-1. Stoichiometry and Gibbs free energy for reactions involved in syntrophic hydrocarbon degradation coupled to methane production ΔG°’(kJ/mol) ΔG’ (kJ/mol)a Methane-producing reactions - - Acetotrophic CH3COO + H2O  HCO3 + CH4 -31.0 -15.6 - + Hydrogenotrophic 4H2 + HCO3 +H  CH4 + 3 H2O -135.6 -38.6 Hydrocarbon degrading syntrophic reactions - + Toluene C7H8 + 7H2O  3.5CH3COO +3.5H + 4H2 +113.6 -40.9 - + Hexadecane C16H34 + 16H2O  8CH3COO + 8H + 17H2 +470.8 -91.3 Overall degradation of hydrocarbons to methane - + Toluene C7H8 + 7.5H2O  4.5CH4 + 2.5HCO3 +2.5H -130.5 -134.1 - Hexadecane C16H34 + 16H2O 12.25CH4+ 3.75HCO3 + -353.5 -380.0 3.75H+ a Based on the following concentrations of intermediates: 10 Pa H2, 50 mM bicarbonate, 50 µM acetate, 50 kPa CH4, 100 µM each substrate as suggested in McInerney et al., 2009 Calculations based on the equation ΔG’= ΔG°’+ RTlnQ where R=0.00831kJ/K mol and T=298K Adapted from Gieg et al., 2014 with permission

2.1.1 Interspecies metabolite and electron transfer

Interspecies metabolite transfer was first described in the classical paper showing that

Methanobacillus omelianskii, an organism that was believed to oxidize ethanol to methane, was actually a syntrophic co-culture of an ethanol degrading H2 and acetate producer (S organism) and a hydrogenotrophic methanogen (Bryant et al., 1967). This study revealed that the S organism could degrade ethanol only when H2 partial pressures were low, either due to the presence of an H2utilizing methanogen, or by sparging gas from the culture vessel (Bryant et al.,

1967).

In order for syntrophic reactions to remain exergonic and for the metabolic relationship to be maintained, there must be a transfer of accumulating metabolites and electrons from the syntrophs to the methanogens. Proposed mechanisms for this transfer include diffusion of electron carrying molecules between syntrophs and methanogens and more recently, direct transfer of electrons through nanowires (Gorby et al., 2006).

7

2.1.1.1 Hydrogen and formate

The observations of Bryant et al., (1967) with M. omelianskii made it clear that molecular hydrogen was an important molecule in electron transfer in methanogenic communities.

Thermodynamic calculations show that depending on the substrate being oxidized, different H2 partial pressures are needed in the medium to make both the syntrophic and methanogenic steps energetically feasible (Table 2-1). The addition of H2 to the headspace of co-cultures containing fatty acid degrading syntrophs and methanogens has been shown to slow or stop fatty acid oxidation, as has the addition of bromoethane sulfonic acid (BESA) – an inhibitor of methanogenesis (Bryant et al., 1967, Struchtemeyer et al., 2011). The initial suspicion that formate may also play a role in interspecies metabolite transfer came from the detection of formate in a bioreactor converting ethanol to methane (Thiele & Zeikus, 1988). Subsequent calculations of diffusion rates in a butyrate degrading co-culture confirmed suspicions that formate transfer could play a role in syntrophy (Boone et al., 1989). Since that time, biochemical analyses and genome sequencing have revealed the presence of multiple genes encoding both hydrogenases and formate dehydrogenases (FDHs) in several long chain fatty acid (LCFA) degrading syntrophic bacteria, including specialized tungsten-containing FDHs which catalyze both forward and reverse reactions at high rates (de Bok et al., 2003, Sieber et al., 2012).

Interestingly, genome sequencing of Desulfatibacillum alkenivorans AK-01, the only organism reported to degrade alkanes in syntrophic association with a methanogen, revealed the presence of FDHs but no iron-only hydrogenases, suggesting that formate is key in interspecies metabolite transfer in this co-culture (Callaghan et al., 2012). Many methanogens can use both formate and

H2 as a source of electrons for methanogenesis and many can convert between them via the

- - following reaction: HCOO + H2O  H2 + HCO3 (Wu et al., 1993). The standard free energy

8

change of this reaction is close to zero, so it may be that it proceeds in whichever direction is favoured based on local conditions.

The low redox potentials of proton reduction to H2 or CO2 reduction to formate

(E°’= -414 mV and -420 mV respectively) present an energetic problem for syntrophs. Typical redox mediators such as NADH (nicotinamide adenine dinucleotide), FADH2 (flavin adenine dinucleotide) or reduced ferredoxin, have redox potentials ranging from E°’ = -220mV to -

398mV, which is insufficient for H2 or formate formation at standard conditions. Maintaining a low H2 partial pressure or formate concentration makes H2 or formate production more energetically feasible, but in order to produce H2 or formate for interspecies transfer, syntrophic microorganisms must reverse electron transport and invest energy in the form of ATP (adenosine triphosphate) or proton motive force. Several mechanisms for reverse electron transport during syntrophic growth have been proposed based on genomic and protein analyses.

One such mechanism of reverse electron transport is electron confurcation, which involves coupling an unfavourable redox reaction with a favourable redox reaction. The electron confurcating hydrogenase of Thermotoga maritima uses the energetically favourable production of H2from reduced ferredoxin (Fd) to drive the unfavourable production of H2 from NADH in the following reaction (Schut & Adams, 2009):

+ + NADH + 2Fdred + 3H  NAD + 2Fdox + 2H2

Similar putative confurcating hydrogenases have also been detected in a number of syntrophic bacteria (Sieber et al., 2012). Unfavourable redox reactions may also be driven by ion gradients, and a number of membrane associated electron transfer complexes associated with menaquinones or ion-translocating membrane complexes have been detected in syntrophs

(Sieber et al., 2012).

9

2.1.1.2 Acetate

In addition to hydrogen and formate transfer, it has been shown that syntrophic organisms can also excrete acetate, which can be used as a substrate for methane production (Schink, 1997).

Acetate accumulation in syntrophic cultures has been shown to stop fatty acid degradation at higher concentrations, suggesting a role in the thermodynamics of these reactions (Warikoo et al., 1996). The dynamics of acetate in mixed methanogenic cultures can be complex. Acetate may be produced by syntrophic reactions but also by acetogenesis, and may be removed by acetoclastic methanogenesis, syntrophic acetate oxidation or by incorporation into biomass.

In methanogenic crude oil metabolism, both acetoclastic and hydrogenotrophic methanogens are frequently identified. The MADCOR (methanogenic alkane degradation dominated by CO2 reduction) model of oil biodegradation suggests that alkanes are degraded by syntrophs to H2 and acetate. A small portion of the acetate is converted to methane by acetoclastic methanogens, but the majority of acetate is oxidized by syntrophs to H2 and CO2, which is then used for hydrogenotrophic methanogenesis, the major source of methane (Jones et al., 2008). This is supported by studies of oil degradation in high temperature fields where the only methanogen detected was Methanothermobacter sp., a thermophilic hydrogenotrophic methanogen (Gieg et al., 2010). However, another crude oil degrading enrichment culture was found by 16S rRNA gene clone libraries to contain a methanogenic community consisting solely of Methanosaeta sp., an acetoclastic methanogen, suggesting that acetate transfer was of prime importance in this culture (Gieg et al., 2008).

These diverse results indicate that syntrophs are versatile organisms that are capable of fine-tuning their metabolism based on physiological conditions such as the presence of acetate and H2 degraders, as well as temperature and substrate availability in order to maximize energy

10

conservation. There appears to be a role for interspecies formate, H2 and acetate transfer in methanogenic hydrocarbon degrading systems.

2.1.1.3 Direct interspecies electron transfer (DIET)

An alternative mechanism to metabolite transfer has been proposed for exocellular electron transfer involving the direct transfer of electrons via nanowires. The nanowires are thought to be type IV pili that are associated with cytochromes that mediate electron transfer to solid surfaces or cells (Reguera et al., 2005, Summers et al., 2010). The first report on this phenomenon revealed the importance of pili for the reduction of exocellular insoluble electron acceptors such as iron(III) oxides in Geobacter sulfurreducens (Reguera et al., 2005). A subsequent study demonstrated nanowire-based electron transmission in an ethanol-degrading syntrophic co- culture of the ethanol degrader Geobacter metallireducens and hydrogen or electron scavenger

G. sulfurreducens. In an evolved co-culture in which ethanol degradation was highly efficient, a mutation in pilR, a DNA binding protein, resulted in increased expression of omcS, which encodes an outer membrane cytochrome that is involved electron transfer to iron(III) oxides. The authors suggest that in the evolved co-culture, OmcS, localized on pili of G. sulfurreducens accepted electrons directly from c-type cytochromes of G. metallireducens, eliminating the need for H2 transfer thereby resulting in more efficient ethanol metabolism by the co-culture

(Summers et al., 2010).

Attempts to demonstrate DIET in other organisms resulted in the identification of electrically conductive filaments in Pelotomaculum thermopropionicum that made direct contact with Methanothermobacter thermoautotrophicus during syntrophic growth (Ishii et al., 2005,

Gorby et al., 2006). Further study revealed the filaments to be flagella, which are not believed to

11

be involved in electron transfer but do influence gene expression in the methanogen and are thought to play a role in synchronizing the metabolisms of P. thermopropionicum and M. thermoautotrophicus (Shimoyama et al., 2009).

Reports of DIET in methanogenic communities are also beginning to emerge. In a study using rice paddy soil, methane production was stimulated by the addition of iron oxide nanoparticles and resulted in the enrichment of Geobacter sp. in the microbial community. The authors suggest either that the nanoparticles facilitated electron transfer via iron-oxides, or that electrons may have been transferred by direct contact or nanowires between Geobacter sp. and

Methanosarcina sp. (Kato et al., 2012). Recent results with a Geobacter sp. dominated brewery- waste degrading digester suggest that Methanosaeta sp., typically considered to be acetoclastic, can also produce methane from electrons directly transferred via nanowires from Geobacter sp.

(Rotaru et al., 2014). While it is an exciting prospect that DIET may be possible in methanogenic syntrophic communities, this is likely not a widespread phenomenon. While many syntrophs harbour genes encoding multiple hydrogenases and FDHs, the presence of genes encoding type IV pili are less widespread in syntrophic organisms (Sieber et al., 2012), and they may not function in electron transfer even if they are present. Direct electron transfer via nanowires has thus far only been demonstrated in Geobacter sp., and thus its role as a widespread electron transfer mechanism in syntrophic environments is questionable.

2.1.1.4 Other compounds

A few other compounds including amino acids and sulfur compounds have also been reported to be involved in metabolite and electron transfer in syntrophic environments. In acetate oxidizing, nitrate-reducing co-cultures of Geobacter sulfurreducens and Wolinella succinogenes,

12

L-cysteine was found to be involved in electron transfer between the two organisms. In the absence of L-cysteine, sulfide, but not other sulfur compounds tested, could substitute as an electron carrier (Kaden et al., 2002). A role for sulfide in electron transfer in acetate oxidation by

Desulfuromonas acetoxidans coupled to phototrophic green sulfur bacteria has also been observed (Biebl & Pfennig, 1978). Upregulation of alanine metabolism genes in Methanococcus maripaludis coupled with reduced intra- and extra-cellular alanine concentrations when grown in co-culture with Desulfovibrio vulgaris suggests that alanine, in addition to H2, could play a role in electron transfer in this co-culture (Walker et al., 2012). Metatranscriptomics suggests that amino acid transfer may also be involved in syntrophy in co-cultures of Pelotomaculum thermopropionicum and Methanothermobacter thermoautotrophicus as genes for amino acid metabolism were upregulated in P. thermopropionicum when grown under syntrophic conditions

(Kato et al., 2009).

2.1.1.5 Summary

In summary, the classical description of syntrophy as being mediated by hydrogen and formate transfer may be incomplete. Results suggest that in addition to formate and hydrogen, acetate dynamics, the transfer of amino acids and sulfur compounds, and DIET, particularly in the presence of Geobacter sp., may all be involved in establishing and maintaining syntrophic interactions. Furthermore, the observation that flagellar contact can play a role in synchronizing the metabolism of syntrophs and methanogens is an intriguing development, and opens the door to additional questions about the involvement of various mechanisms of interspecies communication between members of syntrophic communities.

13

2.2 Methanogenic hydrocarbon metabolism

The methanogenic biodegradation of hydrocarbons follows the general scheme:

Hydrocarbon + H2O  CO2 + CH4

This reaction can be broken down into 3 major steps a) hydrocarbon activation b) downstream reactions and beta-oxidation, and c) methanogenesis. Under anoxic conditions, a number of mechanisms for hydrocarbon activation have been described, and these are discussed below.

Additional hitherto undescribed mechanisms of hydrocarbon activation may also exist.

Following activation, hydrocarbons are generally converted to acyl-CoA intermediates which are then further degraded by the classical beta-oxidation pathway or a modified form of it depending on the chemical structure of the substrate. The intermediate reactions involved in the formation of acyl-CoA molecules vary depending on the substrate but include, for example, ring reduction

(aromatic hydrocarbons) or carbon rearrangement and decarboxylation (n-alkanes following fumarate addition) (Callaghan et al., 2006, Carmona et al., 2009). Subsequently, intermediates of hydrocarbon metabolism are further degraded and methane is produced by hydrogenotrophic and/or acetotrophic methanogenesis (Jones et al., 2008, Fowler et al., 2012, Figure 2-1).

14

Figure 2-1. Pathways of methanogenesis from (1) acetate, (2) H2 and CO2 or formate, and (3) C1 compounds. The enzymes shown are as follows: Fmd/Fwd, Formylmethanofuran dehydrogenase; Ftr, Formylmethanofuran formyltransferase; Mch, Methenyl- tetrahydromethanopterin (H4MPT) cyclohydrolase; Mtd, F420-dependent methylene- H4MPT dehydrogenase; Hmd, H2-dependent methylene-H4MPT dehydrogenase; Mer, Methylene-H4MPT reductase; Mtr, methyl-H4MPT methyltransferase; Mcr, Methyl- coenzyme M methylreductase; Hdr, Heterodisulfide reductase; CODH/ACS, Carbon- monoxide dehydrogenase/Acetyl-CoA synthase; AK, Acetate kinase; Pta, Phosphotransacetylase; Mta, Methanol:coenzyme M methyltransferase. (Thauer, 1998, Liu & Whitman, 2008)

15

2.2.1 Anaerobic hydrocarbon activation

Hydrocarbons are non-polar, chemically inert substrates. Under oxic conditions, the activation of hydrocarbons is catalyzed by mono- or di-oxygenases which use oxygen to disrupt this inert structure. Under anoxic conditions, oxygen is (generally) not available as an oxidizing agent and microbes have had to evolve novel mechanisms for hydrocarbon activation. These reactions are generally seen as a rate limiting step in anaerobic hydrocarbon metabolism.

2.2.1.1 Fumarate addition

Fumarate addition was first described as an anaerobic activation mechanism for hydrocarbons in the biodegradation of toluene using cell-free extracts from Thauera aromatica under denitrifying conditions (Biegert et al., 1996). Since that time, fumarate addition to toluene has also been observed under sulfate and iron reducing as well as methanogenic conditions

(Beller & Spormann, 1997b, Beller & Edwards, 2000, Kane et al., 2002). In this reaction, the double bond of fumarate is added to the methyl group of toluene via a benzylsuccinyl radical intermediate catalyzed by the glycyl radical enzyme benzylsuccinate synthase (Bss) resulting in the formation of (R)-benzylsuccinate (Beller & Spormann, 1998, Figure 2-2).

Figure 2-2. Fumarate addition to toluene catalyzed by the enzyme benzylsuccinate synthase (Bss) encoded by bss genes.

16

Ben ylsuccinate synthase consists of three subunits present in a α2β2γ2 configuration with the alpha subunit, BssA, containing the glycyl-radical forming catalytic centre. Co-transcribed with the genes encoding these subunits (bssABC) are bssD which encodes a glycyl-radical activating protein required for enzyme function, and a number of other genes of unknown function (Heider, 2007). Bss can also catalyze the activation of xylenes and ethylbenzene by fumarate addition (Beller & Spormann, 1997b, Krieger et al., 1999, Kniemeyer et al., 2003,

Morasch & Meckenstock, 2005). Recent work suggests that a range of substrate-specific phylotypes of Bss exist, though co-metabolism by a single Bss has also been reported (Beller &

Spormann, 1997b, Acosta-Gonzalez et al., 2013).

In addition to monoaromatic hydrocarbons, fumarate addition has also been implicated in the anaerobic metabolism of alkanes and 2-methylnaphthalene. Fumarate addition to alkanes was first suggested by Kropp et al., (2000) in dodecane metabolism and has since been observed in alkanes ranging from C5-C18 including cycloalkanes and under a range of electron accepting conditions including methanogenesis (Heider, 2007, Callaghan et al., 2012). The enzyme that catalyzes this reaction, alkylsuccinate synthase (Ass), adds the subterminal carbon (C2) to the double bond of fumarate (Callaghan et al., 2008, Grundmann et al., 2008). The activation of 2- methylnaphthalene by fumarate addition is catalyzed by naphthyl-2-methyl succinate synthase

(Nms) in reactions analogous to fumarate addition to toluene (Annweiler et al., 2000).

A high degree of homology exists between the genes that encode enzymes for fumarate addition to hydrocarbon substrates though assA, bssA and nmsA sequences can be resolved in phylogenetic analysis (Figure 2-3). Fumarate addition enzymes appear to have a range of substrate specificities, as Ass has been observed to activate monoaromatic hydrocarbons co-

17

metabolically while Bss enzymes involved in toluene metabolism have been observed to activate xylenes (Beller & Spormann, 1997a, Rabus et al., 2011).

Figure 2-3. Maximum likelihood tree showing the separation of fumarate addition alpha subunits bssA, nmsA and assA. Predicted full-length amino acid sequences from cultured and uncultured hydrocarbon degrading organisms were used to generate the tree. Pyruvate formate lyase from Clostridium beijerinckii was used as an outgroup. Bootstrap values are based on 100 replicates.

18

2.2.1.2 Carboxylation

In 2003, a novel putative pathway for the carboxylation of alkanes by Desulfococcus oleovorans HxD3 was proposed whereby alkanes are carboxylated at the C3 position by bicarbonate, followed by removal of the C1 and C2 carbons forming a straight chain fatty acid which is further degraded by β-oxidation (So et al., 2003). These results are supported by the observation of metabolites consistent with carboxylation at the C3 position in a study by

Callaghan et al., (2006) on the same strain, and a second study using hydrocarbon degrading nitrate-reducing enrichment cultures (Callaghan et al., 2009). However, the authors point out that carboxylation may not necessarily be the initial activating mechanism and present an alternative pathway involving the formation of an acyl-metal complex (Callaghan et al., 2009). At this time, putative enzymes and genes involved in alkane carboxylation have not been identified. The activation of benzene by carboxylation was described some time ago based on the observation of labelled and unlabelled benzoate in culture fluids in sulfate-reducing cultures (Caldwell &

Suflita, 2000). More recent metaproteomic and metagenomic studies have revealed a putative benzene carboxylase in an iron-reducing benzene degrading culture (Abu Laban et al., 2010).

The putative anaerobic benzene carboxylase (Abc), which was upregulated in the presence of benzene but not phenol or benzoate, consists of two subunits, encoded by abcDA genes which have homology to phenylphosphate carboxylase genes from Aromatoleum aromaticum EbN1

(Abu Laban et al., 2010). A second putative benzene carboxylase was identified shortly after in

Ferroglobus placidus, a hyperthermophilic archaeon that oxidizes benzene coupled to iron reduction at 85°C (Holmes et al., 2011). The identified putative benzene carboxylases share only about 27% amino acid sequence identity, but both contain UbiD carboxylase domains.

19

In addition to benzene, it appears that other unsubstituted aromatics including naphthalene and phenanthrene may be activated by carboxylation under anaerobic conditions.

Both labelled 2-naphthoate and phenanthrene carboxylic acid have been observed in cultures incubated with 13C-bicarbonate (Zhang & Young, 1997). Furthermore, naphthalene carboxylation has been demonstrated in cell extracts under sulfate-reducing conditions, and putative anaerobic naphthalene carboxylase genes (anc) have been identified (DiDonato et al.,

2010, Bergmann et al., 2011, Mouttaki et al., 2012).

2.2.1.3 Methylation

An alternative benzene activation mechanism that has been proposed is methylation. It is proposed that benzene is activated by methylation to form toluene, which can then be further degraded by toluene degradation pathways such as fumarate addition (Coates et al., 2002).

Further experiments involving quantitative analysis of 13C-labelled benzene metabolites in nitrate reducing and methanogenic cultures have further supported the theory that benzene can be methylated to toluene and subsequently degraded to benzoate (Ulrich et al., 2005).

Methylation has also been proposed as an activation mechanism for naphthalene under sulfate reducing conditions (Safinowski & Meckenstock, 2004). In this reaction, a methyl group is added to naphthalene leading to the formation of 2-methylnaphthalene. It is thought that this is further metabolised by fumarate addition and beta-oxidation (Safinowski & Meckenstock, 2004).

However, further studies with this culture have suggested that the enzymes involved in 2- methylnaphthalene degradation are not upregulated during naphthalene degradation, and that 2- methylnaphthalene was not produced in cell extracts of this culture (Musat et al., 2009, Mouttaki

20

et al., 2012). Naphthalene carboxylation was subsequently demonstrated in this culture

(Mouttaki et al., 2012).

2.2.1.4 Hydroxylation

Hydroxylation reactions have been observed in the degradation of both ethylbenzene and propylbenzene under denitrifying conditions (Kniemeyer & Heider, 2001). Hydroxylation occurs at the benzylic (C1) carbon of the aliphatic side chain with the oxygen in the hydroxyl group being donated by water (Ball et al., 1996). Ethylbenzene dehydrogenase, the enzyme that catalyzes this reaction, was the first enzyme discovered to catalyze the hydroxylation of an aromatic hydrocarbon under anaerobic conditions (Ball et al., 1996). Interestingly, in two different strains of Azoarcus sp., this enzyme exhibits different localization and substrate specificity. In Azoarcus sp. strain EbN1, ethylbenzene dehydrogenase is periplasmic and can also hydroxylate propylbenzene (Kniemeyer & Heider, 2001, Rabus et al., 2002). This organism can activate toluene by fumarate addition, but cannot catalyze the addition of fumarate to ethylbenzene (Rabus, 2005). In Azoarcus sp. strain EB1, ethylbenzene dehydrogenase is membrane associated and has a broad substrate specificity extending to fluorinated ethylbenzenes as well as ethyldiene cyclohexanes, but not propylbenzene or BTEX compounds

(Johnson et al., 2001). The hydroxylation of ethylbenzene has been observed under both denitrifying and sulfate reducing conditions (Reinhard et al. 1997). Though there is currently not a great deal of literature on the topic, there is some preliminary evidence that indicates that a homolog of ethylbenzene dehydrogenase may be involved in alkane activation under anaerobic conditions (Callaghan et al., 2013).

21

A novel mechanism for the hydroxylation of alkanes under nitrate-reducing conditions was recently identified in the facultative strain HdN1 (Zedelius et al., 2011). In this organism, alkanes could be oxidized in the presence of nitrate and nitrite, but not nitrous oxide. This phenomenon, which has previously been described in the oxidation of methane, involves the dismutation of nitrate or nitrite, resulting in the formation of O2 which could subsequently be used by monoxygenases in the hydroxylation of hydrocarbons (Ettwig et al., 2010). Evidently, this form of alkane hydroxylation would be limited to facultative organisms that possessed alkane monooxygenase.

The hydroxylation of benzene was first proposed in 1987 when phenol was observed in methanogenic benzene degrading cultures (Grbić-Galić & Vogel). Since then, phenol has been observed in culture fluids of benzene degrading cultures under Fe(III) reducing conditions and by a pure culture under denitrifying conditions (Caldwell & Suflita, 2000, Chakraborty &

Coates, 2005). Oddly, in benzene degradation by the denitrifier Dechloromonas strain RCB, it

18 was shown using H2 O that the oxygen from the hydroxyl group in phenol was not derived from water. The origin of the oxygen is unknown (Chakraborty & Coates, 2005). The discovery of phenol in abiotic controls of anaerobic benzene degrading cultures has led to speculation as to the veracity of previous reports and suggests that caution in interpreting these results might be warranted (Kunapuli et al., 2008). However, phenol has also since been observed as a metabolite of anaerobic benzene metabolism in Geobacter metallireducens (Zhang et al., 2013).

2.2.2 Detailed pathway of anaerobic toluene metabolism by fumarate addition

In order to ensure that readers are familiar with the reactions and genes involved in anaerobic hydrocarbon metabolism, a detailed description of anaerobic toluene metabolism via

22

fumarate addition is presented here. The anaerobic biodegradation of toluene follows a similar scheme to that of other aromatic and even aliphatic hydrocarbons (Figures 2-4 & 2-5).

Figure 2-4. Characterized pathways for anaerobic hydrocarbon metabolism. Degradation of 1. Ethylbenzene by hydroxylation and fumarate addition. 2. Xylenes by fumarate addition (m- xylene is shown, also applies to o-xylene and p-xylene). 3. Toluene by fumarate addition. 4. Benzene by carboxylation. 5. 2-methylnaphthalene by fumarate addition. 6. Naphthalene by carboxylation. 7. Alkanes by fumarate addition.

23

Toluene is activated to benzylsuccinate by fumarate addition to the methyl group of toluene. This is catalyzed by the glycyl-radical enzyme benzylsuccinate synthase, encoded by bss genes, as described previously. Following the activation of toluene, benzylsuccinate undergoes a modified beta-oxidation converting it to benzoyl-CoA (Figure 2-5). The anaerobic degradation of a number of monoaromatic compounds converges on benzoyl-CoA, and as such it is considered a central intermediate in anaerobic monoaromatic compound metabolism. Similarly, the metabolism of several PAHs such as naphthalene and 2-methylnaphthalene converges on naphthoyl-CoA in analogous reactions (Figure 2-4). Conversion of benzylsuccinate to benzoyl-

CoA is catalyzed by a multi-enzyme complex termed beta-oxidation of benzylsuccinate (Bbs), encoded by bbsEFGHCDAB genes (Figure 2-5). The final step in this conversion releases succinyl-CoA which allows the regeneration of fumarate by succinate dehydrogenase. The genes encoding Bss and Bbs are typically arranged in individual co-transcribed operons, and the bss and bbs operons are often located in close proximity to one another in the genomes of toluene degraders (Carmona et al., 2009).

24

Figure 2-5. Pathway of toluene metabolism by fumarate addition. Toluene is activated by addition of fumarate to the methyl group of toluene catalyzed by Bss. Benzylsuccinate undergoes modified beta-oxidation to benzoyl-CoA catalyzed by the Bbs multi-enzyme complex. Reductive dearomatization is carried out by benzoyl-CoA reductase and is further degraded by beta-oxidation (for details see text). Fumarate is regenerated from succinyl-CoA produced by BbsABCD by coA transferase (BbsEF) and succinate dehydrogenase (Sdh). BamR – cyclohexadienoyl-CoA hydratase, BamQ – hydroxyenoyl- CoA dehydrogenase, BamA – oxoenoyl-CoA hydrolase. (Wischgoll et al., 2005, Carmona et al., 2009)

Benzoyl-CoA undergoes further degradation by reductive dearomatization catalyzed by benzoyl-CoA reductase (Figure 2-5). Benzoyl-CoA reductase exists in two different forms. The first is encoded by the bcrABCD genes and has been identified in nitrate-reducing and facultative organisms and requires ATP to catalyze reductive dearomatization (Boll & Fuchs, 1995). The second, encoded by the bamBCDEFGHI genes, has an ATP-independent mechanism and has been found in strict anaerobes such as Geobacter metallireducens (Wischgoll et al., 2005). A second modified beta-oxidation step results in ring cleavage, and subsequent degradation proceeds via beta-oxidation to acetyl-CoA and CO2.

25

While the scheme shown has been observed in isolates that degrade toluene anaerobically

(Figure 2-5), it is possible that under methanogenic conditions, where such reactions are potentially being catalyzed by multiple syntrophic microbes, that there may be modifications to the pathway. Under methanogenic conditions, it is possible that reactions involving the fermentation of downstream fatty acids could result in, for example, the formation of alcohols.

Furthermore, the fate of acetyl-CoA may vary depending on the specific conditions and organisms involved in the degradation of the substrate. It is possible that the H2 and CO2 produced are used for hydrogenotrophic methanogenesis, while the acetyl-CoA produced is used for acetotrophic methanogenesis. Alternatively, organisms carrying out syntrophic acetate oxidation may be involved in the conversion of acetyl-CoA to H2 and CO2, which could then be directed towards hydrogenotrophic methanogenesis. Such a model has been described in the degradation of crude oil (Jones et al., 2008, Gray et al., 2011, Mayumi et al., 2011).

Furthermore, it has been observed that a high degree of carbon fixation may occur concomitantly with syntrophic hydrocarbon degradation (Winderl et al., 2010, Taubert et al., 2012). These reactions could result in the production of additional acetyl-CoA (via the Wood-Ljungdahl pathway) which could be channelled through either acetotrophic methanogenesis, syntrophic acetate oxidation followed by hydrogenotrophic methanogenesis or incorporated into cell biomass.

2.3 Syntrophic hydrocarbon degrading microorganisms

Analysis of 16S rRNA gene sequences indicate that the majority of known syntrophic microorganisms that form associations with methanogens cluster within the delta division of the

Proteobacteria, including organisms from the Syntrophus, , Desulfoglaeba,

26

Desulfatibacillum, Geobacter, Desulfovibrio, Smithella and Pelobacter genera, and the low G+C

Gram-positives within the Firmicutes including organisms from the Desulfotomaculum,

Desulfosporosinus, Pelotomaculum, Sporotomaculum, Syntrophobotulus, Syntrophomonas,

Syntrophothermus, and Thermosyntropha genera (McInerney et al., 2009). Many of these organisms are capable of diverse metabolism including fermentative and respiratory degradation of multiple substrates depending on the availability of substrates, electron acceptors and syntrophic partners in the environment (Wallrabenstein et al., 1994, Harmsen et al., 1998). For example, organisms such as Desulfovibrio sp. and Geobacter sp., Deltaproteobacteria that are typically thought of as sulfate and iron reducers respectively, can grow syntrophically on some substrates in the absence of electron acceptors and are known as facultative syntrophs

(McInerney & Bryant, 1981, Cord-Ruwisch et al., 1998). While facultative syntrophs are capable of multiple metabolic lifestyles, obligate syntrophs, which lack the ability to use alternate electron acceptors, such as Syntrophus spp., Pelotomaculum spp., and Smithella propionica also exist (Liu et al., 1999, de Bok et al., 2005, McInerney et al., 2007). The Desulfotomaculum subcluster I of the Firmicutes represents an interesting case of obligate syntrophy. Organisms belonging to the Desulfotomaculum group are typically associated with sulfate reduction, however all known organisms within subcluster Ih and some organisms within subcluster Ib are incapable of sulfate reduction and lack PCR-amplifiable genes coding for the dissimilatory sulphite reductase (dsrAB) (Imachi et al., 2006). It appears that the extensive formation of syntrophic associations has resulted in a lack of selective pressures to maintain genes involved in sulfate reduction making these organisms obligate syntrophs.

In mixed methanogenic and non-methanogenic syntrophic hydrocarbon degrading cultures, a wide diversity of potential syntrophs have been identified. Commonly identified phyla

27

include Firmicutes, (in particular the Deltaproteobacteria), Chloroflexi,

Spirochaetes, Bacteroidetes, Actinobacteria and others (Kleinsteuber et al., 2012). While all of the organisms present in mature cultures presumably fill some niche, the identification of the key hydrocarbon activating organisms is the primary focus of most studies. The roles of the non- degrading communities are not well characterized. Key hydrocarbon activating and degrading syntrophs have been proposed for a number of mixed methanogenic (and non-methanogenic) syntrophic cultures. The syntrophs involved in the anaerobic degradation of the aromatic hydrocarbons benzene and toluene have been investigated in a number of cultures and under different electron accepting conditions. Under methanogenic conditions, Desulfosporosinus sp. and other members of the Peptococcaceae have been identified as responsible for both benzene and toluene activation (Ulrich & Edwards, 2003, Sun et al., 2014, Chapter 4). Using stable isotope probing (SIP) methods, members of the Peptococcaceae have also been identified as aromatic hydrocarbon degraders in non-methanogenic syntrophic cultures under nitrate, sulfate and iron reducing conditions (Kunapuli et al., 2007, Herrmann et al., 2010, Winderl et al., 2010, van der Zaan et al., 2012). The degradation of alkanes and alkenes under methanogenic conditions has in several cases been attributed to members of the Syntrophus / Smithella genera

(Zengler et al., 1999, Jones et al., 2008, Gray et al., 2011, Hirschler-Rea et al., 2012). In one culture, a relative of Syntrophus sp. was also identified as being involved in benzene activation

(Sakai et al., 2009).

The role of the non-hydrocarbon degraders in these cultures are not well characterized, but possible roles include involvement in downstream degradation pathways, providing essential nutrients to other members of the community or maintaining a low redox potential.

28

2.4 Current research focus

Early descriptions of syntrophy focused on the classical transfer of formate and hydrogen which mediates these energetic relationships. New studies suggest that additional mechanisms of electron and metabolite transfer, as well as other factors involved in metabolic coordination of syntrophs and methanogens may exist. Much remains to be learned about the relationships that exist between syntrophs and methanogens, and how these relationships are established and maintained in different communities.

Knowledge of the diversity of hydrocarbons that can be degraded under methanogenic conditions and the mechanisms by which they are activated has grown substantially in recent years. Fumarate addition has emerged as a key activation mechanism of several classes of hydrocarbons under anoxic conditions, and additional novel mechanisms may yet be identified.

Characterization of the organisms that catalyze these reactions has also come a long way in the past five years, with members of the Peptococcaceae within the Firmicutes and the

Syntrophaceae within the Deltaproteobacteria emerging as key hydrocarbon degraders under methanogenic conditions.

The aim of this dissertation is to investigate the organisms, reactions and syntrophic processes involved in methanogenic hydrocarbon degradation, and to contribute to the growing knowledge in this field.

29

Preface

Chapter 3 describes the characterization of a methanogenic toluene degrading enrichment culture that is a major focus of this dissertation. This chapter describes the biodegradation of toluene, with concomitant methane formation in this culture. Several metabolites, including benzylsuccinate and several compounds that are formed abiotically, were identified and their dynamics were followed over time. The identification of benzylsuccinate in culture fluids as well as the amplification of a partial bssA gene suggest that toluene is activated by fumarate addition in this culture. The microbial community as determined by 16S rRNA gene pyrotag sequencing is also described. The results described in this chapter provide a basis for further study of the culture and develops predictions regarding key hydrocarbon degrading species and toluene activation mechanism that are tested as described in later chapters (Chapters 4, 5 & 6).

30

Chapter Three: Methanogenic toluene metabolism: Community structure and intermediates

S. Jane Fowler1, Xiaoli Dong2, Christoph Sensen2, Joseph M. Suflita3, Lisa M. Gieg1

1Petroleum Microbiology Research Group, Department of Biological Sciences, University of

Calgary, 2500 University Drive NW, Calgary, AB, Canada, T2N 1N4

2Visual Genomics Centre, Faculty of Medicine, 3330 Hospital Drive NW, Calgary, AB, Canada,

T2N 4N1

3Department of Botany & Microbiology and Institute for Energy & the Environment

University of Oklahoma, 770 Van Vleet Oval, Norman, OK, USA, 73019

Status: Published in Environmental Microbiology, March 2012. 14(3): 754-764

Copyright permission for reproduction of this manuscript can be found in Appendix G.

31

3.1 Abstract

Toluene is a model compound used to study the anaerobic biotransformation of aromatic hydrocarbons. Reports indicate that toluene is transformed via fumarate addition to form benzylsuccinate or by unknown mechanisms to form hydroxylated intermediates under methanogenic conditions. We investigated the mechanism(s) of syntrophic toluene metabolism by a newly-described methanogenic enrichment from a gas condensate-contaminated aquifer.

Pyrosequencing of 16S rDNA revealed that the culture was comprised mainly of Clostridiales.

The predominant methanogens affiliated with the Methanomicrobiales. Methane production from toluene ranged from 72 to 79% of that stoichiometrically predicted. Isotope studies using

13 C7-toluene showed that benzylsuccinate and benzoate transiently accumulated revealing that members of this consortium can catalyze fumarate addition and subsequent reactions. Detection of a bssA gene fragment in this culture further supported fumarate addition as a mechanism of toluene activation. Transient formation of cresols, benzylalcohol, hydroquinone, and methylhydroquinone suggested alternate mechanism(s) for toluene metabolism. However,

18 incubations of the consortium with H2 O showed that the hydroxyl group in these metabolites did not originate from water and abiotic control experiments revealed abiotic formation of hydroxylated species due to reactions of toluene with sulphide and oxygen. Our results suggest that toluene is activated by fumarate addition, presumably by the dominant Clostridiales.

3.2 Introduction

Contamination of environmentally sensitive resources such as groundwater aquifers by hydrocarbons is of great concern for negatively impacting human and ecosystem health.

Monoaromatic compounds such as benzene, toluene, ethylbenzene, and the xylene isomers,

32

present in most fuel mixtures, are of high regulatory concern due to their relatively high water- solubility and known toxic and/or carcinogenic properties (Dean, 1985). Thousands of aquifers are contaminated with such compounds as the result of accidental fuel releases (Dietz et al.,

1986), and remediating such sites in a cost-effective manner has led to many investigations of the potential for anaerobic intrinsic hydrocarbon bioremediation (Phelps et al., 2001, Gieg & Suflita,

2005). Under anoxic conditions, toluene is one of the most readily biodegradable hydrocarbons, and much fundamental knowledge of anaerobic hydrocarbon metabolism has been gleaned from studies with this model aromatic substrate (Widdel et al., 2006). Toluene oxidation under anaerobic conditions can be coupled with the reduction of nitrate, chlorine oxyanions, manganese, iron, or sulfate, and it can be consumed under anoxygenic phototrophic or methanogenic conditions by numerous isolates or highly enriched mixed cultures (Widdel et al.,

2006, Heider, 2007). Several organisms capable of toluene degradation under nitrate-, perchlorate-, sulfate-, and iron-reducing conditions have been isolated in pure culture.

(Chakraborty & Coates, 2004). However, the syntrophic processes governing methanogenic hydrocarbon metabolism complicate the isolation of these organisms. To date, Desulfatibacillum alkenivorans AK-01, isolated under sulfate-reducing conditions, is the only organism isolated in pure culture that has been shown to be capable of methanogenic hydrocarbon metabolism

(Callaghan et al., 2012). A single study describing a microbial community degrading toluene methanogenically has thus far been carried out. Both Desulfotomaculum sp. and Desulfovibrio sp. were found in this enrichment culture, however, the organism believed to be carrying out toluene activation was not identified as it was unrelated to known organisms (Ficker et al.,

1999). In another study examining methanogenic aromatic hydrocarbon degradation, an organism distantly related to Syntrophus gentianae was identified as an important benzene

33

degrader using DNA-SIP (Sakai et al., 2009). Beyond these studies, little is known about the organisms that carry out methanogenic aromatic hydrocarbon metabolism.

A novel mechanism of anaerobic hydrocarbon activation, known as fumarate addition, was first discovered in studies examining the anaerobic decay of toluene by nitrate- and sulfate- reducing isolates (Biegert et al., 1996, Beller & Spormann, 1997b). The genes encoding the enzyme responsible for this transformation, benzylsuccinate synthase, have been identified and sequenced in a number of bacteria (Coschigano et al., 1998, Leuthner et al., 1998, Achong et al.,

2001, Winderl et al., 2007) and in a methanogenic enrichment (Washer & Edwards, 2007).

Earlier investigations examining toluene biodegradation under methanogenic conditions have also implicated metabolites such as o-cresol, o-methylcyclohexanol, p-cresol, p- methylcyclohexanol, methylcyclohexane, 2-hydroxybenzoate, benzylalcohol, benzaldehyde, and benzoate (Grbić-Galić and Vogel, 1987), suggesting that alternate mechanisms of toluene activation in the absence of endogenous electron acceptors, such as ring or methyl group

18 hydroxylation, may be possible. In studies using O- H2O, Vogel and Grbić-Galić (1986) showed the incorporation of an 18O atom into toluene forming labeled p-cresol, demonstrating that hydroxylation may also occur under methanogenic conditions.

In this study, we characterized the community composition of a new toluene-degrading methanogenic culture enriched from a gas condensate-contaminated aquifer using 16S rRNA gene-based pyrosequencing. Additionally, we sought to determine the predominant metabolic pathway(s) used by the consortial members to consume toluene under methanogenic conditions.

34

3.3 Experimental procedures

3.3.1 Culture incubations

An active, sediment-free toluene-degrading methanogenic culture enriched from a gas condensate-contaminated aquifer actively undergoing intrinsic bioremediation was used as the inoculum in this study (Gieg et al., 1999). The enrichment culture was maintained by routine transfer and substrate amendment with toluene as the sole electron donor under methanogenic conditions (no added electron acceptor). For routine cultivation under strict anoxic conditions, a bicarbonate-buffered mineral salts medium was used that contained resazurin as the redox indicator and cysteine sulfide as the reductant (prepared by reacting 2.5 g cysteine-HCl with 2.5 g sodium sulfide in a solution of 0.625 g NaOH in 100 mL anoxic water, added to medium at 2% v/v; (Bryant & Robinson, 1961)). Typically, 2 L of toluene (19 mol) was added per 50 mL of culture fluids for maintenance. Cultures were incubated in an inverted position at room temperature (approximately 20 - 22°C) in the dark. Biodegradation experiments to determine stoichiometric reactions were established by amending replicate 125-mL incubations with either

12 13 6 L (~ 56 mol) of C-toluene (99.8%, Sigma-Aldrich, St. Louis, MO), C7-toluene (99 atom%, Sigma-Aldrich, St. Louis, MO), or an equal mixture (3 L each) of labelled and unlabelled toluene. Cultures were routinely monitored for toluene loss and methane production by gas chromatography (described below) to indicate activity.

3.3.2 DNA extraction

DNA from cultures actively degrading toluene was extracted using a phenol-chloroform with bead-beating method (Rios-Hernandez et al., 2003). Briefly, 6 mL of culture supernatant was pelleted by repeated centrifugation at 18 000 g for 5 min in a 2-mL tube containing 0.3 g of

35

0.1-mm and 0.1 g of 0.5-mm zirconia/silica beads (BioSpec Products, USA). The supernatant was removed and 300 µL of chloroform-isoamyl alcohol (24:1) and 300 µL of lysis buffer (500 mM Tris, 100 mM NaCl, 10% SDS, pH 8) were added to the tube and cell disruption by bead beating was carried out at 6.0 m/s for 1 min. DNA was isolated by phenol, chloroform-isoamyl alcohol extraction followed by RNase and proteinase K treatment and a final phenol then chloroform-isoamyl alcohol extraction. DNA was precipitated in sodium acetate (3 M, pH 7) and cold 100% ethanol by centrifuging at 18 000 g for 20 min. The pellet was then washed with cold

70% ethanol. Pellets were resuspended in nuclease-free water.

3.3.3 16S rRNA gene amplification, sequencing and analysis

The 16S rRNA gene was amplified using universal primers 926F

(AAACTYAAAKGAATTGACGG) and 1392R (ACGGGCGGTGTGTRC) with PCR Master

Mix in 25-µL reactions (Fermentas, Burlington, Canada) in a two-cycle PCR method which allowed attachment of adaptor and barcode sequences in the second round of PCR. In the first round, conditions were as follows: 95.0°C for 3 min, 25 cycles of 95.0°C for 30 s, 55.0°C for 45 s, 72.0°C for 90 s and a final elongation at 72.0°C for 10 min. Amplicons were purified using the

Qiaquick PCR Purification kit before the second round of PCR (Qiagen, Mississauga, Canada).

The primers used in the secondary PCR (454T-FB and 454T-R13A) contained an adaptor and a barcode (reverse primer only) at the 5’ end adjacent to the 926F or 1392R primer sequences as required for 454 sequencing and multiplexing. Primer 454T-FB contained the 25-nt B-adaptor

(CTATGCGCCTTGCCAGCCCGCTCAG) and primer 454T-R13A contained the 25-nt A- adaptor (CGTATCGCCTCCCTCGCGCCATCAG) followed by the10-nt barcode sequence

(CATAGTAGTG). Conditions were as follows: 95.0°C for 3 min, 10 cycles of 95.0°C for 30 s,

36

55.0°C for 45 s, 72.0°C for 90 s and final elongation at 72.0°C for 10 min. Products were then

PCR purified, checked by gel electrophoresis and quantified by Q-bit fluorometry (Invitrogen,

Carlsbad, USA). PCR product (150 ng) was sequenced using a GS FLX Titanium Series Kit

XLR70 (Roche Diagnostics Corporation).

Data analysis was conducted using Phoenix 2, an in-house developed ssu (small subunit) rRNA data analysis pipeline. Raw pyrosequence reads were subjected to stringent systematic checks to remove low-quality reads and minimize sequencing errors, which could have been introduced during the pyrosequencing process (Huse et al., 2007). Eliminated sequences included those that: (i) did not perfectly match the adaptor and primer sequences, (ii) had ambiguous bases, (iii) had an average quality score below 27, (iv) contained homopolymer lengths greater than 8, or (v) were shorter than 200 bp after primer removal. The remaining high- quality sequences were compared against the non-redundant SSU_Reference data set SILVA102

(Pruesse et al., 2007) using the Tera-Blast algorithm on a 16-board TimeLogic Decypher system

(Active Motif). Sequences with an alignment covering less than 90% of the trimmed read length to the best BLAST match, with greater than 90% sequence identity, were identified as potential chimeras and were excluded from further analysis. The sequences passing quality control and chimeric sequence removal were clustered into OTUs at 3% distance by using the average linkage algorithm (Schloss & Westcott, 2011). A taxonomic consensus of all representative sequences from each OTU was derived from the recurring species within 5% of the best bitscore from a BLAST search against the SILVA database.

37

3.3.4 Benzylsuccinate synthase gene amplification and sequencing

Established primer sets were used to probe the methanogenic culture for the presence of the benzylsuccinate synthase gene following DNA extraction (Washer & Edwards, 2007). Using primers MBssA1516F and BssA2524R, a single fragment of expected size was recovered, sequenced and queried against the NCBI non-redundant (NR) nucleotide database using

BLASTN to identify homology to known sequences. Multiple alignments of the amplified sequence and all representative bssA sequences covering the same region were generated using

CLUSTALW (Thompson et al., 1994). Bootstrapped neighbour-joining trees (100 replicates) were constructed using PHYLIP (Felsenstein, 1993).

3.3.5 Metabolite experiments and abiotic controls

13 3.3.5.1 Unlabelled and labelled C7-toluene

The culture was established with unlabelled toluene prior to conducting time course- based metabolite experiments and was divided into 125-ml replicates inside an anoxic glove bag

(5% H2 in N2). The serum bottles were capped with sterile Teflon-lined stoppers, crimped with aluminium seals, and the headspaces of the cultures were exchanged with 20% CO2 in N2. The

13 cultures were amended with 6 µL (~56 µmol) of either unlabelled- or C7-labelled toluene.

Negative controls consisted of the anoxic medium to which the same amount of unlabelled or

13 C7-labelled toluene was added. Cultures were returned to the glovebag periodically to obtain samples (24 mL) by syringe. The samples were placed in sterile capped tubes, removed from the glovebag and centrifuged for 15 min at 9000 g. The resazurin indicator in the supernatant remained colourless, indicating that anoxic conditions were maintained throughout the

38

centrifugation step. Supernatants were decanted into glass vessels containing 6 M HCl in the glovebag to immediately protonate metabolites. Samples were then subjected to organic extraction with ethyl acetate outside the glovebag.

3.3.5.2 18O-labelled water.

The detection of hydroxylated products prompted us to explore the source of the oxygen

18 atom using O-H2O (97 atom%, Sigma-Aldrich). Culture fluids (15 mL) were added to serum

18 bottles containing 3 mL of medium and 2 mL of O-labelled or unlabelled H2O (sterile and anoxic) in an anoxic glovebag. Replicates for each condition were established. The headspace was exchanged with 20% CO2 in N2 and cultures were amended with 1 µL of unlabelled toluene

(9.4 µmol). Methane and toluene concentrations were monitored over time. At 60 and 85% toluene loss, 1 mL of 4 M HCl and the first aliquot of ethyl acetate were added via N2-flushed syringes through stoppered serum bottles to maintain anoxic conditions. Serum bottles were then opened and processed by organic extraction with ethyl acetate outside the glovebag. At 85% toluene loss, one unlabelled replicate was injected with 1 mL of O2 prior to acidification and organic extraction in the same manner.

In a separate experiment, toluene-degrading culture fluids (50 mL) were centrifuged at

9500 g for 10 min and the resulting pellet was washed with anoxic, reduced medium in the glovebag. Cells were pelleted again by centrifugation and resuspended in anoxic medium. The same volume of suspended cells or medium (2 mL) was added to each of four serum bottles that

18 contained 1 mL of 2x anoxic medium and 1 mL of O-labelled or unlabelled H2O (anoxic and sterile). Serum bottles were incubated in an anoxic glove bag for 48 h before being subjected to acidification and organic extraction.

39

3.3.5.3 Abiotic controls

Abiotic reactions of toluene under anaerobic conditions were examined using anoxically prepared medium or water in 20 mL serum bottle replicates containing a 20% CO2 in N2 headspace. Serum bottles were capped with butyl rubber stoppers, crimped with aluminium seals, and amended with 1 µL of unlabelled toluene. The abiotic controls were subjected to a variety of redox and chemical conditions including exposure to varying amounts of O2 (0–60%), cysteine sulfide (0–0.13%), or TiNTA as an alternative redox poising agent (0.5%) (Moench &

Zeikus, 1983), and in the presence or absence of trace metal and vitamin solutions. Most controls were prepared for extraction by adding acid and the first aliquot of ethyl acetate to the sealed serum bottle via syringe prior to opening the bottle for organic extraction (anoxic extraction). Some controls were exposed to oxygen by removing the stopper prior to acidification and ethyl acetate extraction (oxic extraction). Oxic medium was prepared by exposing anoxic medium to the atmosphere overnight.

3.3.6 Analytical procedures

Methane production was monitored using a Hewlett-Packard Model 5890 gas chromatograph (GC) with a flame ionization detector (200°C) using helium as the carrier gas and a packed stainless steel column (18″ long x 1/8″ diameter, Poropak R, 80/100, Supelco) held isothermally at 150°C. Headspace samples (0.2 ml) were removed from cultures using a syringe pre-flushed with N2/CO2 (90/10) prior to injection at 150°C. Toluene levels were determined on an Agilent 7890A model GC equipped with an Agilent 5975C mass spectrometer (GC-MS) equipped with a DB-5ms column (30 m x 0.25 internal diameter (i.d.) x 3 µm film, J&W

Scientific) using helium as

40

the carrier gas with an oven temperature of 100°C. Inlet and mass transfer line temperatures were

250°C.

For metabolite analyses, acidified supernatants (< pH 2) were extracted with three aliquots of ethyl acetate, dried over anhydrous Na2SO4, and concentrated by rotary evaporation and under a stream of N2 to a volume of 50 µL. Components in the concentrated extracts were reacted with 50 µL of N,O-bis(trimethylsilyl)trifluoroacetamide (BSTFA) (Pierce Chemical,

Rockford, IL) to form trimethylsilyl (TMS) derivatives and analysed on an Agilent GC-MS system. Derivatized components were separated either on a 20 m DB-5ms capillary column (20 m x 0.18 mm i.d. x 0.18 µm film, Agilent Technologies) or on a 30 m HP5-ms capillary column

(30 m x 0.25 mm i.d. x 0.25 µm film, Agilent Technologies) using a previously published oven temperature program (Gieg & Suflita, 2002). The inlet and mass transfer line temperatures were

270°C and 280°C respectively. Metabolite identifications were made by comparison with the GC retention times and mass spectra of authentic standards that were available from commercial sources. Hydroxybenzylsuccinic acid (TMS-derivatized) was tentatively identified by comparing mass spectral fragment ions with an authentic standard of benzylsuccinic acid (TMS-derivatized) and with published mass spectral profiles of this compound (Muller et al., 1999, Muller et al.,

2001). Identified metabolites were quantified against calibration curves prepared from the standards.

41

3.4 Results

3.4.1 Toluene bioconversion to methane

13 When unlabelled, C7-labelled toluene, or a mixture of labelled and unlabelled toluene was added to a sediment free methanogenic enrichment culture (125 mL), it was consumed at similar rates with concomitant methane accumulation (Figure 3-1). In the unlabelled incubations,

55 µmol of toluene was consumed and 196 µmol of methane was produced, representing a 79% recovery of the expected methane based on the stoichiometric equation for methanogenic toluene

- + mineralization: C7H8 + 7.5H2O → 4.5 CH4 + 2.5 HCO3 + 2.5 H (Symons & Buswell, 1933).

13 Similarly, in the C7-toluene-amended incubations, 57 µmol of toluene was consumed, and 188

µmol of methane was produced, indicating a 74% recovery of the predicted methane. The incubations containing a mixture of unlabelled and labelled toluene consumed 59 µmol of toluene and produced 190 µmol of methane, resulting in a 72% recovery of the predicted amount. Routine cultivation of the methanogenic enrichment repeatedly showed approximately

72–80% recovery of the amount of methane that was stoichiometrically predicted based on the amount of toluene added to the culture. Although not measured, the remaining carbon (25–30%) was likely incorporated into biomass with a small portion going to the formation of abiotic products and methane lost during sampling and due to adsorption to butyl rubber stoppers as has been reported in other anaerobic hydrocarbon-degrading studies (Edwards & Grbić-Galić, 1994,

Zengler et al., 1999, Jahn et al., 2005).

42

Figure 3-1. Toluene consumption (closed symbols) and methane production (open symbols) by a mixed methanogenic consortium incubated with approximately 56 µmol of 12C-toluene (triangles, ▲, Δ), 13C-toluene (squares, ■, □), or an equal mixture of the two isotopes (circles, ●, ○).

43

3.4.2 Microbial community analysis

Microbial community analysis was conducted using pyrotag sequencing of a fragment of the 16S rRNA gene (Accession No. SRX037577 in NCBI sequence read archive). The initial library contained 10 278 reads. Following the removal of low-quality and chimeric reads, 6241 high-quality reads remained comprising 173 OTUs at a 3% distance cut-off. The library consisted of 91.3% bacterial and 8.7% archaeal reads. The bacterial sequences were dominated by those belonging to the phylum Firmicutes (74.1%), followed by Chloroflexi (13.4%),

Spirochaetes (5.4%) and Proteobacteria (4.2%). The remainder of the bacterial sequences belonged to a number of other phyla (Figure 3-2, Table A-1).

Figure 3-2. Distribution of bacterial and archaeal 16S rRNA gene pyrotag sequences by phylum in toluene-degrading methanogenic consortium. Values are shown as the percentage of sequences per domain based on 5698 bacterial sequences and 543 archaeal sequences. Phyla included in ‘Other’ make up less than 0.2% of bacterial reads each and include Thermotogae (0.14%), Candidate division OP8 (0.09%), Verrucomicrobia (0.07%), Candidate division OP11 (0.04%) and Candidate division BRC1 (0.02%).

44

The bacterial taxa into which the majority of reads fell were Clostridium sp.,

Lachnospiraceae Incertae Sedis and Sedimentibacter sp., all members of the phylum Firmicutes

(Table 3-1). All archaeal sequences belonged to the phylum Euryarchaeota with the majority of reads grouping within the class Methanomicrobia (96.9%). Both hydrogenotrophic

(Methanoculleus sp. and Methanolinea sp.) and acetoclastic (Methanosaeta sp.) methanogens were present. The remaining archaeal sequences belonged to the classes Thermoplasmata (2.9%) and Methanobacteria (0.2%).

Table 3-1. Taxonomic affiliation of the ten most abundant bacterial reads in a toluene- degrading methanogenic culture. Lineage % bacterial sequences Clostridium sp. 30.7 Lachnospiraceae Incertae Sedis 23.6 Sedimentibacter sp. 15.2 Uncultured Anaerolinaceae 12.8 Desulfosporosinus sp. 3.1 Uncultured Spirochaetaceae 2.6 Desulfovibrio sp. 2.5 Spirochaeta sp. 2.4 Uncultured Synergistaceae 0.7 Uncultured Lachnospiraceae 0.6

3.4.3 Compounds detected during methanogenic toluene metabolism

Numerous compounds were detected in the culture supernatants during the course of methanogenic toluene biodegradation. The same suite of compounds was found when toluene

13 13 was supplied unlabelled or C7-labelled. Unlabelled or C-labelled benzylsuccinate and benzoate, known metabolites of anaerobic toluene biodegradation, were transiently detected in

13 the culture supernatants as toluene was consumed (Figure 3-3A; shown for C7-toluene amended cultures). The amounts of these compounds were approximately 1000-fold less than that of the starting substrate, similar to what has been observed in other anaerobic hydrocarbon metabolic

45

studies that monitored product formation (Ulrich et al., 2005, Kunapuli et al., 2008). The mass

13 spectral profiles of the C7-labelled benzylsuccinate and benzoate (as TMS derivatives) showed corresponding shifts in mass fragment ions relative to their unlabelled counterparts (Figure A-1).

Several other compounds were also transiently detected and quantified in the unlabelled and

13 C7-toluene-amended cultures including o- and m-cresol, hydroquinone (1, 4-dihydroxybenzene)

13 and methylhydroquinone (Figure 3-3B, shown for the C7-toluene-amended cultures). These other putative metabolites were detected in similar amounts as those measured for benzylsuccinate and benzoate (Figure 3-3A & B). The MS profiles of these compounds also

13 revealed a corresponding shift in fragment ions when C7-labelled toluene was supplied (Figure

A-1). In addition, we detected a compound similar to benzylsuccinate whose unlabelled and labelled MS profiles suggested that it was hydroxybenzylsuccinate based on comparisons with published mass spectra (Muller et al., 1999, Muller et al., 2001, Figure A-1). Benzylalcohol and p-cresol were also positively identified and transiently produced but could not be sufficiently chromatographically separated for accurate quantification. Cyclohexane carboxylate, pimelate and glutarate were also detected during the time-course experiments. Other compounds sought

(based on presumed degradation pathways) but not detected included benzaldehyde, 2-, 3- and 4- methylcyclohexanol, catechol (1, 2-dihydroxybenzene), methylcatechol, resorcinol (1, 3- dihydroxybenzene), methylresorcinol, 2-, 3- and 4-hydroxybenzoate, 2-, 3- and 4- hydroxybenzylalcohol, and gentisate. Although hydroxylated intermediates have been previously identified during methanogenic toluene degradation (Vogel & Grbić-Galić, 1986), they may also be produced during aerobic biodegradation (Gibson & Subramanian, 1984). Recent reports showed that hydroxylated compounds may be formed abiotically during sample processing

(Kunapuli et al., 2008). Therefore, we sought to determine the origin of the cresols,

46

hydroquinone and methylhydroquinone that transiently appeared in our metabolite experiments.

If the hydroxylated intermediates detected have a biotic origin, the most likely source of the hydroxyl group is water from culture fluids as all incubations were carried out under anoxic, highly reduced conditions. When we incubated the methanogenic consortium with toluene in the

18 presence of unlabelled or O-H2O in the medium, the same compounds were detected including benzylsuccinate, o-, m- and p-cresol, hydroquinone, methylhydroquinone, benzoic acid and cyclohexane carboxylate. However, we did not observe any evidence for the incorporation of the

18 18 O label in the MS profiles for any of the compounds in the O-H2O amended incubations.

18 Similarly, when washed cells were incubated with toluene and O-H2O, the cresols, hydroquinone and methylhydroquinone were again detected but the MS profiles of the compounds did not reveal evidence for 18O incorporation (data not shown). Further, the cresols, hydroquinone and methylhydroquinone were also detected in the associated abiotic controls. In a culture where 1 mL of O2 was added prior to extraction at 80% toluene consumption, somewhat higher levels of hydroxylated compounds were observed than other cultures extracted at the same time point. Such results demonstrate that the hydroxyl group did not originate from water and that these compounds may be formed abiotically, possibly from exposure to air during extraction steps. Benzylsuccinate was only detected in biotic incubations with toluene in the washed cell experiments.

47

Figure 3-3. Formation of putative metabolites by a mixed methanogenic consortium 13 incubated with C7-toluene showing A) the loss of toluene coupled with the transient accumulation of benzylsuccinate and benzoate and B) these putative metabolites and other hydroxylated compounds that also transiently appeared during the time-course experiments. HQ, hydroquinone; MeHQ, methylhydroquinone.

48

3.4.4 Abiotic controls

In determining the origin of the hydroxylated compounds detected during the methanogenic toluene time-course experiments, it was important to rule out that the compounds were contaminants of the chemicals or the water used for the metabolism experiments. When the toluene stock, the derivatization reagent (BSTFA), and the ethyl acetate used for organic extractions were analysed by GC-MS, none showed the presence of the hydroxylated compounds. Further, when water or medium was processed through the organic extraction protocol for GC-MS analysis, the hydroxylated products were not detected. Thus, a series of abiotic experiments with toluene in the presence or absence of oxygen, reductants and potential oxidizing medium components was carried out to pinpoint how such compounds could form abiotically. Abiotic control samples were extracted under oxic conditions, by opening serum bottles prior to the addition of acid or ethyl acetate, or under anoxic conditions, by adding acid and the first aliquot of ethyl acetate by syringe prior to opening serum bottles. When oxic medium containing toluene was extracted, no hydroxylated compounds were observed.

However, when anoxic medium containing toluene was extracted under oxic conditions, o-, m- and p-cresol were detected at levels ranging from 8.5 to 15.1 nmol. Cresols were not detected in abiotic controls of anoxic medium incubated with toluene for 24 h when acid and the first aliquot of ethyl acetate were added through the stopper via syringe. In light of this, a series of abiotic controls were carried out to examine the abiotic reactions of toluene when modifying oxygen and sulfide concentrations, the presence of vitamin and metal solutions and the redox poising agent

(Table 3-2). When anoxic medium or water was exposed to oxygen prior to extraction, hydroxylated species were detected including cresols, hydroquinone (but not catechol nor resorcinol) and methylhydroquinone. Later, it was observed that when abiotic controls were

49

incubated for periods of a week or more, trace levels of cresols, hydroquinone and methylhydroquinone were observed even when acid and the first aliquot of ethyl acetate were added in the glovebag. The removal of medium components such as trace metals and vitamins did not alter the results and at least trace levels of hydroxylated compounds were always observed. When medium was prepared anoxically but was not reduced with cysteine sulfide, hydroxylated products were not observed even if bottles were opened prior to the addition of acid. In light of this, an alternative redox poising agent, titanium nitrilotriacetate (TiNTA) was used to reduce abiotic medium (Moench & Zeikus, 1983). In medium containing TiNTA as a reductant, no hydroxylated products were observed regardless of whether the bottles were opened prior to the addition of acid. It was therefore determined that an interaction between cysteine sulfide and toluene, which is exacerbated by exposure to oxygen, results in the formation of hydroxylated species including cresols, hydroquinone and methylhydroquinone.

The mechanism by which this occurs is unknown.

Table 3-2. Abiotic controls showing reactions of toluene under different redox conditions Treatment Oxic extraction Anoxic extraction Cresols HQ/MHQ Cresols HQ/MHQ Anoxic medium + sulfide (50-400 µL) + + - - Anoxic water + sulfide (50-400 µL) + + - - Anoxic medium + oxygen (50 µL-1 mL) + + + + Anoxic water + oxygen (50 µL-1 mL) + + + + Anoxic medium, no vitamins + + - - Anoxic medium, no metals + + - - Anoxic medium (no sulfide) - - - - Anoxic medium + TiNTA - - - - HQ, hydroquinone; MHQ, methylhydroquinone

50

3.4.5 Detection of benzylsuccinate synthase gene

A single 943-base-pair fragment that showed homology to known benzylsuccinate synthase alpha subunit gene sequences (Accession No. JN210553.1) was obtained using previously published primer sequences designed to detect benzylsuccinate synthase genes in a methanogenic toluene-degrading enrichment (Washer & Edwards, 2007). Neighbour-joining trees revealed that the benzylsuccinate synthase fragment recovered from this culture is most closely related to a putative bssA gene in an organism belonging to the class Clostridia recovered from an iron-reducing, benzene degrading culture (Abu Laban et al., 2010, Figure 4). Also of interest is that bssA genes from different environments appear to group with organisms that are more phylogenetically rather than geographically similar (i.e. from the same environment) which may indicate that horizontal gene transfer does not occur as readily as previously thought for this gene (Winderl et al., 2007) although trees containing longer and larger numbers of bssA fragments should be constructed before this can be demonstrated conclusively.

51

Figure 3-4. Neighbour-joining cladogram showing the affiliation of a bssA gene fragment from a methanogenic toluene degrading culture with previously published bssA sequences. The tree was constructed using nucleotide sequences of aligned partial bssA genes of about 650 bp using PHYLIP. Bootstrapping was performed in seqboot using 100 datasets and distance matrices were calculated using dnadist. Sequences were clustered using neighbour and consense was used to select a consensus tree. Pyruvate formate lyase from Clostridium beijerinckii was used to root the tree.

52

3.5 Discussion

The anaerobic degradation of toluene has been observed in the presence of electron acceptors such as nitrate, Fe(III) and sulfate, but reports under methanogenic conditions are more scarce. Thus far, there has only been one report describing the microbial community members potentially involved in methanogenic toluene metabolism (Ficker et al., 1999). Here, using 16S rRNA gene pyrotag sequencing, we describe a new methanogenic culture enriched from a gas condensate- contaminated aquifer that has been maintained on toluene for many transfers.

Despite the enrichment process, the microbial diversity that remains is noteworthy. Across the bacterial and archaeal kingdoms, the pyrotag reads were classified into 173 OTUs at a 3% distance cut-off. Within the Bacteria, 16S rRNA gene pyrotags belonging to 12 phyla were identified. The vast majority of the bacterial 16S rRNA gene reads (74.1%) and 5 of the 10 most predominant lineages belong to the order Clostridiales (Table 3-1). Due to their overwhelming predominance in the culture, it is hypothesized that the Clostridiales are involved in the direct attack on toluene. Several recent studies have suggested an important role for the low G+C Firmicutes in the anaerobic metabolism of hydrocarbons. Using DNA-SIP of contaminated aquifer sediments amended with

13 13 C7-toluene, Winderl and colleagues (2010) observed C labelling of DNA belonging to the genera Desulfotomaculum and Desulfosporosinus. From the same contaminated aquifer,

Morasch and colleagues (2004) isolated a sulfate reducer capable of toluene degradation belonging to the genus Desulfotomaculum. Although these studies were conducted under sulfate- reducing conditions, anaerobic microbes are known to be metabolically diverse with respect to the electron acceptors utilized. Since sulfate reduction and methanogenesis occur at similar redox conditions, it is possible that the same organisms are initiating toluene attack under both

53

conditions. For example, a toluene degrading isolate belonging to the Desulfosporosinus genus was capable of reducing arsenate, sulfate, thiosulfate, nitrate and ferric iron (Liu et al., 2004).

Organisms from the Desulfotomaculum genus have been characterized as both sulfate reducers and syntrophs and are found in high abundance in methanogenic environments. Interestingly, members of the Desulfotomaculum subcluster Ih are obligate syntrophs that appear to have lost the ability to reduce sulfate (Imachi et al., 2006). Additionally, the bssA fragment amplified from our enrichment culture was most closely related to a putative bssA gene from an organism belonging to the class Clostridia from a benzene-degrading iron-reducing culture. This, along with the abundance of Clostridiales in this enrichment, suggests that these organisms may be involved in the activation of toluene in this culture.

Relative to what is known about hydrocarbon metabolic pathways used by sulfate and nitrate reducers, detailed studies on the pathways of methanogenic hydrocarbon metabolism are more scarce. Early studies implicated methyl group oxidation (Edwards et al., 1994) and/or ring oxidation (Grbić-Galić & Vogel, 1987) as toluene activation mechanisms under methanogenic conditions. The former culture was maintained as a highly purified enrichment for several years and was later shown to harbour benzylsuccinate synthase activity (Beller & Edwards, 2000) and benzylsuccinate synthase genes (Washer & Edwards, 2007), confirming that at least one member of the syntrophic enrichment activates toluene by fumarate addition. We also detected

13 benzylsuccinate as a metabolite formed during unlabelled and C7-labelled toluene metabolism by our enriched methanogenic culture derived from a gas condensate-contaminated aquifer

(Figure 3-3 & A-1) supporting evidence for this pathway under methanogenic conditions. The identification of a bssA gene sequence in the consortium augments the metabolite finding.

Benzylsuccinate is presumably metabolized further to benzoate and other downstream

54

metabolites such as cyclohexane carboxylate, pimelate and glutarate (Harwood et al., 1998), as these were also found in the culture fluids during the time-course experiments (data not shown).

Hydroxylated intermediates such as the cresols are produced by the action of O2- requiring monooxygenases in toluene-degrading aerobes (Gibson & Subramanian, 1984). Recent evidence also suggests that alcohols are formed from alkanes under nitrate-reducing conditions due to activation by a monoxygenase using oxygen formed in a nitrite or nitric oxide dismutation reaction (Zedelius et al., 2011). Under methanogenic conditions, Vogel and Grbić-Galić (1986) found that toluene oxidation to p-cresol under methanogenic conditions occurred via the addition

18 of water to the aromatic ring (in O-H2O amended experiments). However, in all incubations

18 18 described here using O-H2O, the hydroxylated species detected were not O-labelled, suggesting that water is not the source of the hydroxyl group in this reaction in our culture.

Additionally, hydroxylated species were observed when anoxic medium containing toluene and cysteine sulfide was exposed to oxygen prior to extraction. In studies examining the anaerobic decay of benzene under numerous electron-accepting conditions, including methanogenesis, phenol was reported as a putative metabolite (Grbić-Galić & Vogel, 1987, Weiner & Lovley,

1998, Caldwell & Suflita, 2000, Ulrich et al., 2005). A recent study of benzene biodegradation under iron-reducing conditions revealed that phenol is formed abiotically rather than biologically during exposure to oxygen during sampling (Kunapuli et al., 2008). In the study, phenol was produced at an unusually high concentration, and it was postulated that the reaction of ferrous iron with oxygen formed hydroxyl radicals that reacted with benzene to form phenol abiotically.

The presence of hydroxylated species including cresols, hydroquinone and methylhydroquinone in abiotic controls in the present study indicates that hydroxylated species can be formed at these low redox levels and that their origin is not (solely) biological. The absence of hydroxylated

55

species in abiotic incubations in anoxic medium lacking cysteine sulfide indicates that cysteine sulfide plays a role in the abiotic formation of these compounds although the mechanism by which this occurs is currently unknown. Our results indicate that care needs to be taken when extracting highly reduced, anaerobic cultures. As much as possible, exposure to oxygen must be minimized, and even then, the origin of compounds observed in metabolite analysis should be confirmed using isotope labelling studies and functional gene analysis (when possible) to characterize the enzymatic mechanisms by which these compounds arise.

Thus, in this study, only benzylsuccinate can be confirmed as a veritable metabolite as it

13 13 was observed to be C labelled in incubations with C7- toluene, and was never observed in abiotic controls. In addition, a bssA gene fragment was amplified from this enrichment culture, supporting fumarate addition as a key mechanism for toluene degradation under methanogenic conditions (Beller & Edwards, 2000). A proposed model for the metabolism of toluene in this methanogenic enrichment culture is that toluene is activated by fumarate addition and subsequently degraded by members of the Firmicutes into simpler organic acids which act as substrates for fermentative and acetogenic syntrophs belonging primarily to the

Chloroflexi, Spirochaetes and Proteobacteria. These organisms in turn produce H2, CO2 and acetate which are subsequently degraded by hydrogenotrophic (Methanoculleus sp. and

Methanolinea sp.) and acetoclastic (Methanosaeta sp.) methanogens into methane. Ongoing metagenomic analysis and stable isotope probing work will provide further insight into the role of the Clostridiales during toluene metabolism by this methanogenic culture.

56

3.6 Acknowledgments

This work was partially supported by NSERC Discovery and Genome Canada grants awarded to L.M.G., through an NSERC Alexander Graham Bell Canada Graduate Scholarship to

S.J.F., and by an NSF grant awarded to J.M.S. and L.M.G. We thank Neil Q. Wofford for help in the preparation of some of the figures.

3.7 References

Abu Laban N, Selesi D, Rattei T, Tischler P & Meckenstock RU (2010) Identification of enzymes involved in anaerobic benzene degradation by a strictly anaerobic iron-reducing enrichment culture. Environ Microbiol 12: 2783-2796.

Achong GR, Rodriguez AM & Spormann AM (2001) Benzylsuccinate synthase of Azoarcus sp. strain T: Cloning, sequencing, transcriptional organization, and its role in anaerobic toluene and m-xylene mineralization. J Bacteriol 183: 6763-6770.

Beller HR & Spormann AM (1997) Anaerobic activation of toluene and o-xylene by addition to fumarate in denitrifying strain T. J Bacteriol 179: 670-676.

Beller HR & Edwards EA (2000) Anaerobic toluene activation by benzylsuccinate synthase in a highly enriched methanogenic culture. Appl Environ Microbiol 66: 5503-5505.

Biegert T, Fuchs G & Heider F (1996) Evidence that anaerobic oxidation of toluene in the denitrifying bacterium Thauera aromatica is initiated by formation of benzylsuccinate from toluene and fumarate. Eur J Biochem 238: 661-668.

Bryant M & Robinson I (1961) An improved non selective culture medium for ruminal bacteria and its use in determining diurnal variation in numbers of bacteria in the rumen. J Dairy Sci 44: 1446-1456.

Caldwell ME & Suflita JM (2000) Detection of phenol and benzoate as intermediates of anaerobic benzene biodegradation under different terminal electron-accepting conditions. Environ Sci Technol 34: 1216-1220.

Callaghan AV, Morris BEL, Pereira IAC, et al. (2012) The genome sequence of Desulfatibacillum alkenivorans AK-01: A blueprint for anaerobic alkane oxidation. Environ Microbiol 14: 101-113.

57

Chakraborty R & Coates JD (2004) Anaerobic degradation of monoaromatic hydrocarbons. Appl Microbiol Biotechnol 64: 437-446.

Coschigano PW, Wehrman TS & Young LY (1998) Identification and analysis of genes involved in anaerobic toluene metabolism by strain T1: Putative role of a glycine free radical. Appl Environ Microbiol 64: 1650-1656.

Dean BJ (1985) Recent findings on the genetic toxicology of benzene, toluene, xylenes and phenols Mutat Res 154: 153-181.

Dietz S, Flora JD, Strenio JF & Vincent CJ (1986) Underground motor fuel storage tanks: A national survey. US Environmental Protection Agency Office of Toxic Substances, Washington D.C., USA.

Edwards EA & Grbić-Galić D (1994) Anaerobic degradation of toluene and o-xylene by a methanogenic consortium. Appl Environ Microbiol 60: 313-322.

Edwards EA, Edwards AM & Grbić-Galić D (1994) A method for detection of aromatic metabolites at very low concentrations - Application to detection of metabolites of anaerobic toluene degradation. Appl Environ Microbiol 60: 323-327.

Felsenstein J (1993) PHYLIP (Phylogeny Inference Package) Version 3.5c. University of Washington, Seattle.

Ficker M, Krastel K, Orlicky S & Edwards E (1999) Molecular characterization of a toluene- degrading methanogenic consortium. Appl Environ Microbiol 65: 5576-5585.

Gibson DT & Subramanian V (1984) Microbial degradation of aromatic hydrocarbons. Microbial degradation of organic compounds,(Gibson DT, ed) pp. 181-252. Marcel-Dekker, New York, USA.

Gieg LM & Suflita JM (2002) Detection of anaerobic metabolites of saturated and aromatic hydrocarbons in petroleum-contaminated aquifers. Environ Sci Technol 36: 3755-3762.

Gieg LM & Suflita JM (2005) Metabolic indicators of anaerobic hydrocarbon biodegradation in petroleum-laden environments. Petroleum Microbiology,(Ollivier B & Magot M, eds) pp. 337- 356. ASM Press, Washington D.C., USA.

Gieg LM, Kolhatkar RV, McInerney MJ, Tanner RS, Harris SH, Sublette KL & Suflita JM (1999) Intrinsic bioremediation of petroleum hydrocarbons in a gas condensate-contaminate aquifer. Environ Sci Technol 33: 2550-2560.

Grbić-Galić D & Vogel TM (1987) Transformation of toluene and benzene by mixed methanogenic cultures. Appl Environ Microbiol 53: 254-260.

58

Harwood CS, Burchhardt G, Herrmann H & Fuchs G (1998) Anaerobic metabolism of aromatic compounds via the benzoyl-CoA pathway. FEMS Microbiol Rev 22: 439-458.

Heider J (2007) Adding handles to unhandy substrates: anaerobic hydrocarbon activation mechanisms. Curr Opin Chem Biol 11: 188-194.

Huse SM, Huber JA, Morrison HG, Sogin ML & Mark Welch D (2007) Accuracy and quality of massively parallel DNA pyrosequencing. Genome Biol 8: R143.

Imachi H, Sekiguchi Y, Kamagata Y, Loy A, Qiu YL, Hugenholtz P, Kimura N, Wagner M, Ohashi A & Harada H (2006) Non-sulfate-reducing, syntrophic bacteria affiliated with Desulfotomaculum cluster I are widely distributed in methanogenic environments. Appl Environ Microbiol 72: 2080-2091.

Jahn MK, Haderlein SB & Meckenstock RU (2005) Anaerobic degradation of benzene, toluene, ethylbenzene, and o-xylene in sediment-free iron-reducing enrichment cultures. Appl Environ Microbiol 71: 3355-3358.

Kunapuli U, Griebler C, Beller HR & Meckenstock RU (2008) Identification of intermediates formed during anaerobic benzene degradation by an iron-reducing enrichment culture. Environ Microbiol 10: 1703-1712.

Leuthner B, Leutwein C, Schulz H, Horth P, Haehnel W, Schiltz E, Schagger H & Heider J (1998) Biochemical and genetic characterization of benzylsuccinate synthase from Thauera aromatica: a new glycyl radical enzyme catalysing the first step in anaerobic toluene metabolism. Mol Microbiol 28: 615-628.

Liu A, Garcia-Dominguez E, Rhine ED & Young LY (2004) A novel arsenate respiring isolate that can utilize aromatic substrates. FEMS Microbiol Ecol 48: 323-332.

Moench TT & Zeikus JG (1983) An improved preparation method for a Titanium (III) media reductant. J Microbiol Methods 1: 199-202.

Morasch B, Schink B, Tebbe CC & Meckenstock RU (2004) Degradation of o-xylene and m- xylene by a novel sulfate-reducer belonging to the genus Desulfotomaculum. Arch Microbiol 181: 407-417.

Muller JA, Galushko AS, Kappler A & Schink B (1999) Anaerobic degradation of m-cresol by Desulfobacterium cetonicum is initiated by formation of 3-hydroxybenzylsuccinate. Arch Microbiol 172: 287-294.

Muller JA, Galushko AS, Kappler A & Schink B (2001) Initiation of anaerobic degradation of p- cresol by formation of 4-hydroxybenzylsuccinate in Desulfobacterium cetonicum. J Bacteriol 183: 752-757.

59

Phelps CD, Zhang ZM & Young LY (2001) Use of stable isotopes to identify benzoate as a metabolite of benzene degradation in a sulphidogenic consortium. Environ Microbiol 3: 600-603.

Pruesse E, Quast C, Knittel K, Fuchs BM, Ludwig WG, Peplies J & Glockner FO (2007) SILVA: A comprehensive online resource for quality checked and aligned ribosomal RNA sequence data compatible with ARB. Nucleic Acids Res 35: 7188-7196.

Rios-Hernandez LA, Gieg LM & Suflita JM (2003) Biodegradation of an alicyclic hydrocarbon by a sulfate-reducing enrichment from a gas condensate-contaminated aquifer. Appl Environ Microbiol 69: 434-443.

Sakai N, Kurisu F, Yagi O, Nakajima F & Yamamoto K (2009) Identification of putative benzene-degrading bacteria in methanogenic enrichment cultures. J BioSci Bioeng 108: 501-507.

Schloss PD & Westcott SL (2011) Assessing and improving methods used in operational taxonomic unit-based approaches for 16S rRNA gene sequence analysis. Appl Environ Microbiol 77: 3219-3226.

Symons G & Buswell A (1933) The methane fermentation of carbohydrates. J Am Chem Soc 55: 2028-2036.

Thompson JD, Higgins DG & Gibson TJ (1994) Clustal-W - Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22: 4673-4680.

Ulrich AC, Beller HR & Edwards EA (2005) Metabolites detected during biodegradation of 13 C6-benzene in nitrate-reducing and methanogenic enrichment cultures. Environ Sci Technol 39: 6681-6691.

Vogel T & Grbić-Galić D (1986) Incorporation of oxygen from water into toluene and benzene during anaerobic fermentative transformation. Appl Environ Microbiol 52: 200-202.

Washer CE & Edwards EA (2007) Identification and expression of benzylsuccinate synthase genes in a toluene-degrading methanogenic consortium. Appl Environ Microbiol 73: 1367-1369.

Weiner JM & Lovley DR (1998) Rapid benzene degradation in methanogenic sediments from a petroleum-contaminated aquifer. Appl Environ Microbiol 64: 1937-1939.

Widdel F, Boetius A & Rabus R (2006) Anaerobic biodegradation of hydrocarbons including methane. The Prokaryotes Vol. 2: Ecophysiology and Biochemistry (Dworkin M, Falkow S, Rosenberg E, Schleifer KH & Stackebrandt E, eds) pp. 1028-1049. Springer Sci + Business Media LLC, New York.

60

Winderl C, Schaefer S & Lueders T (2007) Detection of anaerobic toluene and hydrocarbon degraders in contaminated aquifers using benzylsuccinate synthase (bssA) genes as a functional marker. Environ Microbiol 9: 1035-1046.

Winderl C, Penning H, von Netzer F, Meckenstock RU & Lueders T (2010) DNA-SIP identifies sulfate-reducing Clostridia as important toluene degraders in tar-oil-contaminated aquifer sediment. ISME J 4: 1314-1325.

Zedelius J, Rabus R, Grundmann O, et al. (2011) Alkane degradation under anoxic conditions by a nitrate-reducing bacterium with possible involvement of the electron acceptor in substrate activation. Environ Microbiol Rep 3: 125-135.

Zengler K, Richnow HH, Rossello-Mora R, Michaelis W & Widdel F (1999) Methane formation from long-chain alkanes by anaerobic microorganisms. Nature 401: 266-269.

61

Preface

Chapter 4 presents the results of RNA-stable isotope probing (SIP) and qRT-PCR experiments aimed at identifying key organisms incorporating carbon from toluene in the toluene degrading culture introduced in Chapter 3. This chapter draws on community analysis results obtained in Chapter 3 to aid in hypothesis development and experimental design. In Chapter 3, the microbial community of the toluene degrading methanogenic culture was characterized and the dominant organisms present were identified. However, we were not able to glean any information as to the identity of key hydrocarbon degrading organisms or the roles of the diverse

13 organisms that were identified. Using RNA-SIP with C7-toluene, organisms in the culture that incorporate carbon from toluene including putative hydrocarbon activating organisms were identified. Using qRT-PCR changes in the activity of specific taxa in response to toluene exposure were monitored.

62

Chapter Four: Identification of toluene degraders in a methanogenic enrichment culture

S. Jane Fowler1, Maria-Luisa Gutierrez-Zamora2, Mike Manefield2, Lisa M. Gieg1

1Department of Biological Sciences, University of Calgary, 2500 University Drive N.W.,

Calgary, Alberta Canada T2N 1N4

2Centre for Marine Bio-Innovation, University of New South Wales, Sydney, Australia 2052

Status: In revision for FEMS Microbiology Ecology

63

4.1 Abstract

Methanogenic biodegradation involves the cooperative metabolism of syntrophic bacteria that catalyze the initial attack and subsequent degradation of hydrocarbons, and methanogens that convert intermediates such as hydrogen and carbon dioxide, formate, and/or acetate to methane. The identity of syntrophic microbes and the nature of their interactions with other syntrophs and methanogens are not well understood. Furthermore, it is difficult to isolate the organisms responsible for the initial activation and subsequent degradation of hydrocarbon substrates under methanogenic conditions due to the thermodynamic relationships that exist among microbes in methanogenic communities. We used time-resolved RNA stable isotope probing and qRT-PCR to identify the organisms involved in the initial attack on toluene and subsequent degradation reactions in a highly enriched toluene-degrading methanogenic culture.

Our results reveal the importance of a Desulfosporosinus sp. in anaerobic toluene activation in the culture, and also point to a role for a Desulfovibrionales and Syntrophaceae in downstream methanogenic toluene metabolism. In addition, the high bacterial diversity observed in this culture and the extensive labelling of different phylogenetic groups that occurred over the course of the experiment highlight the complexity of the relationships that exist in methanogenic ecosystems.

4.2 Introduction

Hydrocarbons are found naturally in the deep subsurface, however, widespread contamination of shallow subsurface environments with hydrocarbons has led to regulatory concerns due to negative impacts on human and ecosystem health. Monoaromatic hydrocarbons such as BTEX (benzene, toluene, ethylbenzene and xylenes) are of particular concern due to

64

their toxicity and relatively high solubility in water (Dean, 1985). While these compounds can be readily degraded aerobically, hydrocarbon spills into the subsurface result in anoxic conditions.

Thus, in such environments, hydrocarbon degradation must occur anaerobically, a process that is less well understood. To facilitate the development of in situ bioremediation technologies, a detailed understanding of the processes and the organisms involved in anaerobic hydrocarbon metabolism is imperative.

Toluene is a model compound for anaerobic hydrocarbon degradation and can be oxidized anaerobically coupled to the reduction of nitrate, iron(III), sulfate, manganese and chlorine anoxyions, as well as under anoxygenic phototrophic and methanogenic conditions

(Widdel et al., 2006; Heider, 2007). Several isolates have been obtained that are capable of anaerobic toluene degradation, however no bacteria involved in methanogenic toluene metabolism have been isolated (Cupples, 2011). In environments where metabolism is governed by syntrophic processes it can be difficult to isolate the organisms responsible for the activation and subsequent degradation of a substrate. This is often the case in methanogenic environments where individual organisms can rarely be purified due to the thermodynamically interdependent relationship between the syntrophic bacteria that catalyze the initial attack and subsequent degradation of a substrate and the methanogens that produce the end product, methane.

Desulfatibacillum alkenivorans AK-01 is the single isolate known to methanogenically degrade a hydrocarbon substrate (hexadecane) in co-culture with a methanogen (Callaghan et al., 2012).

Previously, we described a methanogenic toluene degrading culture derived from a gas- condensate contaminated aquifer (Fowler et al., 2012). This culture completely mineralizes toluene to methane using fumarate addition as the hydrocarbon activating mechanism. The consortium contains a diverse community consisting primarily of Firmicutes, Chloroflexi,

65

Spirochaetes, Deltaproteobacteria and acetoclastic and hydrogenotrophic methanogens as determined using 16S rRNA gene pyrotag sequencing (Fowler et al., 2012). These results are in line with a previous study which found the presence of Firmicutes, Deltaproteobacteria and acetoclastic and hydrogenotrophic methanogens in a different methanogenic toluene degrading enrichment culture (Ficker et al., 1999). The organism(s) carrying out the initial attack on toluene was not identified in either study, although Fowler et al., (2012) hypothesized, based on sequence abundance, that a member of the Clostridiales was a key toluene degrader. Recent

DNA-SIP studies carried out on methanogenic hydrocarbon degrading cultures have implicated members of the Syntrophaceae (benzene and hexadecane) and Peptococcaceae (toluene) in hydrocarbon activation (Sakai et al., 2009; Cheng et al., 2013; Sun et al., 2014). In this study,

13 we employed time-resolved RNA-SIP using C7-toluene in order to follow the flow of isotope label through the culture and identify the bacteria carrying out the initial attack and subsequent degradation of toluene. The activity of the key bacteria identified in RNA-SIP analysis was then examined using qRT-PCR to confirm their roles in methanogenic toluene metabolism in this culture.

4.3 Materials and Methods

4.3.1 Culture incubations

A sediment-free toluene-degrading methanogenic culture originally enriched from a gas condensate-contaminated aquifer was used in this study. The culture has been maintained by routine transfer and substrate amendment with toluene as the sole electron donor under methanogenic conditions for over ten years (Fowler et al., 2012). For stable isotope probing experiments, 20 mL cultures were prepared anoxically in 40-mL serum bottles and were sealed

66

13 with butyl rubber stoppers. Cultures were incubated with 1 L (9.4 µmol) C7-labelled toluene

(99%, Sigma-Aldrich) or unlabelled toluene (Aldrich) and were sampled at days 1, 3 and 7. At

12 each time point, two bottles were sacrificed for RNA extraction, one incubated with C7-toluene

13 and one incubated with C7-toluene.

4.3.2 RNA extraction, density gradient centrifugation and fractionation

RNA was extracted using the Qiagen AllPrep DNA/RNA mini kit with bead beating. Pelleted cells were added to a 2-mL tube containing 0.3 g of 0.1 mm and 0.1 g of 0.5 mm zirconia/silica beads (BioSpec Products) and 400 µL of buffer RLT Plus. Cells were disrupted by bead beating for 1 min at 6.0 m/s. The extraction was then carried out according to the manufacturer’s protocol. To separate 12C-RNA and 13C-RNA, 129 ng of RNA was added to

2.8 mL of cesium trifluoroacetate (GE Healthcare), and 119 µL of formamide (Sigma) to a total volume of 3.5 mL. Density gradients were formed by centrifugation at 40 000 rpm (20°C) for 44 hours as described (Zemb et al., 2012). Gradients were fractionated into 16 x 200 µL fractions by displacement at 0.2 mL/min. The density of fractions was determined by weighing 100 µL aliquots (Zemb et al., 2012).

4.3.3 RNA precipitation, quantification, reverse transcription and amplification

RNA was recovered from each fraction by isopropanol precipitation and was quantified using Quant-iT Ribo-Green RNA reagent (Invitrogen). Fractions 1-10 from all gradients were reverse transcribed. Fractions 11-16 were not analysed further as they did not contain substantial amounts of RNA. RNA was denatured (65˚C, 5 min) with bacterial 16S rRNA gene primer 530R

(0.8 µM) (Table 4-1) then AMV reverse transcriptase (10 U, Promega), 5x Tris-HCl reaction

67

buffer and deoxynucleotides (2 mM each) were added and tubes were incubated at 37˚C for 1 hour in a 25 µL sample volume.

PCR amplification of cDNA was carried out using bacterial 16S rRNA gene primers

530R and GC338F (5’-

CGCCCGCCGCGCCCCCGCCCCGGCCCGCCGCCCCCGCCCACTCCTACGGGAGGCAG

C-3’) to amplify the V3 region, at the following conditions: 95˚C 2 min, 30 cycles of 95˚C 30 s,

62˚C 30 s, 72˚C 1.5 min; and 72˚C 10 min.

4.3.4 Denaturing gradient gel electrophoresis

DGGE was carried out as described previously (Shartau et al., 2010). Briefly, 200-250 ng of cDNA was loaded onto a 6.5% (w/v) polyacrylamide gel with a 40-75% denaturing gradient of urea and formamide. Gels were run at 75 V, 60 ˚C for 16 h and were stained with SYBR

Green (Invitrogen). Bands were visualized and excised under UV light and incubated in 50 µL

Tris-EDTA buffer overnight. Pelleted bands (18 000 g, 5 min) were used as a template for re- amplification with bacterial 16S rRNA gene primers 338F and 530R (Table 4-1). The program used was as above with an annealing temperature of 55˚C. Amplicons were purified using the

Qiaquick Gel Extraction Kit (Qiagen).

4.3.5 Sequencing and phylogenetic analysis

Purified amplicons were sequenced at the UCDNA laboratory on an Applied

Biosystems 3730xl 96 capillary genetic analyzer (University of Calgary, Canada). Chimeric sequences were screened for using Mallard 1.02 (Ashelford et al., 2006). No chimeras were identified. Sequences were compared to the NCBI NR database using BLASTN to determine

68

taxonomic affiliation. Sequences were submitted to GenBank and have been assigned accession numbers JX171701 - JX171735.

Multiple sequence alignments of 16S rRNA sequences from DGGE bands, and 16S rRNA gene sequences from closely related cultured organisms and related organisms or clones associated with anaerobic hydrocarbon metabolism were made in T-coffee (Notredame et al.,

2000). Bootstrapped maximum likelihood trees were made in PHYLIP (Felsenstein, 1993).

4.3.6 Quantification of key organisms identified in RNA-SIP

For qRT-PCR experiments, 10 mL incubations were prepared from a single culture that had been amended with 0.01% peptone (in addition to toluene) to enhance growth. Cultures that were deemed free of toluene for 14 days were incubated with 1 µL of unlabelled toluene and were sacrificed in triplicate by centrifugation at 12,000 g for 10 minutes for DNA and RNA extraction on days 1, 3, 8, and 20. Replicate cultures that were not exposed to toluene were similarly sacrificed. RNA was subject to DNaseI treatment (Invitrogen) and purification with the

Zymoresearch Clean and Concentrate-5 kit (Zymoresearch). RNA samples were reverse transcribed using SuperscriptIII (Invitrogen) and cDNA was treated with RNAse H according to the manufacturer’s protocol (Invitrogen). cDNA samples were then subject to qRT-PCR analysis using taxon-specific and bssA gene primers and total rRNA genes were quantified using universal bacteria 16S rRNA gene primers (Table 4-1).

4.3.7 Primer selection, design and optimization and qRT-PCR

Primers targeting the genera Desulfosporosinus, Clostridium, Desulfovibrio and

Syntrophus were sought in the literature and were tested and optimized using DNA from the

69

toluene degrading culture (Table 4-1). In the case that amplification with published primer sets was unsuccessful, primers were modified based on existing sequence data from the culture

(Fowler et al., 2012). Due to the inability of pre-existing primer sets to efficiently amplify bssA in this culture, new primers were designed in Primer3 to target bssA using sequence data from the culture (Fowler et al., 2012). Newly designed primers were screened against the NCBI NR database to test for non-specific binding. All primer sets were optimized by performing temperature gradients using conventional PCR. To generate standards for quantification, amplicons generated using optimized primer sets were cloned using the Topo TA cloning kit

(Invitrogen) and were transformed into E. coli. Positive transformants were selected and grown in 5 mL of LB medium. Plasmid DNA was extracted using the Qiagen Miniprep kit and was sequenced (Eurofins, Louisville, KY, USA). Insert sequences were compared to the NCBI NR database to ensure that the appropriate fragment had been amplified. Plasmid DNA was diluted from 102 to 109 copies/uL and was used to generate standard curves. Slopes of the standard curves ranged from -3.29 to -3.43 with efficiencies ranging from 95.7- 99.7%.

qRT-PCR and qPCR reactions were carried out in triplicate in 10-µL reactions consisting of 500 nM of each primer, 2x EvaGreen Supermix (Bio-Rad) and 1 µL of template DNA in a

C1000 thermocycler (Bio-Rad) under the following thermocycling conditions: 95˚C 3 min, 40 cycles of 95˚C 20 s, 25 s at the optimized annealing temperature (Table 4-1), followed by melt curve analysis. This procedure was slightly altered when the Syntrophus primers were used due to the larger amplicon size generated by these primers: 95˚C 3 min, 40 cycles of 95˚C 20 s, 57°C

35 s followed by melt curve analysis. Melt curve analysis revealed the presence of a small primer dimer peak in no template control samples of bssA and universal bacterial primers. A single dominant peak was seen for each primer, though peaks were often slightly wider in community

70

DNA samples than in standards, which likely reflects the presence of greater than one phylotype of each organism in community DNA. The bacterial universal primers exhibited a substantially wider peak than taxon-specific primers, likely reflecting the greater sequence diversity of these amplicons.

Table 4-1. Primers used in this study Name Sequence (5’-3’) Gene target Amplicon Optimized Reference (forward/ size (bp) Tanneal reverse) (°C) Bac 338F ACTCCTACGGGAGG 16S rRNA 131-202* 55 Whiteley et CAGC Bacteria al., 2000 (F) Bac 530R GTATTACCGCGGCTG Lane 1991 CTG (R) Clos16SF AGCGTTGTCCGGATT 16S rRNA 182 52 Wang et al., TACTG Clostridium 2008 (F) ClosTol16SR TTCGCCACTGGTGTT spp. This study CCTCC (R) Dsp603F TGTGAAAGATCAGG 16S rRNA 218 57 Pester et al., GCTCA Desulfospor- 2010 Dsp821R CCTCTACACCTAGCA sinus spp. CTC Dsv691F CCGTAGATATCTGGA 16S rRNA 135 62 Fite et al., GGAACATCAG Desulfovibrio 2004 Dsv826R ACATCTAGCATCCAT spp. CGTTTACAGC Syn827F TTCACTAGGTGTTGR 16S rRNA 436 57 Gray et al., GRG Syntrophus 2011 Syn1263R CTCTTTGTRCCRCCC and Smithella ATT spp. MBssA1F ATGCCCTTTGTTGCC bssA 223 56 This study AGTAT MBssA1R GCTGCATTTCTTCGA AACCT *Amplicons generated using these primers varied from 131 bp to 202 bp in length due to variation in 16S rRNA gene sequences of various organisms.

71

4.4 Results

13 4.4.1 Exposure to C7-toluene and RNA gradient ultracentrifugation

An established methanogenic toluene degrading enrichment culture that has been

13 routinely transferred for over ten years was incubated with 9.4 µmol of either C7-toluene or unlabeled toluene and subject to RNA-SIP analysis in order to identify the active toluene degraders in the culture. Earlier efforts to carry out RNA-SIP on this culture revealed that all culture members were labelled by day 11 (data not shown), so RNA was extracted from

13 12 incubations containing C7-toluene or C7-toluene on days 1, 3, and 7 following substrate amendment and was subject to density gradient ultracentrifugation. Based on previous results, we would expect approximately 0.2 µmol, 0.5 µmol and 1.1 µmol of toluene to have been utilized by days 1, 3, and 7 respectively (Fowler et al., 2012). Fractionated gradients containing

RNA from labelled or unlabelled pulses were subjected to DGGE fingerprinting (Figure 4-1).

72

Figure 4-1. Denaturing gradient gel electrophoresis (DGGE) community from density- 13 12 13 resolved C7- and C7-toluene incubated samples. A. Day 1 C7-toluene incubated sample. 13 13 B. Day 3 C7-toluene incubated sample. C. Day 7 C7-toluene incubated sample. D. Day 1 12 C7-toluene incubated sample. Numbers indicate buoyant density of CsTFA gradient fractions with values ranging from approximately 1.78-1.80 g/mL typically representing unlabelled (12C) RNA and 1.81-1.83 g/mL representing labelled (13C) RNA. Arrows indicate the enrichment of specific DGGE bands in heavy fractions (refer to text for details).

73

4.4.2 Bacterial diversity of toluene degrading enrichment determined by DGGE

The major bands from DGGE gels were excised, re-amplified and sequenced. Sequences were then compared to the NCBI NR database in order to determine the taxonomic affiliation of the microbes represented by specific bands. This resulted in the identification of a diverse group of bacteria in this culture. Bands identified belonged to the Deltaproteobacteria, Firmicutes, and

Spirochaetes (Figure 4-2, Table B-1). One band was found in blastn searches to be related to both the Firmicutes and Chloroflexi, and in phylogenetic analysis grouped with the Chloroflexi

(band J4, Figures 4-1 & 4-2). Sequenced bands had between 82% and 99% identity to their closest cultured relatives, with most bands exhibiting less than 93% identity to cultured organisms over the sequenced region (Table B-1).

4.4.3 Identification of bacteria involved in toluene degradation by RNA-SIP

In order to identify bacteria involved in toluene degradation, DGGE fingerprints of gradient fractions ranging in buoyant density from heavily labelled (1.82 g/mL) to unlabelled

13 12 (1.79 g/mL) were compared within C7-toluene incubated samples and to C7-toluene incubated controls (Whiteley et al., 2007, Figure 4-1). At all time points in both labelled and unlabelled samples, Band C was found to be a dominant band, indicating that it may play a key role in the culture. In labelled samples on day 1, this band was observed to become partially labelled and

13 became progressively more heavily labelled in day 3 and 7 samples incubated with C7-toluene

(Figure 4-1). Band C represents an organism closely related to Desulfosporosinus sp. DB (96% identity) and to uncultured Desulfosporosinus spp. including those found in methanogenic BTEX degrading enrichments derived from oil sands tailings (99% identity, Siddique et al., 2012) and proposed toluene degraders in a methanogenic toluene degrading culture (98 and 97% identity

74

13 respectively, Table B-1, Sun et al. 2014). In the sample incubated with C7-toluene for 3 days, two additional bands were enriched in heavy and intermediate fractions (bands M and D) and

13 remained enriched in heavy fractions in day 7 C7-toluene incubated samples. Band M became

13 progressively more intense over time in DGGE gels from C7-toluene incubated samples relative

12 to C7-toluene incubated samples (Figure 4-1). Band M represents an organism related to cultured Desulfovibrio spp. (93% identity) including those cultured from or identified in oil reservoirs (93 and 94% identity respectively, Table B-1), (Grabowski et al., 2005; Mbadinga et

13 al., 2012). Band D was more intense in day 3 and 7 C7-toluene incubated samples than at

12 comparable buoyant densities in C7-toluene incubated samples (Figure 4-1). Sequencing of band D revealed that this organism is related to members of Syntrophus and Smithella genera (up to 95% identity) which are commonly identified in oil impacted environments (Table B-1,

Acosta-Gonzalez et al., 2013). Both of these organisms are members of the Deltaproteobacteria.

On day 7, an additional band, J4, appeared at a similar location to bands J1, J2 and J3 in

13C-labelled samples on day 7. While bands J1, J2 and J3 are most closely related to the genera

Clostridium and Youngiibacter within the phylum Firmicutes (formerly Acetivibrio, up to 99% identity), band J4 is most closely related in BLASTN searches with the genus

Peptostreptococcus (90% identity), but in phylogenetic analysis affiliates with Dehalococcoides sp. of the phylum Chloroflexi (Figure 4-2).

75

Figure 4-2. Maximum likelihood tree using Jones-Taylor-Thornton model showing affiliation of 16S rRNA gene fragments from DGGE bands with reference sequences from cultured relatives and select microbes associated with anaerobic hydrocarbon metabolism. Bootstrap values greater than 50 are shown (based on 100 datasets). The scale bar represents the number of nucleotide substitutions.

76

4.4.4 Quantification of key organisms involved in methanogenic toluene degradation

To confirm the results of RNA-SIP analysis and to obtain a more quantitative view of the activity of different taxonomic groups during toluene metabolism, a time course experiment following the expression of 16S rRNA of various taxa identified in the RNA-SIP analysis in response to toluene exposure was undertaken. In addition to Desulfosporosinus sp.,

Desulfovibrio sp. and Syntrophus sp., identified in RNA-SIP analysis Clostridium sp, was also targeted as it was found to be a dominant organism in previous pyrosequencing analysis (Fowler et al. 2012) as well as total bacterial 16S rDNA. In addition, the expression of bssA, the gene encoding the catalytic subunit of benzylsuccinate synthase, involved in toluene activation by fumarate addition in this culture was examined (Fowler et al., 2012).

Quantification of total bacterial 16S rDNA in the culture revealed a small and non-significant increase in cell numbers of about 0.6 fold over the course of 20 days, which indicates that changes in 16S rRNA abundance were due almost solely to changes in transcription and were not strongly impacted by cell growth (Figure 4-3).

Consistent with RNA-SIP analysis, the expression of 16S rRNA from Desulfosporosinus sp. increased significantly after one day of incubation with toluene. This high level of expression continued through days 3 to 8 and exhibited a much larger increase in expression than all other community members tested in response to toluene exposure suggesting that this organism is most likely involved in toluene activation (Figure 4-3). Surprisingly, a significant increase in bssA expression did not accompany the increase in Desulfosporosinus sp. 16SrRNA copies, despite previous evidence that toluene is activated by fumarate addition in this culture (Fowler et al.,

2012). Though a small increase in bssA expression was observed at each time point relative to unamended cultures, these changes were not significant (Figure 4-3). It is a possibility that

77

though the primers used for bssA amplification here were designed based on the only identified bssA gene from this culture, this bssA gene was not involved in toluene activation by

Desulfosporosinus sp.

The activities of both Syntrophus sp. and Desulfovibrio sp. increased on day 8, consistent with the partial labelling of these organisms beginning on day 3 in RNA-SIP analysis (Figure 4-

3). While it is possible that these organisms are also involved in toluene activation, it seems more likely that they play a role in the downstream metabolism of toluene due to the delay in both labelling in RNA-SIP and in their increase in activity when exposed to toluene. While it was not found to be labelled in the SIP experiment, previous work suggested that Clostridium sp. was a dominant member of the microbial community and as such it was included in the qRT-PCR analysis.Results from qRT-PCR indicate that increases in Clostridium sp. activity were not significant, so it seems unlikely that Clostridium sp. plays a direct role in toluene metabolism as it was also not observed to incorporate carbon from toluene over 7 days (Figure 4-3).

Furthermore, DGGE analysis presented here suggest that Clostridium sp. is not a dominant community member as previous results had suggested (Figure 4-1, Fowler et al., 2012).

78

Figure 4-3. Fold change in expression of 16S rRNA of dominant community members and bssA in response to toluene amendment. Total bacterial rDNA is also shown to indicate cell growth that occurred over a 20 day period. A value of one indicates no change, while a value greater than one indicates an increase in expression and a value less than one indicates a decrease in expression. Dsp- Desulfosporosinus, Clos- Clostridium, Dsv- Desulfovibrio, Syn- Syntrophaceae, bssA- benzylsuccinate synthase alpha subunit, Bac- Bacteria. Error bars show standard error of the mean. For each time point, RNA from triplicate biological replicates was extracted, and qRT-PCR was then performed in triplicate for each taxa for each biological replicate. Paired T-test: *p < 0.05; **p < 0.01

79

4.5 Discussion

Nucleic acid based SIP has previously been carried out on cultures capable of anaerobic toluene metabolism under sulfate-, nitrate- and iron-reducing conditions, and most recently, for a methanogenic culture (Bombach et al., 2010; Winderl et al., 2010; Pilloni et al., 2011; Sun &

Cupples, 2012; Sun et al., 2014). In this study, we identified the microorganisms that are presumably involved in the initial attack on toluene and subsequent reactions in a methanogenic enrichment culture using RNA-SIP and qRT-PCR. Methanogenic hydrocarbon degrading cultures exist at the lower energetic limits of life and have long generation times. In light of this,

RNA was considered to be a more useful molecule than DNA to measure the activity of this culture due to its rapid turnover, particularly by microbes that are actively metabolizing a substrate (Whiteley et al., 2007). We found that using RNA for this study allowed for short incubation times relative to those typically used in DNA analysis in slow growing cultures and provided adequate sensitivity to obtain meaningful results.

Organisms from four different bacterial phyla (Deltaproteobacteria, Firmicutes,

Spirochaetes and Chloroflexi) were identified in our RNA-SIP/DGGE analysis, with members of several of these phyla incorporating labelled carbon over the course of seven days. The high bacterial diversity found is supported by previous results in which this culture was found to contain 173 OTUs, with the most abundant bacteria belonging to the phyla Firmicutes,

Chloroflexi, Spirochaetes, and Deltaproteobacteria (Fowler et al., 2012). The highly enriched nature of this culture, and the observation of the incorporation of label into numerous phyla within seven days suggests that all of these organisms play a role in the transformation of toluene to methane and underlines the complex interactions that exist in methanogenic cultures and environments.

80

The early incorporation of 13C-label into Desulfosporosinus sp. on day 1 combined with a rapid increase in cell activity in response to toluene exposure suggests that it is most likely the organism primarily responsible for toluene activation (Figures 4-1 & 4-3), supporting our previous hypothesis that a member of the Clostridiales was a key hydrocarbon-degrader in the toluene degrading enrichment (Fowler et al., 2012). A number of studies in recent years have implicated members of the Peptococcaceae in BTEX metabolism under iron and sulfate reducing and now methanogenic conditions (Morasch et al., 2004; Kunapuli et al., 2007; Abu Laban et al., 2009; Winderl et al., 2010; Herrmann et al., 2010; Sun & Cupples 2012; Sun et al., 2014).

Given that many microbes are able to use multiple electron acceptors and/or metabolize fermentatively (coupled with the similarity in redox potential at which iron and sulfate reduction and methanogenesis occur), it is not too surprising that similar organisms are involved in the activation of BTEX under diverse anaerobic conditions. The specific Desulfosporosinus sp. identified here has high 16S rRNA sequence similarity to both the Desulfosporosinus sp. recently identified to activate toluene under methanogenic conditions and to a Desulfosporosinus sp. identified in BTEX degrading methanogenic cultures derived from oil sands tailings (98 and

99% respectively) suggesting that members of this clade are specifically adapted to BTEX- containing environments (Siddique et al., 2012; Sun et al., 2014). Interestingly, a substantial increase in bssA expression did not accompany the significant increase in Desulfosporosinus sp. activity on day 1 (Figure 4-3). The abundance of bssA transcript was steady over the 20 day time course, and was not significantly higher compared with unamended cultures (Figure 4-3).

Transcription of bssA has previously been shown to be induced by the presence of toluene under methanogenic conditions (Washer & Edwards, 2007), so the reason for this is unclear, as both

DNA sequence data and metabolite analysis support fumarate addition as the toluene activation

81

mechanism in this culture, and members of this clade have previously been shown to activate monoaromatic hydrocarbons by fumarate addition (Morasch et al., 2004; Fowler et al., 2012).

One possibility is that bss genes are constitutively expressed in this culture.

Additional organisms that incorporated carbon from toluene and exhibited increased activity over the course of toluene exposure were a relative of Desulfovibrio sp. (93% identity) and a relative of Syntrophus/ Smithella spp. (up to 95% identity, Figures 4-1 & 4-3). As these two organisms only became more active and incorporated labelled carbon after

Desulfosporosinus sp., it is proposed that they are not involved in the initial activation of toluene but play a key role in downstream toluene metabolism as both had incorporated labelled carbon from toluene early in the time course (Figure 4-1).

Members of Desulfovibrio sp. are commonly found in a variety of strictly anoxic oil- impacted environments such as oil reservoirs and enrichment cultures derived from contaminated sites and oil production waters (Grabowski et al., 2005; Fowler et al., 2012; Mbadinga et al.,

2012; Callbeck et al., 2013). Though they seem to be ubiquitous in these environments, their specific role has not been elucidated. However, it can be speculated that they play a role in fatty acid metabolism (under syntrophic and non-syntrophic conditions) or the consumption of H2 under sulfate-reducing conditions as these are typical of the metabolisms of Desulfovibrio spp. under sulfate-reducing and syntrophic conditions (Walker et al., 2009; Plugge et al., 2010).

Members of the Smithella / Syntrophus genera are typically fermentative organisms that are often found in association with methanogens and are frequently identified in hydrocarbon- impacted environments (reviewed in Gieg et al., 2014). The cultured Syntrophus sp. that are related to the organism identified here are characterized by their ability to degrade benzoate in syntrophic cooperation with methanogens (Wallrabenstein et al., 1995; Jackson et al., 1999).

82

While it is possible that the Syntrophaceae bacterium identified here is involved in benzoate degradation in this culture, this seems unlikely, as this would not allow substantial energy conservation by the Desulfosporosinus sp. that activates toluene, nor explain the substantial label incorporation that was observed for Desulfosporosinus sp. It seems more likely that

Syntrophaceae play a role further downstream, potentially degrading smaller fatty acids into methanogenic substrates, or carrying out acetate oxidation, roles which have previously been ascribed to other members of the Syntrophaceae such as Smithella propionica and Desulfobacca acetoxidans (Liu et al., 1999; Oude Elferink et al., 1999).

Alternatively, it cannot be ruled out that these Deltaproteobacteria are directly involved in toluene activation. While Desulfovibrio sp. has never previously been associated with hydrocarbon activation, Syntrophus / Smithella genera have been implicated in alkane and benzene activation under methanogenic conditions, thus members of this group do have a demonstrated potential for methanogenic hydrocarbon metabolism (Zengler et al., 1999; Jones et al., 2008; Sakai et al., 2009; Gray et al., 2011; Cheng et al., 2013). It is possible that both

Desulfosporosinus sp. and the Syntrophaceae organism are capable of toluene metabolism in this culture and compete for toluene.

A member of the phylum Chloroflexi became labelled in this culture at a later time point

(day 7), suggesting that it may use a product produced by one of the organisms described above and thus incorporate label from toluene (Figure 4-1). Organisms that were present in DGGE analysis but did not become significantly labelled in seven days included two organisms related to Geobacter sp. and the Desulfobacterales, a member of the Spirochaetes and a Clostridium sp. whose activity did not increase significantly when exposed to toluene, and did not appear to incorporate carbon from toluene within seven days. The roles of these unlabelled organisms are

83

elusive. It is possible that some organisms may play supportive roles as has been shown in other cultures, such as maintaining a low redox potential or providing co-factors and vitamins (Hug et al., 2012). However, organisms carrying out such roles would need to conserve sufficient energy to persist in the culture. Longer incubation times may have revealed the incorporation of 13C- label into these organisms.

Methanogenic communities are characterized by the complex energetic relationships that exist amongst their members. This work highlights these complex syntrophic interactions. Based on our data with this toluene-degrading enrichment culture, the direct attack on toluene appears to be catalyzed by Desulfosporosinus sp. We hypothesize that Desulfosporosinus sp. degrades toluene into smaller molecules such as cyclohexane carboxyl-CoA, pimelyl-CoA and glutaryl-

CoA, which were previously detected in culture fluids (Fowler et al. 2012, Figure 4-4). The subsequent steps involved in methanogenic toluene metabolism in this culture are unclear.

Downstream metabolism of benzoyl-CoA beyond glutaryl-CoA is thought to proceed via - oxidation in pure cultures (Harrison & Harwood 2005), however it is also possible that syntrophic metabolism may proceed via a different route, such as via fermentation to volatile fatty acids or alcohols which might be catalyzed by a member of the Desulfovibrionales or

Syntrophaceae (Figure 4-4). The Chloroflexi that also became labelled could be carrying out syntrophic acetate oxidation, or could be involved in the fermentation of another labelled intermediate. The remaining organisms that were present in the culture but did not become strongly labelled within seven days such as Clostridium sp., could be acting acetogenically, or scavenging H2 and/or other products produced by the culture, carrying out syntrophic acetate

13 oxidation (which would result in only low level labelling if acetate is derived from C7-toluene) or they may be involved in subsequent reactions in the conversion of the intermediates shown

84

(Figure 4-4). Due to previous observations revealing the presence of hydrogenotrophic and acetoclastic methanogens in this culture, as well as the close to stoichiometric conversion of toluene to methane (Fowler et al., 2012), it is likely that the bacteria present in this culture convert the intermediates shown into methanogenic substrates such as acetate, CO2 and H2.

Figure 4-4. Proposed pathway of methanogenic toluene metabolism in the culture under study. It is proposed that toluene is degraded to glutaryl-CoA or crotonyl-CoA by the Desulfosporosinus sp. identified. Subsequent metabolism may be carried out by the Desulfovibrionales and Syntrophus/Smithella-like organisms, Chloroflexi and/or organisms that were not labelled by day 7 convert the intermediated shown into methanogenic substrates acetate and hydrogen. Structures marked with an asterisk have previously been detected in culture fluids. Hydrogen production is indicated as it is an important intermediate in fermentative and methanogenic metabolism.

85

In summary, this study has confirmed the importance of Desulfosporosinus sp. in anaerobic toluene degradation under methanogenic conditions and has also revealed a role for

Desulfovibrionales and Syntrophaceae in methanogenic toluene degradation. Our results also indicate that in slow growing cultures such as these, examining the RNA content of a culture is an effective and sensitive way to unravel community and metabolic interactions. Lastly, the complex community structure revealed in this study on a stable, long standing laboratory enrichment culture highlights the extraordinary complexity of hydrocarbon-metabolizing methanogenic communities.

4.6 Acknowledgements

This research was supported by start-up funds from the Faculty of Science, University of

Calgary and NSERC Discovery and Genome Canada grants awarded to LMG. SJF is supported by NSERC CGSD and Alberta Innovates Technology Futures Graduate Fellowships.

86

4.7 References

Abu Laban N, Selesi D, Jobelius C & Meckenstock RU (2009) Anaerobic benzene degradation by Gram-positive sulfate-reducing bacteria. FEMS Microbiol Ecol 68: 300-311.

Acosta-Gonzalez A, Rossello-Mora R & Marques S (2013) Characterization of the anaerobic microbial community in oil-polluted subtidal sediments: aromatic biodegradation potential after the Prestige oil spill. Environ Microbiol 15: 77-92.

Ashelford KE, Chuzhanova NA, Fry JC, Jones AJ & Weightman AJ (2006) New screening software shows that most recent large 16S rRNA gene clone libraries contain chimeras. Appl Environ Microbiol 72: 5734-5741.

Bombach P, Chatzinotas A, Neu TR, Kastner M, Lueders T & Vogt C (2010) Enrichment and characterization of a sulfate-reducing toluene-degrading microbial consortium by combining in situ microcosms and stable isotope probing techniques. FEMS Microbiol Ecol 71: 237-246.

Callaghan AV, Morris BEL, Pereira IAC, et al. (2012) The genome sequence of Desulfatibacillum alkenivorans AK-01: A blueprint for anaerobic alkane oxidation. Environ Microbiol 14: 101-113.

Callbeck CM, Agrawal A & Voordouw G (2013) Acetate production from oil under sulfate- reducing conditions in bioreactors injected with sulfate and nitrate. Appl Environ Microbiol 79: 5059-5068.

Cheng L, Ding C, Li Q, He Q, Dai LR & Zhang H (2013) DNA-SIP reveals that Syntrophaceae play an important role in methanogenic hexadecane degradation. PLOS One 8: e66784.

Cupples AM (2011) The use of nucleic acid based stable isotope probing to identify the microorganisms responsible for anaerobic benzene and toluene biodegradation. J Microbiol Methods 85: 83-91.

Dean BJ (1985) Recent findings on the genetic toxicology of benzene, toluene, xylenes and phenols Mutat Res 154: 153-181. Felsenstein J (1993) PHYLIP (Phylogeny Inference Package) Version 3.5c. University of Washington, Seattle.

Ficker M, Krastel K, Orlicky S & Edwards E (1999) Molecular characterization of a toluene- degrading methanogenic consortium. Appl Environ Microbiol 65: 5576-5585.

Fite A, Macfarlane GT, Cummings JH, Hopkins MJ, Kong SC, Furrie E & Macfarlane S (2004) Identification and quantitation of mucosal and faecal desulfovibrios using real time polymerase chain reaction. Gut 53: 523-529.

87

Fowler SJ, Dong X, Sensen CW, Suflita JM & Gieg LM (2012) Methanogenic toluene metabolism: community structure and intermediates. Environ Microbiol 14: 754-764.

Gieg, LM, Fowler, SJ & Berdugo-Clavijo, C (2014) Syntrophic biodegradation of hydrocarbon contaminants. Curr Opin Biotechnol 27: 21-29.

Grabowski A, Nercessian O, Fayolle F, Blanchet D & Jeanthon C (2005) Microbial diversity in production waters of a low-temperature biodegraded oil reservoir. FEMS Microbiol Ecol 54: 427-443.

Gray ND, Sherry A, Grant RJ, et al. (2011) The quantitative significance of Syntrophaceae and syntrophic partnerships in methanogenic degradation of crude oil alkanes. Environ Microbiol 13: 2957-2975.

Harrison FH & Harwood CS (2005) The pimFABCDE operon from Rhodopseudomonas palustris mediates dicarboxylic acid degradation and participates in anaerobic benzoate degradation. Microbiol-Sgm 151: 727-736.

Heider J (2007) Adding handles to unhandy substrates: anaerobic hydrocarbon activation mechanisms. Curr Opin Chem Biol 11: 188-194.

Herrmann S, Kleinsteuber S, Chatzinotas A, Kuppardt S, Lueders T, Richnow HH & Vogt C (2010) Functional characterization of an anaerobic benzene-degrading enrichment culture by DNA stable isotope probing. Environ Microbiol 12: 401-411.

Hug LA, Beiko RG, Rowe AR, Richardson RE & Edwards EA (2012) Comparative metagenomics of three Dehalococcoides-containing enrichment cultures: the role of the non- dechlorinating community. BMC Genomics 13: 327.

Jackson BE, Bhupathiraju VK, Tanner RS, Woese CR & McInerney MJ (1999) Syntrophus aciditrophicus sp. nov., a new anaerobic bacterium that degrades fatty acids and benzoate in syntrophic association with hydrogen-using microorganisms. Arch Microbiol 171: 107-114.

Jones DM, Head IM, Gray ND, et al. (2008) Crude-oil biodegradation via methanogenesis in subsurface petroleum reservoirs. Nature 451: 176-U176.

Kunapuli U, Lueders T & Meckenstock RU (2007) The use of stable isotope probing to identify key iron-reducing microorganisms involved in anaerobic benzene degradation. ISME J 1: 643- 653.

Lane D (1991) 16S/23S rRNA sequencing. Nucleic acid techniques in bacterial systematics,(Stackebrandt E & Goodfellow M, eds), pp. 115-175. John Wiley and Sons, New York, NY.

88

Liu YT, Balkwill DL, Aldrich HC, Drake GR & Boone DR (1999) Characterization of the anaerobic propioate-degrading syntrophs Smithella propionica gen. nov., sp. nov. and . Int J Syst Bact 49: 545-556.

Mbadinga SM, Li KP, Zhou L, Wang LY, Yang SZ, Liu JF, Gu JD & Mu BZ (2012) Analysis of alkane-dependent methanogenic community derived from production water of a high- temperature petroleum reservoir. Appl Microbiol and Biotechnol 96: 531-542.

Morasch B, Schink B, Tebbe CC & Meckenstock RU (2004) Degradation of o-xylene and m- xylene by a novel sulfate-reducer belonging to the genus Desulfotomaculum. Arch Microbiol 181: 407-417.

Notredame C, Higgins DG & Heringa J (2000) T-Coffee: A novel method for fast and accurate multiple sequence alignment. J Mol Biol 302: 205-217.

Oude Elferink S, Akkermans-van Vliet WM, Bogte JJ & Stams AJM (1999) Desulfobacca acetoxidans gen. nov., sp, nov., a novel acetate-degrading sulfate reducer isolated from sulfidogenic granular sludge. Int J Syst Bacteriol 49: 345-350.

Pilloni G, von Netzer F, Engel M & Lueders T (2011) Electron acceptor-dependent identification of key anaerobic toluene degraders at a tar-oil-contaminated aquifer by Pyro-SIP. FEMS Microbiol Ecol 78: 165-175.

Pester M, Bittner N, Deevong P, Wagner M & Loy A (2010) A ‘rare biosphere’ microorganism contributes to sulfate reduction in a peatland. ISME J 12: 1591-1602.

Plugge CM, Scholten JCM, Culley DE, Nie L, Brockman FJ & Zhang WW (2010) Global transcriptomics analysis of the Desulfovibrio vulgaris change from syntrophic growth with Methanosarcina barkeri to sulfidogenic metabolism. Microbiol-Sgm 156: 2746-2756.

Sakai N, Kurisu F, Yagi O, Nakajima F & Yamamoto K (2009) Identification of putative benzene-degrading bacteria in methanogenic enrichment cultures. J Biosci Bioeng 108: 501-507.

Shartau SLC, Yurkiw M, Lin SP, Grigoryan AA, Lambo A, Park HS, Lomans BP, van der Biezen E, Jetten MSM & Voordouw G (2010) Ammonium concentrations in produced waters from a mesothermic oil field subjected to nitrate injection decrease through formation of denitrifying biomass and anammox activity. Appl Environ Microbiol 76: 4977-4987.

Siddique T, Penner T, Klassen J, Nesbo C & Foght JM (2012) Microbial communities involved in methane production from hydrocarbons in oil sands tailings. Environ Sci Technol 46: 9802- 9810.

Sun WM & Cupples AM (2012) Diversity of five anaerobic toluene-degrading microbial communities investigated using stable isotope probing. Appl Environ Microbiol 78: 972-980.

89

Sun W, Sun X & Cupples AM (2014) Identification of Desulfosporosinus as toluene-assimilating microorganisms from a methanogenic consortium. Int Biodeter Biodegr 88: 13-19.

Walker CB, He ZL, Yang ZK, et al. (2009) The electron transfer system of syntrophically grown Desulfovibrio vulgaris. J Bacteriol 191: 5793-5801.

Wallrabenstein C, Gorny N, Springer N, Ludwig W & Schink B (1995) Pure culture of , definition of its phylogenetic status and description of Syntrophus gentianae sp. nov. Syst Appl Microbiol 18: 62-66.

Wang MY, Tsai YL, Olson BH & Chang JS (2008) Monitoring dark hydrogen fermentation performance of indigenous Clostridium butyricum by hydrogenase gene expression using RT- PCR and qPCR. Int J Hydrogen Energ 33: 4730-4738.

Washer CE & Edwards EA (2007) Identification and expression of benzylsuccinate synthase genes in a toluene-degrading methanogenic consortium. Appl Environ Microbiol 73: 1367-1369.

Whiteley AS & Bailey MJ (2000) Bacterial community structure and physiological state within an industrial phenol bioremediation system. Appl Environ Microbiol 66: 2400-2407.

Whiteley AS, Thomson B, Lueders T & Manefield M (2007) RNA stable-isotope probing. Nature Protocols 2: 838-844.

Widdel F, Boetius A & Rabus R (2006) Anaerobic biodegradation of hydrocarbons including methane. The Prokaryotes Vol. 2: Ecophysiology and Biochemistry (Dworkin M, Falkow S, Rosenberg E, Schleifer KH & Stackebrandt E, eds) pp. 1028-1049. Springer Sci + Business Media LLC, New York.

Winderl C, Penning H, von Netzer F, Meckenstock RU & Lueders T (2010) DNA-SIP identifies sulfate-reducing Clostridia as important toluene degraders in tar-oil-contaminated aquifer sediment. ISME J 4: 1314-1325.

Zemb O, Lee M, Gutierrez-Zamora ML, Hamelin J, Coupland K, Hazrin-Chong NH, Taleb I & Manefield M (2012) Improvement of RNA-SIP by pyrosequencing to identify putative 4-n- nonylphenol degraders in activated sludge. Water Res 46: 601-610.

Zengler K, Richnow HH, Rosello-Mora R, Michaelis W, Widdel F (1999) Methane formation from long-chain alkanes by anaerobic microorganisms. Nature 401: 266-269.

90

Preface

Chapter 5 is a comparative metagenomics study focusing on metagenomes from three methanogenic hydrocarbon degrading enrichment cultures including the 454-pyrosequenced metagenome of the toluene degrading culture. These metagenomes were compared both to each other and to a number of metagenomes from a variety of different environments including oil- impacted marine sediments and oil sands tailings ponds. We determined that the methanogenic enrichment cultures were more similar to one another than to any of the other environments examined including oil sands tailings, from which two of the enrichments were derived. The functional categories that distinguish the methanogenic hydrocarbon degrading enrichments from other environments represent hallmark features of methanogenic hydrocarbon metabolism.

91

Chapter Five: Comparative metagenomic analysis of three methanogenic hydrocarbon degrading enrichment cultures

Boonfei Tan1†, S. Jane Fowler2†, Nidal Abu Laban1, Xiaoli Dong3, Christoph W. Sensen3, Julia

Foght1, Lisa M. Gieg2*

1Department of Biological Sciences, University of Alberta, 116 St. and 85 Ave, Edmonton, Alberta T6G 2E9 2Department of Biological Sciences, University of Calgary, 2500 University Dr. N.W., Calgary, Alberta, Canada T2N 1N4 3Visual Genomics Centre, Faculty of Medicine, 3330 Hospital Drive NW, Calgary, Alberta, Canada, T2N 4N1 †These authors contributed equally to this work

Status: This is a modified version of a manuscript that was submitted to ISME Journal in

September, 2013. A revised version of the manuscript will be resubmitted to ISME Journal in

May 2014.

92

5.1 Abstract

Methanogenic hydrocarbon metabolism is a key process in subsurface oil reservoirs and hydrocarbon-contaminated environments. After depletion of more favourable electron acceptors, the majority of hydrocarbon degradation in the subsurface occurs via methanogenesis. A greater understanding of methanogenic hydrocarbon metabolism could improve current technologies for fossil fuel extraction and bioremediation. Total community DNA from three methanogenic hydrocarbon-degrading cultures enriched from oil sands tailings (NAPDC; naphtha-degrading, and SCADC; C6-C10 n-alkane degrading) and a gas condensate-contaminated aquifer (TOLDC; toluene-degrading) was subjected to 454 pyrosequencing. Using comparative metagenomics, we sought to identify defining features of the three cultures and to ascertain functional relationships to other types of environments with historical exposure to hydrocarbon pollutants including sediments from the Gulf of Mexico and oil sands tailings ponds. Analysis of the metagenomes showed that methanogenic hydrocarbon-degrading consortia are distinct from the other hydrocarbon-impacted environments examined here. Fumarate addition was found to be a common hydrocarbon activation mechanism shared by the three cultures and genes encoding this process have also been detected in other hydrocarbon-impacted environments such as oil sands tailings ponds and marine sediments from the Gulf of Mexico. All three cultures have the genetic potential to degrade a range of hydrocarbon substrates and encode pathways for both acetotrophic and hydrogenotrophic methanogenesis. The methanogenic cultures were enriched in functional categories related to methanogenesis, energy conservation, electron transfer and anaerobic respiration processes common in fermentative/methanogenic environments relative to other environments. Although the three hydrocarbon-degrading cultures harbour diverse

Firmicutes and Deltaproteobacteria putatively involved in hydrocarbon activation, the overall

93

putative functional profiles of the three cultures were similar, and were more similar to one another than to other environments including those impacted by hydrocarbons.

5.2 Introduction

Since the dawn of the industrial age, anthropogenic activities have resulted in the contamination of various soil and subsurface environmental systems with organic compounds including hydrocarbons. Methanogenesis and syntrophic biodegradation of organic compounds are important processes in polluted and engineered environments such as contaminated groundwater aquifers, organic chemical waste disposal sites, former gas plants, landfills and anaerobic digestors (Mountfort & Bryant, 1982, Qiu et al., 2004, Lykidis et al., 2011). When electron acceptors such as oxygen, nitrate, iron(III), and sulfate are depleted, methanogenesis is the dominant process by which organic matter is degraded in the subsurface. Furthermore, methanogenic biodegradation of hydrocarbons is an important biogeochemical process which, over geological time, has contributed to the formation of natural gas deposits in shales and the conversion of certain light oil deposits to heavy oil and bitumen deposits (Jones et al., 2008).

The mineralization of hydrocarbons by methanogenesis involves the coordinated metabolism of bacteria that catalyze the initial attack on hydrocarbon substrates with subsequent conversion to methanogenic substrates, and methanogens that produce CH4 and CO2 (and/or water) as end products. These reactions have relatively low energy yields compared to aerobic or anaerobic metabolism in the presence of electron acceptors, and this energy must be shared amongst all microbes acting on the substrate (Schink, 1997). The adaptations that allow sufficient energy conservation for growth and survival at these low energy yields are not well understood.

94

Previous studies show that methanogenic hydrocarbon-degrading communities are highly diverse (Chang et al., 2005, Kasai et al., 2005). They typically consist of hydrogenotrophic and/or acetotrophic methanogens (e.g., Methanoculleus, Methanolinea, Methanoregula,

Methanospirillum and Methanosaeta respectively), as well as a variety of bacteria, with members of the Deltaproteobacteria (e.g., Syntrophus/Smithella, Desulfovibrio, Geobacter) and

Firmicutes (e.g., Desulfotomaculum, Desulfosporosinus, Pelotomaculum) being the most common and abundant, and frequently identified as the putative hydrocarbon activating organisms (Gray et al., 2011, Kleinsteuber et al., 2012). In addition, members of the

Spirochaetes, Bacteroidetes, Chloroflexi and Betaproteobacteria are frequently found, but generally in lower abundance (Kleinsteuber et al., 2012). Methanogenic hydrocarbon-degrading co-cultures, consisting of a single bacterium and archaeon, are notoriously difficult to obtain, and therefore the specific roles of this wide diversity of organisms in methanogenic communities remain cryptic. The specific community structure may depend on the range of hydrocarbon substrates present, as well as the available nutrients and specific biogeochemical characteristics.

Despite the recent report of a methanogenic hydrocarbon-degrading co-culture (Callaghan et al.,

2012), the key enzymes and genes that mediate the syntrophic biodegradation of hydrocarbons are not yet well described. Genes encoding anaerobic hydrocarbon-degrading enzymes have been shown to be present in hydrocarbon-degrading methanogenic cultures (Washer & Edwards,

2007, Fowler et al., 2012, Wawrik et al., 2012, Tan et al., 2013). Other genes of importance in syntrophic degradation include those involved in methanogenesis as well as electron transfer processes, amino acid and coenzyme biosynthesis, metabolism, and transport (Kato et al., 2009,

Walker et al., 2012).

95

To gain insight into the metabolic processes and the microbial communities involved in methanogenic hydrocarbon metabolism, we carried out metagenomic sequencing of three methanogenic hydrocarbon-degrading cultures enriched on different substrates: toluene, a mixture of low molecular weight alkanes, and naphtha. The metagenomes were screened for the presence of genes and pathways known to be involved in the anaerobic degradation of hydrocarbon substrates, and methanogenesis. To identify functions of importance in methanogenic hydrocarbon degradation, we also compared these metagenomic datasets to publicly available metagenomes from a range of environments including metagenomes from hydrocarbon-impacted environments including oil sands tailings ponds and sediments from the

Gulf of Mexico impacted by the Deep Horizon oil spill (An et al., 2013, Kimes et al., 2013).

5.3 Materials and methods

5.3.1 Incubation conditions

Three methanogenic hydrocarbon-degrading enrichment cultures (NAPDC, SCADC, and

TOLDC) were established from two hydrocarbon impacted environments and maintained on different hydrocarbons as the sole organic carbon source (Table 5-1). The naphtha-degrading culture (NAPDC) and short-chain alkane degrading culture (SCADC) were enriched from methanogenic mature fine tailings collected from Mildred Lake Settling Basin (MLSB), an oil sands tailings pond in northeastern Alberta, Canada (Siddique et al., 2006). NAPDC was maintained with 0.2% (v/v) naphtha (a refinery cut consisting of a mixture of monoaromatic hydrocarbons, n-, iso- and cyclo-alkanes; CAS no. 64742-49-0) as the sole organic carbon substrates (Figure C-1). SCADC completely biodegrades 0.1% v/v C6-C10 n-alkanes as well as minor proportions of 2-methylpentane and methylcyclopentane present as impurities in

96

commercial hexanes (Tan et al., 2013). The toluene degrading culture (TOLDC) was established from gas condensate-contaminated aquifer sediments and maintained with 0.01% (v/v) toluene

(Fowler et al., 2012). The three methanogenic cultures were incubated stationary in the dark under mesothermic conditions (20-28°C) and transferred to fresh medium at various intervals

(Table 5-1).

Table 5-1. Enrichment and incubation conditions of methanogenic hydrocarbon degrading cultures NAPDC SCADC TOLDC

In situ conditions in inoculum source environment

Sample environment Mature fine tailings Mature fine tailings Gas-condensate from oil sands tailings from oil sands tailings contaminated aquifer pond1 pond1 sediments2 Location Alberta, Canada Alberta, Canada Colorado, USA Depth (m below 31 35 1.5 surface) Bulk pH 7-8 7-8 7-8 Temperature 12-20°C 12-20°C 15-20°C Redox condition Anoxic Anoxic Anoxic Incubation conditions for enrichment cultures

Inoculum % 50% (v/v) 50% (v/v) 30% (v/v) Number of transfers 2 4 >10 Substrate 0.2% (v/v) naphtha 0.1% (v/v) C6- C10 0.01% (v/v) toluene n-alkanes Culture medium Anoxic mineral Anoxic mineral Anoxic freshwater medium3 medium3 medium3 Initial medium pH 7-8 7-8 7-8 Initial headspace gas 20/80% (v/v) CO2/N2 20/80% (v/v) CO2/N2 20/80% (v/v) CO2/N2 Incubation time 120 days 120 days 150 days Light exposure Dark Dark Dark 1Mildred Lake Settling Basin, Alberta, Canada (Siddique et al., 2007) 2near Fort Lupton Colorado, USA (Gieg et al., 1999) 3Reported in Widdel and Bak 1992

97

5.3.2 DNA extraction and 16S rRNA gene pyrotag sequencing

The protocols for DNA extraction and pyrotag sequencing of 16S rRNA genes for microbial community analysis in TOLDC and SCADC were previously described, and equivalent methods were used for NAPDC. Briefly, total DNA from NAPDC used for 16S rRNA gene pyrosequencing was extracted (Foght et al., 2004), followed by PCR amplification with primers 926F and 1392R, targeting the V6-V8 regions of the 16S rRNA gene as previously described (Tan et al., 2013, Fowler et al., 2012). All 16S rRNA gene pyrotag sequencing reads were generated using the same primer set and were submitted simultaneously to Phoenix 2 (Soh et al., 2013) for quality control (QC), cluster analysis (0.05 distance cut-off) and taxonomic classification with RDP classifier. A lack of consensus of similarity thresholds used in cluster analysis currently exists (i.e., 97 or 95%). In this study, we used a 95% similarity threshold for

OTU clustering to accommodate potential biases introduced through homopolymers and sequencing artifacts produced during 454 pyrotag sequencing (Kunin et al., 2010).

5.3.3 Total DNA extraction for metagenomic sequencing

For high throughput 454-pyrosequencing of total DNA, approximately 500 mL of 0.2-µm filtered culture fluids were used for phenol-chloroform DNA extraction, followed by cesium chloride purification (Wright et al. 2009). Additionally, total DNA was obtained from the oil sands tailings pond Mildred Lake Settling Basin (MLSB) using the method described by An et al. (2013). Total DNA for each sample was sequenced on a half plate using the GS FLX

Titanium Sequencing Kit XLR70 (Roche) at the Génome Québec Innovation Centre at McGill

University, Canada.

98

5.3.4 Quality control, de novo assembly and annotation of metagenomic data

All metagenomic 454 reads were subjected to QC and sequence assembly using an in- house developed pipeline based on Newbler v2.3 using options “mi 95 -ml 60 -a 200 -l 900”

(Tan et al., 2013). The QC reads and assembled contigs were submitted to MG-RAST for automated gene calling and annotation. Metagenomic sequences from NAPDC, SCADC, and

TOLDC are available in the Sequence Read Archive (SRX210874, SAMN01828453 and

SRX210873, respectively).

5.3.5 Taxonomic classification of metagenomic data

The QC and unassembled metagenomic reads obtained from 454 pyrosequencing of total

DNA were subject to taxonomic classification using (i) the taxonomic classifier in MG-RAST with the following parameters: M5NR annotation, maximum e-value 1x10-10, minimum alignment length 50 bp, minimum identity 60%, and (ii) homology-based binning method using

SOrt-ITEMS (Haque et al., 2009). Additionally, unassembled reads were used in genome mapping in Geneious Pro 7.0.5 (Biomatters Ltd., Auckland, New Zealand) with default settings, unless stated otherwise.

5.3.6 Comparative analysis of functional categories in metagenomic datasets

NAPDC, SCADC, and TOLDC unassembled metagenomic reads were annotated in

MG-RAST v2 using SEED with the following parameters: maximum e-value, 1x10-10; minimum percent identity, 60%; minimum alignment length, 50 bp (Meyer et al., 2008). Forty-four metagenomes representing a variety of different environments including Gulf of Mexico deep marine sediments (Kimes et al., 2013) and metagenomes from two different oil sands tailings

99

ponds in northern Alberta, (Tailings Pond 6, described by An et al. (2013) and MLSB), in addition to NAPDC, SCADC, and TOLDC metagenomes, were compared by principal component analysis (PCA) by comparing relative abundances of SEED functional categories from the different metagenomes using R with the ade4 package (Table C-1). Datasets from oil sands tailings ponds and Gulf of Mexico marine sediments were further compared in groups with pooled NAPDC, SCADC, and TOLDC metagenomes using STAMP (Parks & Beiko, 2010). For subsystem categories with rare counts (e.g., 0.1% of total counts), a fixed number of pseudocounts proportional to the total gene count was added to all categories across all groups used in comparisons to prevent selection of rare categories (Hug et al., 2012). For all comparisons, unassembled metagenomic reads were used unless stated otherwise.

Specific genes encoding proteins involved in methanogenesis and anaerobic hydrocarbon metabolism were sought in the metagenomes using Hidden Markov Models (HMMs). Where available, Pfam profile HMMs (Finn et al., 2010) were used to identify protein families; in-house

HMM models were made for genes for which no Pfam models existed and a minimum of four representative sequences were available in GenBank. To construct HMMs, amino acid sequences of a gene were aligned using T-Coffee, and multiple alignments were manually curated using

GeneDoc (Notredame et al., 2000). Edited alignments were used as input to HMMER to create

HMMs (Eddy 1998). Models were then used to screen assembled metagenomic datasets with an e-value < 1x10-10. For genes that had fewer representative sequences available, tBLASTn searches (protein vs. translated nucleotide database) were performed on each of the metagenomes (e-value < 1x10-10). Assembled datasets were used for this analysis as detection of full-length or near full-length genes was difficult using unassembled reads. This made quantification of genes difficult, and due to the relatively low sequencing depth of the

100

metagenomes, we ascertained that the identification of the majority of genes in a pathway (or enzyme-encoding subunits) was a more suitable indicator of the presence of a pathway or enzyme than was individual gene abundance.

5.3.7 Phylogenetic analysis of putative fumarate addition enzymes

Amino acid sequences for genes encoding fumarate addition enzyme alpha subunits

(assA, bssA, and nmsA) were recovered from NAPDC, SCADC, and TOLDC datasets using

HMMs and tBLASTn. Recovered sequences were aligned with reference sequences obtained from the GenBank database using MUSCLE V3.3 (Edgar, 2004). Poorly aligned regions were manually edited and indels were removed. Phylogenetic analysis was performed using PhyML

(Guindon et al., 2010) with WAG model and 100 bootstrap replicates. Trees were visualized and edited in FigTree V14.0.

5.4 Results and Discussion

5.4.1 Description of the methanogenic hydrocarbon degrading enrichment cultures

While descriptions of both TOLDC and SCADC are available in the literature (Fowler et al., 2012, Tan et al., 2013), NAPDC has not previously been described. Briefly, TOLDC was enriched from a gas-condensate contaminated aquifer near Fort Lupton, CO where previous studies revealed the presence of both bssA and assA genes in contaminated sediments, suggesting that hydrocarbons at this site may be degraded by fumarate addition (Callaghan et al., 2010).

Indeed, the microbial community of TOLDC has been shown to produce benzylsuccinate and harbour a putative gene encoding bssA, suggesting that toluene is activated by fumarate addition in this culture (Fowler et al., 2012). SCADC and NAPDC were enriched from mature fine

101

tailings from MLSB, an oil sands tailings pond in northern Alberta, Canada where methanogenic biodegradation of short and long chain n-alkanes and monoaromatic hydrocarbons has been demonstrated (Siddique et al., 2006, Siddique et al., 2007, Siddique et al., 2011). SCADC degrades n-alkanes ranging from C6-C10, 2-methylpentane and methylcyclopentane. Genomic evidence suggests that alkanes are activated by fumarate addition, and alkylsuccinate metabolites of 2- methylpentane and methylcyclopentane but not n-alkanes were detected in culture fluids

(Tan et al., 2013). NAPDC was enriched on naphtha, a mixture of low molecular weight hydrocarbons including n-, iso- and cycloalkanes, and monoaromatic hydrocarbons. Over 120 days of incubation, depletion of toluene, o-xylene, and iso-alkanes was observed with concomitant methane production in NAPDC (Figure C-1). Following a month long incubation with toluene as the sole substrate, benzylsuccinate was identified in culture fluids, suggesting that NAPDC activates toluene by fumarate addition (Abu Laban, unpublished data).

5.4.2 General features of NAPDC, SCADC and TOLDC metagenomes

Metagenomic 454 pyrosequencing of DNA extracted from NAPDC, SCADC, and

TOLDC generated ~370,000, 670,000, and 550,000 QC reads, respectively (Table 5-2).

Rarefaction analysis and assembly statistics revealed that TOLDC was more deeply sequenced than either NAPDC or SCADC, but that none of the cultures was sequenced to saturation (Figure

C-2). The metagenomes assembled into approximately 8,500 (NAPDC), 15,000 (SCADC), and

11,000 (TOLDC) contigs, with ~162,000, 326,000 and 179,000 singletons, respectively, and had

GC contents of 49-53% (Table 5-2). The average assembled sequence lengths were quite short

(1118–1863 bp) but contigs varied greatly in length (200-30,000 bp). This likely reflects the relative abundance of different community members, with more abundant members being better

102

assembled due to a higher proportion of reads. The longest contigs ranged from 25.8 to 28.2 Kb, which is relatively short compared to other metagenomes (Hug et al., 2012), suggesting that these cultures are particularly biodiverse.

Table 5-2. Features of the metagenomes of three methanogenic hydrocarbon degrading enrichments cultures generated by 454 pyrosequencing NAPDC SCADC TOLDC Number of raw reads1 386 209 667 134 550 247 Unassembled size1 (bp) 130 215 413 230 716 341 215 982 194 Mean read length1 (bp) 354 346 393 Newbler assembly Length of contigs (bp) 9 473 370 17 382 962 20 280 655 Number of contigs 8471 15 274 10 888 Mean contig length (bp) 1118 1138 1863 Longest contig (bp) 25 813 26 073 28 253 Number of singletons 161 851 326 382 179 067 N50 1330 1343 2813 Predicted proteins 133 107 261 378 170 842 rRNA genes (5S/16S/23S) 23/45/155 46/135/267 29/104/189 tRNA genes 816 1322 891 MG-RAST data (assembled) MG-RAST ID 4492772.3 4492619.3 4492778.3 Metagenome size (bp) 64 676 632 127 644 733 89 513 841 Average sequence length 379 ± 352 373 ± 310 471 ± 647 (bp) Number of sequences 170 322 341 656 189 955 GC content (%) 49 ± 8 50 ± 9 53 ± 9 Predicted ORFs 162 642 325 794 187 741 ORFs with predicted function 94 562 184 014 105 547 1Post-QC

103

5.4.3 Microbial community composition of methanogenic hydrocarbon degrading cultures

The microbial community compositions of NAPDC, SCADC, and TOLDC were determined by 16S rRNA gene pyrotag sequencing (Table 5-3) and by taxonomic profiling of unassembled metagenomic reads (Figure 5-1). Overall, the total number of OTUs, determined by

16S rRNA gene pyrotag sequencing defined by ≥95% similarity, were 153 (NAPDC), 320

(SCADC) and 147 (TOLDC), including 65, 167, and 65 singletons, respectively.

The proportion of the populations affiliated with methanogens as determined by pyrotag sequencing was 89% for NAPDC, 65% for SCADC, and 8% for TOLDC. In contrast, taxonomic assignment of metagenomic reads using MG-RAST detected higher abundance of bacterial versus archaeal reads in SCADC and NAPDC (>70% bacterial reads; Figure 5-1). Possible explanations of this discrepancy include potential primer bias favouring amplification of the methanogenic populations of NAPDC and SCADC, or the possibility of multiple 16S rRNA genes present in the genomes of the dominant methanogens from NAPDC and SCADC. The archaeal populations in all three cultures were dominated by Methanosarcinales (2 OTUs affiliated with Methanosaeta) and Methanomicrobiales (2 Methanoculleus OTUs and 1

Methanolinea OTU) (Table 5-3). These methanogens are associated with acetotrophic and hydrogenotrophic methanogenesis, suggesting that both pathways likely contribute to CH4 production in the cultures.

104

Table 5-3. The five most abundant bacterial and archaeal OTUs in methanogenic hydrocarbon degrading enrichment cultures determined by 16S rRNA gene pyrotag sequencing. Percentages represent the proportion of reads associated with each taxon relative to the domain. Phylum Percentage of reads in each taxon Family/Genus NAPDC SCADC TOLDC Bacterial OTUs 11 35 92 Firmicutes Anaerobacter 9.5 3.0 30.2 Firmicutes Lachnospiraceae 0.0 0.0 23.8 Firmicutes Desulfosporosinus 19.5 0.2 0.0 Firmicutes Desulfotomaculum 15.3 0.0 0.0 Firmicutes Sedimentibacter 0.0 0.0 11.1 Spirochaetes Spirochaetaceae 2.7 14.3 0.2 Deltaproteobacteria Smithella 0.6 11.6 0.0 Deltaproteobacteria Syntrophus 0.1 6.8 0.0 Deltaproteobacteria Geobacter 2.8 2.6 0.1 Deltaproteobacteria Desulfovibrio 0.6 4.2 0.0 Deltaproteobacteria Desulfobacterium 0.1 3.6 0.0 Synergistetes Thermanerovibrio 4.2 2.5 0.0 Chloroflexi Anaerolineaceae 0.0 0.0 5.4 Candidate division OP11 Incertae Sedis 2.4 0.0 0.0 Candidate division OP8 Incertae Sedis 0.0 0.0 3.3

Archaeal OTUs 89 65 8 Euryarchaeota Methanosaeta 1 51.5 55.9 50.6 Euryarchaeota Methanosaeta 2 5.4 5.4 2.2 Euryarchaeota Methanoculleus 1 32.1 21.3 15.1 Euryarchaeota Methanoculleus 2 3.6 2.4 0.4 Euryarchaeota Methanolinea 0.4 1.3 27.3 Euryarchaeota CandidatusMethanoregula 0.6 4.8 0.6 Euryarchaeota Methanomicrobia 1.4 1.4 0.0 Euryarchaeota WCHA1 0.2 0.3 3.0

In general, the combination of pyrotag and MG-RAST taxonomic profiling methods revealed that the bacterial communities of NAPDC and TOLDC are dominated by members of the phylum Firmicutes, followed by Proteobacteria, Bacteroidetes, Spirochaetes, and other phyla in smaller proportions (< 1% of total reads) (Figure 5-1 & Table 5-3). Despite the similarities in bacterial community structure at the phylum level, there are noteworthy taxonomic variations in the dominant OTUs associated with the Firmicutes (Table 5-3). The dominant

105

Firmicutes-related OTUs in NAPDC belong to members of Peptococcaceae (e.g.,

Desulfotomaculum and Desulfosporosinus), whereas members of the Clostridiales (e.g.

Anaerobacter, Lachnospiraceae, and Sedimentibacter) were dominant in TOLDC (Table 5-3).

The bacterial community in SCADC, as determined using metagenomic reads, was dominated by members of the Deltaproteobacteria, Spirochaetes, and Bacteroidetes (Figure 5-1) and has a greater abundance of OTUs affiliating with Spirochaetes and Syntrophaceae (e.g., Syntrophus and Smithella) and smaller proportions of Firmicutes and Bacteroidetes relative to NAPDC and

TOLDC (Table 5-3). Not surprisingly, SCADC and NAPDC shared more OTUs in common with each other than with TOLDC (Table 5-3), consistent with the similar environmental origin and substrate-exposure (e.g., alkanes) of SCADC and NAPDC.

106

Figure 5-1. Proportion of microbial communities at the taxonomic class level in NAPDC, TOLDC, and SCADC and eight other metagenomes based on assignment of 454 metagenomic reads using best hit classification against the M5NR database in MG-RAST. All metagenomes are available on MG-RAST and the associated identifications are reported in Table C-1. TP6 = Tailings Pond 6, GoM = Gulf of Mexico.

107

The high abundance of Firmicutes in TOLDC and NAPDC aligns with recent descriptions of strictly anaerobic monoaromatic hydrocarbon-degrading cultures that implicate

Firmicutes (e.g., Peptococcaceae) as primary hydrocarbon degraders (Abu Laban et al., 2009,

Winderl et al., 2010) or playing key roles alongside Deltaproteobacteria (Ficker et al., 1999,

Ulrich & Edwards, 2003, Sakai et al., 2009). This is in contrast with the microbial communities capable of anaerobic degradation of n-alkanes in which members of the Deltaproteobacteria, in particular Syntrophus/Smithella sp. have been routinely implicated in methanogenic alkane degradation (Zengler et al., 1999, Jones et al., 2008, Gray et al., 2011). Furthermore, all of the known strictly anaerobic (sulfate-reducing/syntrophic) alkane degraders are Deltaproteobacteria, including Desulfococcus oleovorans HxD3, strain Pnd3, Desulfatibacillum aliphaticivorans

CV2803, Desulfothermus naphthae TD3, Desulfatibacillum alkenivorans AK-01, Desulfoglaeba alkanexedens, and Desulfosarcina sp. BuS5 (Aeckersberg et al., 1991, Rueter et al., 1994, So &

Young, 1999, Davidova et al., 2006). There may also be a role for Firmicutes in alkane degradation, as suggested by the recent implication of a Desulfotomaculum sp. in the degradation of low-molecular weight n-alkanes (Kniemeyer et al., 2007). Likewise, a SCADC contig harbouring genes putatively associated with anaerobic n-alkane degradation affiliated with members of the Firmicutes (Tan et al., 2013). Based on the dominant OTUs in these cultures

(Table 5-3) and on the phylogenetic distribution of genes involved in activation of hydrocarbons by fumarate addition, the primary hydrocarbon degraders in NAPDC, SCADC, and TOLDC consist of different species from a few bacterial taxa. Tan et al. (2013) noted the apparent phylogenetic novelty of potential primary degraders in SCADC; this may also be true for

TOLDC and NAPDC, as metagenomic sequence reads from these cultures did not map closely to the genomes of known hydrocarbon-degraders or their close relatives (Table C-2).

108

The high diversity of microorganisms in NAPDC, SCADC, and TOLDC after multiple transfers is likely due to the presence of secondary fermenters and syntrophs (e.g., Spirochaetes,

Clostridiales) that are essential to the methanogenic growth of the whole community. In general, these organisms may be involved in the transformation of hydrocarbon degradation products such as formate and fatty acids, to methanogenic substrates (Beller & Edwards, 2000), maintaining a low redox potential and H2 partial pressure by involvement in H2 sequestration/production (Ahring et al., 1991), and/or scavenging or recycling of waste products and dead biomass within the enrichments. More specifically, homoacetogens are capable of autotrophic CO2 fixation for acetate formation. In turn, syntrophic acetate oxidizers can convert acetate into CO2 and H2 that may be utilized by the hydrogenotrophic methanogens for methanogenesis (Gray et al., 2011). Other members of the microbial community may be involved in providing essential nutrients such as vitamin B12 and amino acids for other community members (Walker et al., 2012). The stability and persistence of diverse microorganisms in methanogenic hydrocarbon-degrading cultures such as TOLDC even after incubation for more than 10 years indicates that they must be essential for syntrophic growth of the community.

5.4.4 Key metabolic and anaerobic hydrocarbon-degrading pathways

5.4.4.1 Putative genes associated with hydrocarbon-degrading pathways

Fumarate addition to hydrocarbons was first described for the degradation of toluene by

Thauera aromatica under denitrifying conditions (Biegert et al., 1996). This mechanism has since been implicated in the activation of xylenes, ethylbenzene, and 2-methylnaphthalene under sulfate- and/or iron-reducing conditions (Heider, 2007). Fumarate addition to n-alkanes has been

109

demonstrated under sulfate- and nitrate-reducing conditions thus far but has been questioned under methanogenic conditions (Aitken et al., 2013). Several other mechanisms have been demonstrated in the anaerobic activation of hydrocarbons including carboxylation (benzene, naphthalene) and hydroxylation (ethylbenzene) (Foght, 2008, Abu Laban et al., 2010, Bergmann et al., 2011, Figure 5-2a). Previous analysis of TOLDC revealed the presence of both benzylsuccinate metabolites from toluene and the presence of a bssA gene fragment (Fowler et al., 2012). Similarly, benzylsuccinate has also been observed in NAPDC cultures incubated solely with toluene (unpublished data). Metagenomic analysis of SCADC revealed the presence of ass and nms genes associated with fumarate addition to alkanes and PAHs, and fumarate addition metabolites for iso- and cycloalkanes, but not n-alkanes have been observed in this culture (Tan et al., 2013). The enrichment cultures were examined for the presence of fumarate addition genes related to activation of monoaromatic hydrocarbons (benzylsuccinate synthase,

Bss), polycyclic aromatic hydrocarbons (PAH) like 2-methylnaphthalene (naphthyl-2- methylsuccinate synthase, Nms) and n-alkanes (alkylsuccinate synthase, Ass) and alternate activation mechanisms using Hidden Markov Models (HMM) and BLASTp in order to infer the complete hydrocarbon substrate spectrum of the cultures.

110

A.

B.

111

Figure 5-2. Enzymes involved in anaerobic hydrocarbon-degradation and corresponding genes detected in the metagenomes of NAPDC, SCADC, and TOLDC. (A) Pathways for anaerobic hydrocarbon metabolism and associated enzymes. 1= Ethylbenzene, 2= xylenes, 3= toluene, 4= benzene, 5= 2-methylnaphthalene, 6= naphthalene 7= alkanes (B) Heatmap showing the abundance of various genes and putative genes involved in anaerobic hydrocarbon metabolism in the metagenomes. The scale indicates the inferred enzyme completeness. The enzymes shown are as follows: EbdABC, ethylbenzene dehydrogenase; Ped, (S)-1-phenylethanol dehydrogenase; Apc1 to Apc5, acetophenone carboxylase; Bal, benzoylacetate-CoA ligase; BssABC, benzylsuccinate synthase; BbsEF, succinyl-CoA:(R)- benzylsuccinate CoA transferase; BbsG, (R)-benzylsuccinyl-CoA dehydrogenase; BbsH, phenylitaconyl-CoA hydratase; BbsCD, 2-[hydroxyl(phenyl)methyl]- succinyl-CoA dehydrogenase; BbsAB, benzoylsuccinyl-CoA thiolase; AbcDA, anaerobic benzene carboxylase; BzlA/BamY, Benzoate-CoA ligase; BcrABCD, Benzoyl-CoA reductase (ATP- dependent); BamB to I, Benzoyl-CoA reductase (ATP-independent); NmsABC, Naphthyl- 2-methyl-succinate synthase; BnsEF, Naphthyl-2-methyl-succinate CoA transferase; BnsG, Naphthyl-2-methyl-succinate dehydrogenase; BnsH, Naphthyl-2-methylene-succinyl CoA hydratase; BnsCD, Naphthyl-2-hydroxymethyl-succinyl CoA dehydrogenase; BnsAB naphthyl-2-oxomethyl-succinyl CoA thiolase; NcrABC, 2-naphthoyl CoA reductase; AncA, Anaerobic naphthalene carboxylase; AssABC, Alkylsuccinate synthase; AssK, AMP- dependent synthetase and ligase; Mcm, Methylmalonyl CoA mutase.

5.4.4.1.1 Fumarate addition gene phylogeny

The fumarate addition genes bssA, assA, and nmsA were previously identified in SCADC

(Tan et al., 2013). Further examination of the assembled metagenomes revealed the presence of a bssA in TOLDC which was homologous to a previously detected partial bssA sequence from this culture (Fowler et al., 2012) as well as an assA. Several partial genes encoding bssA, nmsA, and assA genes were found in NAPDC (Figure 5-2b). Phylogenetic analysis of these genes and reference sequences from hydrocarbon degrading organisms reveals distinct groups of fumarate addition genes corresponding to bssA, assA, and nmsA (Figure 5-3).

A number of putative assA genes were identified in NAPDC and SCADC, and several of these share high homology with a putative assA gene from Smithella sp. ME-1 (Figure 5-3;

Smithella_SCADC, NAPDC_assA1, SCADC_assA3, Embree et al., 2013). This suggests that similar alkane degrading organisms from the inoculum source related to Smithella sp. were

112

enriched in these cultures. Though a partial putative assA gene was detected in TOLDC, it did not appear to have a close affiliation to known reference sequences or to putative assA detected in SCADC and NAPDC (Figure 5-3). Instead, the amino acid sequence of the TOLDC putative assA gene had a best BLAST hit to the assA gene in Desulfoglaeba alkenexedens ALDC

(ADJ51097, similarity 44.5%), indicating that the putative TOLDC assA may belong to a bacterial species with unique taxonomic affiliations and/or that the assA-like gene may have a different substrate spectrum (Acosta-Gonzalez et al., 2013).

Full length bssA genes with high sequence homology to one another were detected in

TOLDC, SCADC, and NAPDC (Figure 5-3; SCADC_bssA2, TOLDC_bssA1, and

NAPDC_bssA3), implying similar substrate spectrum and/or phylogeny. A single bssA gene was detected in TOLDC, homologous to a previously reported partial bssA gene (Fowler et al., 2012), suggesting that TOLDC is highly enriched in a dominant toluene degrader. The SCADC metagenome contains several bssA genes affiliating with Firmicutes or Deltaproteobacteria as well as a phylogenetically distinct bssA (SCADC_bssA1) which was not similar to any detected in TOLDC or NAPDC or reference sequences. As with the deeply branching assA detected in

TOLDC, this putative SCADC bssA may belong to a novel toluene degrader, or could have different substrate specificity (Acosta-Gonzalez et al., 2013). Although putative genes encoding bssA were identified in all of the cultures, genes encoding the remaining catalytic subunits of Bss were not identified in NAPDC (Figure 5-2b). The absence of bssB and bssC genes in the

NAPDC metagenome is surprising, as this culture is known to degrade toluene. This observation is most likely a reflection of the low sequencing depth of this metagenome (Figure C-2).

113

Figure 5-3. Maximum likelihood tree of translated assA/bssA/nmsA homologs recovered from TOLDC, SCADC, and NAPDC. Closely related sequences were recovered from the NCBI nr-database through BLASTX searches. All sequences were aligned using Muscle 3.3 (Edgar, 2004), followed by manual adjustment of poorly aligned regions and deletion of indels. Maximum likelihood tree was constructed using PhyML (Guindon et al., 2010) with WAG model and 100 bootstrap replicates. Bootstrap values ≥60 are indicated. Full length translated pyruvate formate lyase (PFL) were used as an outgroup. Sequence length of genes recovered from TOLDC, SCADC and NAPDC, and their corresponding GenBank accession numbers are indicated in brackets. A tree with the same overall topology was obtained when including only full-length sequences with gaps.

114

Whereas all three cultures contained both assA and bssA genes, only SCADC and

NAPDC contained putative nmsA genes (Figures 5-2b & 5-3). Recent evidence suggests that fumarate addition genes that cluster with nmsA may not all be associated with the activation of

PAHs, and that some may function in the activation of toluene or other monoaromatic hydrocarbons (von Netzer et al., 2013). Genes encoding NmsA and BssA exhibit a high degree of homology (Selesi et al., 2010), suggesting that enzymes involved in fumarate addition may to some extent be promiscuous and could potentially co-activate several structurally diverse substrates. For example, Azoarcus sp. HxN1 which activates n-alkanes with Ass can also co- metabolise cycloalkanes in the presence of n-alkanes (Wilkes et al., 2003). Similarly, other Ass enzymes can activate toluene in the presence of n-alkanes, whereas Bss can catalyze fumarate addition to both toluene and xylenes (Beller & Spormann, 1997a, Rabus et al., 2011). A point of interest in the comparison of the fumarate addition genes in these cultures is the relatively high abundance and diversity of fumarate addition gene alpha subunits in NAPDC and SCADC relative to TOLDC (Figure 5-3). This may be due to the relative age of NAPDC and SCADC, which were established in recent years, relative to TOLDC which was established over 10 years ago. Another contributing factor to the diversity of fumarate addition genes observed in NAPDC and SCADC may be the diversity of hydrocarbon substrates on which they have been enriched – naphtha contains both alkanes and monoaromatic hydrocarbons, while SCADC is enriched on a mixture of alkanes. The presence of multiple assA/bssA/nmsA genotypes in these cultures is of interest because hydrocarbon contaminants often exist as diverse structurally complex hydrocarbon substrates. Thus, a microbial community that can degrade multiple substrates may be useful for biotechnological applications such as in situ bioremediation and biostimulation.

However, the presence of enzyme subunits does not necessarily denote functionality, while some

115

enzymes may have the capacity to activate multiple substrates as discussed above. Further physiological studies are needed to define the complete range of substrates that these cultures can activate by fumarate addition.

5.4.4.2 Downstream anaerobic hydrocarbon degradation pathways

Following toluene activation by fumarate addition, benzylsuccinate is converted to benzoyl-CoA by a multi-subunit enzyme encoded by the bbsABCDEFGH genes (Leuthner &

Heider, 2000, Figure 5-2a; substrate 3). Similarly, other compounds activated by fumarate addition likely undergo analogous reaction sequences; for example, naphthyl-2-methylsuccinate

(Figure 5-2a; substrate 5) is degraded to naphthoyl-CoA by a homologous enzyme encoded by putative bns genes (Selesi et al., 2010). We found matches to all HMM models for bbs genes in

TOLDC and for the majority of bbs genes in NAPDC and SCADC (Figure 2b), suggesting that these genes are retained in all of the cultures, regardless of the hydrocarbon substrate used for enrichment. BLAST matches to all of the bns genes were identified in each of the cultures, although it is unknown whether these genes are involved in the degradation of

2-methylnaphthalene. Anaerobic degradation of monoaromatic compounds converges at the central intermediate benzoyl-CoA (Figure 5-2a). Further degradation proceeds by ring reduction followed by ring opening and beta-oxidation. Reductive dearomatization is catalyzed by benzoyl-CoA reductase, which exists in two different forms; an ATP-dependent benzoyl-CoA reductase found in facultative organisms (described here as bcrABCD), and an ATP-independent reductase, found in strict anaerobes (encoded by bamBCDEFGHI, Wischgoll et al., 2005). Both enzymes catalyze the conversion of benzoyl-CoA to cyclohexadienoyl-CoA. The reductive dearomatization of 2-methylnaphthalene is thought to proceed similarly, although only the genes

116

resembling those encoding the ATP-dependent enzyme (ncrABCD) have been identified (Selesi et al., 2010). We queried the three hydrocarbon-degrading metagenomes for the presence of both reductases. Matches to the alpha/delta subunits of the ATP-dependent ring reductases were found in all three cultures but beta and gamma subunits were found only in SCADC and TOLDC

(Figure 5-2b). Virtually all genes encoding the strictly anaerobic ring reductase were also found in the three cultures (Figure 5-2b), an expected result as the majority of the bacterial populations consist of strict anaerobes, rather than facultative organisms (Table 5-3).

Following alkane activation (Figure 5-2a; substrate 7), alkylsuccinates are further degraded by activation to a CoA derivative, followed by carbon-skeleton rearrangement and decarboxylation (Wilkes et al., 2002). In D. alkenivorans AK-01, it has been proposed that these reactions are catalyzed by AssK, a putative methylmalonyl-CoA mutase, and a putative methylmalonyl-CoA carboxyl transferase, respectively (Callaghan et al., 2012). The resulting fatty acid is then subject to beta-oxidation. We found tBLASTn or Pfam matches to these putative genes in all three metagenomes (Figure 5-2b). However, CoA synthetases, along with methylmalonyl CoA mutase (involved in the methylmalonyl CoA pathway) are widespread in microbes, and therefore their presence cannot be directly associated with n-alkane degradation.

Prior to carbon-skeleton rearrangement, it has been proposed that the diastereomers produced from fumarate addition, undergo an epimerization process proposed to be catalyzed by alpha- methylacyl-CoA racemase (related to family III CoA-) to produce one intermediate for carbon skeleton rearrangement (Jarling et al., 2012). In a partial ass operon found in the

SCADC sequence assembly (Tan et al. 2013), putative genes involved in n-alkane addition to fumarate and downstream degradation including alpha-methylacyl-CoA racemase, methylmalonyl-CoA mutase and beta-oxidation clustered together, suggesting that the gene

117

encoding alpha-methylacyl-CoA racemase may indeed be involved in n-alkane degradation. The putative gene encoding alpha-methylacyl-CoA racemase reported by Tan et al. (2013) was used as a probe in BLAST searches to screen TOLDC and NAPDC contigs and revealed the presence of sequence homologs that have high sequence identity (~80%) but with low sequence coverage

(<50%). Unfortunately, we could not examine the operon structure of the genes involved in n- alkane degradation in TOLDC and NAPDC due to the short length of the associated contigs, so we cannot confirm any similarity to operons from known n-alkane-degraders. However the data presented here suggest that all three cultures have the potential to degrade n-alkanes via fumarate addition.

5.4.4.3 Alternative anaerobic hydrocarbon activation mechanisms

Prior to the discovery of fumarate addition, it had been shown that under nitrate-reducing conditions, ethylbenzene can be activated by hydroxylation to produce (S)-1-phenylethanol

(Figure 5-2a; substrate 1), catalyzed by ethylbenzene dehydrogenase (Ebd, encoded by ebdABC)

(Kniemeyer & Heider, 2001) followed by a series of steps leading to benzoyl-CoA (Rabus and

Widdel 1995). Genes similar to known ebd genes were not abundant in the three metagenomes, suggesting that ethylbenzene degradation by hydroxylation is not common in the cultures (Figure

5-2b). More recently, it has been proposed that the sulfate-reducing deltaproteobacterium

Desulfococcus oleovorans Hxd3, which was previously proposed to activate alkanes by carboxylation, actually activates alkanes at C2 by hydroxylation using an enzyme homologous to ethylbenzene dehydrogenase to produce a secondary alcohol (Callaghan et al., 2013). tBLASTn searches against the assembled contigs of TOLDC, SCADC, and NAPDC using ebdA in D. oleovorans Hxd3 (Dole_0194) recovered a few homologs, however, all genes that were

118

identified had higher sequence homology to genes involved in unrelated pathways (e.g. DMSO dehydrogenase and nitrate reductase) (data not shown), suggesting that these genes are likely not involved in ethylbenzene or alkane hydroxylation.

A variety of mechanisms including hydroxylation or methylation have been proposed for the activation of unsubstituted aromatic hydrocarbons (e.g., benzene and naphthalene) (Foght,

2008), although the genes responsible for these processes have not been identified. Recently, putative genes encoding a benzene carboxylase (abcDA) were identified under iron-reducing conditions (Abu Laban et al., 2010, Figure 5-2a; substrate 4). Genes encoding a putative naphthalene carboxylase (Figure 5-2) with high sequence identity to the putative benzene carboxylase were also identified along with a putative naphthoyl-CoA ligase in a sulfate- reducing culture (Bergmann et al., 2011). We screened the cultures for the presence of similar carboxylases by tBLASTn using abcDA and ancAB as probes. Several genes with homology to the alpha subunit of benzene carboxylases were found in the three metagenomes, however no delta subunits were identified (Figure 5-2b). Similarly, matches to the CoA- of benzene and naphthalene carboxylation (bzlA/bamY) were also identified (Figure 5-2b), but none were observed on contigs adjacent to putative benzene carboxylase genes, as was previously observed

(Abu Laban et al. 2010). Thus, the degradative potential represented by these sequences is unknown.

In summary, despite maintenance of the cultures on different hydrocarbon substrates, gene annotation suggests that all three cultures harbour the genetic potential to degrade alkanes and toluene analogs using fumarate addition mechanisms. In addition, NAPDC and SCADC may be able to metabolize 2-methylnaphthalene by fumarate addition. All three cultures are capable of anaerobic benzoate degradation, with the genes for the strictly anaerobic benzoyl-CoA

119

reductase (bam) more prevalent than the ATP-dependent type (bcr). Carboxylase subunits similar to putative benzene and naphthalene carboxylases were identified in all of the cultures.

Physiological studies are needed to definitively demonstrate the degradative range of these cultures, but it appears that each has the potential to utilize a diverse range of substrates.

5.4.4.4 Methanogenesis

The presence of genes encoding pathways for hydrogenotrophic, acetotrophic, and methylotrophic methanogenesis (Figure 5-4a) was examined using Pfam models. We found hits for all relevant models for hydrogenotrophic and acetotrophic methanogenesis in the three metagenomes. However, Pfam matches to MtaB (pf12176), involved in methylotrophic methanogenesis, were not found in any of the cultures (Figure 5-4b), suggesting either that methylotrophic methanogenesis does not occur, (or does not occur to a great extent) or that this gene escaped sequencing and/or assembly. To ensure that the taxonomic affiliations of Pfam matches were appropriate for methanogenesis genes, the contigs containing sequences of interest were compared to the NCBI NR database using BLASTn. The best BLAST hits indicated that different metabolic groups of methanogens dominate in the three cultures. NAPDC appeared to be dominated by the hydrogenotrophic methanogen Methanoculleus sp., whereas SCADC and

TOLDC harboured a greater diversity of methanogens, including the hydrogenotrophs

Methanoculleus sp. and Methanoregula sp., and the acetotroph Methanosaeta sp. (Figure 5-4b).

Notably, the BLASTn contig assignments for NAPDC did not align with the 16S rRNA gene pyrotag results reported here (Table 5-3) in which ~52% of the archaeal sequences amplified from NAPDC were affiliated with Methanosaeta spp. Interestingly, mapping unassembled reads from each of the metagenomes to the reference genome of Methanosaeta concilii GP6 revealed

120

that although SCADC and TOLDC exhibited a high degree of mapping (96.5 and 89.1% reads mapped with >96% identity, respectively), mapping the NAPDC raw reads was less successful

(64.1% mapped with >98% identity) (Table C-2). This suggests that, although Methanosaeta spp. are present in all three cultures, they are present in lower abundance in NAPDC than in

TOLDC and SCADC, resulting in fewer reads representing Methanosaeta spp. in the NAPDC metagenome. This also implies that PCR bias resulted in overrepresentation of Methanosaeta in

NAPDC pyrotags.

In the hydrogenotrophic pathway of methanogenesis, the fourth reaction is the conversion of methenyltetrahydromethanopterin to methylenetetrahydromethanopterin (Figure 5-4a). This reaction can be catalysed by either the H2-dependent 5,10-methylenetetrahydromethanopterin dehydrogenase (encoded by hmd genes) or the F420-dependent methylene-5,6,7,8- tetrahydromethanopterin dehydrogenase (encoded by mtd genes). We did not detect hmd genes in any of the hydrocarbon-degrading cultures, but did identify mtd in all three cultures. This result agrees with the observation that the archaeal community in the cultures is dominated by members of the class Methanomicrobia (Table 5-3) that catalyze this reaction using the F420- dependent hydrogenase rather than via the H2-dependent version.

121

Figure 5-4. Enzymes involved in methanogenesis and corresponding genes detected in the metagenomes of NAPDC, SCADC and TOLDC. (A) Pathways for acetotrophic, hydrogenotrophic, and methylotrophic methanogenesis (Thauer et al., 1998) (B) Heatmap showing the relative abundance of genes and putative genes detected in dominant members of the methanogenic enrichment culture metagenomes. Mc; Methanoculleus spp., Ms; Methanosaeta spp., Mr; Methanoregula spp., Oth; other methanogens. The scale indicates the inferred pathway completeness. The enzymes shown are as follows: Fmd/Fwd, Formylmethanofuran dehydrogenase; Ftr, Formylmethanofuran formyltransferase; Mch, Methenyl-H4MPT cyclohydrolase; Mtd, F420-dependent methylene-H4MPT dehydrogenase; Hmd, H2-dependent methylene-H4MPT dehydrogenase; Mer, Methylene- H4MPT reductase; Mtr, methyl-H4MPT methyltransferase; Mcr, Methyl-coenzyme M methylreductase; Hdr, Heterodisulfide reductase; CODH/ACS, Carbon-monoxide dehydrogenase/Acetyl-CoA synthase; AK, Acetate kinase; Pta, Phosphotransacetylase; Mta, Methanol:coenzyme M methyltransferase.

122

5.4.5 Functional comparison of methanogenic hydrocarbon degrading cultures to other environments

In addition to analysing the NAPDC, SCADC, and TOLDC metagenomes, we obtained a metagenome from mature fine tailings of Syncrude’s MLSB, the tailings pond from which

NAPDC and SCADC were originally derived. This metagenome was sequenced by 454 pyrosequencing and was subjected to QC and annotation as described for the other cultures.

Other metagenomes included in this comparison were from environments including another oil sands tailings pond (Suncor Tailings Pond 6) (An et al., 2013), marine sediments from the Gulf of Mexico following the Deep Horizon oil spill (Kimes et al., 2013) as well as 38 other metagenomes from a wide range of environments with variable physicochemical properties (e.g. marine habitats, sludge) (Table C-1). Principal component analysis (PCA) was performed based on the relative abundance of SEED functional categories (subsystems level 3) determined in

MG-RAST V2 (Meyer et al., 2008). Overall, we found that metagenomes from each type of environment and from enrichment cultures were more functionally related to each other than to metagenomes derived from other environments (Figure 5-5), likely due to selection pressures imposed by diverse environmental conditions. The metagenomes clustered into four distinct groups; (1) terrestrial environments including hot springs and soil, (2) sludge, (3) marine samples including lagoon and marine sediments, as well as the oil-impacted Gulf of Mexico samples, and

(4) hydrocarbon-impacted samples including the methanogenic hydrocarbon degrading enrichments, tailings ponds and dechlorinating enrichments (Figure 5-5). NAPDC, SCADC, and

TOLDC were found to be more functionally similar to each other than to all other environments, including the tailings pond (MLSB) from which NAPDC and SCADC were enriched. They also grouped closely with a group of dechlorinating enrichment cultures derived from contaminated

123

environments. These dechlorinating cultures are also methanogenic enrichments, and the environments from which they were derived were often co-contaminated with chlorinated compounds and hydrocarbons (Hug et al., 2012), indicating that they share several features with the methanogenic hydrocarbon degrading cultures but have been enriched on chlorinated hydrocarbons. Interestingly, the metagenomes from sediments from the Gulf of Mexico grouped more closely with other marine samples and lagoon sediments than with hydrocarbon-impacted environments, despite their recent exposure to hydrocarbons during the Deep Horizon oil spill.

124

Figure 5-5. Principal component analysis of 45 metagenomes available in MG-RAST including TOLDC, SCADC and NAPDC (Table C-1). Symbols are colored according to the environment of origin. All counts were normalized against total annotated sequences of each metagenome. Metagenomes from related environments are circled in dotted lines.

125

Taxonomic analysis of cultures impacted by hydrocarbons including the methanogenic hydrocarbon degrading enrichments, tailings ponds, Gulf of Mexico marine sediments and the dechlorinating cultures revealed that all of these cultures contained methanogenic archaea indicating that they are all anoxic environments, or contain anoxic microenvironments (Figure 5-

1). Furthermore, previous analyses revealed the presence of genes associated with fumarate addition in Tailings Pond 6 and Gulf of Mexico marine sediments (An et al., 2013, Kimes et al.,

2013), suggesting that this is a widespread mechanism of hydrocarbon activation in anoxic environments. To further compare enriched functions in the methanogenic hydrocarbon degrading enrichment cultures with other hydrocarbon-impacted environments, we performed a three-way comparison of pooled metagenomes from the methanogenic hydrocarbon degrading enrichments, tailings ponds, and Gulf of Mexico marine sediments. Metagenomes from the Gulf of Mexico sediments do not share much functional potential with the methanogenic hydrocarbon degrading enrichments, and their microbial communities, characterized by an abundance of

Alphaproteobacteria and Gammaproteobacteria are distinct from those present in the methanogenic enrichments and oil sands tailings ponds (Figure 5-1 & Figure 5-6). The Gulf of

Mexico metagenomes shared some functional similarities with tailings ponds, particularly related to sulfur cycling, (likely due to the high abundance of sulfur compounds in both marine and tailings pond environments), as well as denitrification processes. The specific functions unique to the Gulf of Mexico metagenomes included dimethylsulfoniopropionate (DMSP) breakdown and

CO dehydrogenases which are key functions associated with marine environments (van der

Maarel et al., 1996). Despite the recent exposure of these sediments to crude oil following the

Deep Horizon oil spill, there was a notable absence of functions specifically related to hydrocarbon metabolism (Figure 5-6).

126

Figure 5-6. Ternary plot showing three-way comparisons of functional categories in SEED subsystems level 3 for different groups of metagenomes: methanogenic hydrocarbon- degrading cultures (TOLDC, SCADC, and NAPDC); GM (three metagenomes from Gulf of Mexico marine sediments); and, TP (Two metagenomes of oil sands tailings ponds) (see Table C-1 for details of metagenomes). Each point on the ternary plot represents a subsystem category of the three groups of pooled metagenomes, with the proportion of each being normalized to a value of 1.0. Data points that are coloured represent functions that are significantly enriched in a given group of metagenomes, while points in gray are not significantly enriched in any of the groups.

127

MLSB and Tailings Pond 6 are both oil sands tailings ponds located in Northern Alberta,

Canada that are managed by different operators. Both operators use naphtha as a diluent, components of which can serve as a substrate for methane production (Siddique et al., 2006,

Siddique et al., 2007). Based on PCA analysis, the metagenomes obtained from the two tailings ponds had similar genetic potentials, and were more similar to one another than to SCADC and

NAPDC that were enriched from mature fine tailings from MLSB. Both Tailings Pond 6 and

MLSB harbour microbes capable of anaerobic alkane and aromatic hydrocarbon metabolism by fumarate addition (An et al., 2013, Tan & Foght, unpublished). Three-way comparative analysis revealed that the metagenomes of the oil sands tailings pond are enriched in functions associated with aerobic pollutant and hydrocarbon metabolism (Figure 5-6). This is a result of the oxic conditions in the surface layers, and the ponds are known to harbour a high abundance of Beta- and Gammaproteobacteria including Burkholderia, Pseudomonas, and Rhodococcus (Figure 5-

1), genera which have previously been associated with aerobic hydrocarbon metabolism (Das &

Chandran, 2011). Functions associated with nitrate reduction and nitrogen cycling were also enriched in the tailings ponds, however, it is unlikely that this is an important process in situ due to the absence of nitrate as a terminal electron acceptor in the ponds (Penner & Foght, 2010). In deeper layers of Tailings Pond 6 the microbial communities have been shown to consist mainly of syntrophic bacteria, sulfate reducing bacteria, and methanogens. The presence of gypsum

(CaSO4), in this pond, (used to promote densification), stimulates sulfate reduction (Ramos-

Padron et al., 2011), a function which was also enriched in tailings ponds relative to the methanogenic hydrocarbon degrading cultures. Oil sands tailings ponds do share some functions in common with the methanogenic hydrocarbon degrading cultures, associated with anaerobic or methanogenic metabolism (Figure 5-6, Functional group I). These features, including those

128

associated with hydrogen and formate formation and methanogenesis, and regulation of redox conditions (CoA-disulfide redox systems) seem to be specifically enriched in the methanogenic hydrocarbon degrading cultures. To examine the individual contribution of each of the methanogenic enrichment cultures to the overall functional profile of the methanogenic hydrocarbon degrading cultures (Figure 5-6), we compared the three methanogenic hydrocarbon degrading cultures to each other (Figure C-3). The features found to be enriched in any one of the three cultures were related to non-specific functions that are likely associated with individual taxa in each of the cultures, while key functions related to methanogenesis, anaerobic hydrocarbon metabolism, redox condition regulation and hydrogen and formate transfer are shared amongst the three cultures. The finding that NAPDC, SCADC, and TOLDC share similar genetic potentials despite being enriched from two very different environments illustrates that methanogenic cultures consist of functionally specialized microbial communities. Therefore the establishment and study of these cultures can allow the detailed study of syntrophic processes in complex communities.

5.5 Conclusions

The three methanogenic hydrocarbon degrading enrichments studied here shared marked similarities in microbial community composition. Though there is variation in the specific OTUs present, and in the relative contribution of different taxa to the microbial communities, the major taxonomic groups present were similar across the three cultures. Both hydrogenotrophic and acetotrophic methanogenesis appear to be active in all cultures. Each of the cultures was found to have the genetic potential to degrade multiple hydrocarbon substrates, with fumarate addition being a key anaerobic hydrocarbon activation mechanism in all of the cultures.

129

Despite taxonomic similarities to other environments, and taxonomic differences between

NAPDC, SCADC, and TOLDC, the methanogenic hydrocarbon degrading cultures are distinct from other hydrocarbon impacted environments including the tailings pond from which two of the cultures were derived. Specialized functions are related to methanogenesis, anaerobic hydrocarbon metabolism, regulation of redox conditions and assorted hydrogenases and formate dehydrogenases likely involved in hydrogen and formate production for interspecies metabolite transfer. As methanogenic hydrocarbon communities appear to comprise a distinct functional environment, the establishment and study of these cultures can provide fundamental information about syntrophic processes in methanogenic environments.

5.6 References

Abu Laban N, Selesi D, Jobelius C & Meckenstock RU (2009) Anaerobic benzene degradation by Gram-positive sulfate-reducing bacteria. FEMS Microbiol Ecol 68: 300-311.

Abu Laban N, Selesi D, Rattei T, Tischler P & Meckenstock RU (2010) Identification of enzymes involved in anaerobic benzene degradation by a strictly anaerobic iron-reducing enrichment culture. Environ Microbiol 12: 2783-2796.

Acosta-Gonzalez A, Rossello-Mora R & Marques S (2013) Diversity of benzylsuccinate synthase-like (bssA) genes in hydrocarbon-polluted marine sediments suggests substrate- dependent clustering. Appl Environ Microbiol 79: 3667-3676.

Aeckersberg F, Bak F & Widdel F (1991) Anaerobic oxidation of saturated hydrocarbons to CO2 by a new type of sulfate-reducing bacterium. Arch Microbiol 156: 5-14.

Ahring BK, Westermann P & Mah RA (1991) Hydrogen inhibition of acetate metabolism and kinetics of hydrogen consumption by Methanosarcina thermophila TM-1. Arch Microbiol 157: 38-42.

Aitken CM, Jones DM, Maguire MJ, Gray ND, Sherry A, Bowler BFJ, Ditchfield AK, Larter SR & Head IM (2013) Evidence that crude oil alkane activation proceeds by different mechanisms under sulfate-reducing and methanogenic conditions. Geochim Cosmochim Ac 109: 162-174.

130

An D, Brown D, Chatterjee I, et al. (2013) Microbial community and potential functional gene diversity involved in anaerobic hydrocarbon degradation and methanogenesis in an oil sands tailings pond. Genome 56: 612-618.

Beller HR & Spormann AM (1997) Anaerobic activation of toluene and o-xylene by addition to fumarate in denitrifying strain T. J Bacteriol 179: 670-676.

Beller HR & Edwards EA (2000) Anaerobic toluene activation by benzylsuccinate synthase in a highly enriched methanogenic culture. Appl Environ Microbiol 66: 5503-5505.

Bergmann FD, Selesi D & Meckenstock RU (2011) Identification of new enzymes potentially involved in anaerobic naphthalene degradation by the sulfate-reducing enrichment culture N47. Arch Microbiol 193: 241-250.

Biegert T, Fuchs G & Heider F (1996) Evidence that anaerobic oxidation of toluene in the denitrifying bacterium Thauera aromatica is initiated by formation of benzylsuccinate from toluene and fumarate. Eur J Biochem 238: 661-668.

Callaghan AV, Davidova IA, Savage-Ashlock K, Parisi VA, Gieg LM, Suflita JM, Kukor JJ & Wawrik B (2010) Diversity of benzyl and alkylsuccinate synthase genes in hydrocarbon- impacted environments and enrichment cultures. Environ Sci Technol 44: 7287-7294.

Callaghan AV, Morris BEL, Pereira IAC, et al. (2012) The genome sequence of Desulfatibacillum alkenivorans AK-01: A blueprint for anaerobic alkane oxidation. Environ Microbiol 14: 101-113.

Callaghan AV (2013) Enzymes involved in the anaerobic oxidation of n-alkanes: From methane to long-chain parrafins. Front Microbiol 4: 89.

Chang W, Um Y & Pulliam Holoman T (2005) Molecular characterization of anaerobic microbial communities from benzene-degrading sediments under methanogenic conditions. Biotechnol Prog 21: 1789-1794.

Das N & Chandran P (2011) Microbial degradation of petroleum hydrocarbon contaminants: An overview. Biotechnol Res Int 2011: 941810.

Davidova IA, Duncan KE, Choi OK & Suflita JM (2006) Desulfoglaeba alkanexedens gen. nov., sp nov., an n-alkane-degrading, sulfate-reducing bacterium. Int J Syst Evol Micr 56: 2737-2742.

Edgar RC (2004) MUSCLE: Multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res 32: 1792-1797.

Embree M, Nagarajan H, Movahedi N, Chitsaz H & Zengler K (2014) Single-cell genome and metatranscriptome sequencing reveal metabolic interactions of an alkane-degrading methanogenic community. ISME J 8: 757-767.

131

Ficker M, Krastel K, Orlicky S & Edwards E (1999) Molecular characterization of a toluene- degrading methanogenic consortium. Appl Environ Microbiol 65: 5576-5585.

Finn, RD, Mistry J, Tate J, et al. (2010) The Pfam protein families database. Nucleic Acids Res 38: D211-222.

Foght J (2008) Anaerobic biodegradation of aromatic hydrocarbons: Pathways and prospects. J Mol Microbiol Biotechnol 15: 93-120.

Foght J, Aislabie J, Turner S, Brown CE, Ryburn J, Saul DJ & Lawson W (2004) Culturable bacteria in subglacial sediments and ice from two southern hemisphere glaciers. Microb Ecol 47: 329-340.

Fowler SJ, Dong XL, Sensen CW, Suflita JM & Gieg LM (2012) Methanogenic toluene metabolism: Community structure and intermediates. Environ Microbiol 14: 754-764.

Gieg LM, Kolhatkar RV, McInerney MJ, Tanner RS, Harris SH, Sublette KL & Suflita JM (1999) Intrinsic bioremediation of petroleum hydrocarbons in a gas condensate-contaminated aquifer. Environ Sci Technol 33: 2550-2560.

Gray ND, Sherry A, Grant RJ, et al. (2011) The quantitative significance of Syntrophaceae and syntrophic partnerships in methanogenic degradation of crude oil alkanes. Environ Microbiol 13: 2957-2975.

Guindon S, Dufayard JF, Lefort V, Anisimova M, Hordijk W & Gascuel O (2010) New algorithms and methods to estimate maximum-likelihood phylogenies: Assessing the performance of PhyML 3.0. Syst Biol 59: 307-321.

Haque MM, Ghosh TS, Komanduri D & Mande SS (2009) SOrt-ITEMS: Sequence orthology based approach for improved taxonomic estimation of metagenomic sequences. Bioinformatics 25: 1722-1730.

Heider J (2007) Adding handles to unhandy substrates: anaerobic hydrocarbon activation mechanisms. Curr Opin Chem Biol 11: 188-194.

Hug LA, Beiko RG, Rowe AR, Richardson RE & Edwards EA (2012) Comparative metagenomics of three Dehalococcoides-containing enrichment cultures: the role of the non- dechlorinating community. BMC Genomics 13: 327.

Jarling R, Sadeghi M, Drozdowska M, Lahme S, Buckel W, Rabus R, Widdel F, Golding BT & Wilkes H (2012) Stereochemical investigations reveal the mechanism of the bacterial activation of n-alkanes without oxygen. Angewandte Chem Int Edit 51: 1334-1338.

132

Jones DM, Head IM, Gray ND, et al. (2008) Crude-oil biodegradation via methanogenesis in subsurface petroleum reservoirs. Nature 451: 176-180.

Kasai Y, Takahata Y, Hoaki T & Watanabe K (2005) Physiological and molecular characterization of a microbial community established in unsaturated, petroleum-contaminated soil. Environ Microbiol 7: 806-818.

Kato S, Kosaka T & Watanabe K (2009) Substrate-dependent transcriptomic shifts in Pelotomaculum thermopropionicum grown in syntrophic co-culture with Methanothermobacter thermautotrophicus. Microb Biotechnol 2: 575-584.

Kimes NE, Callaghan AV, Aktas DF, Smith WL, Sunner J, Golding B, Drozdowska M, Hazen TC, Suflita JM & Morris PJ (2013) Metagenomic analysis and metabolite profiling of deep-sea sediments from the Gulf of Mexico following the Deepwater Horizon oil spill. Front Microbiol 4: 50.

Kleinsteuber S, Schleinitz KM & Vogt C (2012) Key players and team play: Anaerobic microbial communities in hydrocarbon-contaminated aquifers. Appl Microbiol Biotech 94: 851- 873.

Kniemeyer O & Heider J (2001) Ethylbenzene dehydrogenase, a novel hydrocarbon-oxidizing molybdenum/iron-sulfur/heme enzyme. J Biol Chem 276: 21381-21386.

Kniemeyer O, Musat F, Sievert SM, et al. (2007) Anaerobic oxidation of short-chain hydrocarbons by marine sulphate-reducing bacteria. Nature 449: 898-901.

Kunin V, Engelbrektson A, Ochman H & Hugenholtz P (2010) Wrinkles in the rare biosphere: pyrosequencing errors can lead to artificial inflation of diversity estimates. Environ Microbiol 12: 118-123.

Leuthner B & Heider J (2000) Anaerobic toluene catabolism of Thauera aromatica: The bbs operon codes for enzymes of beta oxidation of the intermediate benzylsuccinate. J Bacteriol 182: 272-277.

Lykidis A, Chen CL, Tringe SG, et al. (2011) Multiple syntrophic interactions in a terephthalate- degrading methanogenic consortium. ISME J 5: 122-130.

Meyer F, Paarmann D, D'Souza M, et al. (2008) The metagenomics RAST server - a public resource for the automatic phylogenetic and functional analysis of metagenomes. BMC Bioinformatics 9: 386.

Mountfort D & Bryant M (1982) Isolation and characterization of an anaerobic syntrophic benzoate-degrading bacterium from sewage sludge. Arch Microbiol 133: 249-256.

133

Notredame C, Higgins DG & Heringa J (2000) T-Coffee: A novel method for fast and accurate multiple sequence alignment. J Mol Biol 302: 205-217.

Parks DH & Beiko RG (2010) Identifying biologically relevant differences between metagenomic communities. Bioinformatics 26: 715-721.

Penner TJ & Foght JM (2010) Mature fine tailings from oil sands processing harbour diverse methanogenic communities. Can J Microbiol 56: 459-470.

Qiu Y, Sekiguchi Y, Imachi H, Kamagata Y, Tseng IC, Cheng S, Ohashi A & Harada H (2004) Identification and isolation of anaerobic, syntrophic phthalate isomer-degrading microbes from methanogenic sludges treating wastewater from terephthalate manufacturing. Appl Environ Microbiol 70: 1617-1626.

Rabus R, Jarling R, Lahme S, Kuhner S, Heider J, Widdel F & Wilkes H (2011) Co-metabolic conversion of toluene in anaerobic n-alkane-degrading bacteria. Environ Microbiol 13: 2576- 2585.

Ramos-Padron E, Bordenave S, Lin SP, Bhaskar IM, Dong XL, Sensen CW, Fournier J, Voordouw G & Gieg LM (2011) Carbon and sulfur cycling by microbial communities in a gypsum-treated oil sands tailings pond. Environ Sci Technol 45: 439-446.

Rueter P, Rabus R, Wilkes H, Aeckersberg F, Rainey FA, Jannasch HW & Widdel F (1994) Anaerobic oxidation of hydrocarbons in crude-oil by new types of sulfate-reducing bacteria. Nature 372: 455-458.

Sakai N, Kurisu F, Yagi O, Nakajima F & Yamamoto K (2009) Identification of putative benzene-degrading bacteria in methanogenic enrichment cultures. J Biosci Bioeng 108: 501-507.

Schink B (1997) Energetics of syntrophic cooperation in methanogenic degradation. Microbiol Mol Biol Rev 61: 262-280.

Selesi D, Jehmlich N, von Bergen M, Schmidt F, Rattei T, Tischler P, Lueders T & Meckenstock RU (2010) Combined genomic and proteomic approaches identify gene clusters involved in anaerobic 2-methylnaphthalene degradation in the sulfate-reducing enrichment culture N47. J Bacteriol 192: 295-306.

Siddique T, Fedorak PM & Foght JM (2006) Biodegradation of short-chain n-alkanes in oil sands tailings under methanogenic conditions. Environ Sci Technol 40: 5459-5464.

Siddique T, Fedorak PM, McKinnon MD & Foght JM (2007) Metabolism of BTEX and naphtha compounds to methane in oil sands tailings. Environ Sci Technol 41: 2350-2356.

134

Siddique T, Penner T, Semple K & Foght JM (2011) Anaerobic Biodegradation of Longer-Chain n-Alkanes Coupled to Methane Production in Oil Sands Tailings. Environ Sci Technol 45: 5892- 5899.

So CM & Young LY (1999) Isolation and characterization of a sulfate-reducing bacterium that anaerobically degrades alkanes. Appl Environ Microb 65: 2969-2976.

Soh J, Dong X, Caffrey SM, Voordouw G & Sensen CW (2013) Phoenix 2: A locally installable large-scale 16S rRNA gene sequence analysis pipeline with web interface. J Biotechnol 167: 393-403.

Tan B, Dong XL, Sensen CW & Foght JM (2013) Metagenomic analysis of an anaerobic alkane- degrading microbial culture: potential hydrocarbon-activating pathways and inferred roles of community members. Genome 56: 1-13.

Thauer RK (1998) Biochemistry of methanogenesis: A tribute to Marjory Stephenson. Microbiol 144: 2377-2406.

Ulrich AC & Edwards EA (2003) Physiological and molecular characterization of anaerobic benzene-degrading mixed cultures. Environ Microbiol 5: 92-102. van der Maarel M, Jansen M, Haanstra R, Meijer WG & Hansen TA (1996) Demethylation of dimethylsulfoniopropionate to 3-S-methylmercaptopropionate by marine sulfate-reducing bacteria. Appl Environ Microbiol 62: 3978-3984. von Netzer F, Pilloni G, Kleindienst S, Krueger M, Knittel K, Gruendger F & Lueders T (2013) Enhanced gene detection assays for fumarate-adding enzymes allow uncovering of anaerobic hydrocarbon degraders in terrestrial and marine systems. Appl Environ Microbiol 79: 543-552.

Walker CB, Redding-Johanson AM, Baidoo EE, et al. (2012) Functional responses of methanogenic archaea to syntrophic growth. ISME J 6: 2045-2055.

Washer CE & Edwards EA (2007) Identification and expression of benzylsuccinate synthase genes in a toluene-degrading methanogenic consortium. Appl Environ Microb 73: 1367-1369.

Wawrik B, Mendivelso M, Parisi VA, et al. (2012) Field and laboratory studies on the bioconversion of coal to methane in the San Juan Basin. FEMS Microbiol Ecol 81: 26-42.

Widdel F & Bak F (1992) Gram-negative mesophilic sulfate-reducing bacteria. The Prokaryotes, (Balows A, Trüper H, Dworkin M, Harder W & Schleifer K, eds) pp. IV: 3352–3378. Springer- Verlag, New York, USA.

Wilkes H, Rabus R, Fischer T, Armstroff A, Behrends A & Widdel F (2002) Anaerobic degradation of n-hexane in a denitrifying bacterium: Further degradation of the initial

135

intermediate (1-methylpentyl)succinate via C-skeleton rearrangement. Arch Microbiol 177: 235- 243.

Wilkes H, Kuhner S, Bolm C, Fischer T, Classen A, Widdel F & Rabus R (2003) Formation of n-alkane- and cycloalkane-derived organic acids during anaerobic growth of a denitrifying bacterium with crude oil. Org Geochem 34: 1313-1323.

Winderl C, Penning H, von Netzer F, Meckenstock RU & Lueders T (2010) DNA-SIP identifies sulfate-reducing Clostridia as important toluene degraders in tar-oil-contaminated aquifer sediment. ISME J 4: 1314-1325.

Wischgoll S, Heintz D, Peters F, Erxleben A, Sarnighausen E, Reski R, van Dorsselaer A & Boll M (2005) Gene clusters involved in anaerobic benzoate degradation of Geobacter metallireducens. Mol Microbiol 58: 1238-1252.

Zengler K, Richnow HH, Rossello-Mora R, Michaelis W & Widdel F (1999) Methane formation from long-chain alkanes by anaerobic microorganisms. Nature 401: 266-269.

136

Preface

Chapter 6 presents and describes the metagenome of the toluene degrading enrichment culture. Using data from the metagenome, further evidence was provided for the model described for toluene degradation in Chapter 4. Binning of the metagenome further confirmed the identity of the key toluene degrading organism as Desulfosporosinus sp., as described in Chapter 4, and allowed further description of the putative alkane degradation pathway discovered in this culture

(Chapter 5). Pathway analysis of the binned data allowed us to further elucidate putative roles of individual members of the culture. In addition, an investigation into possible mechanisms used by members of the culture to coordinate their metabolism was initiated.

137

Chapter Six: Metagenomic analysis of a toluene degrading methanogenic enrichment culture

6.1 Introduction

Methanogenic degradation of organic matter is a key process in natural and engineered environments. The methanogenic metabolism of hydrocarbons has come to be recognized as a key biogeochemical process that can result in the production of heavy and ultra-heavy oil deposits over geologic time (Jones et al., 2008). For the degradation of hydrocarbons under methanogenic conditions to be energetically feasible, coordination of metabolism is required between the syntrophic bacteria that carry out the activation and subsequent degradation of hydrocarbon substrates, and the methanogens that efficiently remove intermediates of metabolism and produce the end product, methane. The mechanisms governing the activation of hydrocarbons as well as subsequent degradation pathways under methanogenic conditions are only beginning to be described (Berdugo-Clavijo et al., 2012, Fowler et al., 2012, Tan et al.,

2013). Recent studies of methanogenic metabolism indicate that fumarate addition is a key mechanism for the activation of substituted monoaromatic and aliphatic substrates (Chapter 5,

Fowler et al., 2012, Tan et al., 2013), though other activation mechanisms are likely also active under methanogenic conditions (Aitken et al., 2013).

We carried out metagenomic sequencing of a toluene degrading enrichment (Fowler et al.,

2012) using both 454 pyrosequencing and Illumina paired-end sequencing. While we have a grasp of the identity of major community members and hydrocarbon degraders as well as the mechanisms of hydrocarbon activation, we do not have a firm understanding of the roles of the diverse microbes present in this culture or how and with whom they develop and maintain syntrophic relationships. Analysis of the metagenome allows a more in-depth view of the genetic

138

potential of this culture allowing us to provide further support for previous findings, and to aid in improving our current model for methanogenesis from toluene in this culture. These results also support the development of additional hypotheses regarding syntrophic interactions and diverse hydrocarbon metabolism in this culture and inform further physiological and molecular studies with this culture in an overall effort to improve the current understanding of methanogenic hydrocarbon metabolism.

6.2 Methods

6.2.1 Culture incubations, DNA extraction and sequencing

Routine cultivation of the toluene degrading culture (designated TOLDC) has been previously described (Fowler et al., 2012). Briefly, the culture is incubated at room temperature in a bicarbonate-buffered minimal medium with 80% N2, 20% CO2 headspace with the addition of approximately 0.01% (v/v) toluene. For Illumina paired-end sequencing, DNA was extracted according to the phenol-chloroform with bead-beating method described previously (Fowler et al., 2012). DNA extraction for 454 sequencing was described in Chapter 5, and involved filtering culture fluids through a 0.2 µm filter, followed by phenol-chloroform extraction and cesium chloride purification (Wright, 2009). DNA extraction for fosmid libraries was performed as per

454 sequencing and fosmid libraries were prepared at the lab of Dr. Steven Hallam at the

University of British Columbia (UBC) (Taupp et al., 2009). Paired-end Sanger sequencing of

7680 randomly selected fosmids was carried out at the Michael Smith Genome Sciences Centre

(UBC, Vancouver, Canada). Approximately 3 µg each of DNA was sent for sequencing using

454 GS FLX, and Illumina HiSeq2000 (150 cycles) at the Genome Quebec Innovation Centre

(McGill University, Montreal, Canada).

139

6.2.2 Quality control, assembly, ORF prediction and annotation

Reads from 454 sequencing underwent quality control using an in-house developed pipeline that removed sequences which i) contained ambiguous bases, ii) had a quality score below 25, iii) contained homopolymer lengths greater than 6, iv) were shorter than 100 bp, v) had artificial duplicates. Sanger read quality control was similar to above. Following quality control, 454 and Sanger reads were co-assembled using Newbler V2.6 as was described in

Chapter 5. Illumina reads underwent a slightly modified quality control method specialized for

Illumina which removed sequences i) containing spike-in PhiX sequence, ii) that were shorter than 50 bp after removal of partial primer, adapter and low quality regions at ends, and iii) that were of low complexity. Duplicated read pairs derived from PCR amplification during library preparation were consolidated into a single consensus read pair (Hess et al., 2011). Illumina reads were assembled using SOAPdenovo V.1.05. The assemblies for Illumina and 454 data were merged using minimus2 from the AMOS package (Sommer et al., 2007). The assembled metagenome was submitted to MG-RAST (4527900.3) and IMG (3300001567) for ORF prediction and annotation. The annotation of genes predicted to be involved in hydrocarbon activation and subsequent degradation, as well as benzoyl-CoA degradation were manually curated as these genes are often found to be misannotated by automated annotation systems.

Identification of these genes was conducted using in-house HMMs, as described in Chapter 5, or by BLASTp of relevant sequences when sufficient sequence data for HMM construction was not available. In cases where genes or contigs are associated with specific taxa, this was determined based either on the presence of contigs in a given taxon-associated bin, best BLASTp hits to the proteins on the contig as determined by IMG, or manually if not available in IMG. Essentially, if

140

more than 50% of genes on a contig had best BLASTp hits to the same taxon, the contig was assigned to that group.

Putative fumarate addition predicted amino acid sequences from the metagenome and reference sequences of fumarate addition protein sequences obtained from the NCBI and IMG databases were aligned using T-Coffee (Notredame et al., 2000). The multiple alignment was then curated using GeneDoc. Phylogenetic analysis using maximum likelihood was conducted in

PHYLIP (Felsenstein, 1993). Briefly, Seqboot was used to generate 100 datasets for bootstrapping, which were used as input to Proml to generate trees based on the Jones-Taylor-

Thornton model. A consensus tree was selected using Consense, and was then used as input to

Proml to generate branch lengths. Trees were visualized in Dendroscope (Huson & Scornavacca,

2012).

6.2.3 Binning and pathway analysis

Contigs from the hybrid assembly longer than 10 kbp were binned using Metawatt, a computationally light composition-based binning program based on tetranucleotide frequency

(Strous et al., 2012). Bins were screened using a suite of HMMs for the presence of 107 single copy genes that are conserved in 95% of bacteria in order to assess bin completeness (Albertsen et al., 2013). Hits were compared to the refseq database to assess taxonomic affiliation. Bins were manually curated to remove contigs with inconsistent taxonomic classification, GC content or coverage relative to the rest of the bin, and to add contigs that were consistent with the bin characteristics. To estimate the relative abundance of the binned organisms in the culture, the overall bin coverage was calculated from coverage of each of the contigs. The coverage of each contig was originally calculated as the sum of the coverage of each base in a contig, divided by

141

the contig length. Using the coverage value for each contig in a bin, the average bin coverage was calculated as the sum of coverage multiplied by the contig length for each contig in a bin, divided by the total length (in bp) of the bin (Table 6-2)

Syntrophic processes and metabolic pathways were analysed within the bins using curated assemblages of HMMs from COG and pfam databases (Tatusov et al., 1997, Finn et al.,

2010). Plots and visualizations were generated in R.

6.3 Results and discussion

6.3.1 Assembly and general features

Extraction of DNA from the toluene degrading methanogenic culture for metagenomic analysis was carried out at discrete time points while the culture was actively degrading toluene.

Metagenomic sequencing of DNA from the culture was carried out first by 454 sequencing, and then by paired-end Illumina sequencing of metagenomic DNA and Sanger sequencing of fosmid ends. Data from 454 and Sanger, and Illumina sequencing were assembled individually, and assemblies were then merged using minimus2 from the AMOS package (Sommer et al., 2007).

The assembled metagenome consists of 605 Mbp, with an average contig length of 833 bp and an N50 of 2133 bp. This assembly was submitted to both IMG/M and MG-RAST for ORF prediction and annotation, revealing the presence of over 1 million protein coding genes, around

70% of which have a predicted function in IMG/M (Table 6-1).

142

Table 6-1. General features and statistics of the metagenome of the methanogenic toluene degrading enrichment culture TOLDC Type of sequencing 454 Illumina Sanger Size (bp) (post QC) 215 982 194 99 121 490 450 7 459 493 Reads (post QC) 550 247 382 538 808 13 349 Average read length (bp) 392.52 130 558.81 Assembly (based on IMG/M 3300001567) Size (bp) 605 635 502 Number of contigs 727 311 max contig length (bp) 550 011 Average contig length (bp) 832.67 N50 2133 Average G+C% 52.15 rRNA (5S/16S/23S) 339/486/810 tRNA 8184 Protein coding genes 1 174 817 With function prediction -COG 667 325 -Pfam 813 145

6.3.2 Binning and taxonomic composition of the TOLDC culture

Taxonomic binning of contigs greater than 10 kbp from the 454-Illumina hybrid assembly was conducted in Metawatt (Strous et al., 2012). A large number of bins were obtained, but we were particularly interested in 22 bins belonging to putative hydrocarbon degraders, taxa that were previously identified as abundant in 16S rRNA gene pyrotag analysis

(Fowler et al., 2012), and rare or uncultured organisms (Table 6-2). These bins of interest were further curated, with removal of contigs that were outliers in terms of GC content or coverage, and taxonomic affiliation. Additional contigs were added to bins if they matched the parameters of the specified bin and did not result in duplication of single copy genes. In some cases, where our interests lay in identifying potential functions associated with a higher order taxonomic group (e.g. order), some bins were combined, such as was the case for Bacteroidetes2 which consists of four partially merged bins (Table 6-2). The identification of single copy genes in each

143

of the bins allows for an estimate of the completeness of the bin, based on the assertion that a single bacterial genome typically contains around 107 conserved single copy genes (Albertsen et al., 2013). The overall bin coverage, which represents the base coverage per bin, was calculated as a way to estimate the relative abundance of organisms represented by a single bin in the culture. This metric approximates the relative contribution of each of the binned organisms to the microbial community, and as such also relates to relative energy conservation by the organisms from each bin. Based on the average bin coverage, the dominant organisms in this culture are

Desulfosporosinus sp., which has been associated with toluene activation (Chapter 4),

Syntrophaceae1, and Desulfovibrio sp. (Table 6-2).

144

Table 6-2. Details of curated taxonomic bins from contigs greater than 10 kbp from the TOLDC hybrid assembly Bin Size (bp) %GC Contig Overall Single Estimated coverage bin copy taxonomic coverage genes level Desulfosporosinus 3830723 40.1-47.1 20-1210 552.5 99 Genus/species Clostridia1 3185527 34.1-39.2 18-33 23.0 97 Species Clostridia2 4199724 53.8-61.0 13-53 33.1 100 Family/Genus Deltaproteobacteria 3302371 52.2-55.9 140-233 211.7 81 Genus/species undefined Desulfovibrio 4114352 64.3-72.0 135-649 464.8 92 Species Geobacter 2612571 53.6-60.7 19-41 35.3 103 Genus/species Pelobacter 1886294 53.1-60.5 88-627 157.9 36 Genus Syntrophaceae1 2766291 51.6-58.3 25-699 494.6 91 Family/Genus Syntrophaceae2 5446510 55.5-65.2 17-91 37.0 97 Family/Genus Bacteroidetes11 2229248 39.3-43.4 181-316 209.4 94 Species Bacteroidetes2 6176447 44.2-50.3 10-75 43.9 98 Order/family Anaerolinea 3255129 47.9-54.2 22-97 69.5 85 Genus Chloroflexi1 4191301 41.4-46.3 15-493 50.5 91 Order/family Chloroflexi2 4126984 46.4-53.5 19-263 114.5 87 Order/family Chloroflexi32 4649245 55.1-65.5 47-263 117.6 83 Genus Spirochaetes1 4396200 48.1-54.3 28-697 296.7 94 Family/Genus Spirochaetes2 2438454 49.5-57.0 20-704 79.2 67 Family/Genus Synergistetes12 1783259 54.0-60.7 246-268 254.9 89 Genus/species Synergistetes2 1747697 45-4-50.0 62-80 65.5 85 Genus/species Thermotogae 2641819 43.0-49.9 11-544 137.6 10 Order/Family Verrucomicrobia 5501140 54.6-60.9 141-329 274.5 90 Genus/species WWE1 2753203 35.2-45.0 37-315 91.9 103 Family/Genus Actinobacteria 2278430 63.8-69.8 30-78 65.1 103 Genus/species 1Consists of four partially combined bins with similar coverage and GC content 2Consists of two partially combined bins with similar coverage and GC content

Bins that were identified to be of key importance in hydrocarbon metabolism included

Desulfosporosinus, associated with toluene activation, as well as Deltaproteobacteria undefined, which does not have substantial similarity to any cultured members of the Deltaproteobacteria

(described below). Overall, the bins described here contain 79.5 Mbp of the assembled metagenome. While this represents only 13% of the total assembly, it represents 41% of the dataset consisting of contigs greater than 10 kbp, and does not contain any archaeal bins. Future reassembly of individual bins may allow the recruitment of shorter contigs from the dataset and

145

based on the completeness of several of the bins described, could potentially result in the assembly of draft genomes of some members of this culture.

Previous pyrotag sequencing of the toluene degrading culture indicated that a number of members of different phyla are present in this culture including Chloroflexi,

Deltaproteobacteria, Spirochaetes, Bacteroidetes and Synergistetes and Actinobacteria (Fowler et al., 2012). Indeed, binning of the metagenomic datasets resulted in the production of taxonomic bins for each of these groups, and multiple species from some of these phyla appear to be present in the culture (Table 6-2). In addition to organisms that were previously identified in this culture by pyrotag sequencing, we were surprised to obtain clean, relatively large bins for a few organisms not previously identified as major members of the bacterial community which are considered to be rare or difficult to cultivate. These include members of candidate phylum

WWE1, Verrucomicrobia, and Thermotogae (Table 6-2). It seems likely that due to a shortage of genomic sequence data for members of these phyla, the universal primers used for pyrotag sequencing were not efficient at amplifying 16S rRNA genes from these organisms, but metagenomic sequencing has now revealed their presence. Additional genomic sequence data from members of these phyla may enable the development of universal primers with less bias against these phyla.

6.3.3 Anaerobic hydrocarbon metabolism

Previous work revealed the importance of fumarate addition as a hydrocarbon activation mechanism in this culture, and in other methanogenic hydrocarbon degrading cultures (Chapter

5, Fowler et al., 2012). At present, fumarate addition genes and other genes associated with upstream anaerobic hydrocarbon metabolism are frequently misannotated by automated

146

annotation systems. Thus, we searched for genes associated with anaerobic hydrocarbon metabolism using in-house developed HMMs when sufficient sequence data was available, or by

BLAST of known protein sequences against predicted amino acid sequences from the metagenome (as in Chapter 5) in order to improve the detection of genes associated with anaerobic hydrocarbon metabolism in this culture.

6.3.3.1 Fumarate addition

Fumarate addition has been identified as a key mechanism for the activation of aromatic, polyaromatic and aliphatic hydrocarbons under anaerobic conditions, and the alpha subunits of fumarate addition genes are key biomarkers for establishing the occurrence of anaerobic hydrocarbon degradation in situ (Biegert et al., 1996, Annweiler et al., 2000, Winderl et al.,

2007, Callaghan et al., 2008). In previous work, PCR-amplification enabled the detection of a single partial bssA gene in the toluene degrading enrichment, suggesting, along with metabolite analysis, that toluene was activated by fumarate addition in this culture (Fowler et al., 2012).

While assembly of 454 data revealed the presence of a single bssA gene that was homologous to the previously PCR-amplified bssA gene fragment presumed to be involved in toluene activation and a putative assA gene (Chapters 3 & 5), further Illumina sequencing and hybrid assembly revealed the presence of three additional contigs harbouring putative bssA genes as well as an additional contig harbouring a second putative assA gene (Figure 6-1).

147

Figure 6-1. Maximum likelihood tree showing the affiliation of fumarate addition gene sequences identified in the assembled metagenome of the toluene degrading methanogenic enrichment (shown in bold) relative to cultivated isolates or enriched cultures. The tree was constructed using near full-length predicted amino acid sequences of fumarate addition and glycyl-radical enzyme genes using PHYLIP with the Jones-Taylor-Thornton model. Bootstrap values, based on 100 replicates, are shown if they are greater than 60. Pyruvate formate lyase from Clostridium beijerinckii and from the toluene degrading culture were used to root the tree.

148

Phylogenetic analysis revealed that two of the newly identified bssA genes (bssA2, bssA4) have identical nucleotide sequences to the previously identified bssA1, and further analysis of the contigs harbouring these genes revealed that they could be assembled into a single

46 776 bp contig that affiliates with the Desulfosporosinus bin. Members of this taxon and the

Peptococcaceae have previously been implicated in toluene activation in this culture (Chapter 4) and in other toluene degrading methanogenic and sulfate-reducing cultures (Winderl et al., 2010,

Sun et al., 2014).

The newly identified bssA3 shares only 69% identity with bssA1, but is still related to bssA phylotypes belonging to members of the Peptococcaceae (Figure 6-1). The function of bssA3 is currently unknown. It is possible that both bssA genes identified here are involved in toluene activation by different toluene-degrading members of the Peptococcaceae. However, it seems possible that bssA3 could also be involved in the activation of other monoaromatic substrates such as xylenes or ethylbenzene; preliminary evidence suggests that these monoaromatics are also degraded by this culture (Figures D-1 & D-2). Previous phylogenetic analysis of bssA genes revealed the clustering of bssA sequences into two major groups, which is proposed to be related to substrate specificity for various alkylbenzenes (Acosta-Gonzalez et al.,

2013). Analysis of residues by the authors revealed key differences between cluster I

(canonical bssA associated with toluene degradation) and cluster II (putatively associated with p- xylene and/or other alkylbenzene metabolism) at residues 605 and 608 (based on Thauera aromatica K172 bssA numbering) (Acosta-Gonzalez et al., 2013). Interestingly, clustering of bssA sequences shown here was based on phylogenetic affiliation (Figure 6-1). However, analysis of active site residues reveals that bssA1, which belongs to Desulfosporosinus sp. and is putatively associated with toluene metabolism in this culture, contains active site residues

149

consistent with cluster I bssA, while bssA3 active site residues were at an intermediate configuration, with residue 605 matching cluster I (Glutamine/Q at site 605) and residue 608 matching cluster II (Proline/P at site 608). Thus, the active site of bssA3 likely has a slightly different configuration than the canonical bssA (e.g., bssA1), indicating that it may have altered substrate specificity or range and hence may be involved in the activation of alternate monoaromatic hydrocarbons.

Phylogenetic analysis of glycyl-radical enzymes also revealed the presence of two contigs harbouring assA genes that encode the genes for fumarate addition to alkanes. Sequence assA1 was found on a 160 407 bp contig (contig 86) that affiliates with bin Deltaproteobacteria undefined, which is not well defined taxonomically. Best BLAST hits of protein sequences from this contig suggest that it belongs to a member of the Deltaproteobacteria related to the

Syntrophobacteraceae and Desulfobacteraceae. Comparison of the assA1 operon with the assA1 operon of the alkane degrader Desulfatibacillum alkenivorans AK-01 revealed striking similarities in both operon arrangement, and predicted amino acid sequences (Figure 6-2). Gene arrangement within the two operons was very similar, and homologs shared at least 60% amino acid sequence similarity (Figure 6-2). This suggests that the organism that harbours this putative assA operon in TOLDC could be closely related to D. alkenivorans AK-01.

150

Figure 6-2. Comparison of putative assA1 operon from TOLDC (contig 86) with assA1 operon from Desulfatibacillum alkenivorans AK-01. Red/pink lines indicate degree of amino acid sequence similarity between connected genes. Constructed using genoplotR.

151

The second putative assA gene identified, assA2, was found on an 8847 bp contig (contig

7287) and clusters separately from the assA genes that have been identified in alkane degrading isolates (Figure 6-1). It shares only about 37% amino acid identity with assA from Desulfoglaeba alkanexedens, its best BLASTp hit to a cultured organism. It does however exhibit approximately 87% amino acid similarity to a partial assA detected in a short chain alkane degrading methanogenic enrichment culture derived from oil sands tailings (Tan et al., 2013). Of the genes typically found in operons for fumarate addition enzymes, the partial operon encodes only assA and assD (Table D-1). The absence of assB, which is thought to be required for Ass activity, brings into question whether this partial ass operon is functional. Additionally, the presence of both a transposase and integrase at one end of this contig suggest that this fragment may be part of a mobile genetic element acquired by lateral gene transfer. Best BLASTp hits of other genes present on this contig do not reveal a strong affiliation with any particular taxonomic group, suggesting that this may represent a novel organism, or that this genomic fragment may be part of a transposable element.

No genes were identified in the toluene degrading enrichment culture that had homology to nms genes, involved in fumarate addition to substituted PAHs. This suggests that this culture may be unable to degrade substituted PAHs by fumarate addition though 2-methylnaphthalene degradation and concomitant methane production has been observed in this culture (Figures D-1

& D-2). It is possible that substituted PAHs are degraded by an alternate mechanism, or that they are co-activated by Bss in the presence of trace toluene.

152

6.3.3.2 Alternate hydrocarbon activation mechanisms

Alternate mechanisms of anaerobic hydrocarbon activation for which genes have been characterized include the hydroxylation of ethylbenzene by ethylbenzene dehydrogenase

(encoded by ebd genes), and the carboxylation of benzene and naphthalene, catalyzed respectively by anaerobic benzene carboxylase (encoded by abc genes) and anaerobic naphthalene carboxylase (encoded by anc genes).

The hydroxylation of ethylbenzene has been observed under nitrate and sulfate reducing conditions, but not under methanogenic conditions (Reinhard et al., 1997, Kniemeyer & Heider,

2001). Genes homologous to known ethylbenzene dehydrogenases were not identified in the metagenome. It is likely that the degradation of ethylbenzene in this culture (Figures D-1 & D-2) is catalyzed by fumarate addition, as has been observed for ethylbenzene degradation under sulfate reducing conditions (Kniemeyer et al., 2003), though whether dedicated bss genes for ethylbenzene metabolism exist (such as bssA3) or whether it is co-metabolized in the presence of trace toluene, is currently unclear.

The genes involved in the carboxylation of benzene have been putatively identified in two organisms, (1) Clostridia BF clone from an iron-reducing enrichment, and (2) the archaeon

Ferroglobus placidus (Abu Laban et al., 2010, Holmes et al., 2011). Both carboxylases are characterized by the presence of a UbiD carboxylase protein domain (pfam01977). We searched the metagenome for genes homologous to the putative carboxylases from Clostridia BF and F. placidus which contained a UbiD domain, and identified a carboxylase with 51.4% amino acid similarity to abcA from Clostridia BF and 44.8% similarity to benzene carboxylase from F. placidus on a 11331 bp contig (contig 5585) (Table 6-3). Examination of the contig reveals similarity in gene organization to Clostridia BF, including the presence of a CoA-ligase adjacent

153

to the carboxylase subunits which is proposed to be involved in CoA-ligation to benzoate following benzene carboxylation, as well as a UbiX carboxylase of unknown function further downstream (Abu Laban et al., 2010). Other genes present in this operon in TOLDC include a transporter which could potentially be involved in benzoate transport (Table 6-3).

Table 6-3. Comparison of genes from the putative benzene carboxylase operon from TOLDC contig 5585 with the putative benzene carboxylase from Clostridia BF clone Gene_ID Annotation Size Similarity to Accession (aa) Clostridia BF (%)1 No. Draft_100055859 UbiD carboxylase 480 51.4 GU357992 Draft_100055858 carboxylase gamma subunit 105 28.5 GU357991 Draft_100055857 CoA-ligase 376 28.8 GU357993 Draft_100055855 Succinate dehydrogenase 496 - - Draft_100055854 TRAP transporter periplasmic 345 - - component Draft_100055853 TRAP transporter permease 659 - - component Draft_100055852 UbiX carboxylase 202 72.3 GU357978 1A dash indicates no homology with any genes from the Clostridia BF benzene carboxylase operon.

While the genes present in this operon show some homology to the putative genes involved in benzene carboxylation, whether these genes are truly involved in anaerobic benzene metabolism is unknown and requires further study. The contig on which these genes were found does not associate with any of the bins described here, but based on best BLASTp hits, belongs to a member of the . No carboxylases with both high homology to putative naphthalene carboxylases and similarity to the putative naphthalene carboxylase operon

(Bergmann et al., 2011) were identified. Furthermore, naphthalene degradation has not been observed in this culture (data not shown).

154

6.3.3.3 Downstream aromatic hydrocarbon metabolism

Following fumarate addition to toluene, benzylsuccinate undergoes a modified beta- oxidation to benzoyl-CoA followed by reductive dearomatization and ring opening (Figure 2-4).

The modified beta-oxidation is catalyzed by a multi-enzyme complex encoded by bbsEFGHCDAB genes. A near complete bbs operon was found directly adjacent to the bss operon on contig 1060 within the Desulfosporosinus bin (Figure 6-3). In toluene degrading isolates, bbs operons have been found either adjacent to bss operons, as in Geobacter metallireducens, or in a different part of the genome, as in Desulfobacula toluolica Tol2 (Butler et al., 2007, Wohlbrand et al., 2013). Interestingly, the bbs operon found adjacent to bss in

TOLDC was missing two key subunits, bbsG and bbsH. These genes were found on a separate contig, but still grouped within the Desulfosporosinus bin. This contig harboured a partial bbs operon consisting of bbsEFGH (contig 456). The reason for the presence of two bbs operons in the putative toluene-degrader in TOLDC is unknown. It is possible that the acquisition of these genes could have been through two separate events as the putative bbsEF genes on contigs 1060 and 456 are not identical though both have best BLASTp hits to members of the Firmicutes

(Table D-2).

Comparison of the bss and bbs operons on contig 1060 with D. toluolica Tol2, which in preliminary analysis showed consistently high identity in BLAST searches to putative bbs genes from the toluene degrading culture, revealed substantial similarities in both sequence and gene organization (Figure 6-3). D. toluolica Tol2 is a toluene degrading sulfate-reducing isolate belonging to the Deltaproteobacteria whose genome was recently sequenced (Wohlbrand et al.,

2013). Genes from the bss operon also shared high homology between the two organisms, and gene organization within the operon was similar, with the exception of the location of bssD at

155

opposite ends of each operon (Figure 6-3). Predicted protein sequences in the bbs operon were somewhat less similar than in the bss operons, but all genes exhibited greater than 40% similarity to each other. Gene organization was also similar, although inverted, and as previously mentioned, bbsGH were missing from this bbs operon in TOLDC.

Figure 6-3. Comparison of putative bss and bbs operons from contig 1060 with bss and bbs operons from Desulfobacula toluolica Tol2.

156

Following beta-oxidation of benzylsuccinate, reductive dearomatization is catalyzed by benzoyl-CoA reductase. Two different types of benzoyl-CoA reductases exist, and both catalyze the conversion of benzoyl-CoA to cyclohexadienoyl-CoA by a common mechanism (Figure 2-4,

Peters et al., 2007). The first type, encoded by bcrABCD genes (also encoded by bzd and bad genes in other facultative organisms (Carmona et al., 2009)), was initially discovered in Thauera aromatica K172 and is ATP-dependent (Boll & Fuchs, 1995). The second, encoded by bamBCDEFGHI genes, was first identified in Geobacter metallireducens, and uses an ATP- independent mechanism for reductive dearomatization (Wischgoll et al., 2005). These genes have subsequently been identified in a number of benzoate-degrading strict anaerobes such as

Syntrophus aciditrophicus and Desulfococcus multivorans (Boll, 2005). We searched the

TOLDC metagenome for both types of benzoyl-CoA reductases. A single 12847 bp contig

(contig 4854) containing a putative bcrADBC operon was identified (Table D-3). Best BLAST hits revealed that genes on this contig were most closely related to members of the

Gammaproteobacteria. Taxonomically, this makes sense as a number of facultative organisms are members of this clade. Two contigs containing near-complete putative bam operons were also found in the culture. The first operon (contig 322), belonging to the Desulfosporosinus bin, consists of bamBCDEFGHI, involved in the reductive dearomatization of benzoyl-CoA as well as bamRQY, involved in the downstream steps prior to ring opening (bamRQ) and CoA-ligation to benzoate (bamY). The second partial operon (contig 229) consists of bamBCDEF and though the contig was not binned, best BLAST hits determined by IMG/M suggest it belongs to a member of the Syntrophobacterales. GC and coverage characteristics and single copy gene analysis suggest that contig 229 could belong to the Syntrophaceae1 bin, though it was not automatically binned to this group. Interestingly, a gene encoding bamA, the oxoenoyl-CoA

157

hydrolase that catalyzes ring opening, was not found on either contig containing bam genes.

However, a BLAST search revealed the presence of homologs of bamA in the Desulfosporosinus bin (contig 952) and on a contig that affiliates with Syntrophobacterales along with bamR and bamQ (contig 24074) (Table D-3). Together, these results suggest that three organisms,

Desulfosporosinus, Syntrophobacterales, and a gammaproteobacterium are potentially capable of benzoate metabolism in this culture. Whether the Syntrophobacterales and gammaproteobacterium gain access to benzoate derived from toluene is unknown, but it seems that the toluene degrading Desulfosporosinus sp. would maximize energy conservation from toluene oxidation. However, reductive dearomatization does require an energy input, thus some of the benzoate could potentially be released by the Desulfosporosinus sp. at this stage.

Interestingly, directly upstream of the bam operon in contig 322 in the Desulfosporosinus bin, a major facilitator superfamily efflux permease was found that could potentially be involved in benzoate transport by Desulfosporosinus sp. (Table D-3). RNA-SIP revealed that a member of the Deltaproteobacteria related to Syntrophus acquired carbon from toluene early in toluene degradation (Chapter 4). It seems possible that a small amount of benzoate from toluene could be taken up and degraded by Syntrophobacterales, and if this functionality belongs to the organism represented by Syntrophaceae1, this explains its high prevalence in the culture as suggested by the overall bin coverage. Metatranscriptomic sequencing of TOLDC may provide additional insight into whether Syntrophobacterales and Gammaproteobacteria are involved in benzoate metabolism from toluene.

158

6.3.3.4 Downstream alkane metabolism

Following fumarate addition to alkanes, alkylsuccinates undergo CoA-ligation followed by carbon skeleton rearrangement and decarboxylation prior to beta-oxidation (Figure 2-4,

Wilkes et al., 2002, Callaghan et al., 2006). The genes thought to be involved in the downstream steps of alkane metabolism in Desulfatibacillum alkenivorans AK-01 include a CoA-ligase,

(assK), methylmalonyl-CoA mutase (encoded by mcmS1, mcmL2) and a carboxyl transferase

(Callaghan et al., 2012). As shown earlier (Figure 6-2), there are notable similarities in gene sequence and arrangement in putative assA1 operons in D. alkenivorans and TOLDC, suggesting that the organisms to which they belong may be closely related. In addition to the genes encoding Ass, the assA1 operon from the toluene degrading culture encodes genes homologous to assK (putative CoA-ligase), as well as methylmalonyl-CoA mutase, believed to be involved in carbon skeleton rearrangement (Figure 6-2). A decarboxylase or carboxyl transferase was not identified in the assA1 operon of TOLDC, however, within the same bin a carboxyl transferase with 48% similarity to Dalk_1740 of D. alkenivorans was identified (contig 41). Adjacent to this carboxyl transferase was a putative subunit of propionyl-CoA carboxylase, which initiates the methylmalonyl-CoA pathway, and a methylmalonyl-CoA racemase was also identified on this contig. The methylmalonyl-CoA pathway has been proposed to catalyze fumarate regeneration during alkane metabolism in D. alkenivorans, and with the detection of the genes encoding this pathway, it seems likely that these genes could also be involved in fumarate regeneration by this organism (Table D-4, Callaghan et al., 2012). Further enrichment and study of this culture in the presence of alkanes may provide evidence to this end.

Analysis of the pathways and reactions involved in anaerobic hydrocarbon metabolism in the metagenome provided additional evidence that the primary toluene degrading organism in

159

this culture is a Desulfosporosinus sp. (see Chapter 4). Additional bss genes that were identified may be involved in the metabolism of alternate monoaromatic substrates such as xylenes or ethylbenzene. Fumarate addition genes involved in alkane metabolism were also identified in this culture, and it appears that the major alkane degrading organism is related to

Desulfatibacillum alkenivorans AK-01. Regeneration of fumarate following alkane activation likely occurs via the methylmalonyl-CoA pathway as has been proposed for D. alkenivorans

AK-01. Putative genes associated with anaerobic benzene activation by carboxylation were also identified with the respective genes belonging to a member of the Syntrophobacterales. A member of this group also possesses the genetic potential to degrade benzoate in addition to the

Desulfosporosinus sp. associated with toluene metabolism, and potentially a member of the

Gammaproteobacteria. Further enrichment of this culture on alkanes, benzene, and other monoaromatics will enable further insights into the physiological capabilities of this consortium.

6.3.4 Syntrophic processes

For the complete conversion of toluene to methane by TOLDC, transfer of electrons between the syntrophic bacteria and methanogens is required. Currently, there are two major models for electron transfer in syntrophic environments. The traditional view is that electrons are transferred by interspecies metabolite transfer. Under methanogenic conditions, this involves primarily the transfer of H2 and formate, which are subsequently converted to methane, allowing the syntrophic reactions to be energetically favourable (McInerney et al., 2009). Acetate transfer between syntrophs and methanogens is also likely to occur, but its role in the thermodynamics of syntrophic reactions is secondary to that of H2 and formate (McInerney et al., 2009). The second model, known as DIET (direct interspecies electron transfer), involves the direct transfer of

160

electrons between cells via electrically-conductive nanowires which consist of type IV pili coated with outer membrane cytochromes (Omc) (Summers et al., 2010). A number of genes or complexes have been associated with each of these two models of electron transfer. We examined the genes that encode some of these complexes in a number of syntrophs and nanowire-utilizing microbes, and developed combinations of COG (clusters of orthologous groups) models that could be used to characterize these complexes or genes (Table D-5). Using these combinations of models we searched the metagenome for the presence of genes associated with interspecies metabolite transfer and DIET. The contigs on which these genes were found were associated with specific taxa either based on binning or taxonomic assignments from IMG allowing the distribution of these complexes and genes across different organisms in the toluene degrading culture to be determined (Figure 6-4). While this analysis allowed us to identify genetic potential for interspecies metabolite transfer and DIET across different members of

TOLDC, caution should be taken when interpreting the results. Some genes may not be functional in some organisms and some genes may have multiple functions across different organisms. While this analysis enables us to estimate the prevalence of the relevant models in the culture, the results are solely predictive.

6.3.4.1 Hydrogen and formate formation and reverse electron transfer

The traditional model of interspecies metabolite transfer stipulates that for the bioconversion of toluene to methane to be energetically feasible, transfer of metabolites such as

H2 and/or formate, and possibly acetate, from syntrophic bacteria to methanogens present in this culture is required. However, in order to form H2 or formate using typical redox mediators such as NADH, an input of energy is required. A number of complexes have been identified in

161

syntrophic bacteria that solve this problem by using reverse electron transport (Sieber et al.,

2012). Reverse electron transfer can be driven by ion gradients when carried out at the cell membrane. Two ion-translocating complexes known as Fnr and Fix appear to use ion gradients to catalyze the unfavourable reduction of Fd using NADH and electrons from fatty acid oxidation respectively (Sieber et al., 2012). Electron carrying complexes such as Fe-S and menaquinones can acquire electrons derived from metabolic processes from electron transfer proteins which can then be transferred to membrane bound hydrogenases and formate dehydrogenases (FDHs) for H2 or formate production. Confurcating hydrogenases, first identified in Thermotoga maritima, couple proton reduction to the oxidation of Fdred and NADH, generating 2 H2. Though H2 formation from NADH is not energetically feasible, coupling the oxidation of both Fdred and NADH provides sufficient reducing power to generate 2 H2 (Schut &

Adams, 2009). Putative NADH-linked FDHs have also been identified, and are believed to be involved in electron confurcation in the production of formate (Sieber et al., 2010). Putative confurcating hydrogenases or FDHs have now been identified in a number of syntrophs across diverse phyla including members of the Deltaproteobacteria, Firmicutes, Synergistetes, and

WWE1 (Sieber et al., 2010). The extent to which NADH is used as a redox mediator during toluene metabolism in this culture is unknown. Transcriptomic data could provide evidence to this end. However, complexes associated with reverse electron transfer and H2/formate production were widespread in putative hydrocarbon degraders in TOLDC, including

Desulfosporosinus sp., Deltaproteobacteria undefined, and Syntrophobacterales. In addition to hydrocarbon degraders, complexes involved in reverse electron transfer and H2/ formate formation were also found in other members of the Deltaproteobacteria, Firmicutes, and the phyla Synergistetes and WWE1 (Figure 6-4), in which these complexes have previously been

162

described (Sieber et al., 2012). In addition, we found such complexes to be widespread among the Chloroflexi, Spirochaetes, and Bacteroidetes and a lower abundance of such complexes were found in the Verrucomicrobia, Actinobacteria, and Mesotoga (Figure 6-4). The results shown here suggest that many phyla can participate in syntrophic interactions mediated by hydrogen and formate transfer in this culture.

163

Figure 6-4. Heatmap showing the distribution of genes or operons associated with H2 and formate formation, reverse electron transfer, and DIET among various taxa in TOLDC. Values have been normalized based on the total number of hits in each category, which are shown below the heatmap. Thus, each column shows the relative abundance of the given gene or complex in each of the taxa. Hits that could not be classified below the domain level are included in the total count, but are not shown in the heatmap. In cases where classification is redundant, lower level taxonomic categories do not include hits assigned to higher-order categories that are presented here. (e.g. Deltaproteobacteria does not include hits that were assigned to Desulfuromonadales or Geobacter, and Desulfuromonadales does not include hits assigned to Geobacter). MB = membrane bound, H2ase = hydrogenase, FDH = formate dehydrogenase

164

6.3.4.2 Direct interspecies electron transfer

As an alternative to the traditional mechanism of electron and metabolite transfer in methanogenic environments, DIET via nanowires has been suggested as a possible mechanism for electron transfer in methanogenic cultures (Rotaru et al., 2014). Nanowires in Geobacter spp. have been shown to be composed of type IV pili, made up of pilin subunits encoded by pilA

(Reguera et al., 2005). Outer membrane cytochromes (Omc) which associate with these nanowires and are essential for DIET, include OmcS in Geobacter sulfurreducens and OmcE in

Geobacter metallireducens (Shrestha et al., 2013). It is believed that Omc proteins are involved in transferring electrons to, and/or along the surface of pili (Summers et al., 2010). We screened the TOLDC metagenome for the presence of genes that have been associated with DIET. A large number of genes encoding type IV pilin subunits from a variety of organisms were identified, however, these genes are present in a number of bacteria where they may be used for traditional functions such as twitching motility or adhesion to surfaces (White, 2012, Figure 6-4). We identified a limited number of omc genes, and the majority of these were associated with members of the Desulfuromonadales and Geobacter spp. (Figure 6-4). Based on the limited identification of genes shown to be essential for DIET, and the abundance of genes encoding hydrogenases, formate dehydrogenases, and complexes associated with reverse electron transport in syntrophs, we postulate that the traditional model of hydrogen and formate transfer is a more prevalent electron transfer mechanism in this culture. While we cannot rule out that DIET may occur in the culture, particularly by Geobacter sp. for which this mechanism has been well characterized, it does not seem to an important mechanism for electron transfer in this culture based on metagenomic analysis.

165

6.3.5 Pathway analysis and putative roles of community members

In order to describe the putative roles of the dominant community members in the culture, we conducted an analysis of a variety of pathways associated with carbon metabolism including central carbon metabolism and carbon fixation as well as pathways associated with other functions using the individual bins described previously (Table 6-2). We also examined the annotation of methanogenic pathways using IMG/M taxonomic assignments.

6.3.5.1 Methanogens and methanogenic pathways

Previous analysis of the 454 metagenome of the toluene degrading culture revealed fully annotated pathways for hydrogenotrophic and acetotrophic methanogenesis (Chapter 5). Further analysis of the major contigs harbouring genes encoding these pathways reveals that the dominant hydrogenotrophic methanogens in this culture are members of the Methanoregulaceae including Methanoregula sp. and Methanolinea sp., as well as Methanoculleus sp. Genes encoding enzymes involved in acetotrophic methanogenesis associated primarily with

Methanosaeta sp. While not previously detected, deeper sequencing of this culture also revealed the presence of contigs associated with methylotrophic methanogenesis which were found on contigs associated with Methanomethylovorans sp. The identification of a number of large contigs that had best BLASTp hits to Methanomethylovorans sp. supports not only the genetic potential for methylotrophic methanogenesis in the culture, but suggests that it likely occurs in this culture in order for these genes and organisms to persist, as methylotrophic methanogens are usually obligate methylotrophs (Liu & Whitman, 2008). The dominant methylated compounds that are being used for methanogenesis in the culture are unknown but could include methanol, sulfur containing methylated compounds or methylamines based on the substrate range of

166

Methanomethylovorans hollandica (Lomans et al., 1999), the best BLAST hit of contigs detected in the metagenome.

6.3.5.2 Alternative carbon sources for syntrophic bacteria

From RNA-SIP and metagenomic analysis, it is clear that Desulfosporosinus sp. is the dominant toluene activating organism present in the culture (Figure 6-5). Most likely, it is also the major degrader of benzoyl-CoA though the participation of organisms including a member of the Syntrophobacterales and a gammaproteobacterium are also possible. While several members of the community may be able to obtain carbon directly from toluene and its degradation products, with the diverse assemblage of organisms present in this culture it seems unlikely that all organisms would be able to satisfy their carbon requirements solely from the small amount of toluene present. Furthermore, incorporation of bicarbonate, concurrent with hydrocarbon metabolism, has previously been observed in syntrophic hydrocarbon degrading cultures

(Taubert et al., 2012), so we investigated the presence of carbon fixation pathways in the binned datasets. The majority of organisms from the binned datasets had the genetic potential to fix carbon via either the reductive TCA cycle or Wood-Ljungdahl pathway (Figure 6-5).

Interestingly, the 3-hydroxypropionate pathway, which has been observed in some members of the phylum Chloroflexi, was not identified in this culture. Use of the Wood-Ljungdahl pathway would allow some organisms to use acetogenesis to conserve energy. As for incorporation of acetate into cellular material, a number of organisms present here may use pyruvate synthase and

PEP synthetase for this function, but the glyoxylate pathway is not prevalent (Figure 6-5).

Another alternative source of carbon in this culture is dead biomass. Some members of the culture may be able to satisfy their carbon and energy needs by degradation of cell biomass. In

167

particular, Syntrophaceae1 and 2 are the only organisms identified here that are capable of unsaturated fatty acid metabolism and thus may be involved in the degradation of membrane lipids from dead biomass. As this is not expected to be a particularly good source of carbon and energy, it is likely that this function is carried out by less abundant members of the culture such as, for example, Syntrophaceae2, and Bacteroidetes2.

168

Figure 6-5. Presence and absence of metabolic pathways or processes in individual binned datasets from the toluene degrading methanogenic culture. Cases where 25% or less of enzymes in a pathway were identified are only shown if a partial pathway can serve a biological function (e.g. nitrate reduction).

169

6.3.5.3 Establishment and maintenance of syntrophic interactions

The syntrophic degradation of hydrocarbons requires the coordinated metabolism of syntrophic bacteria and methanogenic archaea. In this culture, there are a large number of organisms present which must coordinate their metabolism to enable the complete mineralization of toluene to methane. The mechanisms used to initially establish as well as maintain and modify these relationships as required are not well understood. A number of possibilities exist which include intercellular communication and sensing of the local environment. We investigated the prevalence of pathways or functions which could enable these behaviours in the binned datasets from the culture.

We hypothesized that intercellular communication mechanisms such as quorum sensing could play a role in establishing metabolic coordination in complex communities. Quorum sensing allows microbes to sense cell density or flow characteristics within their environment, in response to which a species or community as a whole can alter their gene expression, sometimes resulting in community-based behaviours such as biofilm formation (Choudhary & Schmidt-

Dannert, 2010). We investigated the presence of pathways for acyl homoserine lactone (AHL) synthesis, involved in AHL-based quorum sensing, and did not find any indication of its presence. Thus it seems that AHL-based quorum sensing is not important in the culture. The possibility of other quorum sensing mechanisms such as autoinducer peptides, or autoinducer-2

(AI-2), which has been associated with inter- as well as intra-species communication, was not investigated, so it is possible that other quorum sensing mechanisms could be operational in this culture (Choudhary & Schmidt-Dannert, 2010).

Another mechanism of intercellular communication that has been observed in syntrophic cultures involves intercellular contact between the flagella of syntrophic bacteria and

170

methanogens as identified in Pelotomaculum thermopropionicum and Methanothermobacter thermoautotrophicus (Shimoyama et al., 2009). Contact of the flagellar cap protein of P. thermopropionicum to M. thermoautotrophicus resulted in gene expression changes in the methanogen associated with transitioning towards syntrophic metabolism (Shimoyama et al.,

2009). Several of the syntrophic bacteria in this culture encode genes for a flagellar assembly

(Figure 6-5), suggesting that there is a potential for interactions via flagella in this culture.

However, flagellar assembly is a common function also associated with many non-syntrophic organisms (White, 2012). Microscopy of dense cell suspensions from this culture would allow us to elucidate the extent of flagellar contact between members of this culture. Furthermore, motility may enhance the ability of cells to position themselves relative to one another to fine- tune interspecies metabolite transfer. A number of the binned organisms were also capable of chemotaxis (Figure 6-5), though the specific stimuli involved were not investigated. Chemotaxis could also play a role in the positioning of cells relative to each other or within chemical gradients in order to maximize energy conservation and substrate flux.

6.3.5.4 Model for syntrophic toluene metabolism by TOLDC

Based on the metagenomic analysis presented here, it seems most likely that toluene is activated by fumarate addition by Desulfosporosinus sp. which further degrades this substrate to a shorter chain fatty acid. It is possible that some benzoate is transferred to a member of the

Syntrophobacterales (potentially represented by bin Syntrophaceae1, a dominant member of the culture), which is further degraded by this organism. Any shorter chain fatty acids produced may be further degraded by beta-oxidation by other community members including Chloroflexi,

WWE1, and some Deltaproteobacteria to produce acetate, CO2, and H2 (Figure 6-5). A portion

171

of this acetate likely goes to acetoclastic methanogenesis catalyzed by Methanosaeta sp., while some of it may undergo syntrophic acetate oxidation to H2 and CO2 via the Wood-Ljungdahl pathway which could be catalyzed by Clostridia, Actinobacteria, Syntrophaceae, or

Deltaproteobacteria undefined (Figure 6-5). A portion of the H2 and CO2 produced from syntrophic acetate oxidation and beta-oxidation is likely directed to hydrogenotrophic methanogenesis by Methanoregula sp., Methanolinea sp., and Methanoculleus sp. Community members other than methanogens may also be involved in H2 consumption. For example,

Desulfovibrio spp. are highly efficient H2 scavengers with a higher affinity for H2 than most methanogens (Lupton & Zeikus, 1984). One possibility is that Desulfovibrio sp. in this culture ferments H2/CO2 or formate to methanol, which could then be used by Methanomethylovorans sp. as a substrate for methanogenesis. Fermentative organisms like Desulfovibrio sp. could also be involved in the metabolism of acetate, potentially to fermentation products such as ethanol.

Other organisms, such as Clostridia, may produce acetate using the Wood-Ljungdahl pathway.

Members of this culture may participate in some of the processes described above and in other reactions involving fermentation of intermediates, while some members of the culture are likely also involved in the syntrophic degradation of dead biomass. A number of organisms present in the culture have the capacity for reverse electron transport and thus may contribute to syntrophic processes in the culture. It is likely that a complex network of syntrophic interactions occurs in this consortium to catalyze the conversion of toluene to methane.

172

6.4 Conclusions

Toluene degradation in this culture appears to be catalyzed by a diverse assemblage of syntrophic bacteria. While toluene is activated by Desulfosporosinus sp., diverse bacteria are presumably involved in downstream beta-oxidation, syntrophic acetate oxidation, H2 scavenging, fermentation and acetogenesis. In addition, a number of the syntrophic bacteria are capable of carbon fixation, and some members of the culture may be involved in the degradation of dead cell biomass. A large number of the bacteria present have the genetic capacity to participate in syntrophic interactions in the culture by interspecies hydrogen and/or formate transfer. Methane produced in this culture can be derived from hydrogen or formate, acetate, and also methylated compounds (e.g., methanol). The analysis presented here also provides the genetic basis for the degradation of diverse hydrocarbon substrates by this culture, including other monoaromatic compounds and alkanes in addition to toluene.

Mechanisms that may allow the establishment and maintenance of syntrophic relationships were examined, but have not been elucidated. Examination of non-AHL-based quorum sensing systems should be investigated, and microscopy could be used to establish the extent of intercellular contact via flagella. In order to better study syntrophic interactions, isolation of culture members for co- and mono-culture studies would be useful, however we have had much difficulty in this endeavour. Clues provided to the potential metabolism of community members provided by pathway analysis presented here may inform more targeted isolation experiments in future. The potential for dissimilatory nitrate or sulfate reduction by some members of the consortium provide possibilities to target their isolation under different electron accepting conditions (Figure 6-5). While we have previously been unsuccessful at obtaining a sulfate-reducing toluene degrading consortium using this inoculum (data not shown), it may be

173

possible, for example, to isolate individual members of the consortium under sulfate-reducing conditions in the presence of alternate electron donors.

In conclusion, while metagenomic analysis has allowed the identification of hydrocarbon degraders and elucidation of putative roles of community members, this has also led to the development of a number of new questions and hypotheses. Future work should include more closely examining the diversity of hydrocarbon substrates that may be degraded by the culture, as well as the examination of intercellular communication and sensing mechanisms that could be involved in syntrophic relationships. Further physiological experiments combined with additional analysis of the metagenome as well as metatranscriptomic sequencing will allow further insight into the process of syntrophic toluene metabolism in this culture, and into methanogenic hydrocarbon degradation by complex consortia as a whole.

174

Preface

Chapter 7 describes methanogenic residual oil, LCFA and alkane degrading cultures that

I have been working with in the lab in addition to the toluene degrading culture. The cultures described here were established using the same gas-condensate contaminated aquifer sediments as inoculum as the toluene degrading culture and thus all cultures share a similar microbial community. Variations in the microbial communities are believed to be due to the specific substrates provided to each of the cultures. Due to an improved understanding of the toluene degrading culture and the common source community of all of the cultures, the roles of the various organisms in the cultures described here can now be more confidently hypothesized including identification of putative hydrocarbon degraders in the cultures. Two methods of pyrotag sequencing were also examined and show that a two-step amplification procedure enables the detection of more diversity in samples and should be used as a standard method for pyrotag sequencing with these primers in future.

175

Chapter Seven: Community analysis and methane production from other methanogenic cultures

7.1 Introduction

While the bioconversion of toluene to methane and the organisms that mediate these reactions have been discussed in detail (Chapters 3-6), additional cultures that degrade other hydrocarbon or hydrocarbon-like substrates were also studied. Previous work demonstrates that diverse hydrocarbon substrates can be degraded under methanogenic conditions (Gieg et al.,

2008, Jones et al., 2008). In this chapter, methanogenic cultures degrading palmitate, stearate, as well as their parent alkanes, hexadecane and octadecane, are described. All of the cultures described herein were originally enriched from a residual oil degrading culture that was shown to degrade a range of crude oil components including alkanes (Gieg et al., 2008). The inoculum for the residual oil degrading culture was derived from the same gas-condensate contaminated aquifer as the toluene degrading culture (Gieg et al., 1999, Townsend et al., 2003). Around six years ago, methanogenic cultures degrading palmitate and stearate were enriched from the residual oil degrading culture. As this work describes, these LCFA degrading cultures have subsequently been transferred onto their parent alkanes, hexadecane and octadecane, to see if these cultures have retained the ability to degrade alkanes. By comparing the microbial communities of residual oil, LCFA, and alkane degrading cultures, as determined by 16S rRNA gene pyrotag sequencing, we anticipated variations in the communities related to the supplied carbon substrate. Furthermore, we expected that the residual oil degrading culture, which is exposed to whole crude oil and is the original parent culture, would be the most biodiverse of all the cultures, with the LCFA degrading cultures exhibiting substantially less diversity due to the restriction of carbon and energy sources in the culture. It was further postulated that community

176

analysis of the alkane-amended cultures derived from LCFA degrading cultures may enable the identification of the putative alkane degrading organisms as these cultures should exhibit substantially less diversity than the residual oil degrading culture, but show an enrichment of specific alkane degraders relative to the LCFA degrading cultures.

Furthermore, the results described here suggest that variation in sample preparation methodologies used for 16S rRNA gene pyrotag sequencing can influence the extent of the biodiversity detected within a microbial community.

7.2 Methods

7.2.1 Culture incubations

Inocula for the cultures described herein were derived initially from sediments from a gas-condensate contaminated aquifer that was the subject of an in situ bioremediation study

(Gieg et al., 1999). The cultures were established and maintained on a bicarbonate-buffered minimal salts freshwater medium with 0.01% resazurin as a redox indicator and 2.5% v/v cysteine sulfide as the reductant (Fowler et al., 2012). The residual oil culture was amended with oil-saturated crushed sandstone core as previously described (Gieg et al., 2008). The palmitate and stearate cultures are sediment-free enrichments that were originally derived from the residual oil degrading culture in 2008. They have undergone routine substrate amendment with 30 µmol of stearate or palmitate as needed and the cultures have been transferred four times since being established (30-50% v/v transfer). The hexadecane and octadecane amended cultures were established by inoculating substrate-depleted palmitate and stearate degrading cultures with 0.03 g (113 µmol) hexadecane (neat) or 0.03 g (118 µmol) octadecane, dissolved in heptamethylnonane (HMN) (0.5 g/mL). The reason for the use of HMN, an inert hydrocarbon

177

carrier, is that octadecane is a solid at room temperature (unlike hexadecane), and was thus difficult to reliably measure and amend to sealed serum bottles without first being dissolved in a solvent. These cultures have undergone a single transfer to new medium (50% v/v) and substrate amendment as described above.

7.2.2 Methane measurement

Methane was measured regularly using a Hewlett-Packard model 5890 GC with a flame ionization detector (200°C) with helium as the carrier gas and a packed stainless steel column

(150°C) (18” long x 1/8” i.d., Poropak R 80/100, Supelco). Headspace (200 µL) was sampled from cultures using a 1 mL syringe flushed with N2/CO2 (90/10) (Fowler et al., 2012).

7.2.3 DNA extraction, PCR and pyrotag sequencing

DNA was extracted using a modified phenol-chloroform method with bead-beating. Cells

(6 mL total) were repeatedly centrifuged at 18 000 g for 10 min to pellet cells in 2 mL bead beating tubes containing 0.3 g of 0.01 mm and 0.1 g of 0.5 mm zirconia/silica beads (BioSpec

Products). Cells were resuspended in 300 µL of lysis buffer (500 mM Tris, 100 mM NaCl, 10%

SDS, pH 8) and 300 µL of chloroform-isoamyl alcohol (24:1). Bead beating was carried out at

6.0 m/s for 45 s. DNA was extracted by phenol chloroform-isoamyl alcohol extraction followed by RNAse and proteinase K treatment and a final phenol then chloroform-isoamyl alcohol extraction step. DNA was precipitated in sodium acetate (3 M, pH 7) and cold 100% ethanol at

18 000 g for 20 min. Pellets were washed with cold 70% ethanol and resuspended in nuclease- free water (Fowler et al., 2012).

178

For pyrotag sequencing, DNA was amplified using universal primers 926F

(AAACTYAAKGAATTGACGG) and 1392R (ACGGGCGGTGTGTRC) targeting the V6, V7 and V8 variable regions of the 16S rRNA gene. In the first round of pyrotag sequencing, a single

PCR step was carried out using primer 454T-FB-926F (which included the 25 bp B-adaptor sequence CTATGCGCCTTGCCAGCCCGCTCAG 5’ to the primer sequence) and 454T-FA-

1392R (which included the 25 nt A-adaptor sequence CGTATCGCCTCCCTCGCGCATCAG and a variable 10 nt barcode sequence 5’ to the primer sequence) in 25 µL reactions containing

2x PCR Master Mix (Fermentas), 0.2 µM of each primer and 1 µL of DNA using the following thermocycling protocol: 95°C 3 min; 25 cycles of 95°C (30s), 55.0°C (45 s), 72.0°C (90 s); final extension 72°C 10 min. The exception to this protocol was the stearate culture, which was sequenced both times using the two-step PCR method described below.

In the second round of pyrotag sequencing a two-step PCR method was employed.

Changes in PCR-amplification methods were made as a result of a decision by the Hydrocarbon

Metagenomics Project to adopt a two-step method which improved the amplification of 16S rRNA genes from difficult samples, and standardized 16S rRNA gene pyrotag sample preparation methodology. In this new method, DNA was first amplified using universal primers

926F and 1392R with no adaptors attached according to the thermocycling and reaction conditions described above. In order to attach barcode and adaptor sequences for 454 multiplex sequencing, a secondary PCR was carried out with primers 454T-FB-926F and 454T-FA-1392R.

Reactions were prepared as above with modified thermocycling conditions: 95°C 3 min; 10 cycles of 95°C (30s), 55.0°C (45 s), 72.0°C (90 s); final extension 72°C 10 min.

All PCR products containing adaptors and barcodes were then purified using the Qiagen

PCR Purification Kit. Amplicons were quantified by Q-bit fluorometry (Invitrogen) according to

179

the manufacturer’s protocol and were sequenced at the McGill University and Genome Quebec

Innovation Centre (Montreal, Canada) using a GS FLX Titanium Series Kit XLR70 (Roche).

7.2.4 Sequencing and bioinformatics analysis

Analysis of 16S rRNA gene pyrotag data was carried out using the Phoenix 2 pipeline

(Soh et al., 2013). Briefly, quality control was performed to remove low quality and chimeric sequences. De-replication was performed (99% identity threshold) and sequences were clustered into OTUs at 5% distance using the average linkage algorithm. OTUs were mapped to taxa using the RDP classification algorithm with the SILVA training dataset (Pruesse et al., 2007).

Biodiversity and other statistical measures were generated using mothur commands (Soh et al.,

2013). In the results shown here, taxa comprising a single read were excluded from analysis as singleton and rare OTUs can be the result of sequencing errors, and rare taxa were not the focus of this analysis.

7.3 Results and discussion

The study of a number of methanogenic cultures has been ongoing in the laboratory for several years. These include a residual oil degrading culture that has been previously described to degrade n-alkanes (and other oil components) to methane (Gieg et al., 2008). From this culture, two long chain fatty acid (LCFA) degrading methanogenic cultures were established on palmitate and stearate respectively and have undergone routine substrate amendment and four culture transfers over approximately six years. More recently, these LCFA degrading cultures have been transferred onto their parent alkane substrates, hexadecane and octadecane, resulting in the establishment of two methanogenic alkane degrading cultures.

180

7.3.1 Methane production

Methane production was measured following transfer and substrate amendment of all cultures with the exception of the residual oil degrading culture for which methane production has previously been reported (Gieg et al., 2008). Palmitate and stearate degrading cultures were amended with 30 µmol of either palmitate or stearate. By the end of the incubation period, visual inspection indicated that stearate was completely depleted, while a small amount of palmitate remained in the cultures. After 340 days of incubation approximately 384 µmol of methane from stearate and 289 µmol of methane from palmitate were produced (Figure 7-1). Equations for the complete mineralization of palmitate and stearate to methane based on the Buswell equation are shown below (Symons & Buswell, 1933):

C16H32O2 + 7H2O  4.5CO2 + 11.5CH4 (Palmitate)

C18H36O2 + 8H2O  5CO2 + 13CH4 (Stearate)

Based on these equations, 84% of the predicted methane from palmitate was produced, while

98% of the stoichiometrically predicted methane from stearate was produced. Production of methane from unamended controls was 0 µmol (palmitate) and 41 µmol (stearate) (Figure 7-1).

181

450

400

350

300

250

200

Methane (µmol) Methane 150

100

50

0 0 50 100 150 200 250 300 350 400 Days

Figure 7-1. Production of methane by palmitate (▲) and stearate (■) degrading cultures over 340 days. Cultures were transferred and amended with 30 µmol of substrate. Methane production is the average of 5 (palmitate) or 6 (stearate) cultures from the most recent culture transfer. Dotted lines show methane production from substrate unamended control. Error bars show ± 1 standard error of the mean.

It is expected that continued incubation of the palmitate degrading culture will result in additional methane production, as residual palmitate remained in the culture. The production of additional methane from stearate is not expected as stearate has been depleted from culture incubations. Furthermore, nearly all theoretically predicted methane has been produced, with apparently little carbon going to the production of biomass in this culture. Previous work with methanogenic cultures typically result in the production of about 64 - 98% of theoretically

182

predicted methane. Theoretically predicted methane that is not observed is generally hypothesized to go to the production of biomass, with a small amount being lost during headspace sampling and due to adsorption to the stopper (Stadtman & Barker, 1951, Zengler et al., 1999, Fowler et al., 2012).

Hexadecane and octadecane degrading methanogenic cultures were established by amending substrate-depleted palmitate and stearate degrading cultures with their parent alkanes.

These were incubated for approximately one year and were then transferred to new medium

(50% v/v) and were amended with 0.03 g of either hexadecane (neat) or octadecane dissolved in

HMN.

183

A 100

80

60

40 Methane (µmol) Methane 20

0 0 50 100 150 200 250 300 Days

B 120

100

80

60

40 Methane (µmol) Methane 20

0 0 50 100 150 200 250 300 Days

Figure 7-2. Production of methane from (A) hexadecane degrading culture (B) octadecane degrading culture over 300 days. Methane production from unamended controls is shown as dotted lines, while solid lines represent individual replicates of cultures amended with hexadecane (♦) or octadecane (■). Note that methane production from each replicate is shown individually because of the large differences in methane production rates between replicates.

184

Over the course of 300 days, up to 81 µmol of methane was produced from hexadecane and up to 109 µmol methane from octadecane (Figure 7-2). The complete degradation of the amended hexadecane or octadecane to methane would theoretically produce 1384 and 1623 µmol of methane respectively based on the following equations for methane production from alkanes

(Symons & Buswell, 1933):

C16H34 + 7.5H2O  3.75CO2 + 12.25CH4 (hexadecane)

C18H38 + 8.5H2O  4.25CO2 + 13.75CH4 (octadecane)

A long lag in methane production ranging from about 170 to 250 days was observed in all cultures, but methane production now appears to be increasing (Figure 7-2). The production of methane in the unamended controls is believed to be a result of substantial substrate carryover from the initial hydrocarbon amendment during culture transfer. The observation of early and increased methane production of the unamended hexadecane control is likely due to a lower degree of inhibition by the hydrocarbon substrates as hydrocarbon concentrations would be substantially lower in these cultures (Figure 7-2a). Inhibition of microbes by hydrocarbon substrates has been well documented and is thought to be related to interference with biological membranes (Sikkema et al., 1995). It is likely that this effect is more pronounced in the hexadecane degrading culture because this substrate was added as a pure compound, while in the octadecane culture the presence of HMN may reduce the toxicity of the hydrocarbon substrate to microbes in the culture (Rabus et al., 1993). Alternatively, it is possible that the reducing agent, cysteine sulfide, is serving as a carbon source in these cultures (C. Toth, unpublished data).

Based on the equation for the conversion of cysteine to methane (below), up to107 µmol of the

185

methane produced could be a result of cysteine metabolism. Thus, it is difficult to say whether alkanes are being degraded by these cultures, or whether cysteine is serving as a carbon source.

Further monitoring of methane production in these cultures will reveal whether these cultures are degrading the alkanes supplied.

+ + 4C3H7NO2S+ 6 H2O + 4H  4H2S + 4NH4 + 5CH4 + 7CO2

In terms of methanogenic time frames, these alkane degrading cultures are still quite young. Continued monitoring and culturing will hopefully result in the establishment of stable, sediment-free methanogenic alkane degrading consortia. Future study should involve continued monitoring of methane production, examination of the metabolic pathways involved in methanogenesis from alkanes and microbial community analysis. Comparison of the microbial communities of the alkane degrading cultures with those of the LCFA degrading cultures may provide insight into the identity of the active alkane degrading organisms.

7.3.2 Microbial community analysis

The residual oil, palmitate, and stearate cultures have each been subjected to two rounds of microbial community analysis by 16S rRNA gene pyrotag sequencing from separate DNA extractions and at discrete time points, though always when actively degrading their respective substrates. Differences between the microbial communities of a single culture may reflect changes in the community over time and/or variation based on the pyrotag sample preparation method used. Sample preparation methods varied between the two replicates of the residual oil and palmitate degrading cultures from a single PCR step using primers with adaptor sequences in the first round of sequencing to a two-step method using primers without the adaptor in the first step followed by 10 additional cycles to attach adaptor and barcode sequences. The stearate

186

degrading culture was sequenced using the two-step PCR method in both cases. Pyrotag sequencing of alkane degrading cultures has not yet been carried out as it was felt that they have not exhibited sufficient methane production from alkanes relative to unamended controls since undergoing their first culture transfer in 2013.

The microbial community of the residual oil degrading culture was previously examined by 16S rRNA clone library analysis (Gieg et al., 2008). The study identified a number of bacterial and archaeal OTUs in the culture. Based on 16S rRNA gene clone library sequencing, the only archaeon detected was Methanosaeta sp., however further sequencing of an mcrA gene library also revealed the presence of Methanoculleus sp. and cultivation efforts enabled enrichment of a Methanobacterium sp. (Gieg et al., 2008). In 16S rRNA gene pyrotag sequencing performed here, the percentage of archaea in the residual oil culture varied widely from about 7-20% between samples R1 and R2. However, in both samples, the most abundant archaeon was the acetate-utilizing Methanosaeta sp. (4.2-12.1% of reads, Table 7-1), with hydrogenotrophic methanogens such as Methanoculleus sp. and Methanolinea sp. also present, but in lower abundance (0.9-2.8% and 0.8-3.8% of reads respectively, Table 7-1). Interestingly, no members of the Methanobacteria were detected by pyrotag sequencing suggesting either that these organisms represent a very small (and thus undetected) proportion of the community, or that they have been outcompeted by other community members since the initial cultivation experiments were carried out.

187

Table 7-1. Ten most abundant lineages as assessed by 16S rRNA gene pyrotag sequencing of a residual oil degrading cultures (R1, R2), a palmitate degrading culture (P1, P2) and a stearate degrading culture (S1, S2). Pyrotag sequencing was performed twice, at two separate time points, for each culture. Lineage % reads

Sample R1 R2 P1 P2 S1 S2 Clostridium sp. 69.1 31.4 76.4 53.7 62.5 61.6 Smithella sp. 7.2 16.1 0.6 15.5 1.3 1.0 Desulfovibrio sp. 4.7 3.7 3.5 0.6 2.2 0.9 Methanosaeta sp. 4.2 12.1 6.2 8.0 6.6 11.0 Enterobacter sp. 2.1 3.5 0 0 0.1 0.3 Anaerolinaceae 2.0 5.8 3.6 1.9 3.4 8.7 Methanoculleus sp. 0.9 2.8 4.6 1.0 2.0 2.5 Sedimentibacter sp. 0.9 1.4 0.05 0.8 0.6 0.3 Methanolinea sp. 0.8 3.8 0 0 0.04 0.2 Anaerobacter sp. 0.7 0.4 0.5 0.3 0.09 0.4 Uncultured Firmicutes 0.4 2.3 0.2 0.4 0 0.08 Spirochaetaceae 0.2 2.2 0.3 0.4 0.8 1.1 Geobacter sp. 0.1 0.4 0.9 0.1 0.1 0.3 Methanoregula sp. 0.3 0.7 0.4 13.0 0.8 1.2 Lachnospiraceae Incertae Sedis 0 0.07 0.09 1.1 11.8 4.4 Ruminococcaceae 0.2 0.2 0.2 0.7 3.6 1.5

The bacterial clone library sequenced by Gieg et al., (2008) was dominated by members of the Clostridiaceae. Other Firmicutes identified included three clones belonging to the

Peptococcaceae, including a Desulfosporosinus sp. and a Cryptanaerobacter sp.

Deltaproteobacteria related to Syntrophus sp., Desulfovibrio sp., and the uncharacterized cluster

TA were also identified in addition to a few members of the phyla Chloroflexi, Actinobacteria, and Bacteroidetes (Gieg et al., 2008). These findings are in alignment with the pyrotag results reported here. The Firmicutes dominated pyrotag sequences (38- 73% of reads) with members of

Clostridium sp. being by far the most abundantly sequenced (31.4- 69.1%). Members of the

Peptococcaceae including Cryptanaerobacter sp. (0.4 -0.5%) were present in low abundance.

Deltaproteobacterial members such as Desulfovibrio sp. (3.7-4.7%) and Smithella sp. (7.2-

188

16.1%) were also among the most abundant organisms detected by pyrotag sequencing (Table 7-

1). Members of the phyla Chloroflexi (2.3- 7.3%), Bacteroidetes (1.2- 3.2%), and Actinobacteria

(0.6-0.9%) were detected in both samples though in relatively lower abundance (Figure 7-3).

Enrichmentcultures

Figure 7-3. Microbial communities of residual oil (R1, R2), stearate (S1, S2), and palmitate (P1, P2) degrading methanogenic cultures by comparison at the phylum level.

Since the microbial communities from the stearate and palmitate degrading cultures were initially derived from the residual oil degrading culture, we expected to see similarities between the microbial communities, with major changes likely reflecting the role of the organisms in hydrocarbon vs. LCFA degradation. Furthermore, we expected to observe a reduction in

189

biodiversity between the residual oil and LCFA degrading cultures, as the diversity in substrates has been substantially reduced in the latter, and LCFA metabolism is expected to be a central pathway in all cultures.

Indeed we did observe a decrease in the number of OTUs between the residual oil culture

(110 and 204) and the palmitate (83 and 86) and stearate cultures (73 and 97). Based on the

Shannon index, which measures evenness of the population with an emphasis on rare species, the residual oil culture was, on average, the most diverse. Further, based on the Simpson index, a metric which focuses on the number of abundant species, the residual oil culture was again, on average, the most biodiverse (Table 7-2). Together these results indicate an overall loss of biodiversity between residual oil and LCFA degrading cultures, as we had hypothesized.

However, substantial differences in the number of OTUs existed between the two replicates for the residual oil culture (Table 7-2). This difference is likely due to sample preparation methodology and not to changes in the culture over time, as sample R2 was prepared at a later time point than sample R1 and would thus not be expected to become more biodiverse. These observations may also be related to sample size, as the number of reads in sample R2 was about

80% greater than sample R1. Less variation in sample size and number of OTUs was observed between the palmitate and stearate replicates (Table 7-2). This can also be seen by looking at the

Chao index, which estimates the total number of OTUs in a sample. The residual oil degrading culture, as expected, contains more OTUs than the LCFA degrading cultures, but the variation in

OTU estimates is high for the residual oil culture. This suggests that the one-step PCR method may limit the detection of diversity relative to the two-step method, particularly in the residual oil degrading culture, and to a lesser extent in the palmitate degrading culture (Table 7-2). The major resultant changes are a decrease in the fraction of Firmicutes, and an increase in fractions

190

of Euryarchaeota and Deltaproteobacteria in samples R2 and P2 relative to R1 and P1 (Table 7-

1, Figure 7-3). An alternative possibility is that the additional PCR cycles with barcoded primers are allowing for the increased amplification of errors. While this is certainly a possibility, it is likely that the presence of the adaptor and barcode sequence on the primers would reduce the number of targets that the primers would anneal to, resulting in less diverse results when using the one-step method. Furthermore, amplification of errors would result in a random increase in biodiversity across all taxa, while increased biodiversity using the two-step method was detected primarily in two groups - the Euryarchaeota and Deltaproteobacteria. While targeted studies comparing these two methods using a known mixture of target sequences would provide more robust data, based on the results shown here, it seems reasonable to suggest that future pyrotag sequencing should be carried out using the two-step PCR method to maximize detected biodiversity.

Table 7-2. Alpha-diversity statistics from 16S rRNA gene pyrotag sequencing of residual oil, palmitate, and stearate degrading methanogenic cultures Sample Reads (post-QC) OTUs Shannon Simpson Chao R1 4260 110 1.61 0.46 184 R2 7620 204 2.84 0.13 312 P1 5636 83 1.19 0.59 145 P2 4804 86 1.68 0.33 162 S1 4705 73 1.63 0.41 115 S2 6051 97 1.76 0.40 141

With regards to the microbial community composition, there were substantial similarities across the cultures. The dominant phylum in all of the cultures was Firmicutes (Figure 7-3), with

Clostridium sp. making up the most dominant lineage by a wide margin in all samples (31.4-

76.4% of reads, Table 7-1). Smithella sp. was the second most abundant organism in the residual oil degrading culture, and while it was still one of the most abundant organisms in LCFA

191

degrading cultures, it was in much lower relative abundance (except in sample P2) (Table 7-1).

Smithella sp. and its close relative Syntrophus sp. have frequently been associated with alkane activation in methanogenic environments (Zengler et al., 1999, Jones et al., 2008, Gray et al.,

2011, Embree et al., 2013). Thus, this taxon may also fulfill this function in the residual oil degrading culture, explaining its lower abundance in LCFA degrading cultures. Microbial community analysis of the alkane degrading cultures may shed additional light on this hypothesis. Another member of the Deltaproteobacteria that was abundant in all cultures was

Desulfovibrio sp. Though Desulfovibrio sp. is not believed to be involved in hydrocarbon or

LCFA oxidation, they are ubiquitous in hydrocarbon-impacted environments (Agrawal et al.,

2010, Ramos-Padron et al., 2011, Bordenave et al., 2013). They are well known as facultative syntrophs (Walker et al., 2009) and thus may be involved in the fermentation of shorter-chain fatty acids. Members of the Anaerolinaceae (phylum Chloroflexi) were also found in fairly high abundance in all of the cultures. The role of this organism is uncertain, though previous results with a methanogenic toluene degrading enrichment from the same source inoculum suggests that these organisms do incorporate carbon from the hydrocarbon substrate and it has been hypothesized that they may be involved syntrophic acetate oxidation or the downstream metabolism of another compound (Chapters 4 & 6). Members of the Anaerolineae are syntrophs that have been identified in diverse environments where their ecological roles are largely unknown (Yamada & Sekiguchi, 2009).

The acetoclastic methanogen Methanosaeta sp. was a major contributor to archaeal diversity, and represented the most abundant methanogen in all cultures with the exception of sample P2 where Methanoregula sp. dominated. However, hydrogenotrophic methanogens were also found in relatively high abundance in all cultures, and comprised multiple species including

192

Methanoculleus sp., Methanoregula sp., and Methanolinea sp. (Table 7-1). Using the same residual oil degrading culture described here, Morris et al., (2012) provided evidence that in the presence of LCFAs, acetoclastic methanogenesis was dominant, while in the presence of only residual oil, both acetotrophic and hydrogenotrophic methanogenesis occurred. The archaeal communities found here suggest that both pathways contribute to methane production from

LCFA and residual oil in the cultures.

In summary, we have shown methane production from LCFA and newly established alkane degrading methanogenic cultures, though the production of methane from alkanes has not been conclusively demonstrated. The microbial communities of LCFA cultures are less biodiverse than the residual oil degrading culture from which they were derived, as we expected due to the reduction in substrate diversity. Additionally, the data shown here suggests that a two- step PCR method where adaptor and barcode sequences are incorporated in a secondary PCR increases the diversity of organisms detected by pyrotag sequencing. The dominant community member in all cultures was Clostridium sp., though it is not believed to be involved in hydrocarbon activation (based on results shown in Chapters 4 & 6). Alkane activation in the residual oil culture may be catalyzed by Smithella sp. based on literature reports, although this remains to be tested. The dominant archaeon in all cultures was the acetotrophic methanogen

Methanosaeta sp., but hydrogenotrophic methanogens were also present in all cultures. Further incubation and study of the methanogenic alkane degrading cultures could provide more insight into the identity of methanogenic hydrocarbon activating organisms and the pathways by which alkanes are degraded under methanogenic conditions. The large number of OTUs identified in all cultures despite the long duration of culturing, in addition to the uncertainty with regards to their

193

metabolic roles, emphasizes the work that remains to be done in understanding the dynamics of methanogenic environments.

194

Chapter Eight: Conclusions and future directions for research

The focus of this dissertation was the characterization of syntrophic microorganisms involved in methanogenic hydrocarbon biodegradation in order to provide a better understanding of their unique metabolism. The objectives guiding this work were; i) identification of the microorganisms present in methanogenic hydrocarbon degrading enrichment cultures, ii) associating the activation of hydrocarbon substrates with specific microorganisms present in the cultures, and iii) identification and characterization of the pathways utilized by syntrophic microorganisms for the initial activation and subsequent degradation of hydrocarbon substrates.

To target these objectives, a combination of analytical, molecular biology and metagenomic methods were applied to study such metabolism, focusing on a methanogenic toluene degrading enrichment culture. This stable, sediment-free culture was enriched using sediments from a gas- condensate contaminated aquifer subjected to in-situ bioremediation (Gieg et al., 1999) and has been maintained in the laboratory by routine substrate amendment and culture transfer for over ten years.

8.1 Summary of key findings

At the beginning of this study, we hypothesized that toluene was activated by either fumarate addition or hydroxylation in this culture, both of which had been described as possible toluene activation mechanisms under methanogenic conditions (Vogel & Grbić-Galić, 1986,

Washer & Edwards, 2007). After demonstrating that the production of methane was coupled to toluene depletion in the culture, we examined metabolite production in the culture using GC-MS

(Chapter 3). This analysis revealed the presence of benzylsuccinate, cresols and benzyl alcohol,

195

putative metabolites of fumarate addition, ring hydroxylation, and methyl group hydroxylation of toluene respectively. Further analysis revealed that the hydroxylated compounds were produced abiotically, while benzylsuccinate was a true metabolite, providing evidence that toluene was activated by fumarate addition in the culture and ruling out hydroxylation as a biological activation mechanism in this culture. Amplification of a bssA gene fragment by PCR provided corroborating genetic evidence for fumarate addition in the culture. Metagenomic analysis of several other methanogenic hydrocarbon degrading enrichments and hydrocarbon-impacted environments, such as tailings ponds and marine sediments, suggest that fumarate addition is a widespread mechanism for hydrocarbon activation under anaerobic conditions (Chapter 5).

Metabolite analysis also enabled the detection of a number of downstream metabolites of toluene metabolism such as benzoate, cyclohexane carboxylate, pimelate and glutarate (Chapter 3).

Further evidence for the pathway of toluene metabolism was provided by the analysis of the metagenome (Chapters 5 & 6) in which genes for beta-oxidation of benzylsuccinate and benzoyl-

CoA reductases were identified. Analysis of the metagenome also revealed the genetic potential for the degradation of alternate hydrocarbon substrates such as alkanes, benzene and possibly other monoaromatic hydrocarbons (Chapters 5 & 6).

Pyrotag sequencing of the 16S rRNA gene presented in Chapter 3 gave the first insight into the microbial community involved in methanogenic toluene metabolism. This analysis suggested that both acetotrophic and hydrogenotrophic methanogenesis occurred in the culture due to the presence of both hydrogenotrophic and acetoclastic methanogens. Bacterial diversity was much greater than expected, and the role of individual organisms at this point was cryptic. It was speculated that the organism involved in toluene activation was likely a member of the

Clostridiales, as members of this group were present in the greatest abundance. RNA-SIP

196

analysis allowed for the identification of key organisms that incorporated carbon from toluene, which suggested that Desulfosporosinus sp. was involved in toluene activation (Chapter 4). A number of other members of the community including organisms related to Syntrophus sp.,

Desulfovibrio sp., and Chloroflexi were also found to incorporate carbon from toluene, suggesting direct involvement in toluene metabolism. The role of Desulfosporosinus sp. in toluene activation was confirmed by metagenomic analysis where a bin corresponding to

Desulfosporosinus sp. was found to contain genes for toluene activation, beta-oxidation of benzylsuccinate and benzoyl-CoA reductase (Chapter 6). The analysis of the metagenome also provided some evidence as to the role of other syntrophic bacteria, suggesting that some are involved in beta-oxidation of potential products of toluene metabolism as well as syntrophic acetate oxidation and other fermentation reactions. A member of the Syntrophobacterales may also be involved benzoyl-CoA metabolism along with Desulfosporosinus sp., explaining the early incorporation of carbon from toluene detected by RNA-SIP. The degradation of dead cell material as well as carbon fixation may provide alternate carbon sources for some members of the culture.

Comparative metagenomic analysis revealed that the functional profiles of three methanogenic hydrocarbon degrading cultures, including the toluene degrading culture, share a common functional profile, which is distinct from other environments (including those impacted by hydrocarbons), despite variation in the original inoculum source, enrichment substrates, and microbial community (Chapter 5). This study suggests that methanogenic hydrocarbon degrading communities have a specific functional profile which reflects key metabolic features of methanogenesis from hydrocarbon substrates. Functional categories found to be enriched in the methanogenic hydrocarbon degrading enrichments included complexes associated with

197

maintaining a low redox potential and/or reducing oxidative stress, a number of hydrogenases and formate hydrogenases, and features associated with archaea and methanogens. Thus, key features of methanogenic hydrocarbon degrading environments are regulation of redox conditions, interspecies hydrogen and formate transfer, and a stable methanogenic population.

The importance of formate and hydrogen transfer was further established by the discovery of numerous redox complexes, formate dehydrogenases and hydrogenases associated with reverse electron transport across numerous taxa in the metagenome of the toluene degrading enrichment culture. These findings suggest that numerous syntrophic interactions occur in this culture

(Chapter 6).

In Chapter 7 we began extending the methods applied to the methanogenic toluene degrading culture to other methanogenic hydrocarbon and LCFA degrading enrichments and describe the establishment of two methanogenic alkane degrading cultures. As these cultures were established using sediments from the same gas-condensate contaminated aquifer as the toluene degrading culture, it is likely that much of the information gained through the study of any one culture, such as the metabolic function of specific organisms, can be more confidently assumed to be relevant in the other cultures.

8.2 Future directions for research

Over the course of these investigations, I was continually reminded of the vast complexity of methanogenic hydrocarbon degrading cultures and the inherent difficulties in studying the syntrophic processes that allow these communities to function. Several avenues of study that stem from the research described in this dissertation may aid in an improved understanding of syntrophic processes.

198

While much information was gained about the genetic potential of the toluene degrading culture by metagenomic sequencing, metatranscriptomic analysis of this culture would provide insight into functions that are actually active in the culture. Coupled with the metagenomic data described here, this would provide further insight into the putative roles of individual members of the community and possibly provide more insight into the processes governing the conversion of toluene to methane in this culture.

Isolation of members of these communities and studies in isolation and in co-culture would simplify the study of syntrophic processes relevant in methanogenic hydrocarbon degrading cultures. While isolation of organisms from the methanogenic hydrocarbon degrading cultures described in this dissertation has thus far not been successful (data not shown), new information gained from metagenomic analysis may help to develop more targeted strategies for isolation of individual community members. Developing simpler model systems using microbes isolated from complex communities may enable physiological studies to follow up the preliminary investigation into potential intercellular communication and sensing mechanisms that could be involved in the establishment and maintenance of syntrophic relationships (Chapter

6).

Assembly of draft genomes of syntrophic bacteria using binned metagenomic data could provide additional clues as to the genetic potential and putative functional roles of members of the culture without the need to isolate individual organisms, and could also provide targeted strategies for isolation experiments. Draft genome assembly of organisms belonging to taxa for which no or few isolates or genome sequences exist (e.g. Verrucomicrobia, WWE1,

Thermotogae) would be of particular interest as it could provide a means to study previously

199

uncharacterized organisms and provide clues to their function in both syntrophic and non- syntrophic environments.

Additional microcosms should be established using the toluene degrading culture to determine if the genetic potential to degrade alkanes, benzene, and other monoaromatic hydrocarbons can be translated into functional potential. Studying these cultures, as well as the cultures described in Chapter 7 could provide additional insights into hydrocarbon degradation pathways under methanogenic conditions. Furthermore, if the toluene degrading culture has the ability to degrade multiple hydrocarbon substrates, this culture could potentially be scaled up and used for biotechnological applications such as biostimulation for remediation of hydrocarbon contaminated environments.

This dissertation provides evidence that methanogenic hydrocarbon degrading cultures consist of functionally specialized communities that catalyze the conversion of hydrocarbons to methane. The work has revealed some of the metabolic pathways utilized for hydrocarbon metabolism under methanogenic conditions, and has pointed to some of the syntrophic interactions that appear to facilitate hydrocarbon metabolism. The high microbial diversity present in all of the cultures discussed here, coupled to the continued uncertainty of the roles of specific organisms emphasizes the work that remains to be done in understanding the dynamics of methanogenic hydrocarbon degrading environments. A further understanding of these processes may guide the development of biotechnological applications for in-situ bioremediation and microbially enhanced energy recovery, as well as providing a better understanding of the adaptations used by members of these communities for metabolic coordination and survival at low energy yields.

200

References

Abu Laban N, Selesi D, Jobelius C & Meckenstock RU (2009) Anaerobic benzene degradation by Gram-positive sulfate-reducing bacteria. FEMS Microbiol Ecol 68: 300-311.

Abu Laban N, Selesi D, Rattei T, Tischler P & Meckenstock RU (2010) Identification of enzymes involved in anaerobic benzene degradation by a strictly anaerobic iron-reducing enrichment culture. Environ Microbiol 12: 2783-2796.

Acosta-Gonzalez A, Rossello-Mora R & Marques S (2013) Diversity of benzylsuccinate synthase-like (bssA) genes in hydrocarbon-polluted marine sediments suggests substrate- dependent clustering. Appl Environ Microbiol 79: 3667-3676.

Agrawal A, Vanbroekhoven K & Lal B (2010) Diversity of culturable sulfidogenic bacteria in two oil-water separation tanks in the north-eastern oil fields of India. Anaerobe 16: 12-18.

Aitken CM, Jones DM, Maguire MJ, Gray ND, Sherry A, Bowler BFJ, Ditchfield AK, Larter SR & Head IM (2013) Evidence that crude oil alkane activation proceeds by different mechanisms under sulfate-reducing and methanogenic conditions. Geochim Cosmochim Ac 109: 162-174.

Albertsen M, Hugenholtz P, Skarshewski A, Nielsen KL, Tyson GW & Nielsen PH (2013) Genome sequences of rare, uncultured bacteria obtained by differential coverage binning of multiple metagenomes. Nature Biotechnol 31: 533-538.

Annweiler E, Materna A, Safinowski M, Kappler A, Richnow HH, Michaelis W & Meckenstock RU (2000) Anaerobic degradation of 2-methylnaphthalene by a sulfate-reducing enrichment culture. Appl Environ Microbiol 66: 5329-5333.

Ball HA, Johnson HA, Reinhard M & Spormann AM (1996) Initial reactions in anaerobic ethylbenzene oxidation by a denitrifying bacterium, strain EB1. J Bacteriol 178: 5755-5761.

Beller HR & Spormann AM (1997a) Anaerobic activation of toluene and o-xylene by addition to fumarate in denitrifying strain T. J Bacteriol 179: 670-676.

Beller HR & Spormann AM (1997b) Benzylsuccinate formation as a means of anaerobic toluene activation by sulfate-reducing strain PRTOL1. Appl Environ Microbiol 63: 3729-3731.

Beller HR & Spormann AM (1998) Analysis of the novel benzylsuccinate synthase reaction for anaerobic toluene activation based on structural studies of the product. J Bacteriol 180: 5454- 5457.

Beller HR & Edwards EA (2000) Anaerobic toluene activation by benzylsuccinate synthase in a highly enriched methanogenic culture. Appl Environ Microbiol 66: 5503-5505.

201

Berdugo-Clavijo C, Dong XL, Soh J, Sensen CW & Gieg LM (2012) Methanogenic biodegradation of two-ringed polycyclic aromatic hydrocarbons. FEMS Microbiol Ecol 81: 124- 133. Bergmann FD, Selesi D & Meckenstock RU (2011) Identification of new enzymes potentially involved in anaerobic naphthalene degradation by the sulfate-reducing enrichment culture N47. Arch Microbiol 193: 241-250.

Biebl H & Pfennig N (1978) Growth yields of green sulfur bacteria in mixed cultures with sulfur and sulfate reducing bacteria. Arch Microbiol 117: 9-16.

Biegert T, Fuchs G & Heider F (1996) Evidence that anaerobic oxidation of toluene in the denitrifying bacterium Thauera aromatica is initiated by formation of benzylsuccinate from toluene and fumarate. Eur J Biochem 238: 661-668.

Boll M (2005) Dearomatizing benzene ring reductases. J Mol Microbiol Biotechnol 10: 132-142.

Boll M & Fuchs G (1995) Benzoyl-coenzymeA reductase (dearomatizing), a key enzyme of anaerobic aromatic metabolism - ATP dependence of the reaction, purification and some properties of the enzyme from Thauera aromatica strain K172. Eur J Biochem 234: 921-933.

Boone DR, Johnson RL & Liu Y (1989) Diffusion of the interspecies electron carriers H2 and formate in methanogenic ecosystems and its implications on the measurement of Km for H2 or formate uptake. Appl Environ Microbiol 55: 1735-1741.

Bordenave S, Chatterjee I & Voordouw G (2013) Microbial community structure and microbial activities related to CO2 storage capacities of a salt cavern. Int Biodeter Biodegr 81: 82-87.

Bryant MP, Wolin EA, Wolin MJ & Wolfe RS (1967) Methanobacillus omelianskii a symbiotic association of 2 species of bacteria. Arch Microbiol 59: 20-31.

Butler JE, He Q, Nevin KP, He ZL, Zhou JZ & Lovley DR (2007) Genomic and microarray analysis of aromatics degradation in Geobacter metallireducens and comparison to a Geobacter isolate from a contaminated field site. BMC Genomics 8: 180.

Caldwell ME & Suflita JM (2000) Detection of phenol and benzoate as intermediates of anaerobic benzene biodegradation under different terminal electron-accepting conditions. Environ Sci Technol 34: 1216-1220.

Callaghan AV, Tierney M, Phelps CD & Young LY (2009) Anaerobic biodegradation of n- hexadecane by a nitrate-reducing consortium. Appl Environ Microbiol 75: 1339-1344.

Callaghan AV, Gieg LM, Kropp KG, Suflita JM & Young LY (2006) Comparison of mechanisms of alkane metabolism under sulfate-reducing conditions among two bacterial isolates and a bacterial consortium. Appl Environ Microbiol 72: 4274-4282.

202

Callaghan AV, Wawrik B, Chadhain SMN, Young LY & Zylstra GJ (2008) Anaerobic alkane- degrading strain AK-01 contains two alkylsuccinate synthase genes. Biochem Bioph Res Co 366: 142-148. Callaghan AV, Morris BEL, Pereira IAC, et al. (2012) The genome sequence of Desulfatibacillum alkenivorans AK-01: A blueprint for anaerobic alkane oxidation. Environ Microbiol 14: 101-113.

Callaghan AV (2013) Enzymes involved in the anaerobic oxidation of n-alkanes: From methane to long-chain parrafins. Front Microbiol 4: 89.

Carmona M, Zamarro MT, Blazquez B, Durante-Rodriguez G, Juarez JF, Valderrama JA, Barragan JL, Garcia JL & Diaz E (2009) Anaerobic catabolism of aromatic compounds: a genetic and genomic view. Microbiol Mol Biol Rev 73: 71-133.

Chakraborty R & Coates JD (2005) Hydroxylation and carboxylation-two crucial steps of anaerobic benzene degradation by Dechloromonas strain RCB. Appl Environ Microbiol 71: 5427-5432.

Choudhary S & Schmidt-Dannert C (2010) Applications of quorum sensing in biotechnology. Appl Microbiol Biotechnol 86: 1267-1279.

Coates JD, Chakraborty R & McInerney MJ (2002) Anaerobic benzene biodegradation - a new era. Res Microbiol 153: 621-628.

Cord-Ruwisch R, Lovley DR & Schink B (1998) Growth of Geobacter sulfurreducens with acetate in syntrophic cooperation with hydrogen-oxidizing anaerobic partners. Appl Environ Microbiol 64: 2232-2236. de Bok FAM, Hagedoorn PL, Silva PJ, Hagen WR, Schiltz E, Fritsche K & Stams AJM (2003) Two W-containing formate dehydrogenases (CO2-reductases) involved in syntrophic propionate oxidation by Syntrophobacter fumaroxidans. Eur J Biochem 270: 2476-2485. de Bok FAM, Harmsen HJM, Plugge CM, de Vries MC, Akkermans ADL, de Vos WM & Stams AJM (2005) The first true obligately syntrophic propionate-oxidizing bacterium, Pelotomaculum schinkii sp nov., co-cultured with Methanospirillum hungatei, and emended description of the genus Pelotomaculum. Int J Syst Evol Microbiol 55: 1697-1703.

DiDonato RJ, Young ND, Butler JE, Chin K-J, Hixson KK, Mouser P, Lipton MS, DeBoy R & Methe BA (2010) Genome sequence of the deltaproteobacterial strain NaphS2 and analysis of differential gene expression during anaerobic growth on naphthalene. PLOS One 5: e14072.

Ekzertsev V (1960) Production of methane by microorganisms in petroleum deposits. Geochem 4: 432-442.

203

Embree M, Nagarajan H, Movahedi N, Chitsaz H & Zengler K (2013) Single-cell genome and metatranscriptome sequencing reveal metabolic interactions of an alkane-degrading methanogenic community. ISME J 8: 757-767.

Ettwig K, Butler M, Le Paslier D, Pelletier E, Mangenot S, Kuypers MMM, Schreiber F, Dutilh BE, Zedelius J, de Beer D, et al. (2010) Nitrite-driven anaerobic methane oxidation by oxygenic bacteria. Nature 464: 543-548.

Felsenstein J (1993) PHYLIP (Phylogeny Inference Package) Version 3.5c. University of Washington, Seattle.

Finn RD, Mistry J, Tate J, et al. (2010) The Pfam protein families database. Nucleic Acids Res 38: D211-D222.

Foght J (2008) Anaerobic biodegradation of aromatic hydrocarbons: Pathways and prospects. J Mol Microbiol Biotechnol 15: 93-120.

Fowler SJ, Dong X, Sensen CW, Suflita JM & Gieg LM (2012) Methanogenic toluene metabolism: Community structure and intermediates. Environmental Microbiology 14: 754-764.

Gieg LM, Fowler SJ & Berdugo-Clavijo C (2014) Syntrophic biodegradation of hydrocarbon contaminants. Curr Opin Biotechnol 27: 21-29.

Gieg LM, Duncan KE & Suflita JM (2008) Bioenergy production via microbial conversion of residual oil to natural gas. Appl Environ Microbiol 74: 3022-3029.

Gieg LM, Davidova IA, Duncan KE & Suflita JM (2010) Methanogenesis, sulfate reduction and crude oil biodegradation in hot Alaskan oilfields. Environ Microbiol 12: 3074-3086.

Gieg LM, Kolhatkar RV, McInerney MJ, Tanner RS, Harris SH, Sublette KL & Suflita JM (1999) Intrinsic bioremediation of petroleum hydrocarbons in a gas condensate-contaminated aquifer. Environ Sci Technol 33: 2550-2560.

Gorby YA, Yanina S, McLean JS, et al. (2006) Electrically conductive bacterial nanowires produced by Shewanella oneidensis strain MR-1 and other microorganisms. P Natl Acad Sci USA 103: 11358-11363.

Gray ND, Sherry A, Grant RJ, et al. (2011) The quantitative significance of Syntrophaceae and syntrophic partnerships in methanogenic degradation of crude oil alkanes. Environ Microbiol 13: 2957-2975.

Grbić-Galić D & Vogel TM (1987) Transformation of toluene and benzene by mixed methanogenic cultures Appl Environ Microbiol 53: 254-260.

204

Grundmann O, Behrends A, Rabus R, Amann J, Halder T, Heider J & Widdel F (2008) Genes encoding the candidate enzyme for anaerobic activation of n-alkanes in the denitrifying bacterium, strain HxN1. Environ Microbiol 10: 376-385.

Harmsen HJM, Van Kuijk BLM, Plugge CM, Akkermans ADL, De Vos WM & Stams AJM (1998) Syntrophobacter fumaroxidans sp. nov., a syntrophic propionate-degrading sulfate- reducing bacterium. Int J Syst Bacteriol 48: 1383-1387.

Heider J (2007) Adding handles to unhandy substrates: anaerobic hydrocarbon activation mechanisms. Curr Opin Chem Biol 11: 188-194.

Herrmann S, Kleinsteuber S, Chatzinotas A, Kuppardt S, Lueders T, Richnow HH & Vogt C (2010) Functional characterization of an anaerobic benzene-degrading enrichment culture by DNA stable isotope probing. Environ Microbiol 12: 401-411.

Hess M, Sczyrba A, Egan R, et al. (2011) Metagenomic discovery of biomass-degrading genes and genomes from cow rumen. Science 331: 463-467.

Hirschler-Rea A, Cravo-Laureau C, Casalot L & Matheron R (2012) Methanogenic octadecene degradation by syntrophic enrichment culture from brackish sediments. Curr Microbiol 65: 561- 567.

Holmes DE, Risso C, Smith JA & Lovley DR (2011) Anaerobic oxidation of benzene by the hyperthermophilic archaeon Ferroglobus placidus. Appl Environ Microbiol 77: 5926-5933.

Huson DH & Scornavacca C (2012) Dendroscope 3: An interactive tool for rooted phylogenetic trees and networks. Syst Biol 61: 1061-1067.

Imachi H, Sekiguchi Y, Kamagata Y, Loy A, Qiu YL, Hugenholtz P, Kimura N, Wagner M, Ohashi A & Harada H (2006) Non-sulfate-reducing, syntrophic bacteria affiliated with Desulfotomaculum cluster I are widely distributed in methanogenic environments. Appl Environ Microbiol 72: 2080-2091.

Ishii S, Kosaka T, Hori K, Hotta Y & Watanabe K (2005) Coaggregation facilitates interspecies hydrogen transfer between Pelotomaculum thermopropionicum and Methanothermobacter thermautotrophicus. Appl Environ Microbiol 71: 7838-7845.

Johnson HA, Pelletier DA & Spormann AM (2001) Isolation and characterization of anaerobic ethylbenzene dehydrogenase, a novel Mo-Fe-S enzyme. J Bacteriol 183: 4536-4542.

Jones DM, Head IM, Gray ND, et al. (2008) Crude-oil biodegradation via methanogenesis in subsurface petroleum reservoirs. Nature 451: 176-181.

205

Kaden J, Galushko AS & Schink B (2002) Cysteine-mediated electron transfer in syntrophic acetate oxidation by co-cultures of Geobacter sulfurreducens and Wolinella succinogenes. Arch Microbiol 178: 53-58.

Kane SR, Beller HR, Legler TC & Anderson RT (2002) Biochemical and genetic evidence of benzylsuccinate synthase in toluene-degrading, ferric iron-reducing Geobacter metallireducens. Biodegradation 13: 149-154.

Kato S, Kosaka T & Watanabe K (2009) Substrate-dependent transcriptomic shifts in Pelotomaculum thermopropionicum grown in syntrophic co-culture with Methanothermobacter thermautotrophicus. Microb Biotechnol 2: 575-584.

Kato S, Hashimoto K & Watanabe K (2012) Methanogenesis facilitated by electric syntrophy via (semi)conductive iron-oxide minerals. Environ Microbiol 14: 1646-1654.

Kleinsteuber S, Schleinitz KM & Vogt C (2012) Key players and team play: Anaerobic microbial communities in hydrocarbon-contaminated aquifers. Appl Microbiol Biotechnol 94: 851-873.

Kniemeyer O & Heider J (2001) Ethylbenzene dehydrogenase, a novel hydrocarbon-oxidizing molybdenum/iron-sulfur/heme enzyme. J Biol Chem 276: 21381-21386.

Kniemeyer O, Fischer T, Wilkes H, Glockner FO & Widdel F (2003) Anaerobic degradation of ethylbenzene by a new type of marine sulfate-reducing bacterium. Appl Environ Microbiol 69: 760-768.

Krieger CJ, Beller HR, Reinhard M & Spormann AM (1999) Initial reactions in anaerobic oxidation of m-xylene by the denitrifying bacterium Azoarcus sp. strain T. J Bacteriol 181: 6403- 6410.

Kropp KG, Davidova IA & Suflita JM (2000) Anaerobic oxidation of n-dodecane by an addition reaction in a sulfate-reducing bacterial enrichment culture. Appl Environ Microbiol 66: 5393- 5398.

Kunapuli U, Lueders T & Meckenstock RU (2007) The use of stable isotope probing to identify key iron-reducing microorganisms involved in anaerobic benzene degradation. ISME J 1: 643- 653.

Kunapuli U, Griebler C, Beller HR & Meckenstock RU (2008) Identification of intermediates formed during anaerobic benzene degradation by an iron-reducing enrichment culture. Environ Microbiol 10: 1703-1712.

Liu YC & Whitman WB (2008) Metabolic, phylogenetic, and ecological diversity of the methanogenic archaea. Ann NY Acad Sci 1125: 171-189.

206

Liu YT, Balkwill DL, Aldrich HC, Drake GR & Boone DR (1999) Characterization of the anaerobic propionate-degrading syntrophs Smithella propionica gen. nov., sp. nov. and Syntrophobacter wolinii. Int J Syst Bacteriol 49: 545-556.

Lomans BP, Maas R, Luderer R, den Camp H, Pol A, van der Drift C & Vogels GD (1999) Isolation and characterization of Methanomethylovorans hollandica gen. nov., sp. nov., isolated from freshwater sediment, a methylotrophic methanogen able to grow on dimethyl sulfide and methanethiol. Appl Environ Microbiol 65: 3641-3650.

Lupton FS & Zeikus JG (1984) Physiological basis for sulfate-dependent hydrogen competition between sulfidogens and methanogens. Curr Microbiol 11: 7-12.

Mayumi D, Mochimaru H, Yoshioka H, Sakata S, Maeda H, Miyagawa Y, Ikarashi M, Takeuchi M & Kamagata Y (2011) Evidence for syntrophic acetate oxidation coupled to hydrogenotrophic methanogenesis in the high-temperature petroleum reservoir of Yabase oil field (Japan). Environ Microbiol 13: 1995-2006.

McInerney MJ & Bryant MP (1981) Anaerobic degradation of lactate by syntrophic associations of Methanosarcina barkeri and Desulfovibrio species and effect of H2 on acetate degradation. Appl Environ Microbiol 41: 346-354.

McInerney MJ, Sieber JR & Gunsalus RP (2009) Syntrophy in anaerobic global carbon cycles. Curr Opin Biotechnol 20: 623-632.

McInerney MJ, Rohlin L, Mouttaki H, et al. (2007) The genome of Syntrophus aciditrophicus: Life at the thermodynamic limit of microbial growth. P Natl Acad Sci USA 104: 7600-7605.

Morasch B & Meckenstock RU (2005) Anaerobic degradation of p-xylene by a sulfate-reducing enrichment culture. Curr Microbiol 51: 127-130.

Morris BEL, Herbst FA, Bastida F, Seifert J, von Bergen M, Richnow HH & Suflita JM (2012) Microbial interactions during residual oil and n-fatty acid metabolism by a methanogenic consortium. Environ Microbiol Rep 4: 297-306.

Mouttaki H, Johannes J & Meckenstock RU (2012) Identification of naphthalene carboxylase as a prototype for the anaerobic activation of non-substituted aromatic hydrocarbons. Environ Microbiol 14: 2770-2774.

Muller F (1957) On methane fermentation of higher alkanes. Ant Van Leeuw 23: 369-384.

Musat F, Galushko A, Jacob J, Widdel F, Kube M, Reinhardt R, Wilkes H, Schink B & Rabus R (2009) Anaerobic degradation of naphthalene and 2-methylnaphthalene by strains of marine sulfate-reducing bacteria. Environ Microbiol 11: 209-219.

207

Notredame C, Higgins DG & Heringa J (2000) T-Coffee: A novel method for fast and accurate multiple sequence alignment. J Mol Biol 302: 205-217.

Peters F, Shinoda Y, McInerney MJ & Boll M (2007) Cyclohexa-1,5-diene-1-carbonyl- coenzyme-A hydratases of Geobacter metallireducens and Syntrophus aciditrophicus: Evidence for a common benzoyl-CoA degradation pathway in facultative and strict anaerobes. J Bacteriol 189: 1055-1060.

Pruesse E, Quast C, Knittel K, Fuchs BM, Ludwig WG, Peplies J & Glockner FO (2007) SILVA: A comprehensive online resource for quality checked and aligned ribosomal RNA sequence data compatible with ARB. Nucleic Acids Res 35: 7188-7196.

Rabus R (2005) Functional genomics of an anaerobic aromatic-degrading denitrifying bacterium, strain EbN1. Appl Microbiol Biotechnol 68: 580-587.

Rabus R, Nordhaus R, Ludwig W & Widdel F (1993) Complete oxidation of toluene under strictly anoxic conditions by a new sulfate-reducing bacterium. Appl Environ Microbiol 59: 1444-1451.

Rabus R, Kube M, Beck A, Widdel F & Reinhardt R (2002) Genes involved in the anaerobic degradation of ethylbenzene in a denitrifying bacterium, strain EbN1. Arch Microbiol 178: 506- 516.

Rabus R, Jarling R, Lahme S, Kuhner S, Heider J, Widdel F & Wilkes H (2011) Co-metabolic conversion of toluene in anaerobic n-alkane-degrading bacteria. Environ Microbiol 13: 2576- 2585.

Ramos-Padron E, Bordenave S, Lin SP, Bhaskar IM, Dong XL, Sensen CW, Fournier J, Voordouw G & Gieg LM (2011) Carbon and sulfur cycling by microbial communities in a gypsum-treated oil sands tailings pond. Environ Sci Technol 45: 439-446.

Reguera G, McCarthy KD, Mehta T, Nicoll JS, Tuominen MT & Lovley DR (2005) Extracellular electron transfer via microbial nanowires. Nature 435: 1098-1101.

Reinhard M, Shang S, Kitanidis PK, Orwin E, Hopkins GD & Lebron CA (1997) In situ BTEX biotransformation under enhanced nitrate- and sulfate-reducing conditions. Environ Sci Technol 31: 28-36.

Rotaru AE, Shrestha PM, Liu FH, Shrestha M, Shrestha D, Embree M, Zengler K, Wardman C, Nevin KP & Lovley DR (2014) A new model for electron flow during anaerobic digestion: Direct interspecies electron transfer to Methanosaeta for the reduction of carbon dioxide to methane. Energy Environ Sci 7: 408-415.

208

Safinowski M & Meckenstock RU (2004) Enzymatic reactions in anaerobic 2- methylnaphthalene degradation by the sulphate-reducing enrichment culture N47. FEMS Microbiol Lett 240: 99-104.

Sakai N, Kurisu F, Yagi O, Nakajima F & Yamamoto K (2009) Identification of putative benzene-degrading bacteria in methanogenic enrichment cultures. J Biosci Bioeng 108: 501-507.

Schink B (1997) Energetics of syntrophic cooperation in methanogenic degradation. Microbiol Mol Biol Rev 61: 262-280.

Schut GJ & Adams MWW (2009) The iron-hydrogenase of Thermotoga maritima utilizes ferredoxin and NADH synergistically: A new perspective on anaerobic hydrogen production. J Bacteriol 191: 4451-4457.

Shimoyama T, Kato S, Ishii S & Watanabe K (2009) Flagellum mediates symbiosis. Science 323: 1574-1574.

Shrestha PM, Rotaru AE, Summers ZM, Shrestha M, Liu FH & Lovley DR (2013) Transcriptomic and genetic analysis of direct interspecies electron transfer. Appl Environ Microbiol 79: 2397-2404.

Sieber JR, McInerney MJ & Gunsalus RP (2012) Genomic insights into syntrophy: The paradigm for anaerobic metabolic cooperation. Ann Rev Microbiol 66: 429-452.

Sieber JR, Sims DR, Han C, et al. (2010) The genome of Syntrophomonas wolfei: New insights into syntrophic metabolism and biohydrogen production. Environ Microbiol 12: 2289-2301.

Sikkema J, Debont JAM & Poolman B (1995) Mechanisms of membrane toxicity of hydrocarbons. Microbiol Rev 59: 201-222.

So CM, Phelps CD & Young LY (2003) Anaerobic transformation of alkanes to fatty acids by a sulfate-reducing bacterium, strain Hxd3. Appl Environ Microbiol 69: 3892-3900.

Soh J, Dong XL, Caffrey SM, Voordouw G & Sensen CW (2013) Phoenix 2: A locally installable large-scale 16S rRNA gene sequence analysis pipeline with web interface. J Biotechnol 167: 393-403.

Sommer DD, Delcher AL, Salzberg SL & Pop M (2007) Minimus: A fast, lightweight genome assembler. BMC Bioinformatics 8: 64.

Stadtman TC & Barker HA (1951) Studies on the methane fermentation 8. Tracer experiments on fatty acid oxidation by methane bacteria. J Bacteriol 61: 67-80.

Strous M, Kraft B, Bisdorf R & Tegetmeyer H (2012) The binning of metagenomic contigs for microbial physiology of mixed cultures. Front Microbiol 3: 410.

209

Struchtemeyer CG, Duncan KE & McInerney MJ (2011) Evidence for syntrophic butyrate metabolism under sulfate-reducing conditions in a hydrocarbon-contaminated aquifer. FEMS Microbiol Ecol 76: 289-300.

Summers ZM, Fogarty HE, Leang C, Franks AE, Malvankar NS & Lovley DR (2010) Direct exchange of electrons within aggregates of an evolved syntrophic coculture of anaerobic bacteria. Science 330: 1413-1415.

Sun W, Sun X & Cupples A (2014) Identificatrion of Desulfosporosinus as toluene assimilating microorganisms from a methanogenic consortium. Int Biodeter Biodegr 88: 13-19.

Symons G & Buswell A (1933) The methane fermentation of carbohydrates. J Am Chem Soc 55: 2028-2036.

Tan B, Dong X, Sensen CW & Foght J (2013) Metagenomic analysis of an anaerobic alkane- degrading microbial culture: Potential hydrocarbon-activating pathways and inferred roles of community members. Genome 56: 599-611.

Tatusov RL, Koonin EV & Lipman DJ (1997) A genomic perspective on protein families. Science 278: 631-637.

Taubert M, Vogt C, Wubet T, Kleinsteuber S, Tarkka MT, Harms H, Buscot F, Richnow HH, von Bergen M & Seifert J (2012) Protein-SIP enables time-resolved analysis of the carbon flux in a sulfate-reducing, benzene-degrading microbial consortium. ISME J 6: 2291-2301.

Taupp M, Lee S, Hawley A, Yang J & Hallam S (2009) Large insert environmental genomic library production. J Vis Exp 31: e1387.

Thauer RK (1998) Biochemistry of methanogenesis: A tribute to Marjory Stephenson. Microbiol UK 144: 2377-2406.

Thiele JH & Zeikus JG (1988) Control of interspecies electron flow during anaerobic digestion – significance of formate transfer versus hydrogen transfer during syntrophic methanogenesis in flocs. Appl Environ Microbiol 54: 20-29.

Townsend GT, Prince RC & Suflita JM (2003) Anaerobic oxidation of crude oil hydrocarbons by the resident microorganisms of a contaminated anoxic aquifer. Environ Sci Technol 37: 5213- 5218.

Ulrich AC & Edwards EA (2003) Physiological and molecular characterization of anaerobic benzene-degrading mixed cultures. Environ Microbiol 5: 92-102.

210

Ulrich AC, Beller HR & Edwards EA (2005) Metabolites detected during biodegradation of 13 C6-benzene in nitrate-reducing and methanogenic enrichment cultures. Environ Sci Technol 39: 6681-6691. van der Zaan BM, Saia FT, Stams AJM, Plugge CM, de Vos WM, Smidt H, Langenhoff AAM & Gerritse J (2012) Anaerobic benzene degradation under denitrifying conditions: Peptococcaceae as dominant benzene degraders and evidence for a syntrophic process. Environ Microbiol 14: 1171-1181.

Vogel T & Grbić-Galić D (1986) Incorporation of oxygen from water into toluene and benzene during anaerobic fermentative transformation. Appl Environ Microbiol 52: 200-202.

Walker CB, He ZL, Yang ZK, et al. (2009) The electron transfer system of syntrophically grown Desulfovibrio vulgaris. J Bacteriol 191: 5793-5801.

Walker CB, Redding-Johanson AM, Baidoo EE, et al. (2012) Functional responses of methanogenic archaea to syntrophic growth. ISME J 6: 2045-2055.

Wallrabenstein C, Hauschild E & Schink B (1994) Pure culture and cytological properties of Syntrophobacter wolinii. FEMS Microbiol Lett 123: 249-254.

Warikoo V, McInerney MJ, Robinson JA & Suflita JM (1996) Interspecies acetate transfer influences the extent of anaerobic benzoate degradation by syntrophic consortia. Appl Environ Microbiol 62: 26-32.

Washer CE & Edwards EA (2007) Identification and expression of benzylsuccinate synthase genes in a toluene-degrading methanogenic consortium. Appl Environ Microbiol 73: 1367-1369.

White D (2012) The physiology and biochemistry of prokaryotes. Oxford University Press, New York, USA.

Wilkes H, Rabus R, Fischer T, Armstroff A, Behrends A & Widdel F (2002) Anaerobic degradation of n-hexane in a denitrifying bacterium: Further degradation of the initial intermediate (1-methylpentyl)succinate via C-skeleton rearrangement. Arch Microbiol 177: 235- 243.

Winderl C, Schaefer S & Lueders T (2007) Detection of anaerobic toluene and hydrocarbon degraders in contaminated aquifers using benzylsuccinate synthase (bssA) genes as a functional marker. Environ Microbiol 9: 1035-1046.

Winderl C, Penning H, von Netzer F, Meckenstock RU & Lueders T (2010) DNA-SIP identifies sulfate-reducing Clostridia as important toluene degraders in tar-oil-contaminated aquifer sediment. ISME J 4: 1314-1325.

211

Wischgoll S, Heintz D, Peters F, Erxleben A, Sarnighausen E, Reski R, van Dorsselaer A & Boll M (2005) Gene clusters involved in anaerobic benzoate degradation of Geobacter metallireducens. Mol Microbiol 58: 1238-1252.

Wohlbrand L, Jacob JH, Kube M, Mussmann M, Jarling R, Beck A, Amann R, Wilkes H, Reinhardt R & Rabus R (2013) Complete genome, catabolic sub-proteomes and key-metabolites of Desulfobacula toluolica Tol2, a marine, aromatic compound-degrading, sulfate-reducing bacterium. Environ Microbiol 15: 1334-1355.

Wright JJ, Lee, S., Zaikova, E., Walsh, D. A., Hallam, S. J (2009) DNA extraction from 0.22 μM sterivex filters and cesium chloride density gradient centrifugation. J Vis Exp 31: e1352.

Wu WM, Hickey RF, Jain MK & Zeikus JG (1993) Energetics and regulations of formate and hydrogen metabolism by Methanobacterium formicicum. Arch Microbiol 159: 57-65.

Yamada T & Sekiguchi Y (2009) Cultivation of uncultured Chloroflexi subphyla: Significance and ecophysiology of formerly uncultured Chloroflexi 'subphylum I' with natural and biotechnological relevance. Microbes Environ 24: 205-216.

Zedelius J, Rabus R, Grundmann O, et al. (2011) Alkane degradation under anoxic conditions by a nitrate-reducing bacterium with possible involvement of the electron acceptor in substrate activation. Environ Microbiol Rep 3: 125-135.

Zengler K, Richnow HH, Rossello-Mora R, Michaelis W & Widdel F (1999) Methane formation from long-chain alkanes by anaerobic microorganisms. Nature 401: 266-269.

Zhang T, Tremblay PL, Chaurasia AK, Smith JA, Bain TS & Lovley DR (2013) Anaerobic benzene oxidation via phenol in Geobacter metallireducens. Appl Environ Microbiol 79: 7800- 7806.

Zhang XM & Young LY (1997) Carboxylation as an initial reaction in the anaerobic metabolism of naphthalene and phenanthrene by sulfidogenic consortia. Appl Environ Microbiol 63: 4759- 4764.

212

Appendix A: SUPPLEMENTARY MATERIAL FROM CHAPTER THREE: METHANOGENIC TOLUENE

METABOLISM: COMMUNITY STRUCTURE AND INTERMEDIATES

Table A-1. Taxonomic distribution of bacterial and archaeal sequences. Values are shown as the number of sequence reads out of 6241 sequences that were assigned by at least 90% similarity to a 16S rRNA gene sequence in the BLAST database. Domain Phylum Class Order Genus/Organism Number of reads Archaea Euryarchaeota Methanomicrobia Methanosarcinales Methanosaeta 265 Archaea Euryarchaeota Methanomicrobia Methanomicrobiales Methanolinea 173 Archaea Euryarchaeota Methanomicrobia Methanomicrobiales Methanoculleus 85 Archaea Euryarchaeota Thermoplasmata WCHA1-57 16 Archaea Euryarchaeota Methanomicrobia Methanomicrobiales Methanoregula 3 Archaea Euryarchaeota Methanobacteria Methanobacteriales Methanobacterium 1 Bacteria Firmicutes Clostridia Clostridiales Clostridium 1749 Bacteria Firmicutes Clostridia Clostridiales Incertae Sedis 1344 Bacteria Firmicutes Clostridia Clostridiales Sedimentibacter 864 Bacteria Chloroflexi Anaerolineae Anaerolineales 728 Bacteria Firmicutes Clostridia Clostridiales Desulfosporosinus 174 Bacteria Spirochaetes Spirochaetes Spirochaetales 150 Bacteria Proteobacteria Deltaproteobacteria Desulfovibrionales Desulfovibrio 143 Bacteria Spirochaetes Spirochaetes Spirochaetales Spirochaeta 138 Bacteria Synergistetes Synergistia Synergistales 41 Bacteria Firmicutes Clostridia Clostridiales 34 Bacteria Proteobacteria Gammaproteobacteria Pseudomonadales Pseudomonas 32 Bacteria Bacteroidetes Sphingobacteria Sphingobacteriales vadinHA17 30 Bacteria Firmicutes Clostridia Clostridiales Thermosinus 26 Bacteria Actinobacteria Actinobacteria Actinomycetales Rhodococcus 23 Bacteria Chloroflexi Anaerolineae Anaerolineales Leptolinea 20 Bacteria Firmicutes Clostridia Clostridiales Acetobacterium 17 Bacteria Bacteroidetes Bacteroidia Bacteroidales Proteiniphilum 15

213

Bacteria Proteobacteria Deltaproteobacteria Desulfuromonadales Pelobacter 15 Bacteria Spirochaetes Spirochaetes PBS-18 10 Bacteria Spirochaetes Spirochaetes 9 Bacteria Chloroflexi GIF9 8 Bacteria Thermotogae Thermotogae Thermotogales Kosmotoga 8 Bacteria Proteobacteria Betaproteobacteria Burkholderiales Burkholderia 8 Bacteria Firmicutes Clostridia Clostridiales 6 Bacteria Bacteroidetes Bacteroidia Bacteroidales vadinBC27 6 Bacteria Actinobacteria Actinobacteria Actinomycetales Microbacterium 6 Bacteria Synergistetes Synergistia Synergistales Thermovirga 5 Bacteria Candidate division OP8 5 Bacteria Bacteroidetes Sphingobacteria Sphingobacteriales SB-1 5 Bacteria Proteobacteria Deltaproteobacteria Syntrophobacterales Syntrophus 5 Bacteria Proteobacteria Deltaproteobacteria Desulfuromonadales Geobacter 5 Bacteria Proteobacteria Deltaproteobacteria GR-WP33-30 4 Bacteria Firmicutes Clostridia Clostridiales 4 Bacteria Verrucomicrobia OPB35 soil group 4 Bacteria Proteobacteria Deltaproteobacteria Syntrophobacterales Smithella 4 Bacteria Proteobacteria Deltaproteobacteria Syntrophobacterales Syntrophorhabdus 4 Bacteria Chloroflexi Caldilineae Caldilineales 4 Bacteria Proteobacteria Deltaproteobacteria Syntrophobacterales 4 Bacteria Actinobacteria Actinobacteria Actinomycetales 3 Bacteria Actinobacteria Actinobacteria Coriobacteriales 3 Bacteria Proteobacteria Deltaproteobacteria Desulfuromonadales Desulfuromonas 2 Bacteria Actinobacteria Actinobacteria OPB41 2 Bacteria Proteobacteria Alphaproteobacteria Rhizobiales Nordella 2 Bacteria Candidate division OP11 2 Bacteria Bacteroidetes Bacteroidia Bacteroidales Porphyromonas 2 Bacteria Firmicutes Bacilli Lactobacillales Leuconostoc 2

214

Bacteria Proteobacteria Deltaproteobacteria Bdellovibrionales 2 Bacteria Chloroflexi Anaerolineae Anaerolineales Anaerolinea 2 Bacteria Chloroflexi Anaerolineae Anaerolineales Levilinea 2 Bacteria Proteobacteria Betaproteobacteria Burkholderiales Rhodoferax 1 Bacteria Proteobacteria Gammaproteobacteria Enterobacteriales 1 Bacteria Actinobacteria Actinobacteria Actinomycetales Cellulosimicrobium 1 Bacteria Firmicutes Clostridia Clostridiales TSAC18 1 Bacteria Proteobacteria Betaproteobacteria Burkholderiales Acidovorax 1 Bacteria Candidate division BRC1 1 Bacteria Proteobacteria Betaproteobacteria Burkholderiales Achromobacter 1 Bacteria Proteobacteria Gammaproteobacteria Alteromonadales Colwellia 1 Bacteria Bacteroidetes Sphingobacteria Sphingobacteriales BSV13 1 Bacteria Proteobacteria Deltaproteobacteria Desulfuromonadales JN18-A94-J 1 Bacteria Actinobacteria Actinobacteria Coriobacteriales Collinsella 1 Bacteria Proteobacteria Alphaproteobacteria Rhodobacterales Amaricoccus 1 Bacteria Proteobacteria Gammaproteobacteria WN-HWB-116 1 Bacteria Actinobacteria Actinobacteria Actinomycetales Terracoccus 1 Bacteria Proteobacteria Gammaproteobacteria Thiotrichales 1 Bacteria Proteobacteria Deltaproteobacteria Syntrophobacterales 1 Bacteria Firmicutes Clostridia Clostridiales Lachnospira 1

215

(a (b (c ) ) )

(d (e (f ) ) )

216

Figure A-1. Mass spectral profiles of some metabolites (as TMS derivatives) found to 12 13 transiently accumulate during C-toluene (upper panel) and C7-toluene degradation (lower panel) under methanogenic conditions; (a) benzylsuccinate-diTMS, (b) hydroxybenzylsuccinate-diTMS, (c) benzoate-TMS, (d) m-cresol-TMS, (e) methylhydroquinone-diTMS, (f) hydroquinone-diTMS. 13C-Labeled carbon atoms on the structures (lower panel) are indicated by black dot.

217

Appendix B: SUPPLEMENTARY MATERIAL FROM CHAPTER FOUR:

IDENTIFICATION OF TOLUENE DEGRADERS IN A METHANOGENIC

ENRICHMENT CULTURE

Table B-1. Bacterial diversity present in a methanogenic toluene degrading culture determined by DGGE and similarity to cultured microbes Sequence Closest cultured % identity Closest relative % identity relative A1 AB762695 Geobacter sp. 92 KC961279 Uncultured 94 OSK2A bacterium clone SM18NY GQ463728 Geobacter sp. KC605075 Uncultured T32 bacterium clone CarbonSeq021 022210 CP000148 KC574703 Uncultured Geobacter bacterium clone Mb1 D01 metallireducens GS-15 NR_044262 Geobacter AB755788 Uncultured uraniireducens Rf4 Geobacter sp. isolate 4-CP-Fe- OTU10 EU660516 Geobacter sp. JQ654787 Uncultured FRC-32 bacterium clone anode Geo4 JQ799138 Geobacter sp. Ben JQ655460 Geobacter sp. sa2 GQ463728 Geobacter sp. T32 GQ463727 Geobacter sp. T33 CP0001390 Geobacter daltonii FRC-32 A2 NR_026076 Geobacter 91 HM066225 Uncultured 92 bremensis strain Dfr1 bacterium clone EDW07B001_47 NR_043576 Geobacter GU303179 Uncultured rumen pickeringii strain G13 bacterium clone L206RT-3-B02 JN759193-JN759201 Geobacter bremensis strains ONC101- ONC109 A3 HG005283 Geobacter sp. 90 JX223738 Uncultured 91 Cd1 bacterium clone EMIRGE OTU s6b4a 652 NR_043575 Geobacter AB657389 Uncultured 218

argillaceus strain G12 bacterium RNA clone B0610R003_C15 NR_026077 Geobacter EF669050 Uncultured pelophilus strain Dfr2 Geobacteraceae bacterium clone M16_7238 NR_026076 KC145396 Uncultured Geobacter bremensis bacterium clone EG15ED4 strain Dfr1 JN759193-JN759194 JQ367541 Uncultured Geobacter bremensis bacterium clone NC1F1f10 strains ONC101- ONC102 JN759196-JN759199 Geobacter bremensis ONC104-107 A4 NR_026076 Geobacter 91 AB660562 Uncultured 91 bremensis strain Dfr1 bacterium clone B0610D003_J14 JN759193- JN759194 HQ875551 Uncultured Geobacter bremensis Geobacter sp. clone HZ-30d-94 ONC101-102 JN759196-JN759199 HQ875504 Uncultured Geobacter bremensis Geobacter sp. clone HZ-1h-138 ONC104-107 JQ625077 Uncultured bacterium clone FLH24 26 KC574698 Uncultured bacterium clone MEC GeoM2 A5 NR_026076 Geobacter 94 AB660562 Uncultured 95 bremensis strain Dfr1 bacterium clone B0610D003_J14 JN759193- JN759194 GQ422147 Uncultured Geobacter bremensis bacterium isolate DGGE gel ONC101-102 band III_Sa-P-CC1-c JN759196-JN759199 HQ875551 Uncultured Geobacter bremensis Geobacter sp. clone HZ-30d-94 ONC104-107 HQ875504 Uncultured Geobacter sp. clone HZ-1h-138 JN091612 Uncultured Geobacter sp. clone ZJ-20d-11 B1 EU737112 92 EU522658 Uncultured 96 Desulfosporosinus sp. Desulfosporosinus sp. clone DB BTEX1-4F B2 EU737112 92 EU522658 Uncultured 97 Desulfosporosinus sp. Desulfosporosinus sp. clone DB BTEX1-4F 219

B3 EU737112 93 EU522658 Uncultured 99 Desulfosporosinus sp. Desulfosporosinus sp. clone DB BTEX1-4F AY780358 Desulfosporosinus sp. JG32A JQ411266 Desulfosporosinus sp. P26 C EU737112 96 EU522658 Uncultured 99 Desulfosporosinus sp. Desulfosporosinus sp. clone DB BTEX1-4F D1 CP000252 Syntrophus 88 JQ560417 Uncultured 89 aciditrophicus SB deltaproteobaceterium clone RII-AN038 KF440301 Uncultured bacterium clone AMSGC_63_B35 JX272065 Uncultured Syntrophus sp. clone POTRO AIKE BactD7/Clone 39 KC604907 Uncultured bacterium clone CarbonSeq09b_030410_5621 FR820263 Uncultured deltaproteobacterium clone 534d08 D2 CP000252 Syntrophus 92 EU542439 Uncultured 95 aciditrophicus SB bacterium clone Er-MS-29 NR_029295 Syntrophus gentianae strain HQgoe1 D3 CP000252 Syntrophus 95 KC821334 Methanogenic 100 aciditrophicus SB prokaryote enrichment culture B19_127 NR_029295 Syntrophus JQ256499 Syntrophaceae gentianae strain HQgoe1 bacterium enrichment culture clone MC18B6-8 NR_024989 Smithella DQ200784 Uncultured propionica strain LYP bacterium clone E79-1238 NR_029294 Syntrophus buswellii strain DM-2 D4 CP000252 Syntrophus 90 JQ121500 Uncultured 92 aciditrophicus SB bacterium clone J2_5_236 KC604907 Uncultured bacterium clone CarbonSeq09b_030410_5621 FJ264763 Uncultured bacterium 220

clone livecontrol B7 FJ264761 Uncultured bacterium clone livecontrol B5 EU542439 Uncultured bacterium clone Er-MS-29 D5 NR_024989 Smithella 93 KC821334 Methanogenic 96 propionica strain LYP prokaryote enrichment culture B19_127 Y19190 Geobacter sp. KC424655 Uncultured strain CdA-2 bacterium clone DS-04 JQ256499 Syntrophaceae bacterium enrichment culture clone MC18B6-8 JQ668517 Uncultured bacterium clone OUT-X1-1 DQ200784 Uncultured bacterium clone E79-1238 E1 NR_026076 Geobacter 90 AY607119 Uncultured 91 bremensis strain Dfr1 Geobacter sp. clone X3Ba20 NR_043575 Geobacter AB656650 Uncultured argillaceus strain G12 bacterium B0423R002_A05 JN759193-JN759194 AB658893 Uncultured Geobacter bremensis bacterium B0618R002_O18 strains ONC101- ONC102 JN759196-JN759199 HQ875532 Uncultured Geobacter bremensis Geobacter sp. clone HZ-10d- ONC104-107 100 EF693512 Uncultured bacterium clone FW104-132 E2 NR_026076 Geobacter 84 KC605222 Uncultured 85 bremensis strain Dfr1 bacterium clone bacflank 0060 NR_043575 Geobacter KC605217 Uncultured argillaceus strain G12 bacterium clone bacBiof 0743 HG005283 Geobacter sp. KC605201 Uncultured Cd1 bacterium clone Csbiofilm 8 040210 F02 JN759193-JN759201 KC605200 Uncultured Geobacter bremensis bacterium clone Csbiofilm 8 strains ONC101- 040210 A01 ONC109

KC435513 Uncultured bacterium clone SEAD1BG101 E3 HM750216 91 KF550878 Uncultured 98 Desulfobulbus bacterium clone DAB-3 alkaliphilus APS1 221

HQ171448 DQ088260 Uncultured Desulfobulbus bacterium clone cs41 alkaliphilus strain ASS1 KC991099 Uncultured bacterium JX844016 Uncultured actinobacterium clone 6B CU924922 Uncultured Deltaproteobacterium clone 7A- Hi E4 CP001124 Geobacter 91 JX844016 Uncultured 92 bemidjiensis Bem str. actinobacterium clone 6B Bem DQ088261 Uncultured bacterium clone cs43 JQ161871 Uncultured bacterium clone N2_3_2418 JQ121291 Uncultured bacterium clone N1_2_2863 JQ012306 Uncultured proteobacterium clone wn82 E5 NR_024949 Desulfotalea 84 JX844016 Uncultured 89 arctica strain LSv514 actinobacterium clone 6B HE600886 JQ121291 Uncultured Desulfobulbaceae bacterium clone N1_2_2863 bacterium PR2_D11 JQ012306 Uncultured proteobacterium clone wn82 DQ088261 Uncultured bacterium clone cs43 F1 NR_043576 Geobacter 90 GU083491 Uncultured 91 pickeringii strain G13 bacterium clone A1-C18 M13R NR_041826 Geobacter GU083489 Uncultured grbiciae strain TACP-5 bacterium clone A1-B12 M13R NR_104561 Geobacter grbicium strain TACP-2 NR_075011 Geobacter metallireducens GS-15 F2 EF059536 92 DQ829097 Uncultured 93 Geobacteraceae proteobacterium clone DOK bacterium JN18_V95_J NOFERT clone 095 DQ168651 Desulfuromonadales bacterium JN18_A94_J G1 CP01197 Desulfovibrio 88 KC860700 Uncultured 89 vulgaris str. 'Miyazaki F' bacterium clone SP4 O16 AY57691 Desulfovibrio KF193246 Bacterium 222

sp. Bsl2 endosymbiont of Onthophagus Taurus clone 3L3 IN1 012 AY770382 Desulfovibrio GQ137697 Uncultured sp. A2 bacterium clone 03c01 NR_043069 GQ137493 Uncultured Desulfovibrio bacterium clone 04h12 alkalitolerans strain RT2

NR_043567 GQ137484 Uncultured Desulfovibrio oxamicus bacterium clone 04d03 strain DSM 1925 AY059411 Desulfovibrio sp. R2 Y12255 Desulfovibrio termitidis KSS1 X93147 Desulfovibrio sp. str. KH2 NR_026255 Desulfovibrio termitidis HI1 NR_029364 Desulfovibrio longreachensis strain 16910a G2 NR_043069 93 JN680666 Uncultured 94 Desulfovibrio Desulfovibrionaceae clone alkalitolerans strain RT2 SL11 CP01197 Desulfovibrio JN651981 Uncultured vulgaris str. 'Miyazaki F' deltaproteobacterium clone BSL34B-2 AY57691 Desulfovibrio GQ181464 Uncultured sp. Bsl2 bacterium clone BP U1B 2d10 AY770382 Desulfovibrio JF309193 Uncultured bacterium sp. A2 clone MFC4P 353 NR_043567 FJ798838 Uncultured bacterium Desulfovibrio oxamicus clone IC9 strain DSM 1925 AY059411 Desulfovibrio sp. R2 Y12255 Desulfovibrio termitidis KSS1 X93147 Desulfovibrio sp. str. KH2 NR_026255 Desulfovibrio termitidis HI1 NR_029364 223

Desulfovibrio longreachensis strain 16910a H1 CP01197 Desulfovibrio 89 JN651981 Uncultured 90 vulgaris str. 'Miyazaki F' deltaproteobacterium clone BSL34B-2 AY57691 Desulfovibrio GQ181464 Uncultured sp. Bsl2 bacterium clone BP U1B 2d10 AY770382 Desulfovibrio JF309193 Uncultured bacterium sp. A2 clone MFC4P 353 NR_043567 FJ798838 Uncultured bacterium Desulfovibrio oxamicus clone IC9 strain DSM 1925 AY059411 Desulfovibrio EF188739 Uncultured sp. R2 deltaproteobacterium clone 1910 Y12255 Desulfovibrio termitidis KSS1 X93147 Desulfovibrio sp. str. KH2 NR_026255 Desulfovibrio termitidis HI1 NR_029364 Desulfovibrio longreachensis strain 16910a NR_043069 Desulfovibrio alkalitolerans strain RT2 H2 HQ693573 Desulfovibrio 86 JQ368872 Uncultured 86 sp. X2 bacterium clone MD10c7 9721 HQ693573 Desulfovibrio sp. X2 JN620014 Uncultured bacterium clone 08102902- Y3GUT 16S 5 14 JN619489 Uncultured bacterium clone 08102902- Y3GU- 16S-1 37 JN619913 Uncultured bacterium clone 08102902- Y3GUT 16S 5 05 J1 JF262039 Youngiibacter 95 KC821442 Methanogenic 95 fragile 232.1 (formerly prokaryote enrichment culture Acetivibrio multivorans) B31_3_86 NR_104785 KC821441 Methanogenic 224

Youngiibacter prokaryote enrichment culture multivorans B31_2_47 DQ677011 Clostridium KC821440 Methanogenic sp. Iso-A7 prokaryote enrichment culture B31_3_96 KC821439 Methanogenic prokaryote enrichment culture B31_2_41 KC821438 Methanogenic prokaryote enrichment culture B31_3_114 J2 JF262039 Youngiibacter 96 KC821442 Methanogenic 96 fragile 232.1 prokaryote enrichment culture B31_3_86 NR_104785 KC821441 Methanogenic Youngiibacter prokaryote enrichment culture multivorans B31_2_47 KC821440 Methanogenic prokaryote enrichment culture B31_3_96 KC821439 Methanogenic prokaryote enrichment culture B31_2_41 KC821438 Methanogenic prokaryote enrichment culture B31_3_114 J3 JF262039 Youngiibacter 99 KC821442 Methanogenic 99 fragile 232.1 prokaryote enrichment culture B31_3_86 NR_104785 KC821441 Methanogenic Youngiibacter prokaryote enrichment culture multivorans B31_2_47 KC821440 Methanogenic prokaryote enrichment culture B31_3_96 KC821439 Methanogenic prokaryote enrichment culture B31_2_41 KC821438 Methanogenic prokaryote enrichment culture B31_3_114 J4 JF803562 90 JF946964 Bacterium 98 Peptostreptococcus enrichment clone L35B 139 stomatis strain C1311 HQ610195 JF964961 Bacterium Peptostreptococcus sp. enrichment clone L35B 141 CM88 225

GU401462 JF964959 Bacterium Peptostreptococcus enrichment clone L35B 58 stomatis clone WWP_SS5_C17 GU401283 JF964963 Bacterium Peptostreptococcus enrichment clone L35B 93 stomatis clone S016 GQ422715 JF964962 Bacterium Peptostreptococcus enrichment clone L35B 92 stomatis strain A21H2 AY167967 Swine manure bacterium 37-5 NR_043589 Peptostreptococcus stomatis strain W2278 K1 NR_043069 93 JN680666 Uncultured 94 Desulfovibrio Desulfovibrionaceae clone alkalitolerans strain RT2 SL11 HQ693573 Desulfovibrio JN651981 Uncultured sp. X2 deltaproteobacterium clone BSL34B-2 CP01197 Desulfovibrio GQ181464 Uncultured vulgaris str. 'Miyazaki F' bacterium clone BP U1B 2d10 AY57691 Desulfovibrio JF309193 Uncultured bacterium sp. Bsl2 clone MFC4P 353 AY770382 Desulfovibrio EF188739 Uncultured sp. A2 deltaproteobacterium clone 1910 NR_043567 Desulfovibrio oxamicus strain DSM 1925 AY059411 Desulfovibrio sp. R2 Y12255 Desulfovibrio termitidis KSS1 X93147 Desulfovibrio sp. str. KH2 NR_026255 Desulfovibrio termitidis HI1 K2 NR_043069 93 GU339470 Delta 94 Desulfovibrio proteobacterium enrichment alkalitolerans strain RT2 culture clone VNC1B049 L1 NR_102964 93 JX224549 Uncultured 94 Sphaerochaeta bacterium clone EMIRGE OTU pleomorpha str. Grapes S7t4e 459 CP002541 226

Sphaerochaeta globosa str. Buddy NR_074647 Sphaerochaeta coccoides DSM 17374 L2 NR_102964 82 JX224549 Uncultured 88 Sphaerochaeta bacterium clone EMIRGE OTU pleomorpha str. Grapes S7t4e 459 CP002541 Sphaerochaeta globosa str. Buddy AB598280 Spirochaeta sp. MO-SPC2 M1 NR_043069 93 JN680666 Uncultured 94 Desulfovibrio Desulfovibrionaceae clone alkalitolerans strain RT2 SL11 CP01197 Desulfovibrio JN651981 Uncultured vulgaris str. 'Miyazaki F' deltaproteobacterium clone BSL34B-2 AY57691 Desulfovibrio GQ181464 Uncultured sp. Bsl2 bacterium clone BP U1B 2d10 AY770382 Desulfovibrio JF309193 Uncultured bacterium sp. A2 clone MFC4P 353 NR_043567 FJ98838 Uncultured bacterium Desulfovibrio oxamicus clone IC9 strain DSM 1925 AY059411 Desulfovibrio sp. R2 Y12255 Desulfovibrio termitidis KSS1 X93147 Desulfovibrio sp. str. KH2 NR_026255 Desulfovibrio termitidis HI1 NR_029364 Desulfovibrio longreachensis strain 16910a M2 NR_043069 93 JN680666 Uncultured 94 Desulfovibrio Desulfovibrionaceae clone alkalitolerans strain RT2 SL11 CP01197 Desulfovibrio JN651981 Uncultured vulgaris str. 'Miyazaki F' deltaproteobacterium clone BSL34B-2 AY57691 Desulfovibrio GQ181464 Uncultured sp. Bsl2 bacterium clone BP U1B 2d10 227

AY770382 Desulfovibrio JF309193 Uncultured bacterium sp. A2 clone MFC4P 353 NR_043567 FJ98838 Uncultured bacterium Desulfovibrio oxamicus clone IC9 strain DSM 1925 AY059411 Desulfovibrio sp. R2 Y12255 Desulfovibrio termitidis KSS1 X93147 Desulfovibrio sp. str. KH2 NR_026255 Desulfovibrio termitidis HI1 NR_029364 Desulfovibrio longreachensis strain 16910a

228

Appendix C: SUPPLEMENTARY MATERIAL FROM CHAPTER FIVE:

COMPARATIVE METAGENOMIC ANALYSIS OF THREE METHANOGENIC

HYDROCARBON DEGRADING ENRICHMENT CULTURES

Table C-1. Lists of metagenomes from MG-RAST used in comparative metagenomic analysis representing a variety of different environments MG-RAST ID Name Environment 4478350.3 ANAS dechlorinating Dechlorinating culture bioreactor 4450840.3 KB-1 dechlorinating culture Dechlorinating culture 4451259.3 DONNAII dechlorinating Dechlorinating culture culture 4465489.3 GoM Gulf of Mexico hydrocarbon- impacted marine sediment 4465491.3 GoM Gulf of Mexico hydrocarbon- impacted marine sediment 4465490.3 GoM Gulf of Mexico hydrocarbon- impacted marine sediment 4445996.3 NTS creosote.amb.1 Hot spring microbial mat 4445990.3 NTS creosote.ele.1 Hot spring microbial mat 4445993.3 NTS crust.amb.1 Hot spring microbial mat 4445994.3 NTS creosote.ele.2 Hot spring microbial mat 4441022.3 Australian Coorong high Lagoon sediment salinity 136psu M4 4441022.3 Australian Coorong high Lagoon sediment salinity 136psu M4 4440984.3 Australian lowest salinity Lagoon sediment Murray mouth 36psu M1 4441022.3 Australian Coorong medium Lagoon sediment high salinity 132psu M3 4441022.3 Australian Coorong medium Lagoon sediment salinity 105psu M2 4446342.3 Port Flinders Lagoon sediment 4446341.3 Port Turton Lagoon sediment 4443697.3 Marine Bacterioplankton Marine 4443700.3 Marine Bacterioplankton Marine 4443701.3 Marine Bacterioplankton Marine 4443695.3 Marine Bacterioplankton Marine 4443698.3 Marine Bacterioplankton Marine 4443699.3 Marine Bacterioplankton Marine 4443766.3 Marine Bacterioplankton Marine 229

4441025.3 Mediterranean Bathypelagic Marine Habitat 4442464.3 Mediterranean Bathypelagic Marine Habitat 4443712.3 Monterey Bay Marine 4443714.3 Monterey Bay Marine 4443716.3 Monterey Bay Marine 4443713.3 Monterey Bay Marine 4443715.3 Monterey Bay Marine 4443717.3 Monterey Bay Marine 4492620.3 Methanogenic Aliphatic Methanogenic hydrocarbon alkane-degrading microcosm degrading enrichment (SCADC) enriched from oil sands tailing pond 4470908.3 Methanogenic microcosm Methanogenic hydrocarbon enriched from oil sands degrading enrichment tailings pond with naphtha diluent (NAPDC) 4470904.3 Methanogenic toluene- Methanogenic hydrocarbon degrading microcosm enriched degrading enrichment from gasoline-contaminated site in the US (TOLDC) 4441092.3 Australian Phosphorus Sludge Removing (EBPR) Sludge 4441093.3 US Phosphorus Removing Sludge (EBPR) Sludge 4451103.3 NTS_007_lucy_ELEV Soil 4451104.3 NTS_010_ELEV Soil 4451105.3 NTS_067_AMBIENT Soil 4451106.3 NTS_071_AMBIENT Soil 4450750.3 NTS004-ele-crust Soil 4450752.3 NTS064-amb-crust Soil 4470907.3 Suncore Pond 6 Oil sands tailings ponds 4492624.3 Syncrude Mildred Lake Oil sands tailings ponds Settling Basin

230

Table C-2. Summary of recruitment of quality filtered 454 raw datasets to selected reference genomes. Reference genome NAPDC SCADC TOLDC % % % % % % genome identical genome identical genome identical mapped site mapped site mapped site Methanosaeta concilli GP6 64.1 98.6 96.5 96.2 89.1 96.5 (NC_015416) Methanoculleus marisnigri JR1 2.2 95.4 0.9 96.1 1.3 98.6 (NC_009051) Methanolinea tarda NOBI-1 0.0 0.0 0.0 0.0 0.0 0.0 (AGIY00000000) Methanoregula booonei 6A8 0.0 0.0 0.0 0.0 0.0 0.0 (NC_009712) Desulfosporosinus acidiphilus 0.0 0.0 0.0 0.0 0.0 0.0 SJ4 (CP003639) Desulfosporosinus meridei S10 0.0 0.0 0.0 0.0 0.0 0.0 (NR_024933) Desulfobacula toluolica TOL2 0.0 0.0 0.0 0.0 0.0 0.0 (NC_018645) Syntrophus aciditrophicus SB 2.4 98.5 65.8 97.5 0.5 97.6 (CP000252) Geobacter metallireducens GS- 0.0 0.0 0.0 0.0 0.0 0.0 15 (NC_007517) Desulfatibacillum alkenivorans 0.0 0.0 0.0 0.0 0.0 0.0 AK-01 (NC_011768) Syntrophomonas wolfeii 0.0 0.0 0.0 0.0 0.0 0.0 (NC_008346) Desulfobacterium 0.0 0.0 0.0 0.0 0.0 0.0 autotrophicum HRM2 (NC_012108) Pelotomaculum 0.0 0.0 0.0 0.0 0.0 0.0 thermopropionicum (NC_009454.1)

231

Figure C-1. Methane production by NAPDC culture incubated with naphtha over 100 days of incubation (a) and substrate usage of naphtha components by NAPDC after 120 days as determined by GC-MS (b)

232

Figure C-2. Rarefaction curves from 454 pyrosequenced metagenomes of NAPDC, SCADC and TOLDC based on taxonomic classification in MG-RAST with M5NR

233

Figure C-3. Three-way comparison of functional categories (SEED subsystems level 3) from NAPDC, SCADC, and TOLDC.

234

Appendix D: SUPPLEMENTARY MATERIAL FROM CHAPTER SIX:

METAGENOMIC ANALYSIS OF A TOLUENE DEGRADING METHANOGENIC

ENRICHMENT CULTURE

100 90

80 70 60 50 40 40 34 30 26 27 21

Hydrocarbon loss (%) loss Hydrocarbon 19 20 9 9 10 10 0

Figure D-1. Percent hydrocarbon loss from incubations of the toluene degrading methanogenic culture with alternate hydrocarbon substrates. Measurements of hydrocarbon loss were made at day 261 of incubation. Data collected by Courtney Toth.

235

120.00

100.00

80.00

60.00

40.00 Methane (umol) Methane

20.00

0.00 0 50 100 150 200 250 300 Days

Figure D-2. Production of methane from toluene degrading methanogenic culture incubated with alternate hydrocarbon substrates over 342 days. Hydrocarbon substrates from which methane production was observed include benzene (black line, ■), ethylben ene (black line, ♦), o-xylene (black line, ▲), m-xylene (black line, ), hexane and decane (black line, ●), 2-methylnaphthalene (gray line, ■), hexadecane and octadecane (gray line, ♦). Unamended control is shown as a dotted line.

236

Table D-1. Genes found in assA2 operon from the toluene degrading methanogenic culture located on contig 7287. Gene id Putative Size Best BLASTp hit Accession No. Identity annotation (bp) (%) 100072871 Transposase 642 Hypothetical protein YP_004246404 54 Sphaerochaeta globosa 100072872 Integrase 375 Hypothetical protein YP_004246404 60 Sphaerochaeta globosa 100072873 Transcriptional 726 lclR transcriptional WP_006447585 30 regulator regulator Alicyclobacillus hesperidum 100072875 assA2 2483 Alkylsuccinate synthase ADJ1097 37 Desulfoglaeba alkanexedens 100072876 assD2 927 Radical SAM protein WP_010238294 41 Clostridium arbusti 100072877 TRAP 1104 TRAP dicarboxylate YP_007943924 29 dicarboxylate transport system, transport system, periplasmic periplasmic Desulfotomaculum gibsoniae 100072878 TRAP 327 C4-dicarboxylate ABC WP_019670658 31 dicarboxylate transporter permease transport system, Eudoraea adriatica small permease 100072879 TRAP transport 162 ABC transporter WP_006912203 40 system small substrate-binding permease protein Salinisphaera shabanensis 1000728710 TRAP 1104 TRAP transporter DctM YP_007943926 51 dicarboxylate subunit transport system Desulfotomaculum large permease gibsoniae

237

Table D-2. Comparison of putative bbs operons on contig 456 with putative bbs operons from contig 1060 and Desulfobacula toluolica TOL2. Gene id Putative Size (bp) Similarity to contig Similarity to D. annotation 1060 toluolica Draft_1000045612 bbsE 755 68.4 65.0 Draft_1000045611 bbsF 752 72.7 71.1 Draft_1000045610 bbsG 1238 NA 71.0 Draft_100004569 bbsH 1244 NA 74.2

Table D-3. Putative genes associated with reductive dearomatization of benzoyl-CoA identified in the genome of a toluene degrading methanogenic culture and their similarity to previously characterized proteins. Gene ID Putative Length Best BLASTp hit Accession No. % annotation (bp) Contig 4854 Draft_10000485410 bcrA 812 2-hydroxyglutaryl CoA YP_002466214 42 dehydratase Methanosphaerula palustris Draft_10000485411 bcrD 830 Putative benzoyl-CoA WP_006425530 56 reductase D NaphS2 Draft_10000485412 bcrB 1307 2-hydroxyglutaryl coA WP_006425525 42 dehydratase NaphS2 Draft_10000485413 bcrC 1142 2-hydroxyglutaryl coA WP_006425542 41 dehydratase NaphS2 Contig229 Draft_1000022910 bamB 1964 Putative bamB ADJ94019 77 Clostridia clone BF Draft_100002299 bamC 539 bamC YP_006446885 81 tiedjei Draft_100002298 bamD 1151 Putative bamC ADJ93884 76 Clostridia clone BF Draft_100002295 bamE 1520 Polyferrodoxin hdrA YP_007946829 83 Desulfotomaculum gibsoniae Draft_100002294 bamE 1295 Polyferrodoxin hdrA YP_007946829 75 Desulfotomaculum gibsoniae Draft_100002293 bamF 725 Coenzyme F420- YP_007945096 71 reducing dehydrogenase, delta subunit 238

Desulfotomaculum gibsoniae Draft_100002292 bamU 827 Amidohydrolase 2 WP_020878755 58 Desulfococcus multivorans Contig 322 Draft_1000032236 bamB 1967 Putative bamB ADJ94019 78 Clostridia clone BF Draft_1000032235 bamC 530 Hypothetical protein YP_007945092 78 Desulfotomaculum gibsoniae Draft_1000032234 bamD 1151 Fe-S YP_007945093 80 Desulfotomaculum gibsoniae Draft_1000032231 bamE 2657 Polyferrodoxin hdrA YP_007946829 74 Desulfotomaculum gibsoniae Draft_1000032230 bamF 638 Coenzyme F420- YP_007945101 59 reducing hydrogenase, delta subunit Desulfotomaculum gibsoniae Draft_1000032229 bamG 452 NADH:ubiquinone YP_007945192 75 oxidoreductase 24 kD subunit Desulfotomaculum gibsoniae Draft_1000032228 bamH 1697 NADH:ubiquinone YP_007945103 79 oxidoreductase 51 kD subunit Desulfotomaculum gibsoniae Draft_1000032227 bamI 590 NADH:ubiquinone YP_007945104 74 oxidoreductase chain G Desulfotomaculum gibsoniae Draft_1000032226 bamR 764 Enoyl-CoA hydratase YP_007945089 87 Desulfotomaculum gibsoniae Draft_1000032225 bamQ 749 Short-chain alcohol YP_007945085 57 dehydrogenase Desulfotomaculum gibsoniae 239

Draft_1000032224 bamY 1190 Acetyl-CoA YP_004969390 76 acetyltransferase Desulfosporosinus orientis Draft_1000032218 MFS 1182 Arabinose ABC WP_009617403 75 transporter transporter permease Desulfosporosinus sp. OT Contig 952 Draft_1000095217 bamA 1143 6-oxocyclohex-1-ene- YP_007945088 72 1-carbonyl-CoA hydrolase Desulfotomaculum gibsoniae Contig 24074 Draft_1000240741 bamQ 864 6-hydroxycyclohex-1- YP_463072 68 ene-1-carboxyl-CoA dehydrogenase Syntrophus aciditrophicus Draft_1000240742 bamR 1152 Enoyl-CoA hydratase YP_463073 89 Syntrophus aciditrophicus Draft_1000240743 bamA 849 Enoyl-CoA hydratase YP_463074 83 Syntrophus aciditrophicus

240

Table D-4. Putative genes involved in fumarate regeneration from alkane activation via the methylmalonyl-CoA pathway. Gene id Putative Size Best BLASTp hit Accession No. Identity annotation (bp) (%) Draft_1000004151 Carboxyl 1551 Carboxyl WP_006159239 48 transferase transferase Cupriavidus basilensis Draft_1000004150 Propionyl-CoA 1965 3- YP_008934080 43 carboxylase, methylcrotonyl- alpha subunit CoA carboxylase subunit alpha Pseudomonas sp. TKP Draft_1000004162 Methylmalonyl- 573 Methylmalonyl- YP_462144 57 CoA racemase CoA epimerase Syntrophus aciditrophicus Draft_1000008665 Methylmalonyl- 423 Cobalamin B12- YP_002430889 70 CoA mutase, binding domain small subunit containing protein Desulfatibacillum alkenivorans AK-01 Draft_1000008664 Methylmalonyl- 1770 Methylmalonyl- ETR66922 73 CoA mutase CoA mutase, large subunit large subunit Candidatus Magnetoglobus multicellularis Draft_1000008663 Methylmalonyl- 981 LAO/AO YP_002430891 55 CoA mutase transport system metalloprotein ATPase Desulfatibacillum alkenivorans AK-01

241

Table D-5. Models used to identify genes and complexes associated with reverse electron transfer, hydrogen and formate transfer, and DIET. Enzyme Putative function COGs Iron-sulfur Oxidation of ETF(electron COG2086 – Electron transfer oxidoreductase transfer flavoprotein) to provide flavoprotein, beta subunit energy for H2 production COG0247 – Fe-S oxidoreductase Fnr (ion-translocating Uses energy derived from ion- COG4657 – Predicted ferredoxin:NAD+ gradients to drive the NADH:ubiquinone oxidoreductase) unfavourable reduction of Fd oxidoreductase, RnfA coupled to the oxidation of COG2878 – Predicted NADH NADH:ubiquinone oxidoreductase, RnfB COG4656 - Predicted NADH:ubiquinone oxidoreductase, RnfC COG4658 – Predicted NADH:ubiquinone oxidoreductase, RnfD COG4659 – Predicted NADH:ubiquinone oxidoreductase, RnfG COG4660 – Predicted NADH:ubiquinone oxidoreductase, RnfE Fix (putative electron Uses energy derived from ion- COG0644 – Dehydrogenases transfer flavoprotein gradients to drive unfavourable (flavoproteins) :quinone reduction of Fd with electrons COG2025 – Electron transfer oxidoreductase) derived from fatty acid oxidation flavoprotein, alpha subunit COG2086 – Electron transfer flavoprotein, beta subunit COG2440 – Ferrodoxin-like protein Confurcating Couples the energetically COG1894 – NADH:ubiquinone hydrogenase favourable production of H2 from oxidoreductase 51kDa subunit Fdred with the unfavourable COG1905 – NADH-ubiquinone production of H2 from NADH oxidoreductase 24 kDa subunit resulting in the formation of 2H2 COG4624 – Iron-only hydrogenase large subunit, C- terminal domain Membrane-bound Ni- Produces H2 by proton reduction, COG0374 – NiFe hydrogenase I Fe hydrogenase possibly using electrons acquired large subunit from COG1740 – NiFe hydrogenase I oxidoreductases/menaquinones. small subunit

242

NADH-linked formate Produces formate from CO2 and COG1905 – NADH-ubiquinone dehydrogenase H+ coupled to NADH oxidation oxidoreductase 24 kDa subunit COG3383 – Anaerobic dehydrogenase Membrane bound Produces formate from CO2 and COG0243 – Anaerobic formate dehydrogenase H+ possibly using electrons dehydrogenase, typically acquired from selenocysteine containing oxidoreductases/menaquinones. COG0437 – Fe-S cluster containing hydrogenase components 1 OmcE Involved in transferring electrons Pfam09699 – Paired CXXCH_1 to and along pili-based nanowires motif in Geobacter metallireducens OmcS Involved in transferring electrons GSU2504 (BLASTp) to and along pili-based nanowires in Geobacter sulfurreducens PilA Encodes the pilin subunits that COG4968-Tfp pilus assembly make up nanowires in Geobacter protein pilE spp. COG4969-Tfp pilis assembly protein pilA

243

Appendix E: SYNTROPHIC BIODEGRADATION OF HYDROCARBON

CONTAMINANTS

Citation: Gieg LM, Fowler SJ & Berdugo-Clavijo C (2014) Syntrophic biodegradation of hydrocarbon contaminants. Current Opinion in Biotechnology 27: 21-29.

Copyright permission for reproduction of this review paper can be found in Appendix G.

244

245

246

247

248

249

250

251

252

253

Appendix F: STABLE ISOTOPE PROBING IN ENVIRONMENTAL MICROBIOLOGY

STUDIES

Citation: Fowler SJ & Gieg LM (2014) Stable isotope probing in environmental microbiology studies. Molecular methods and applications in microbiology. (Skovhus TL, Caffrey S & Hubert

C, eds) pp. 171-179. Caister Academic Press, Norfolk, UK.

Copyright permission is not required for reproduction of this work as Caister Academic Press grants use without explicit permission for authors wishing to reproduce or republish their work in theses or dissertations provided full reference is made to the original source.

(www.horizonpress.com/help/copyright.html)

254

Abstract

Traditional microbiological methods involving the isolation of microbes from the environment in pure culture have been shown to be ineffective at accessing the majority of microbial diversity.

Methods that allow the study of microbes in their native environment or in mixed cultures have been gaining in popularity in recent years. Stable isotope probing is a method that allows the identification of the taxonomic groups that are actively metabolizing a substrate, typically in enriched cultures but also in in situ communities. This technique involves incubations with an isotopically- labelled substrate (e.g. 13C-labelled) during which time the isotope label is incorporated into the biomolecules of organisms actively degrading the substrate. This is followed by the extraction and analysis of these biomolecules in order to identify the organisms incorporating the isotope label. Stable isotope probing has been refined for the analysis of all classes of biomolecules, and has been used to identify the key microbes involved in a number of biological processes.

Introduction

A major goal of microbial ecology is to characterize and understand the roles of microbes in their natural environment. To achieve this, a traditional approach is to isolate microbes from their native environment and study their physiology in a laboratory setting; however, this has proven to be of limited success as traditional laboratory methods enable the purification of only a small fraction of microbes from the environment (Staley & Konopka, 1985). The development of cultivation independent methods has transformed microbial ecology and helped to overcome many of the limitations of traditional methods by enabling the study of microbes in situ or in

255

enrichment cultures under conditions that mimic more closely their native environment. Stable isotope probing (SIP) is a semi-cultivation independent to cultivation independent method, as it is frequently applied to enriched laboratory cultures, but can also be applied to unenriched environmental samples studied in the laboratory and directly in the environment for in situ studies. The method allows for the metabolism of a given substrate to be linked to specific microbes by using isotopically-labelled substrates. The rationale behind this method is that members of a given microbial community that are actively metabolizing an isotopically-labelled compound will incorporate this label into their biomolecules. Pioneered by Boschker et al.,

(1998), SIP was initially used to demonstrate the importance of type I methanotrophs in methane mineralization in lake sediments through the analysis of phospholipid fatty acids (PLFAs) that

13 13 had incorporated C from CH4. Their method has subsequently been modified for the analysis of isotopically-labelled DNA (Radajewski et al., 2000), RNA (Manefield et al., 2002) and proteins (Jehmlich et al., 2008). The basic SIP methodology involves applying a pulse of an isotopically-labelled substrate (typically 13C or 15N, though 18O has also been used successfully) for an incubation period long enough to allow for metabolism of the compound and incorporation of isotope into biomolecules, followed by extraction of the biomolecule(s) of interest and downstream phylogenetic analysis to associate the labelled biomolecules with specific organisms from the community. SIP has been applied to address a variety of research questions. Although SIP has predominantly been applied to enrichment cultures and unenriched samples collected from the environment, it is also attractive for use in field applications as stable isotopes are not detrimental to the environment, and close to in situ substrate concentrations can often be used.

256

Methodologies

PLFA-SIP

The initial application of SIP involved the analysis of PLFAs from cell membranes of methanotrophs and sulfate-reducing bacteria (SRB) in sediment core samples that had been amended with 13C-labelled methane and acetate respectively (Boschker et al., 1998). During the pulse, isotope label is incorporated by cells actively metabolising a 13C-labelled compound, with the rate of PLFA turnover being related to cellular activity but independent of cell replication

(Neufeld et al., 2007a). Following the pulse, PLFAs are extracted and are analysed by GC-C-

IRMS (gas chromatography combustion isotope-ratio mass spectrometry). The results of this analysis give the lipid composition of the sample as well as the degree of 13C labelling. Thus, unlike nucleic-acid SIP (NA-SIP, described below), no prior separation of labelled and unlabelled lipids is required. Furthermore, this analysis is extremely sensitive and label incorporation as low as 0.1-0.2% can be detected (Boschker et al., 1998). This makes PLFA-SIP an attractive technique for field use as in situ substrate concentrations can be applied and very dilute labelling can be detected (Table 14-1). For example, PLFA-SIP has been used in the field to assess the secondary labelling of rhizosphere-associated microbes of plants that have received

13 a CO2 pulse (e.g., Evershed et al., 2006; Denef et al., 2007; Balasooriya et al., 2008; Jin and

Evans, 2010).

In order to make taxonomic assignments based on PLFA profiles, it is necessary to have some knowledge of the lipid content and specific lipid biomarkers of different phylogenetic groups within the sample. PLFA-SIP has been shown to be particularly effective in the analysis of the methanotrophic communities in soil, sediments, and the atmosphere as type I and II

257

methanotrophs have well described distinct membrane lipids that are characteristic of these taxonomic groups (McDonald et al., 2008). For example, PLFA-SIP has been used to differentiate the microbes responsible for methane oxidation in the organic horizon of forest soil at low and high methane concentrations (Bull et al., 2000). By incubating soil cores with low and

13 13 high CH4 concentrations and analysing the enrichment of C in PLFAs, it was determined that at atmospheric (low) concentrations, methane oxidation was carried out primarily by a novel type

II methanotroph related to Methylosinus genus, while at high methane concentrations, methane oxidation was carried out by both a type I methanotroph (Methylomonas sp.) as well as the type

II methanotroph identified at low concentrations. This study demonstrates the benefit of the high sensitivity of PLFA-SIP as it was possible to differentiate high and low affinity methanotrophs by using low (in situ), and high methane concentrations respectively (Bull et al., 2000).

The major drawbacks of PLFA-SIP are that the approach is limited to the identification of cultivated groups with characterized lipids and to environments with relatively low complexity

(Table 14-1). The identification of novel groups of organisms with PLFA-SIP is unlikely as it is only possible if the group contains previously uncharacterized lipids. Moreover, the microbial diversity within the sample must be sufficiently low that it is possible to distinguish individual lipid profiles (Manefield et al., 2002). Characterization of PLFAs of newly cultivated organisms and the improvement of PLFA databases should result in improved taxonomic resolution and more robust results from PLFA-SIP experiments (Bodelier et al., 2009).

258

Table 14-1. Advantages and drawbacks of different SIP methods

Method Pros Cons Useful for PLFA-SIP - High sensitivity - Low phylogenetic - Low complexity -Can use in situ substrate resolution environments containing concentrations - Poor quality and organisms with distinctive -Amenable to field studies availability of databases and well-characterized -No separation of labelled of phylogenetic PLFA lipids and unlabelled molecules profiles - Situations where label required - Inability to identify incorporation is expected novel organisms to be very low - Limited to 13C substrates DNA-SIP - High phylogenetic - Low sensitivity - Actively growing resolution - Requires highly labelled populations with substrate and longer relatively high activity incubation times RNA-SIP - High phylogenetic - Self-affinity of RNA can - Environments with good resolution create technical activity but possibly slow - Higher sensitivity than difficulties in resolving growth rates DNA-SIP heavy and light communities - RNA recovery from environmental samples may be difficult Protein- - Relatively high - Analysis of - Cultures for which SIP sensitivity and uncharacterized microbial metagenomic or genomic phylogenetic resolution communities will likely sequencing of isolates of - Can use in situ substrate require metagenomic closely related organisms concentrations sequencing to achieve are available desired phylogenetic resolution - Protein extraction from environmental samples may be difficult

DNA-SIP

The basic procedure used for DNA-SIP involves applying a pulse of a 13C, 15N or 18O- labelled substrate for an appropriate duration followed by DNA extraction. Light and heavy

DNA molecules are then separated by cesium chloride (CsCl) density gradient

259

ultracentrifugation. Resolved heavy and light DNA can be recovered from gradients visualized under UV light using a syringe if ethidium bromide is included in the gradient solution, or alternatively gradients can be fractionated. Following this, DNA is precipitated and fingerprinting methods can be applied to identify the microbial taxa that have incorporated the label into newly synthesized DNA (Figure14-1). More methodological information is available in a detailed protocol (Neufeld et al., 2007b). The most common fingerprinting methods involve

PCR amplification of the 16S rRNA gene (or a functional gene of interest) followed by clone library construction, a combination of clone library and T-RFLP (terminal restriction fragment length polymorphism), DGGE (denaturing gradient gel electrophoresis), or via pyrosequencing that allows for comparison and differentiation of organisms with labelled and unlabelled DNA.

Alternatively, PCR-independent metagenomic shotgun sequencing of labelled DNA is gaining in popularity, although multiple displacement amplification (MDA) is often required due to the low yield of labelled DNA (Chen and Murrell, 2010). Despite this, amplification and metagenomic sequencing of labelled DNA has been shown to be a useful way to selectively target genomic information from the active members of a community (Neufeld et al., 2008).

A minimum degree of labelling of 15-20 atom% is required to separate 13C-labelled and unlabelled nucleic acids (Radajewski et al., 2000; Whiteley et al., 2007). As label incorporation into DNA requires cell replication, DNA-SIP is less sensitive and requires longer incubation times than other SIP methods (Figure 1, Table 1). To improve labelling efficiency, a highly labelled substrate should be used, and it is often necessary to use higher than in situ substrate concentrations to obtain sufficiently labelled DNA for adequate separation. A drawback of this is that high concentrations of substrate may be inhibitory to some microbial community members

260

and result in a culture bias. Another issue that may occur is crossfeeding, which is the consumption of a byproduct of metabolism of one group by another. If this byproduct is isotopically labelled, this results in the labelling of more than one group of organisms. Though crossfeeding and culture bias can occur in any SIP experiment, it is more prevalent when longer incubation times or increased substrate concentrations are required, such as for DNA-SIP.

Performing time-resolved experiments can allow the identification of crossfeeding, and actually enables the discovery of trophic networks by following the incorporation of isotope label into different groups of organisms over time. Methodological refinements to improve the recovery of low quantities of DNA from gradients include the addition of 13C-labelled carrier DNA to gradients (Gallagher et al., 2005) or the addition of glycogen during DNA precipitation (Neufeld et al., 2007b).

Small differences in buoyant density exist between 13C-labelled and unlabelled nucleic acids (approximately 0.04 g/mL for DNA in CsCl) (Lueders et al., 2004). Variation in the nucleic acid buoyant density of different organisms due to their G+C contents further complicate the separation of labelled and unlabelled nucleic acid molecules. As a result, shallow gradients are required for adequate separation. These can be achieved using vertical or near vertical ultracentrifuge rotors, while large fixed angle and swinging bucket ultracentrifuge rotors result in gradients that are insufficiently shallow for good separation (Lueders, 2010).

While 13C-labelled substrates are most commonly used in DNA-SIP, 15N and 18O-labelled substrates have also been applied (Cadisch et al., 2005; Schwartz, 2007). Due to the lower abundance of N and O atoms in DNA compared to carbon, separation of 15N and 18O-labelled and unlabelled DNA can be even more difficult. When using 15N-labelled substrates, a minimum

261

degree of labelling of 40 atom% is required to achieve separation in environmental samples, and a longer, slower ultracentrifugation has been shown to improve separation of labelled and unlabelled DNA (Cadisch et al., 2005). In the case of 18O-labelled substrates, it is thought that the mass increase in 18O compared to 16O results in sufficient changes in DNA buoyant density to achieve effective separation without modifications to the protocol (Schwartz, 2007).

Despite its low sensitivity and complications in separating labelled and unlabelled nucleic acids, NA-SIP has an extremely high phylogenetic resolution due to the ability to probe the 16S rRNA gene directly and capitalize on the wide abundance of 16S rRNA genes from different phyla in the reference databases (Table 14-1). The extremely high phylogenetic resolution and the relative ease of DNA extraction from environmental samples and enrichment cultures

(compared to RNA and protein extraction) make DNA-SIP the most widely used of SIP methodologies at the present moment.

In an effort to overcome the limitations in sensitivity and phylogenetic resolution of different SIP methods, it is possible to combine molecular methods with SIP techniques in order to gain additional insight into the environment of interest. For example, by using both PLFA-

SIP and DNA-SIP, Webster et al. (2006) characterized SRB in unenriched marine sediments samples more completely than either method would have achieved alone. The analysis of 16S rRNA of the 13C-labelled fractions of SRB grown on glucose revealed that all major community members incorporated carbon from glucose within 7 days. However, the high sensitivity of

PLFA-SIP allowed the examination of glucose metabolism in a time resolved fashion, and revealed that specific uncultured SRB became labelled by days 1 and 4, while the remainder of the community became labelled by day 7. This allowed the authors to differentiate specific

262

glucose oxidizers from organisms metabolizing glucose degradation products. In 13C-acetate incubated sediments, PLFA profiles implicated SRB including Desulfobacter spp. and

Desulfococcus multivorans in acetate oxidation. While DNA-SIP analysis of 16S rRNA genes confirmed this, it also revealed the presence of 16S rRNA genes most closely related to uncultured Firmicutes and candidate division JS1 in 13C-labelled acetate-incubated fractions.

Using PLFA- and DNA-SIP methods in combination allowed the authors to minimize the drawbacks of both methods, namely the low phylogenetic resolution and inability to identify uncultured organisms by PLFA-SIP and the low sensitivity of DNA-SIP. As a result, they provided a more complete picture of SRB in marine sediments and described a metabolic role for the previously uncharacterized candidate division JS1 (Webster et al., 2006).

263

Figure 14-1. Sample treatment in different stable isotope probing methodologies. GC-C- IRMS (Gas combustion isotope ratio mass spectrometry), CsCl (cesium chloride), CsTFA (cesium trifluoroacetate), SDS-PAGE (sodium dodecyl sulfate polyacrylamide gel electrophoresis), 2-D (two-dimensional), MALDI-MS (matrix-assisted laser desorption/ionization mass spectrometry), LC-MS/MS (liquid chromatography tandem mass spectrometry)

264

RNA-SIP

The method used for RNA-SIP is similar to that of DNA-SIP with some minor modifications. RNA turnover is a continuous process that is independent of cell replication and is higher in active compared to inactive cells (Manefield et al., 2002). For this reason, RNA-SIP is more sensitive than DNA-SIP, while maintaining the same high taxonomic resolution. Due to the increased sensitivity of RNA-SIP, the duration of the incubation period is typically shorter

(Figure14-1). Following the incubation, RNA is extracted and labelled and unlabelled RNA molecules are separated in a cesium trifluoroacetate (CsTFA) gradient solution rather than CsCl, as the buoyant density of RNA is higher than DNA (Whiteley et al., 2007). Labelled and unlabelled RNA are subsequently separated by fractionation, and RNA is precipitated (Whiteley et al., 2007; Figure 1). Following reverse transcription of RNA to cDNA, 16S rRNA can be amplified and fingerprinting methods can be applied as described for DNA-SIP. Additionally, metatranscriptomic sequencing of mRNA is theoretically feasible, though this has not yet been demonstrated and considerable transcriptome amplification would be required. Methodological details can be found in a comprehensive RNA-SIP protocol (Whiteley et al., 2007).

Equivalent problems in the separation of labelled and unlabelled nucleic acids in DNA-

SIP exist for RNA-SIP. In addition, the tendency of RNA to self-associate further confounds the separation of labelled and unlabelled RNA. Interactions of labelled and unlabelled RNA molecules result in decreased gradient resolution and the use of high concentrations of RNA (>1 ug) results in aggregation, precipitation and incomplete separation (Lueders et al., 2004). To achieve efficient separation of heavy and light RNA, low quantities of RNA (~500 ng) must be

265

used to minimize aggregation and prevent precipitation. At these concentrations, the visualization of RNA in ethidium bromide-containing gradients is not possible, and as a result, gradient fractionation was developed (Manefield et al., 2002). Gradient fractionation and RNA-

SIP were first used to definitively identify the dominant phenol degrader in a bioreactor previously shown to be dominated by pseudomonads, γ-Proteobacteria and Cytophaga-

Flavobacterium groups. In DGGE gels of the fractionated gradients, it became clear that a single band was dominant in the heavy (labelled) gradient fractions, and sequencing revealed that this phenol degrader was a Thauera sp. which had not previously been found to degrade phenol under aerobic conditions (Manefield et al., 2002). Fractionation has subsequently also been optimized for DNA-SIP as it allows a quantitative examination of the complete gradient, enabling the detection of incomplete separation due to partial label incorporation and diffusion.

This is particularly relevant in slow growing communities wherein the incorporation of label is slow and may not be complete (Lueders et al., 2004).

Due to the diffusion that occurs in all gradients, variations in G+C content and the self- affinity of RNA in RNA-SIP, labelled and unlabelled nucleic acid molecules will be distributed over a range of buoyant densities in NA-SIP experiments (Table 14-1). Furthermore, particularly under anaerobic conditions, CO2 fixation may occur concurrently with substrate degradation,

13 12 12 which results in dilution of the C label due to the concurrent incorporation of C from CO2 into nucleic acids (Lueders, 2010). As a result, care must be taken to differentiate the incorporation of isotope into certain templates from a background of unlabelled nucleic acids. To demonstrate true label incorporation, it is important to include control samples incubated with unlabelled substrate in parallel with labelled (Lueders, 2010). By using control samples

266

incubated with unlabeled substrates, it becomes possible to demonstrate that the buoyant density of templates that incorporate the label are higher in samples incubated with labelled substrate than in control samples. In addition, to confirm that isotopic enrichment has occurred in a sample, nucleic acid samples can be subject to GC-C-IRMS to quantify the degree of labelling

(Manefield et al., 2002).

Protein-SIP

Protein-SIP is a recently developed method that provides a functional link between an environmental process and specific proteins in a microbial community by applying 13C and 15N- labelled substrates (Jehmlich et al., 2008). Identified proteins can be assigned taxonomically by comparison to reference databases. This method has intermediate sensitivity, between that of

PLFA-SIP and NA-SIP, with a minimum label incorporation of 2 and 5 atom% required for downstream analysis with 13C- and 15N-labelled substrates respectively (Jehmlich et al., 2010,

Table 14-1). The phylogenetic resolution of this method is also at an intermediate level relative to PLFA and NA-SIP, as amino acid sequences can often provide more specific phylogenetic information than PLFA profiles, but are more highly conserved across taxonomic groups compared to nucleic acid sequences. The phylogenetic resolution of protein-SIP can be improved when accompanied by genomic information (e.g. metagenome or individual genomes) from the community of interest so that amino acid sequences can be associated with genes that are analysed phylogenetically at the genomic level (Jehmlich et al., 2010). For poorly characterized samples this is likely required for good phylogenetic resolution as sequence information for many organisms is not available in reference databases.

267

Protein-SIP is carried out by applying a pulse of appropriate duration with 13C or 15N- labelled substrates and unlabelled control substrate, followed by protein extraction and downstream analysis that involves either gel-based methods or gel-free shotgun proteomics

(Figure14-1). Gel-based methods involve the separation of proteins by SDS-PAGE or 2D gel electrophoresis followed by protein digestion and analysis with MALDI-MS (matrix assisted laser ionization/desorption mass spectrometry), LC-MS or LC-MS/MS to obtain peptide mass fingerprints (PMF) for individual proteins (Jehmlich et al., 2010). Gel-free methods include IPP

(intact protein profiling), which involves the analysis of small undigested proteins by MALDI-

MS to create a profile which is compared to profiles from reference strains, and SMM (shotgun mass mapping), which involves protein digestion followed by MALDI-MS analysis which provides peptide sequence information (Jehmlich et al., 2009). The degree of isotope incorporation into proteins is calculated based on a model of amino acid mass and the comparison of the respective masses of a protein in the labelled and unlabelled samples

(Jehmlich et al., 2009). Downstream data analysis and protein identification is carried out using search engines that assign peptide sequences from primary sequence reference databases to MS data. This requires MS data derived from control incubations with unlabelled substrate as the protein searches rely on the mass of unlabelled peptides (Jehmlich et al., 2008). For further information on specific protein-SIP methods, a detailed protocol is available (Jehmlich et al.,

2010).

The use of shotgun proteomics in protein-SIP could potentially reduce the intensive data analysis that is required for gel-based methods. IPP relies on protein profiles of reference strains and is likely not suitable for the analysis of microbial communities which consist largely of

268

uncharacterized organisms (Jehmlich et al., 2009). Although SMM has been shown to be more accurate than IPP and does not require reference strain profiles, adequate taxonomic resolution can only be achieved with the analysis of 3 peptides per protein, which creates large amounts of data (Jehmlich et al., 2009). At present, few studies have applied protein-SIP to microbial communities derived from the environment, and these have relied on gel-based methods (Bastida et al., 2010; Bastida et al., 2011; Bozinovski et al., 2012). Despite this, the potential for protein-

SIP to be a useful method to analyze microbial communities has been demonstrated. Protein-SIP was recently used to identify the methyl tert-butyl ether (MTBE) degrader in an enrichment culture established from contaminated groundwater sediments (Bastida et al., 2010). The authors identified 27 different proteins, most of which originated from Methylibium petroleiphilum PM1 and members of the Comamonadaceae that were the dominant members of the community.

Interestingly, MALDI-MS revealed that 13C enrichment was observed only in proteins belonging to M. petroleiphilum PM1 even after 5 days of MTBE degradation. This result suggested that M. petroleiphilum PM1 was the sole MTBE degrader in the culture, and that no crossfeeding was occurring. It was proposed that other community members were utilizing detritus from dead biomass as a carbon and energy source (Bastida et al., 2010).

Currently, protein-SIP is still in its infancy, but it has the potential to be a useful technique for the study of microbial and even mixed microbial and eukaryotic communities

(Bastida et al., 2011). As the degree of label incorporation into proteins corresponds to the metabolic activity of that organism, protein-SIP could be used to resolve trophic interactions in a variety of microbial communities (Jehmlich et al., 2010). Further technical advancements such as developments in shotgun proteomics and improved protein extraction efficiency from

269

environmental samples could make protein-SIP more user friendly and broaden the range of environments to which the method can be applied (Jehmlich et al., 2010; Table 1). Based on the high sensitivity, relatively good phylogenetic resolution, and direct functional link between proteins and metabolism, protein-SIP could potentially be used in field applications and for the description of metabolic pathways and trophic interactions.

Summary

The development of molecular methods amenable to the study of mixed microbial communities in recent decades has led to a revolution in the field of microbial ecology. Much more is now known about the microbiota of a variety of natural environments such as marine and freshwater systems, terrestrial environments, the deep subsurface and the human microbiome.

Stable isotope probing techniques are particularly intriguing due to their ability to link biological functions with specific microbes in a given environment (e.g., in enrichment cultures, in unenriched samples retrieved from an environment, or directly in situ). To date, SIP methods have provided new insight into biogeochemical processes such as sulfate reduction and methanotrophy as well as contaminant biodegradation. In the coming years, the combination of

SIP methods with complementary molecular methods such as metagenomics and proteomics will further improve our understanding of the microbial world and the metabolic processes that are mediated by microbes in a variety of ecosystems.

270

References

Balasooriya WK, Denef K, Peters J, Verhoest NEC, & Boeckx P (2008) Vegetation composition and soil microbial community structural changes along a wetland hydrological gradient. Hydrol Earth Syst Sci 12: 277-291.

Bastida F, Jechalke S, Bombach P, Franchini AG, Seifert J, von Bergen M et al. (2011) Assimilation of benzene carbon through multiple trophic levels traced by different stable isotope probing methodologies. FEMS Microbiol Ecol 77: 357-369.

Bastida, F., Rosell, M., Franchini, A.G., Seifert, J., Finsterbusch, S., Jehmlich, N. et al. (2010) Elucidating MTBE degradation in a mixed consortium using a multidisciplinary approach. FEMS Microbiol Ecol 73: 370-384.

Bodelier PLE, Gillisen MJB, Hordijk K, Damste JSS, Rijpstra WIC, Geenevasen, JAJ, & Dunfield PF (2009) A reanalysis of phospholipid fatty acids as ecological biomarkers for methanotrophic bacteria. ISME J 3: 606-617.

Boschker HTS, Nold SC, Wellsbury P, Bos D, de Graaf W, Pel R et al. (1998) Direct linking of microbial populations to specific biogeochemical processes by 13C-labelling of biomarkers. Nature 392: 801-805.

Bozinovski D, Herrmann S, Richnow HH, von Bergen M, Seifert J, and Vogt C. (2012) Functional analysis of an anaerobic m-xylene-degrading enrichment culture using protein-based stable isotope probing. FEMS Microbiol Ecol 81: 134-144.

Bull, ID, Parekh NR, Hall GH, Ineson P, & Evershed RP (2000) Detection and classification of atmospheric methane oxidizing bacteria in soil. Nature 405: 175-178.

Cadisch G, Espana M, Causey R, Richter M, Shaw E, Morgan JAW et al. (2005) Technical considerations for the use of 15N DNA stable-isotope probing for functional microbial activity in soils. Rapid Commun Mass Sp 19: 1424-1428.

Chen Y, and Murrell JC (2010) When metagenomics meets stable-isotope probing: progress and perspectives. Trends Microbiol 18: 157-163.

Denef K, Bubenheim H, Lenhart K, Vermeulen J, Van Cleemput O, Boeckx P & Muller C (2007) Community shifts and carbon translocation within metabolically-active rhizosphere microorganisms in grasslands under elevated CO2. Biogeosciences 4: 769-779.

Evershed RP, Crossman ZM, Bull ID, Mottram H, Dungait JAJ, Maxfield PJ & Brennand EL (2006) 13C-Labelling of lipids to investigate microbial communities in the environment. Curr Opin Biotechnol 17: 72-82.

271

Gallagher E, McGuinness L, Phelps C, Young LY & Kerkhof LJ (2005) 13C-carrier DNA shortens the incubation time needed to detect benzoate-utilizing denitrifying bacteria by stable- isotope probing. Appl Environ Microbiol 71: 5192-5196.

Jehmlich N, Schmidt F, von Bergen M, Richnow HH & Vogt C (2008) Protein-based stable isotope probing (Protein-SIP) reveals active species within anoxic mixed cultures. ISME J 2: 1122-1133.

Jehmlich N, Schmidt F, Taubert M, Seifert J, von Bergen M, Richnow HH & Vogt C (2009) Comparison of methods for simultaneous identification of bacterial species and determination of metabolic activity by protein-based stable isotope probing (Protein-SIP) experiments. Rapid Commun Mass Sp 23: 1871-1878.

Jehmlich N, Schmidt F, Taubert M, Seifert J, Bastida F, von Bergen, M. et al. (2010) Protein- based stable isotope probing. Nat Protoc 5: 1957-1966.

Jin VL & Evans RD (2010) Microbial 13C utilization patterns via stable isotope probing of phospholipid biomarkers in Mojave Desert soils exposed to ambient and elevated atmospheric CO2. Glob Change Biol 16: 2334-2344.

Lueders T (2010) Stable isotope probing of hydrocarbon-degraders. Handbook of Hydrocarbon and Lipid Microbiology. (Timmis KN ed.) pp. 4012-4024. Springler Verlag, Berlin Heidelberg,

Lueders T, Manefield M & Friedrich MW (2004) Enhanced sensitivity of DNA- and rRNA- based stable isotope probing by fractionation and quantitative analysis of isopycnic centrifugation gradients. Environ Microbiol 6: 73-78.

Manefield M, Whiteley AS, Griffiths RI & Bailey MJ (2002) RNA stable isotope probing, a novel means of linking microbial community function to Phylogeny. Appl Environ Microbiol 68: 5367-5373.

McDonald IR, Bodrossy L, Chen Y & Murrell JC (2008) Molecular ecology techniques for the study of aerobic methanotrophs. Appl Environ Microbiol 74: 1305-1315.

Neufeld JD, Dumont MG, Vohra J & Murrell JC (2007a) Methodological considerations for the use of stable isotope probing in microbial ecology. Microbial Ecol 53: 435-442.

Neufeld JD, Chen Y, Dumont MG & Murrell JC. (2008) Marine methylotrophs revealed by stable-isotope probing, multiple displacement amplification and metagenomics. Environ Microbiol 10: 1526-1535.

Neufeld JD, Vohra J, Dumont MG, Lueders T, Manefield M, Friedrich MW & Murrell JC (2007b) DNA stable-isotope probing. Nat Protoc 2: 860-866.

272

Radajewski S, Ineson P, Parekh NR & Murrell JC (2000) Stable-isotope probing as a tool in microbial ecology. Nature 403: 646-649.

Schwartz E (2007) Characterization of growing microorganisms in soil by stable isotope probing 18 with H2 O. Appl Environ Microbiol 73: 2541-2546.

Staley JT & Konopka A (1985) Measurement of in situ activities of nonphotosynthetic microorganisms in aquatic and terrestrial habitats. Annu Rev Microbiol 39: 321-346.

Webster G, Watt LC, Rinna J, Fry JC, Evershed RP, Parkes RJ & Weightman AJ (2006) A comparison of stable-isotope probing of DNA and phospholipid fatty acids to study prokaryotic functional diversity in sulfate-reducing marine sediment enrichment slurries. Environ Microbiol 8: 1575-1589.

Whiteley AS, Thomson B, Lueders T & Manefield M (2007) RNA stable-isotope probing. Nat Protoc 2: 838-844.

273

274

275

276

277

Appendix G: COPYRIGHT PERMISSIONS

The following pages contain copyright permission licenses for the following publications:

Fowler SJ, Dong X, Sensen CW, Suflita JM & Gieg LM (2012) Methanogenic toluene metabolism: community structure and intermediates. Environ Microbiol 14: 754-764.

Gieg LM, Fowler S & Berdugo-Clavijo C (2014) Syntrophic biodegradation of hydrocarbon contaminants. Curr Opin Biotechnol 27: 21-29

278

279

280