JOBNAME: RNA 12#12 PAGE: 1 OUTPUT: Friday October 27 16:36:06 2006 csh/RNA/125784/rna2915

Downloaded from rnajournal.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press

Roles of a Trypanosoma brucei 59/39 exoribonuclease homolog in mRNA degradation

CHI-HO LI, HENRIETTE IRMER,1 DRIFA GUDJONSDOTTIR-PLANCK, SIMONE FREESE,2 HEIKE SALM, SIMON HAILE,3 ANTONIO M. ESTE´VEZ,4 and CHRISTINE CLAYTON Zentrum fu¨r Molekulare Biologie der Universita¨t Heidelberg (ZMBH), D-69120 Heidelberg, Germany

ABSTRACT The genome of the kinetoplastid parasite Trypanosoma brucei encodes four homologs of the Saccharomyces cerevisiae 59/39 exoribonucleases Xrn1p and Xrn2p/Rat1p, XRNA, XRNB, XRNC, and XRND. In S. cerevisiae, Xrn1p is a cytosolic enzyme involved in degradation of mRNA, whereas Xrn2p is involved in RNA processing in the nucleus. Trypanosome XRND was found in the nucleus, XRNB and XRNC were found in the cytoplasm, and XRNA appeared to be in both compartments. XRND and XRNA were essential for parasite growth. Depletion of XRNA increased the abundances of highly unstable developmentally regulated mRNAs, perhaps by delaying a deadenylation-independent decay pathway. Degradation of more stable or unregulated mRNAs was not affected by XRNA depletion although a slight decrease in average poly(A) tail length was observed. We conclude that in trypanosomes 59/39 exonuclease activity is important in degradation of highly unstable, regulated mRNAs, but that for other mRNAs another step is more important in determining the decay rate. Keywords: Rat1; Trypanosoma; XRN1; degradation; mRNA

INTRODUCTION whereas Rat1p/Xrn2p is located in the nucleus (Johnson 1997). Correspondingly, Xrn1p is more important in The processing of RNAs in mammalian cells involves mRNA degradation, whereas Rat1p is implicated primarily various endonucleases and exonucleases that affect site- in nuclear processing events. specific internal cleavages and trim the RNAs to their The major pathway of mRNA degradation in yeast mature lengths. Accurate regulation of gene expression also involves initial shortening of the poly(A) tail, followed by requires that mRNA and other RNAs be degraded in removal of the cap structure and degradation by Xrn1p a controlled fashion (Arraiano and Maquat 2003). In the (Decker and Parker 1994; Muhlrad et al. 1995; for reviews, yeast Saccharomyces cerevisiae, two major 59–39 exonu- see Decker and Parker 1994; Caponigro and Parker 1996; cleases, Xrn1/Sep1/Kem1 and Xrn2/Rat1, have been impli- Parker and Song 2004). S. cerevisiae and Schizosaccharo- cated in the 59 processing of RNAs. The two proteins have myces pombe that lack Xrn1p are viable although they show homologous N-terminal exonuclease domains (Bashkirov impaired growth (Larimer and Stevens 1990; Szankasi and et al. 1995) but differ in their location: Xrn1p is pre- Smith 1996). The S. cerevisiae mutant accumulates dead- dominantly (at least 90%) cytoplasmic (Heyer et al. 1995) enylated mRNAs (Hsu and Stevens 1993), which are gradually degraded by the exosome 39/59 exonuclease complex; Xrn1p mutations are synthetically lethal with Present address: 1Bernhard-Nocht-Institut fu¨r Tropenmedizin, Abtei- mutations in exosome activity (Johnson and Kolodner lung Molekularbiologie, Bernhard-Nocht-Str. 74, Hamburg, Germany. 1995; Anderson and Parker 1998). 2Max-Planck Institut for Medical Research, Heidelberg, Germany. 3Centre de recherche en Infectiologie, CHUQ, Pavillon Chul, 2705 Boul. Apart from the roles of S. cerevisiae Xrn1p in mRNA Laurier, Ste-Foy, Que G1V 4G2, Canada. degradation, there is evidence that it can promote micro- 4 Instituto de Parasitologia y Biomedicina ‘‘Lopez-Neyra’’, CSIC, Avda. tubule assembly in vitro, and xrn1 mutants are hypersen- del Conocimiento, s/n 18100 Armilla, Granada, Spain. Reprint requests to: Christine Clayton, Zentrum fu¨r Molekulare sitive to benomyl and defective in karyogamy (Johnson Biologie der Universita¨t Heidelberg (ZMBH), Im Neuenheimer Feld 282, 1997; Page et al. 1998; Solinger et al. 1999). Xrn1p has also D-69120 Heidelberg, Germany; e-mail: [email protected]; been shown to have DNA strand-exchange and exonucleo- fax: 49-6221-54-5894. Article published online ahead of print. Article and publication date are lytic activity (Kolodner et al. 1987; Dykstra et al. 1990; at http://www.rnajournal.org/cgi/doi/10.1261/rna.291506. Tishkoff et al. 1991; Liu and Gilbert 1994). The significance

RNA (2006), 12:1–16. Published by Cold Spring Harbor Laboratory Press. Copyright Ó 2006 RNA Society. 1

rna2915 Li et al. ARTICLE RA JOBNAME: RNA 12#12 PAGE: 2 OUTPUT: Friday October 27 16:36:07 2006 csh/RNA/125784/rna2915

Downloaded from rnajournal.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press

Li et al.

of these other activities is subject to debate since it is not In mammals, a subclass of highly unstable mRNAs clear how many of the effects are secondary to RNA containing AU-rich elements (AREs) has received particu- degradation defects. lar attention because of their roles in the control of cell The S. cerevisiae nuclear exonuclease Rat1p is, unlike proliferation and inflammation (Bevilacqua et al. 2003). Xrn1p, essential (Kenna et al. 1993). Its exonuclease activity Until very recently it was thought that the principal is similar to that of Xrn1p, but Rat1p/Xrn2p is present at pathway of degradation of mRNAs containing AREs was only one-tenth of the abundance of Xrn1p (Poole and deadenylation followed by 39/59 degradation by the Stevens 1995). Rat1 mutants show defects in the 59 exosome (Chen et al. 2001; Mukherjee et al. 2002). This processing of 5.8s rRNA (Amberg et al. 1992; Fang et al. conclusion was based mainly on results obtained in experi- 2005) and of snoRNAs (Lee et al. 2003), and in degrada- ments with in vitro extracts. Recently, however, siRNA tion of pre-mRNAs (Bousquet-Antonelli et al. 2000). The experiments targeting Xrn1 in human cells revealed a clear N-terminal 765 amino acids of Rat1p correspond to role for Xrn1 in degradation of an ARE-containing reporter residues 1–671 of Xrn1p; the most important difference RNA (Stoecklin et al. 2005). within this region is the insertion of a bipartite nuclear The Kinetoplastid protists include several parasites of localization signal in Rat1p. Since overexpressed Rat1p high economic and medical importance, infecting over (Poole and Stevens 1995) or expression of a mutant Rat1p 20 million people and reducing livestock production in lacking the nuclear localization signal (Johnson 1997) can tropical countries. Trypanosoma brucei and related (sali- complement the Dxrn1 mutant, and Xrn1p targeted to the varian) trypanosomes cause human sleeping sickness and nucleus can complement the conditional rat1-1 mutant of infect cattle throughout sub-Saharan Africa, and are trans- Rat1p (Johnson 1997), it appears that the major functional mitted by Tsetse flies; Trypanosoma cruzi is transmitted by difference between the two proteins is confined to their reduviid bugs in South and Middle America and is the localization. The functions of the long divergent C termini causative agent of Chagas disease; and the various Leish- (763 residues of Xrn1p and 241 residues of Rat1p) are as yet manias, which are transmitted by sandflies, cause a variety unknown. Rat1p also plays a role in transcription termi- of diseases throughout tropical and subtropical regions. All nation in yeast and mammalian cells (Kim et al. 2004; West of these parasites regulate their gene expression in order to et al. 2004), both through recruitment of polyadenylation adjust to the different conditions in the mammalian and factors and by digesting the cleaved product downstream of arthropod hosts—and all of them show no sign whatsoever the poly(A) site (Luo et al. 2006). This activity cannot be of gene-specific control of RNA polymerase II transcription complemented by nuclear-targeted Xrn1p, but a role for (Clayton 2002). The genomes of the Kinetoplastids are Xrn1p was nevertheless suggested by the fact that deletion constructed of polycistronic transcription units that can be of XRN1 exacerbated the Rat1 mutant phenotype. over 1000 kb long and produce hundreds of independently The study of XRN homologs in multicellular eukaryotes regulated mRNAs (Berriman 2005; El-Sayed et al. 2005a). has revealed functions similar to those seen in yeast. 59/39 Although transcription probably initiates in the gaps exonuclease activity was demonstrated for the mouse between polycistronic units, specific initiation sites have (Bashkirov et al. 1997) and Arabidopsis (Kastenmeier and proved elusive (Martinez-Calvillo et al. 2003, 2004). In- Green 2000) homologs. A requirement for 59/39 mRNA dividual mRNAs are excised from the polycistronic pre- degradation in Caenorhabditis elegans was demonstrated by cursors by 59-trans splicing and polyadenylation (Liang RNA silencing of xrn-1; this resulted in a failure of ventral et al. 2003). The levels of the encoded proteins are epithelial closure (Newbury and Woolard 2004). The determined primarily through regulation of mRNA turn- mRNA encoding the Drosophila homolog, pacman,isan over and translation and protein degradation (Clayton abundant component of maternal mRNA in embryos, 2002). again suggesting a role in development; this enzyme can We have particularly concentrated on the regulation of the complement the yeast Dxrn1 mutant, indicating functional turnover of two mRNAs, which are expressed almost exclu- conservation from Drosophila to yeast (Till et al. 1998). The sively in the Tsetse fly (‘‘procyclic’’) form of T. brucei.These Arabidopsis thaliana genome encodes three XRN-like mRNAs encode the major surface protein of the procyclic proteins, all of which resemble Rat1p/Xrn2p in primary form, the EP procyclin, and an isoenzyme of phosphoglycer- structure: None of them has the C-terminal extension, ate kinase, PGKB. Both the EP and PGKB mRNAs contain, which is characteristic of yeast Xrn1p (Kastenmeier and in their 39-untranslated regions (39 UTRs), U-rich elements Green 2000). AtXRN2 and AtXRN3 are nuclear and (UREs), which are responsible for very rapid degradation of complement the yeast rat1-1 mutant, whereas AtXRN4 is the mRNAs in the mammalian or ‘‘bloodstream’’ form of the a cytosolic protein, responsible for 59/39 degradation of parasite (Hotz et al. 1997; Haile et al. 2003). The two mRNAs mRNAs. Experiments with both Drosophila and Arabidopsis have half-lives of z5 min in bloodstream forms and over an also implicate XRN homologs in the degradation of the hour in procyclic forms (Hotz et al. 1997; Haile et al. 2003). products of miRNA- or siRNA- and Dicer- mediated RNA To determine the pathway of degradation, we analyzed the cleavage (Souret et al. 2004; Orban and Izaurralde 2005). decay of reporter mRNAs including different 39 UTRs, and

2 RNA, Vol. 12, No. 12 JOBNAME: RNA 12#12 PAGE: 3 OUTPUT: Friday October 27 16:36:08 2006 csh/RNA/125784/rna2915

Downloaded from rnajournal.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press

Trypanosoma brucei 59/39 exoribonuclease

mapped degradation intermediates. The results suggested that exoribonuclease activity. A search for targeting signals using degradation of the EP mRNA is initiated by destruction of the http://psort.nibb.ac.jp (Nakai and Horton 1999) showed weak 39 end, by an exonuclease activity that stalls upon encoun- nuclear localization signals for all four TbXRNs, but none of tering a G30C30 sequence (Irmer and Clayton 2001). This the proteins was unambiguously predicted to be nuclear. activity was shown to be the exosome (Haile et al. 2003). The When we constructed phylogenetic trees, using a variety mapping experiments also, however, implied a role for of approaches, the Kinetoplastid XRNA sequences clustered a59/39 exonuclease activity which was—like ScXrn1p consistently closest to the yeast, human, and Arabidopsis (Muhlrad et al. 1994) and AtXRN4 (Kastenmeier and Green XRN1 sequences. At 1418 residues, and a predicted molec- 2000)—delayed by a G30 sequence. The actin (ACT)mRNAis ular weight of 158 kDa, T. brucei XRNA is the longest of the expressed at similar levels at both life-cycle stages and is of Kinetoplastid XRN homologs and is nearest in size to the intermediate stability. Degradation of a reporter mRNA XRN1 proteins from other species. When aligned with the containing the ACT 39 UTR was bidirectional (Irmer and C terminus of ScXrn1p (residue 660 onward), residues Clayton 2001), implying roles for 59/39 and 39/59 563–945 of TbXRNA show 20% identity and 41% similarity. exonucleases in the degradation, but exosome activity was In blast searches, XRND gave the best match for yeast not rate limiting (Haile et al. 2003). Rat1p (although the position on trees was more ambiguous). In this article we identify a 59/39 exonuclease, which The 801-residue (90 kDa) XRND also has a size similar to the plays a critical role in regulated mRNA degradation in Rat1p proteins. Relative to XRNA, the N-terminal exonucle- trypanosomes. ase domain of XRND contains additional short inserted domains, which are similar in position and length—but not sequence—to those that are also seen in Arabidopsis XRN2-4 RESULTS and yeast Rat1p. The C terminus, however, could not be aligned with the other nuclear XRN/Rat1p sequences, and The four XRN genes of Kinetoplastids a Blastp search of the kinetoplastid databases with residues A combination of homology searches and sequencing 700–1006 of ScRat1p yielded no significant matches. revealed four potential homologs of the yeast XRN1 and TbXRNB is the second largest protein of the four, with XRN2 genes in T. brucei. We named these genes XRNA, 1036 residues and a predicted molecular weight of 115 kDa. XRNB, XRNC, and XRND, and they are annotated as such All of the trypanosomatid XRNBs have a predicted zinc in the genome database (Berriman et al. 2005). Homolo- finger domain (SM00547) near the C terminus; for T. gous genes are also present in Leishmania major, Trypano- brucei this has a probability of 8.2e-09 and is at residues soma cruzi, Trypanosoma congolense, Trypanosoma vivax, 976–1000. In the T. brucei 927-genome sequence the gene and Leishmania infantum (unpublished, but publicly avail- has a frame shift, but our sequencing of a P1 clone of the able, data from Pathogen Sequencing Unit, Sanger Center; same T. brucei strain yielded an intact open reading frame. Table 1; El-Sayed et al. 2005b; Ivens et al. 2005). It is not clear whether the frame shift is a sequencing error Conservation of the XRNs is restricted to the N termi- or if one allele has mutated in the genome strain. nus, which contains the exonuclease domain: This corre- XRNC is an 868-residue, 95-kDa protein and is the most sponds to residues 1–671 of ScXrn1p and 1–765 of ScRat1p. divergent of the four polypeptides: Even the putative exo- An alignment is available from the authors and a diagram is nuclease domain is less conserved toward the C terminus. shown in Figure 1. All of the trypanosome proteins are Processing sites for trypanosome RNAs can be predicted predicted to have exoribonuclease activity by Interpro based on the positions of polypyrimidine tracts and the (http://www.ebi.ac.uk/InterProScan/), with a 59/39 exo- downstream open reading frame (Benz et al. 2005); the size nuclease domain (PF03159.7). The percent identities with of the mRNA can thus be estimated by including the the N-terminal 671 residues of ScXrn1p were: XRNA, 36%; 39-nucleotide (nt) spliced leader and a 100–200-nt poly(A) XRNB, 23%; XRNC, 15%; and XRND, 27%. (For reference, tail. The sizes of the XRNA, XRNB, and XRND mRNAs the identity of ScXrn1p with ScRat1p is 37%.) Thirteen conformed with the predictions, as follows: XRNA: 9.5 kb; amino acids have been shown to be important for ScXrn1p XRNB: 4.4 kb; XRNC: transcript not detected; XRND: 3.4 activity by mutational analysis: Asn37, His41, Asp86, Lys93, kb. No developmental regulation of XRNA, XRNB, and Gln97, Pro90, Arg101, Glu176, Glu178, Cys201, Asp206, XRND mRNA abundances was seen (data not shown). Asp208, and Leu592 (Johnson 1997; Page et al. 1998; Solinger et al. 1999). All of these amino acids are conserved XRNA and XRND are required for in all of the trypanosomatid proteins with the exception of trypanosome growth two. Cys201 is Val in XRNB, XRNC, and XRND, but mouse Dhm1 (an Xrn1p homolog with demonstrated exoribonu- To assess the roles of the four putative exonucleases in clease activity; Bashkirov et al. 1997) has the same change, so trypanosomes, we down-regulated their expression by it is unlikely to affect function. His41 is replaced by Thr or tetracycline-inducible RNA interference. The sequences Ala in XRNC: We do not know if this would affect used as templates for dsRNA were genomic fragments of

www.rnajournal.org 3 JOBNAME: RNA 12#12 PAGE: 4 OUTPUT: Friday October 27 16:36:08 2006 csh/RNA/125784/rna2915

Downloaded from rnajournal.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press

Li et al.

TABLE 1. Identities of XRNs in five Kinetoplastid genomes

Gene T. brucei T. cruzi L. major T. congolense T. vivax L. infantum

XRNA Tb07.26A24.100 Tc00.1047053507817.80 LmjF06.0260 congo1273e10.p1k_13 tviv1125c06.q1k_0 LinJ06.0230 (C-term from aa 597) Tc00.1047053505939.89 N-term XRNB Was Tb05.3C6.570 Tc00.1047053511305.10 LmjF17.1150 congo1169g09.q1k_2 tviv685h07.q1k_0 LinJ17.0960 Tc00.1047053507087.80 XRNC Tb08.28F14.150 Tc00.1047053504427.130 LmjF23.0543 congo693h05.p1k_0 tviv696h02.p1k_1 LinJ23.0410 XRND Tb10.70.0610 Tc00.1047053507641.80 LmjF36.1790 congo938g03.p1k_1 tviv97e03.p1k_4 LinJ36.1690

400–600 base pairs (bp). The double-stranded RNAs were XRNA/B RNAi lines showed growth inhibition similar to obtained either as stem–loop structures (expressed from that seen for down-regulation of XRNA alone (Fig. 3). a tetracycline-inducible RNA polymerase I promoter) or as The second RNAi construct against XRNB produced clean double strands (expressed from opposing bacterio- a dsRNA from a unique part of the gene, and caused clear phage T7 promoters) (see Materials and Methods). All and specific down-regulation of XRNB RNA with no effects plasmids were transfected into both bloodstream and on XRNA, XRNC, or XRND expression (Fig. 2A and data procyclic trypanosomes. The effectiveness of the RNAi not shown; the slight increase in XRNA visible in this blot was assessed either by Western blotting with anti-peptide was not reproducible). XRNB RNAi had no effect on either antibodies (XRNA, XRNC, XRND), or by Northern blot- bloodstream or procyclic trypanosome growth (data not ting (XRNB). shown; Fig. 3). Down-regulation of XRNA was achieved by expressing a The XRND and XRNC RNAi lines showed specific down- dsRNA corresponding to a part of the gene that is unrelated regulation of the 100-kDa XRND and 95-kDa XRNC to the other three XRN coding regions. The predicted size of proteins, respectively (Fig. 2B). XRND was threefold less XRNA is 158 kDa. Our anti-XRNA-peptide antibody recog- abundant in bloodstream forms than in procyclics (Fig. 2B). nized several bands. A band that migrated in SDS gels above It is intriguing that, although the XRND RNAi fragment had the 180-kDa marker was reduced in abundance upon RNAi 62% identity with XRNA over 282 nt, no off-target effects induction (Fig. 2A). Quantitation of the RNAi effect was were seen. We have so far been unable to obtain bloodstream difficult due to the proximity of a neighboring cross-reacting trypanosomes showing down-regulation of either XRNC or band, but the level of XRNA appeared to have been reduced XRND. Down-regulation of XRND inhibited procyclic try- by z80%. The RNAi had no effect on expression of the panosome growth (Fig. 3) whereas the XRNC RNAi had no other XRNs (Fig. 2A–C). Growth of both bloodstream and effect (not shown). procyclic trypanosomes was inhibited by XRNA down- So far the results indicated that XRNA and XRND were regulation (Fig. 3). essential for trypanosome growth and that all four putative Two different RNAi constructs were made for XRNB. exonucleases were expressed in trypanosomes. One, a stem–loop containing 59 sequences, had 65% identity with XRNA over 222 nt, including one contiguous stretch of 20 nt. We have designated this construct ‘‘XRNA/ Subcellular distribution of XRNs B’’ in this article because a bloodstream cell line containing this construct showed a clear reduction in XRNA protein To determine the subcellular localization of the XRNs, we (Fig. 2A). It had previously been reported that a sequence examined their distributions in nuclear and cytoplasmic identity between the dsRNA and the target in excess of 80% fractions after NP40 lysis of the parasites (Fig. 4). To detect is needed in order to get efficient RNAi in trypanosomes XRNB we used cell lines in which a sequence encoding a V5 (Durand-Dubief et al. 2003); our result therefore suggests tag had been introduced at the 59 end of the gene by that much lower identities can be problematic. Strangely, homologous recombination. Antibodies to a cytosolic the amount of XRNB mRNA reproducibly appeared to be marker protein (Guerra-Giraldez et al. 2002) and to two slightly increased upon induction of the XRNA/B dsRNA related RNA-binding proteins, p34/p37, which were hairpin (Fig. 2A). Similar effects have been seen for other described as predominantly nuclear (Zhang et al. 1998), RNAi lines in which the protein level was clearly reduced served as controls. In our hands, the ‘‘nuclear’’ marker was (Hendriks et al. 2003); this could be due to inhibition of always partially in the cytoplasmic fraction; we do not translation, but the mechanism has not been investigated. know if this truly reflects the localization or if proteins had Since we have no satisfactory antibody to XRNB, we could leaked from the nuclei during fractionation. XRND was not test the down-regulation of the XRNB protein. The exclusively in the nuclear fraction (Fig. 4C), and XRNC

4 RNA, Vol. 12, No. 12 JOBNAME: RNA 12#12 PAGE: 5 OUTPUT: Friday October 27 16:36:09 2006 csh/RNA/125784/rna2915

Downloaded from rnajournal.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press

Trypanosoma brucei 59/39 exoribonuclease

TABLE 2. Plasmids used in this work

Plasmid pHD no. Details

pHD 1077 XRND Expression in E. coli: ORF in peT3a, with his tag pHD 1078 tetracycline-inducible RAT1, Hyg. in pHD 678 pHD 1079 XRND KO construct, blasticidin resistance. 59UTR amplified with CZ1172(GGGCGGCCGCCCAACATTCTGATTGCTTACGTGC) and CZ1173(GGCTGGAGCCTTTGCCTTACGTACGCACACC) 39 UTR with CZ1192(CCACACTAATCTTGCCACTG) and CZ1202(TCAGTGGCAAGATTAGTGTG) pHD 1080 XRND KO construct—neomycin resistance. pHD1120 pHD 1060 with Gim 5B N = term myc tag. pHD1144 Bluscript with SL stuffer fragment. pHD1145 pHD677 without T7 promoter. Inducible EP1 promoter, insertion into ribosomal spacer, hyg resistance. pHD1146 pHD678 without T7 promoter. Inducible EP1 promoter, insertion into ribosomal spacer, hyg resistance. pHD1222 pHD1145 + XRNA sense-stuffer-antisense fragment, nt 18–450 amplified with CZ1481(AGGAAGATCTGCATGCCTTTCGATGGGTAGCGGAGC) and CZ1482 (GTGAATTCGTCGACATCTTCATCATGATAAAG) pHD1223 pHD1145 + XRNB sense-stuffer-antisense fragment, nt 8–575 amplified with CZ1483(AGGAAGATCTGCATGCTGCCAAAGTTCGCCTCTTGG) and CZ1484(GTGAATTCGTCGACCATAATTCAATCATCTGTGCTCC) pHD1224 pHD1145 + XRNC sense-stuffer-antisense fragment, nt26–631 amplified with CZ1508(AGGAAGATCTGCATGCGGTTAAGGCGACGGTTTGCGGC) and CZ1509(GTGAATTCGTCGACGCTTGGTTGCGAGCGAAAGC) pHD1235 pHD 1144+ XRND sense PCR product, nt 261–876 amplified with CZ1521(GAGAAGATCTGCATGCTAAGGTGGTGAGGCCACGGAAATGC) and CZ1522(CGGAATTCGTCGACGACACGCTCGAAACTCATC) pHD1236 pHD 1135 + CZ1521/1522-PCR product (antisense) pHD1237 pHD 1145 + stem–loop insert from 1236 pHD1238 pHD 1146 XRND sense-stuffer-antisense fragment RNAi for RAT1/XRND, Blasticidin resistance pHD 1343 pHD1413–EPI+G30 UTR from pHD 921. SpRRNA-PT7-CAT-G30-EP139-PAC pHD 1344 pHD1413–Act 39 UTR from pHD 1034. SpRRNA-PT7-CAT-ACT’-PAC pHD 1532 XRNA RNAi construct in p2T7, 488 bp cloned with CZ2510 CTCGAGCCAACGTACGGGAACTAAA and CZ2511 GGATCCAATTGCGAGACGAAGCATA pHD 1610 1344 with G-CAT-EP1 of 874, 766–2167 pHD 1681 XRNB RNAi construct in p2T7, 567 bp cloned with CZ2512 TTGGAGTACCCGTGTGTGAA and CZ2513 TGATTTCATGAGGCCCTTTC

and V5-tagged XRNB were reproducibly cytoplasmic also unsuccessful: Either the tag was inaccessible in fixed (Fig. 4A,B). Results for XRNA were difficult to interpret. cells or the abundances of the proteins were too low for Its distribution was always similar to that of the p34/p37 detection. marker (Fig. 4A,B); partially nuclear, partially cytoplasmic. This result was problematic for two reasons. First, we are not absolutely certain that the p34/p37 marker is exclusively nuclear. Second, XRNA was very sus- ceptible to proteolysis, which could FIGURE 1. Diagrammatic representation of T. brucei XRN exonuclease domain structures. The have affected the results. regions shown correspond to residues 1–671 of XRNA, 1–784 (XRNB), 1–557 (XRNC), and 1–600 We next attempted to confirm (XRND). The lengths of the C-terminal domains not included in the figure are indicated on the right. The 59-39 exonuclease domain PF03159.7 was identified as follows: XRNA: 4e-130 (residues these results by immunofluorescent 1–229); XRNB: 1.1e-77 (residues 1–327); XRNC: 5e-38 (residues 1–245); XRND: 9.3e-104 staining. None of the anti-XRN (residues 1–251). XRNB has predicted zinc finger (SM00547 8.3e-09) from residues 976–1000. antibodies gave detectable signals, The conserved 59/39 exonuclease sequences are represented as black bars. Insertions that are and staining of cells expressing unique to the individual proteins are shown with vertical stripes (XRNA), white (XRND), horizontal stripes (XRNB), or cross-hatches (XRNC). The XRNC sequence diverges considerably V5-tagged XRNB, XRNA, and after residue 470, despite isolated 4–8-residue zones of conservation, so the C-terminal segment is XRNC with anti-V5 antibody was shown in dark gray. The other Kinetoplastid sequences showed similar organization.

www.rnajournal.org 5 JOBNAME: RNA 12#12 PAGE: 6 OUTPUT: Friday October 27 16:36:12 2006 csh/RNA/125784/rna2915

Downloaded from rnajournal.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press

Li et al.

FIGURE 2. (A) Effects of RNAi on XRNA and XRNB. Whole trypanosome lysates were analyzed by Western blotting using antisera to an XRNA peptide, with a cytosolic marker protein as control. Total trypanosome RNA was examined by Northern blotting with an XRNB probe, with the SRP RNA as control. The life-cycle stage is indicated as procyclic (PC) or bloodstream (BS). The RNA targeted by RNAi is indicated below the life- cycle stage. Cells were cultivated either without tetracycline (control, indicated as ‘‘À’’) or with tetracycline (‘‘+’’) to induce RNAi (1 d for bloodstream forms, 2 d for procyclics). The signals on the Western blots were quantitated by scanning densitometry and normalized to the CSM control. One of the signals on each blot was then arbitrarily chosen to represent 100% and all other signals were compared to that one. The rather high signal for the XRNA RNAi on the left may be a consequence of the proximity of the nonspecific band or by a smear on the blot. The signal on the XRNB Northern blot was too low for accurate quantitation. (B) Effect of RNAi on expression of XRNC and XRND. The figure shows Western blots of total lysates from different cultures, detected with anti-peptide antibodies and labeled as in ‘‘A.’’ The values in parentheses were affected by the anomalously low CSM signal, which was not consistent with very similar Ponceau red staining of protein in all lanes.

A nuclear role for XRND? exonucleolytic trimming which is abolished by an Xrn1D In yeast, Rat1p has a variety of roles in the processing of rat1-1 double mutation (Lee et al. 2003). Since XRND was stable RNAs and in quality control. Processing of snoRNAs nuclear, we tested two potential functions in the RNAi cells: in yeast involves endonucleolytic cleavage followed by 59 processing of the 5.8 S rRNA, and 59 trimming of several

6 RNA, Vol. 12, No. 12 JOBNAME: RNA 12#12 PAGE: 7 OUTPUT: Friday October 27 16:36:30 2006 csh/RNA/125784/rna2915

Downloaded from rnajournal.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press

Trypanosoma brucei 59/39 exoribonuclease

not, by themselves, change relative mRNA abundances or the rate of mRNA degradation in trypanosomes (see, for example, Haile et al. 2003). We now used cell lines with inducible RNAi against either XRNA alone or XRNA and XRNB (XRNA/B). We, and others, have previously measured the half-lives of trypanosome and Leishmania mRNAs after the inhibi- tion of transcription with Actinomycin D. For several mRNAs, including ACT, a variable transient rise in the mRNA abundance was observed before degradation started (see, for example, Wilson et al. 1993; Coulson et al. 1996; Hotz et al. 1997), making half-lives difficult to measure. One possible reason for this could be that after transcrip- tion inhibition, some precursor RNA remains and can be trans spliced. In order to avoid this complication we instead inhibited mRNA maturation using Sinefungin, which inhibits cap methylation. The trimethyl cap on the spliced leader RNA is essential for trans splicing (Ullu and Tschudi 1991), and the pool of capped spliced leader RNAs is exhausted within 5–10 min of addition of the inhibitor FIGURE 3. Effects of RNA interference targeting different XRN mRNAs on trypanosome growth. Transgenic trypanosomes contain- (McNally and Agabian 1992). Maturation of mRNAs is ing tetracycline-inducible RNAi constructs were grown with or then inhibited and decay of preexisting RNAs can be without tetracycline for the times indicated. Vertical lines indicate observed (Hotz et al. 1997; Webb et al. 2005). dilution of the cultures. (Black symbols and solid lines) cells without Figure 5A illustrates degradation of ACT mRNA after tetracycline, normal XRN levels; (open symbols and dotted lines) cells with tetracycline and induced RNAi. The nature of the targeted addition of Sinefungin to a bloodstream trypanosome cell transcript and the life-cycle stage are indicated above each graph. line with inducible down-regulation of XRNA. There are two ACT genes in the 427 strain (and 927 strain) genome, organized as a tandem repeat. For the 927 strain the expected sizes of mRNAs from these genes are 1.6 kb (upstream gene) small RNAs (see Materials and Methods). Although the and 1.5 kb (downstream gene). The ACT gene probe cells exhibited strong growth inhibition, no effects on the recognizes a major band at z1.7 kb (Ben Amar et al. tested RNAs were seen. It could be that XRND is not 1988; Fig. 5A). The minor bands at 2.2 kb and 0.7 kb could involved in the reactions. Alternatively, it may be that the be alternative processing products, or may originate from RNAs tested are not produced during growth arrest (see the T7 polymerase or lac repressor transgenes, which have Discussion). It is also possible that nuclear XRNA can ACT 39 UTRs; they will not be considered further here. partially take over the nuclear role of XRND. After Sinefungin addition, there was a lag of 5–15 min

Effects of depletion of XRNA on degradation of actin mRNA To assess the role of 59/39 exonuclease activity in mRNA decay, we first stud- ied the degradation of the actin (ACT) mRNA, for which we had previously measured a half-life of 20–30 min in bloodstream forms and 90 min in procyclic forms (Hotz et al. 1997; Irmer FIGURE 4. Subcellular fractionation results. Trypanosomes were lysed with NP40 and and Clayton 2001; Haile et al. 2003). fractions prepared as described by Zeiner et al. (2003). Aliquots representing equivalent numbers of cells were separated on SDS-polyacrylamide gels and the XRN proteins detected by We had previously found that depletion Western blotting. The p34/p37 proteins were used as a nuclear marker (Nuc), and the of the exosome in bloodstream forms cytoplasmic marker (Cyt) was CSM (see Materials and Methods). RNAi controls for the did not influence the ACT mRNA half- Westerns are also shown (labeled as in Fig. 2). (T) total lysate; (C) cytoplasmic fraction; (N) life (Haile et al. 2003) and that, in nuclear fraction. (A) Fractionation of procyclic trypanosomes, detection of XRNA and XRNC; nonspecific bands are indicated by *.(B) Fractionation of bloodstream trypanosomes general, addition of tetracycline and expressing V5-tagged XRNB, detection of XRNA and the V5 tag. (C) Fractionation of inhibition of trypanosome growth do procyclic trypanosomes, detection of XRND.

www.rnajournal.org 7 JOBNAME: RNA 12#12 PAGE: 8 OUTPUT: Friday October 27 16:36:35 2006 csh/RNA/125784/rna2915

Downloaded from rnajournal.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press

Li et al.

Although XRNA depletion had no reproducible effect on the abundance of ACT mRNA, the degradation rate after Sinefungin addition appeared to be slower (Fig. 5A). Similar results were obtained using the XRNA/B bloodstream-form cells (not shown): The half-life of ACT mRNA was z30 min in the absence of tetracycline and increased about twofold after XRNA/B down-regulation. In several experiments, the appearance of the putative aberrant splicing products was visibly delayed in the XRNA-depleted cells (Fig. 5A). The half-life of actin mRNA, as measured using Sine- fungin, was longer than that previously measured using Actinomycin D. Simple mathematical modeling results suggested that this could have been caused by incomplete (70%) splicing inhibition. We therefore repeated the experiments using a different protocol. We first added Sinefungin and waited for 5 min to allow depletion of spliced leader RNA and then added Actinomycin D to inhibit transcription. Using this protocol, degradation of ACT mRNA commenced immediately after Actinomycin D addition, with a half-life of z9 min. Notably, degradation now appeared to be unaffected by XRNA depletion. This result suggested that XRNA levels were not rate limiting for ACT mRNA degradation in the depleted cells. The ACT half-life shown here is shorter than previously measured by us and by others. Previous measurements were probably compromised by continuation of mRNA processing after transcription inhibition, coupled with a lack of computer- ized curve fitting to ensure that half-lives were measured FIGURE 5. Effect of XRNA depletion on actin (ACT) mRNA. (A) Trypanosomes with inducible RNAi targeting XRNA were treated only when decay was exponential. with 1 mg/mL Sinefungin; mRNA was prepared and analyzed by We also measured ACT mRNA degradation in procyclic Northern blotting. To induce XRNA RNAi (downward arrow), the forms using both the Sinefungin and Sinefungin-Actino- cells were treated with 100 ng/mL tetracycline for 24 h before mycin D protocols. Depletion of XRNA had no effect on Sinefungin addition. The 0 time point was take before Sinefungin addition and the 5-min time point was taken by centrifuging the cells either the steady-state level or degradation irrespective of immediately after Sinefungin addition. A typical blot is shown, with the protocol used. Using Sinefungin, the measured half- signal recognition particle (SRP) RNA as a loading control. The levels lives were z60 min with or without RNAi (not shown); of ACT mRNA were assessed using phosphorimaging. On the graph, z each series of symbols represents the result of one experiment, and half-lives of 22 min were seen using Sinefungin with different symbol shapes are used for different experiments. Filled Actinomycin D (Fig. 5C). Actin mRNA abundance and symbols show the amount of RNA in the absence of tetracycline, and degradation kinetics were also unaffected in the cell lines open symbols the amount in cells with XRNA depletion. The lines with RNAi against XRNB, XRNC, and XRND (not shown). were created by plotting the arithmetic means for each time point, then interpolating. (Solid line) without tetracycline (control); (dashed line) with tetracycline (XRNA depleted). The half-lives shown were estimated on the exponential part of the curve only, using Kaleido- Depletion of XRNA inhibits degradation of an graph. (B) Cells were incubated for 5 min with Sinefungin, then (at unstable reporter mRNA time = 0) 10 mg/mL Actinomycin D was added. Results are means and standard deviations for four experiments, three of which were done To assess the effects of XRNA depletion on decay of a very with the XRNA RNAi cells and one in cells with the XRNA/B RNAi unstable mRNA, we used cell lines expressing a CAT (which gave indistinguishable results). Open symbols are after RNAi. transgene bearing the 39 UTR of the EP1 transcript (Fig. (C) Degradation after Sinefungin and Actinomycin D treatment, 6). In order to be able to study the degradation of this RNA using procyclic trypanosomes; symbols as in A. in detail, it is necessary that it be produced at an abnormally high rate (Irmer and Clayton 2001). The trypanosomes we used express T7 RNA polymerase, which during which time the mRNA level remained approximately transcribes the transgene. The resulting mRNA precursor constant. Subsequently, ACT RNA was degraded with a half- has, at the 59 end, a polypyrimidine tract trans splicing life of z40 min. After z30 min we observed the appearance signal, and RNA is processed by 59 trans splicing of a capped of bands of z3.2 and 4.8 kb: These could be partially pro- 39-nt spliced leader and by polyadenylation (Irmer and cessed RNAs made by residual, inefficient splicing (Fig. 5A). Clayton 2001). We previously showed that overproduction

8 RNA, Vol. 12, No. 12 JOBNAME: RNA 12#12 PAGE: 9 OUTPUT: Friday October 27 16:36:40 2006 csh/RNA/125784/rna2915

Downloaded from rnajournal.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press

Trypanosoma brucei 59/39 exoribonuclease

reporters include G30 or G30C30 secondary structures, which slightly impede the progression of exonucleases but do not affect the overall half-life of the full-length tran- scripts (Irmer and Clayton 2001; Haile et al. 2003). The structures of the mRNAs and the potential degradation intermediate are shown in Figure 6A. In addition to the reporter RNA, the 39 UTR portion of the probe detected the mature EP mRNA, which is present at low levels in bloodstream trypanosomes. The steady-state levels of deg- radation intermediates should depend on the amount of mature mRNA, the rate of their creation from the full- length mRNA, the extent to which the stem–loop delays the exosome and 59/39 exonucleases, and on the activities of both enzyme types. The mRNA whose decay is illustrated in Figure 6B, G-CAT-EP, includes a G30 sequence between the CAT reporter and the 59 UTR. Figure 6B shows a typical Northern blot, with inhibition of mRNA synthesis using Sinefungin and Actinomycin D. The presence of the G30 sequence results in creation of a transient degradation intermediate with the G30 at the 59 end (Irmer and Clayton 2001; Haile et al. 2003), but this was not well resolved from the mature transcripts. The faint band at z900 nt is the EP mRNA, which did not hybridize with a probe including the CAT sequence alone (not shown). Sixty percent to 70% of the G-CAT-EP mRNA was degraded extremely rapidly, with a half-life of <5 min, while the remainder was degraded more slowly. These biphasic kinetics suggest the presence of two different degradation pathways. After XRNA depletion there was a three- to fourfold increase in the abundance of the G-CAT-EP mRNA (three experi- ments) and the initial, rapid phase of degradation was eliminated. The mRNA whose degradation is illustrated in Figure 6C FIGURE 6. Effect of XRNA depletion on CAT-GC-EP and G-CAT- has a G C sequence between the CAT reporter and the 39 EP mRNA degradation in bloodstream trypanosomes. Methodological 30 30 details and symbols are all as in Figure 5. The probe was a PCR UTR. The transgene directs production of a major mature fragment encompassing the CAT-EP reporter (without a GC tract); it mRNA (CAT-GC-EP) (Haile et al. 2003). The G30C30 loop contains the 59 UTR, the CAT gene, and the 39 UTR. (A) Structures of delays degradation by the exosome; the products of 39/59 the mRNAs detected in cells expressing CAT-EP mRNAs. The CAT degradation paused at G C produce a 0.85-kb band open reading frame is shown in black and the untranslated regions are 30 30 unfilled, except for the destabilizing U-rich tract, which is gray. The (CAT-GC), which hybridizes with a CAT probe but not an poly(A) tail is represented by ‘‘AA’’ and the G30 or G30C30 are EP 39 UTR probe (Figs. 6A, 8; Haile et al. 2003). This RNA indicated as tangled loops. (B) Degradation of G-CAT-EP mRNA after comigrates with the EP mRNA (Figs. 6D, 8). The products addition of Sinefungin and Actinomycin D. (C) Degradation of CAT- of 59/39 degradation (GC-EP) (Irmer and Clayton 2001; GC-EP mRNA after addition of Sinefungin and Actinomycin D. Haile et al. 2003) are predicted to be 300-nt long without poly(A) or longer with poly(A). Figure 6C shows the effects of this mRNA by T7 polymerase did not affect its of addition of Sinefungin and Actinomycin D to cells degradation rate (Irmer and Clayton 2001). expressing the CAT-GC-EP mRNA. CAT-GC-EP mRNA Experiments using Actinomycin D alone previously showed the same degradation kinetics as the G-CAT-EP showed that CAT-EP1 transcripts have half-lives of 5–10 mRNA: An initial, very rapid decrease (half-life 6–7 min) min in bloodstream forms (Hotz et al. 1997; Irmer and followed by a slower phase. The other species were Clayton 2001; Haile et al. 2003); depletion of the exosome degraded with half-lives of 19–26 min (CAT-GC & EP) caused a slight delay in the initiation of degradation (Haile and 17–20 min (GC-EP). et al. 2003). Figure 6 illustrates the degradation of two XRNA down-regulation caused a 1.5-fold increase in the different CAT-EP reporter mRNAs, detected with a probe steady-state amount of the CAT-GC-EP1 mRNA (mean of encompassing both the CAT gene and the EP 39 UTR. The eight experiments). As for G-CAT-EP, the initial phase of

www.rnajournal.org 9 JOBNAME: RNA 12#12 PAGE: 10 OUTPUT: Friday October 27 16:36:46 2006 csh/RNA/125784/rna2915

Downloaded from rnajournal.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press

Li et al.

very rapid degradation of CAT-GC-EP1 mRNA was elim- abundances of stable mRNAs were, in contrast, unchanged inated, resulting in exponential decay with a half-life of 11– by RNAi against XRNA. Half-life analyses have confirmed 14 min (Fig. 6C). The combined CAT-GC and EP band was that XRNA depletion decreased PGKB mRNA degradation also more stable. We had expected that the abundance of in bloodstream forms (C. Colasante, A. Robles, C.-H. Li, the GC-EP intermediate might be decreased after 59/39 A. Schwede, C. Benz, F. Vancken, D.L. Guilbride, C. Clayton, exonuclease depletion. Upon first glance, the abundance in prep.). We conclude that 59/39 exonuclease activity and stability of the GC-EP intermediate appeared to is important in the degradation of unstable mRNAs in increase instead, with a greatly prolonged half-life. In fact, T. brucei, and that the protein that is mainly responsible however, the results for this portion of the gel were is XRNA. impossible to interpret due to the presence of a smear of—presumably heterogenous—degradation products Effect of XRNA depletion on poly(A) tail lengths extending below the CAT-GC band. Overall these results suggested that the amount of XRNA If 59/39 degradation in trypanosomes is triggered by was rate limiting for the rapid degradation of the CAT-EP deadenylation, one might expect XRNA depletion to stabi- transcript. lize deadenylated mRNAs, as is seen in yeast (Hsu and Stevens 1993). To test this, we examined mRNAs encoding histone H4 (HISH4). There are 10 copies of the HISH4 gene XRNA depletion disrupts developmental regulation of arranged in a tandem repeat in the sequenced trypanosome gene expression genome. HISH4 expressed sequenced tags are trans spliced The results so far had suggested that XRNA was implicated and polyadenylated to give a predicted mRNA size of z570 in the degradation of mRNA precursors and of highly nt without the poly(A). There was a clear difference in unstable mRNAs with an EP1 39 UTR. We next wished to migration between the polyadenylated HISH4 mRNA and find out if the depletion of XRNA affected other mRNAs. the deadenylated transcript [incubation with RNase H in the In bloodstream forms, the PGKC mRNA is very stable presence of oligo d(T)] (Fig. 8A, cf. lanes 1,2 and 5,6). (half-life 1 h) (C. Colasante, A. Robles, C.-H. Li, A. Schwede, Depletion of XRNA caused a broadening of the HISH4 C. Benz, F. Voncken, D.L. Guilbride, C. Clayton, in prep.) mRNA band and a decrease in average length (Fig. 8A, cf. and the PGKB mRNA is unstable (half-life 5–10 min) lanes 2,3 and 6,7). After RNase H digestion in the presence (Quijada et al. 2002; Haile et al. 2003). In procyclic forms, of oligo d(T), the RNAs were the same length whether or PGKC mRNA is unstable and undetectable, whereas PGKB not XRNA was depleted (Fig. 8A, cf. lanes 1,4 and 5,8). This mRNA is stable (C. Colasante, A. Robles, C.-H. Li, A. showed that the decrease in average migration after XRNA Schwede, C. Benz, F. Voncken, D.L. Guilbride, C. Clayton, depletion was due to a difference in poly(A) tail length. in prep.). The mRNA encoding the amino acid transporter Thirty minutes (Fig. 8A, lanes 9,10) and 60 min (Fig. 8A, AAT11 is up-regulated in procyclic forms (Brems et al. lanes 12,13) after inhibition of mRNA synthesis using 2005) and is regulated by mRNA degradation (A. Robles, Actinomycin D, the average poly(A) tail lengths of HISH4 unpubl. results). The effects of depletion of the various mRNAs were similar whether or not XRNA was depleted, XRNs on these mRNAs are illustrated in Figure 7A. RNAi but the mRNAs were clearly not fully deadenylated (Fig. 8A, against XRNB, XRNC, or XRND had no effect. XRNA cf. lanes 10,11 and 13,14). XRNA depletion did not affect the depletion, in contrast, resulted in the appearance of PGKC HISH4 half-life, which is z60 min (A. Schwede, unpubl.). mRNA in procyclic forms; in bloodstream forms, PGKB We also examined the polyadenylation status of CAT- and AAT11 mRNA both increased by about twofold. The GC-EP mRNA. The pattern was similar to that seen for HISH4 in that the mRNA seemed to be partially dead- enylated, in XRNA-depleted cells (Fig. 8A). As before, the initial phase of CAT-GC-EP mRNA degradation was delayed by XRNA depletion. To analyze the effects of XRNA depletion on polyade- nylation in more detail, we selected polyadenylated RNAs on oligo d(T) cellulose. Figure 8B shows a typical blot after hybridization with several probes. The uppermost panel was hybridized with an EP 39 UTR probe, which detected FIGURE 7. Depletion of XRNA increases the steady-state abundances CAT-GC-EP mRNA, EP mRNA, and the GC-EP degrada- of other unstable mRNAs. RNAi against XRNA, XRNB, XRNC, or tion intermediate (Fig. 8B, lane 1). The CAT-GC-EP mRNA XRND was induced for 1 d (bloodstream) or 2 d (procyclics), and and EP mRNA were predominantly polyadenylated (Fig. RNA was prepared and analyzed by Northern blotting using various 8B, lanes 2,3). Two bands of the GC-EP degradation probes. The PGK open reading frame probe hybridizes with the PGKA, PGKB, and PGKC mRNAs; AAT11 an amino acid transporter mRNA intermediate were resolved; the upper band was polyade- up-regulated in procyclics. SRP loading controls are also shown. nylated (Fig. 8B, lane 3) whereas the shortest GC-EP species

10 RNA, Vol. 12, No. 12 JOBNAME: RNA 12#12 PAGE: 11 OUTPUT: Friday October 27 16:36:47 2006 csh/RNA/125784/rna2915

Downloaded from rnajournal.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press

Trypanosoma brucei 59/39 exoribonuclease

failed to bind to oligo d(T) (Fig. 8B, lane 2). This result suggests that some of the CAT-GC-EP mRNA is degraded without prior deadenylation. The second panel shows rehybridization (after stripping) with a CAT probe: This detected the CAT-GC-EP mRNA (Fig. 8B, lane 1) and the CAT-GC intermediate, which, as expected, did not bind to oligo d(T) (Fig. 8B, lane 2). In the XRNA-depleted cells, some deadenylated CAT-GC-EP RNA was detected (Fig. 8B, lane 5). After 30 min Actinomycin D treatment, most of the CAT-GC-EP RNA was sufficiently deadenylated to no longer bind to oligo d(T) (Fig. 8B, lanes 8,11). In the XRNA-depleted cells, degradation of the deadenylated mRNA was delayed (Fig. 8B, lane 11). As controls, we also examined the polyadenylation status of GPIPLC and HISH4 mRNAs. Depletion of XRNA caused a clear increase in the level of deadenylated GPIPLC mRNA (Fig. 8B, cf. lanes 2 and 5). The HISH4 pattern showed that the selection was efficient, since all full-length HISH4 mRNA was found in the poly(A)+ fraction (Fig. 8B, lanes 3,6,9,12); a faster migrating smear—presumably of degrad- ing deadenylated mRNA—was seen in the XRNA-depleted cells (Fig. 8B, lanes 5,11). These results showed that XRNA is important in the degradation of deadenylated mRNAs in trypanosomes, and that the CAT-EP reporter transcript was subject to two independent degradation pathways, one of which was independent of deadenylation and dependent on XRNA.

DISCUSSION The genomes of Kinetoplastid protists contain four genes encoding homologs of the yeast 59/39 exonucleases Xrn1p and Rat1p. We have shown here that two of the encoded proteins are essential for normal trypanosome growth and that XRNA plays a role in mRNA degradation. FIGURE 8. Effect of XRNA results on poly(A) tail lengths. Tran- XRND is a nuclear protein, and down-regulation of its scription was inhibited using Actinomycin D (added at time 0). (A) expression was lethal. We do not know which vital The deadenylated transcript was made by incubating the RNA with oligo d(T) and RNase H (Irmer and Clayton 2001). RNA was functions were defective in the XRND RNAi cells. Assays examined by Northern blotting using probes for HISH4, PGK, and of snRNA and 5.8S rRNA 59 processing revealed no defects, CAT. The trypanosome genome sequence shows 10 genes encoding but many other roles are possible. It is also important here histone H4 arranged as tandem repeats (Tb927.4.4170–4260) with to recognize the limitations of RNAi in demonstration of identical 300-bp coding regions. The intergenic regions downstream of the first nine genes are also identical. Histone H4 mRNA cDNAs in gene function. First, RNA interference does not completely the EMBL database have three different trans splicing acceptor sites eliminate the target protein from cells, so that processes spanning a region of 24 nt, and one polyadenylation site giving a 188-nt that can proceed normally at the reduced enzyme level will z 39 UTR, resulting in predicted mRNA lengths of 570 nt without be unaffected. Second, a defect in a process may not be poly(A); the band shown migrates z600 nt. The amounts of CAT-EP transcript were quantitated and expressed as a percentage of the visible when growth of the cells is reduced. For example, amount present at time = 0; the amounts for the cells with and ribosomal RNA synthesis is closely coupled to cell growth without tetracycline were assessed separately. (B) Northern blot in yeast and mammalian cells (see, for example, Warner showing 10 mg total RNA (T), and the poly(A)- and poly(A)+ 1999; Grummt 2003), and RNA synthesis is known to be fractions from 20 mg total RNA. RNA was prepared from the XRNA RNAi cell line expressing CAT-GC-EP mRNA, incubated with or repressed in stationary-phase trypanosomes (Pays et al. without tetracycline for 1 d, before and 30 min after Actinomycin D 1993). If synthesis of an RNA is not occurring, defects in its treatment. The blot was hybridized with probes for the EP 39-UTR, processing will not be seen. Although XRNA appeared to be GPIPLC, CAT, and HISH4 with or without intermediate stripping as at least partially localized to the nucleus, it clearly could not required. The ethidium bromide stain detecting rRNA is also shown. Probes are indicated in bold italics on the right, together with size complement the XRND defect. It may be that the specific- indicators, and detected RNAs are shown on the left. ities of XRND and XRNA do not overlap sufficiently to

www.rnajournal.org 11 JOBNAME: RNA 12#12 PAGE: 12 OUTPUT: Friday October 27 16:36:54 2006 csh/RNA/125784/rna2915

Downloaded from rnajournal.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press

Li et al.

permit complementation; alternatively, it may be that the scription and by including secondary structures in reporter nuclear activity of XRNA is not high enough to compensate RNAs (as in this study) (Irmer and Clayton 2001). We also for XRND down-regulation. Roles for the two proteins in assessed the effects of depleting the exosome (Haile et al. polyadenylation-coupled transcription termination are im- 2003). The results suggested that in bloodstream trypano- probable, since polyadenylation is not linked to termina- somes, degradation of ACT mRNA occurs through the tion in trypanosomes and genes encoding the three action of both 59/39 and 39/59 exonucleases, but that proteins required for the linkage of Rat1p to the poly- exosome activity was not rate limiting. In contrast, the adenylation machinery in yeast—Pcf11p, Rna14p, and rapid degradation of various highly unstable reporter Rna15p (Luo et al. 2006)—are not detectable in the mRNAs was initiated by destruction of the 39 end (Irmer trypanosome genome. and Clayton 2001), and exosome depletion delayed degra- Two of the predicted exonucleases, XRNB and XRNC, dation (Haile et al. 2003). The abundances of the CAT-EP, were found to be exclusively cytoplasmic. Down-regulation AAT11, PGKB, and PGKC transcripts are controlled by of their expression had no detectable effects on cell growth sequences in their 39 UTRs, which affect degradation, not or mRNA degradation. Since the genes are conserved in all processing (Hug et al. 1993; Blattner and Clayton 1995; three sequenced Kinetoplastid genomes, the proteins are Quijada et al. 2002; A. Robles and C. Colasante, unpubl.) unlikely to be functionless. XRNB is particularly intriguing and in each case, developmental regulation was disrupted because it has a zinc finger domain at the C terminus. It by depletion of XRNA. Although affects on splicing cannot may be that the RNAi was insufficiently effective or that be entirely ruled out, it is probable that in all of these cases XRNB and XRNC are functionally redundant. Alternatively XRNA depletion specifically affected the very rapid degra- they may play roles during differentiation or in experi- dation pathway. mentally poorly accessible life-cycle stages in the Tsetse fly; Our results suggest that trypanosomes have at least two this would not have been detected in our experiments with different mRNA degradation pathways. The pathway used laboratory-adapted, differentiation-incompetent trypano- to degrade mRNAs, which does not show developmental somes. To analyze these questions further it will be regulation (such as ACT and HISH4), and to degrade stable necessary to work with differentiation-competent cells mRNAs such as PGKC was unaffected by depletion of and to use alternative methods to decrease or eliminate XRNA (this article) or the exosome (Haile et al. 2003). This XRNB and XRNC activity. does not mean that the exosome and XRNA are not XRNA is the closest homolog of yeast and human Xrn1p involved, but it does mean that neither activity was in trypanosomes. The results of cell fractionation experi- sufficiently reduced after RNAi to become rate limiting. It ments suggested that XRNA was present in both the is therefore likely that another step, such as deadenylation, cytoplasm and the nucleus. To analyze XRNA function exerts more control over this degradation pathway. Pre- we analyzed degradation of the ACT mRNA after inhibition liminary results from RNA interference depletion of dead- of both trans splicing and transcription. The results enylases so far support this idea (A. Schwede, unpubl.). In suggested that after depletion of XRNA by RNAi, XRNA contrast, developmentally down-regulated mRNAs appear levels were not rate limiting for ACT mRNA degradation. to be rapidly destroyed by a second degradation pathway When, however, only trans splicing was inhibited, XRNA that is delayed after down-regulation of XRNA (this article) depletion resulted in an apparent increase in the ACT or the exosome (Haile et al. 2003). Our previous results had mRNA half-life. A possible explanation for this could be suggested that this pathway did not involve a deadenylated that there is competition in the nucleus between mRNA intermediate (Irmer and Clayton 2001; Haile et al. 2003). In processing and precursor degradation. If this were the case, this article, we have been able to demonstrate that rapidly and XRNA were involved in mRNA precursor degradation, degraded reporter mRNAs with an EP 39 UTR are subject XRNA depletion could increase the efficiency of splicing. to two degradation pathways. The rapid pathway, giving An involvement of XRNA in degradation of mRNA a half-life of z5 min, affects z70% of the mRNA and precursors in the nucleus would be consistent with results depends on XRNA; it may be that this pathway does not from yeast, which have shown that xrn1 mutations can require deadenylation. The remaining 30% of the RNA is affect not only nuclear rRNA and snoRNA processing apparently subjected to the default pathway initiated by (Petfalski et al. 1998) but also the degradation of RNA deadenylation. polymerase II primary transcripts downstream of the In yeast, deletion of the XRN1 gene does not affect the polyadenylation site (Luo et al. 2006). Further investigation degradation of stable mRNA (Muhlrad et al. 1995), but of this subject will require a detailed quantitative analysis of unstable mRNA accumulates in deadenylated form (Muhlrad in vivo mRNA processing kinetics, which is outside the et al. 1994). In mammalian cells also, siRNA-mediated scope of the current study. depletion of the exosome, Xrn1, or the decapping complex In previous experiments, we analyzed the pathways of component Dcp1a delayed the degradation of unstable ACT and CAT-EP mRNA degradation in trypanosomes by mRNAs containing AU-rich elements in their 39 UTRs site-specific cleavage of mRNAs after inhibition of tran- (Stoecklin et al. 2005), but in contrast to yeast, deadenylated

12 RNA, Vol. 12, No. 12 JOBNAME: RNA 12#12 PAGE: 13 OUTPUT: Friday October 27 16:36:55 2006 csh/RNA/125784/rna2915

Downloaded from rnajournal.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press

Trypanosoma brucei 59/39 exoribonuclease

intermediates did not accumulate. The authors therefore To assess the effects of RNA interference on cell growth, suggested that either deadenylation and the subsequent steps parasites were diluted to 1 3 105 to 4 3 105 cells/mL and allowed 6 were very tightly coupled or the degradation was dead- to grow to maximum densities of 2 3 10 cells/mL (bloodstream 6 enylation independent. Our current results for the rapid form) or 5 3 10 cells/mL (procyclic form) before redilution. degradation pathway in trypanosomes are similar to those RNA degradation assays were done 24 h after tetracycline (100 ng/ mL) addition to bloodstream forms and 48 h for procyclic forms. already obtained for ARE-mediated degradation, suggesting that the mechanisms may be more similar to those in mammals than to yeast. Plasmid construction It has been repeatedly shown that the trypanosome rapid The XRN genes were initially identified from genomic sequence degradation pathway—but not the constitutive path- tags, and the sequences were completed from P1 clones (kindly way—is dependent upon ongoing translation activity sent by S. Melville, University of Cambridge). All sequences used (Dorn et al. 1991; Graham and Barry 1996) although the for this article are from the completed TREU 927 trypanosome RNA target itself does not have to be translated (Webb et al. genome, with the exception of the XRNB, whose sequence is taken 2005). Results from both mammalian cells and yeast from that of the Lister 427 strain. Oligonucleotides were synthe- indicate that mRNA degradation is localized within the sized by Sigma Ark Scientific or MWG, and DNA sequences were cytoplasm in discrete loci called ‘‘P bodies’’ (Stoecklin et al. obtained from Medigenomix. Details of plasmid constructs are shown in Table 2. For RNA 2005) containing Lsm proteins, the decapping enzyme interference, we initially used sequences of z500 bp, which were complex, and Xrn1p, but not the exosome (Bashkirov determined through Blast searching of available data to be gene et al. 1997; Ingelfinger et al. 2002; Sheth and Parker 2003; specific. The fragments were PCR amplified from the genome and Cougot et al. 2004). P-body assembly is inhibited by inserted twice, in opposite orientations, on either side of cycloheximide but enhanced by puromycin treatment, a ‘‘stuffer’’ fragment from the spliced leader array (Ngo et al. and P bodies may be a final destination for nonpolysomal 1998; Shi et al. 2000). This ‘‘stem–loop’’ was then cloned into a RNAs. So far we have no clear marker for P bodies in vector with a tetracycline-inducible procyclin promoter (Biebinger trypanosomes, but it is tempting to speculate that the very et al. 1997); for more detail see Clayton et al. (2005). These rapid destruction of developmentally down-regulated constructs were used for XRNA/B, XRNDC, and XRND; trans- mRNAs may be caused by recruitment to degradation fected cell lines were obtained but no RNAi was seen for such complexes immediately following export from the nucleus. constructs against XRNA and XRNB. Later constructs were designed for synthesis of double-stranded RNA in trypanosomes expressing T7 polymerase, using constructs with opposing tetra- MATERIALS AND METHODS cycline-inducible T7 promoters (Alibu et al. 2004). For these constructs RNAi fragments were designed using the RNAit pro- Trypanosome culture and transfection gram (Redmond et al. 2003). For in situ epitope tagging of the XRNB open reading frame, we The trypanosomes used were bloodstream and procyclic forms of used the plasmid containing the V5 tag and Blasticidin selectable the Lister 427 strain. Cells were grown in liquid culture at 37°C marker sequence that is described in Shen et al. (2001). We cloned (bloodstream forms) or 30°C (procyclic forms) as described in van 300 bp of the target open reading frame in frame with, and Deursen et al. (2001). RNA interference experiments with stem– downstream of, the tag sequence, and inserted a 300-bp fragment loop constructs targeting XRNA, XRNC,andXRND in procyclic from directly 59 to the target gene at the 59 end of the construct, trypanosomes were done using cells containing integrated plasmid upstream of the selectable marker. The cassette was then excised pHD449, which encodes the Tn10 tet repressor and confers using unique restriction sites at the boundaries of the 59- and open- resistance to phleomycin (Biebinger et al. 1997). Experiments reading-frame fragments and transfected into trypanosomes. targeting XRNA and XRNB using constructs with opposing T7 promoters were done using cells that also constitutively express Antibodies and protein detection bacteriophage T7 polymerase (Haile et al. 2003; Alibu et al. 2004). Transfection by electroporation, drug selection, and induction of Guinea pigs were immunized with the following peptides, coupled RNA interference were done as described in Clayton et al. (2005). to KLH: XRNA: QESRRAREQREQDESDGIVADKSYQC; XRNB: To measure mRNA half-lives, cell samples were taken at various DYESTHENRYVESNQVADDVFGHRGC; XRNC: RRQDPHSH times after treatment with 1 mg/mL Sinefungin, which inhibits cap VRTTEWDSNSISC; XRND: CEDYRDKYYQKKFGWDPEKRSK. methylation and thereby rapidly prevents mRNA maturation Other antibodies were mouse anti-V5 tag (Invitrogen, lot no. through trans splicing (McNally and Agabian 1992; Ullu et al. 1,278,034) and rabbit antibodies to aldolase (Clayton 1987), the 1993; Haile et al. 2003; Webb et al. 2005). Treated cells survive CSM marker (Guerra-Giraldez et al. 2002), and the predomi- with normal motility for at least 6 h. Samples of at least 2 3 107 nantly nuclear proteins p34 and p37 (Zhang et al. 1998). Western cells in 10 mL medium were sedimented at 2300g for 3 min and blotting was done using ECL detection (Amersham Bioscience) resuspended in Trizol, followed by RNA isolation. The duration of according to the manufacturer’s instructions. His-tagged XRND inhibition was taken as the interval between Sinefungin addition protein was expressed in Escherichia coli by cloning into pET3A and Trizol addition to the cell pellet. In some experiments, and was purified by nickel affinity chromatography; the purity was Actinomycin D (final 10 mg/mL) was added either alone or 5 unfortunately not sufficient for RNase activity assays to give min after the Sinefungin. unambiguous results.

www.rnajournal.org 13 JOBNAME: RNA 12#12 PAGE: 14 OUTPUT: Friday October 27 16:36:55 2006 csh/RNA/125784/rna2915

Downloaded from rnajournal.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press

Li et al.

Separation of nuclei and cytoplasm was effected using an NP40 RNAi constructs and conducted initial characterization of relevant lysis procedure as described in Zeiner et al. (2003). In an attempt cell lines and anti-peptide antibodies. H.S. finished the XRND to reduce nuclear leakage during fractionation, we tried analyzing sequence, made inducible and knockout constructs, expressed the the nuclear and cytoplasmic fractions of cells resuspended in protein in E. coli, and characterized the anti-peptide antiserum; isotonic sucrose and broken by grinding in silicon carbide D.G.-P. made the XRND RNAi plasmid and generated cell lines. (Clayton 1987), but the resulting fractions were severely cross- A.M.E. supervised H.S. and D.G.-P., and S.H. initially supervised contaminated. C.-H.L. We thank Angela Schwede (ZMBH) for plasmid pHD 1610. C.-H.L. made the remaining RNAi and overexpressing lines and did the in situ tagging, cell fractionation, and RNA processing DNA and RNA analysis and decay analysis; he produced the data for all the figures shown Plasmid DNA was purified using NucleoSpin columns (Macherey- in this article. We thank Claudia Colasante (ZMBH) for help with Nagel) and RNA was purified using Trizol (Peqlab) according to the silicon carbide fractionation. C.C. supervised the work and the manufacturer’s instructions. Polyadenylated RNA was selected wrote the article. by incubating 15–20 mg total RNA with 10 mg oligo d(T) sepharose in RNA binding buffer (20 mM HEPES at pH 7.4, 5 Received September 4, 2006; accepted September 21, 2006. mM EDTA at pH 7.4, 500 mM NaCl, 0.4% SDS) for 10 min at room temperature. The beads were separated by centrifugation and the supernatant saved as the poly(A) fraction. After three REFERENCES washes with RNA washing buffer (20 mM HEPES at pH 7.4, 5 Alibu, P., Storm, L., Haile, S., Clayton, C., and Horn, D. 2004. A mM EDTA at pH 7.4, 0.5% SDS), the poly(A)+RNA was eluted doubly inducible system for RNA interference and rapid RNAi with DEPC-treated water. plasmid construction in Trypanosoma brucei. Mol. Biochem. Para- Levels of mRNAs were assessed by formaldehyde gel electro- sitol. 139: 75–82. phoresis, followed by blotting onto Nytran membranes and Amberg, D.C., Goldstein, L.A., and Cole, C.N. 1992. Isolation and characterization of RAT1: An essential gene of Saccharomyces hybridization with radioactive probes. Signals were measured cerevisiae required for the efficient nucleocytoplasmic trafficking using a PhosphorImager. Northern blots were stripped by brief of mRNA. Genes & Dev. 6: 1173–1189. boiling in 0.5% SDS, the efficacy of stripping was assessed by the Anderson, J.S. and Parker, R.P. 1998. The 39 to 59 degradation of yeast PhosphorImager, and any residual signals were left to decay as mRNAs is a general mechanism for mRNA turnover that requires necessary before reuse. All mRNA signals were normalized relative the SKI2 DEVH box protein and 39 to 59 exonucleases of the to the signal from a signal recognition particle (SRP) probe. The exosome complex. EMBO J. 17: 1497–1506. Arraiano, C.M. and Maquat, L.E. 2003. Post-transcriptional control of half-lives were measured by plotting relative signal intensities gene expression: Effectors of mRNA decay. Mol. Microbiol. 49: using Kaleidograph (Synergy software), including only the seg- 267–276. ments of the time course that gave exponential decay curves (fit- Bashkirov, V.I., Solinger, J.A., and Heyer, W.D. 1995. Identification of ted with a linear correlation coefficient generally exceeding 0.9). functional domains in the Sep1 protein (= Kem1, Xrn1), which is The status of 5.8S rRNA was assessed by Northern blotting as required for transition through meiotic prophase in Saccharomyces described in Este´vez et al. (2001) using a probe recognizing the 59 cerevisiae. Chromosoma 104: 215–222. Bashkirov, V.I., Scherthan, H., Solinger, J.A., Buerstedde, J.M., and extension, cz1543 (59-GGAGCCGTGGTCAACAGG-39). The 59 Heyer, W.D. 1997. A mouse cytoplasmic exoribonuclease ends of snRNAs encoded in the SLA locus were determined by (mXRN1p) with preference for G4 tetraplex substrates. J. Cell primer extension as described in Roberts et al. (1998): TGR03: Biol. 136: 761–773. GGGCGGACACGGCGATCAGTCAGG; TGR06: TGGGGTCAT- Ben Amar, M., Pays, A., Tebabi, P., Dero, B., Seebeck, T., Steinert, M., CAAAGTCTGTGATG; TGR11: CTGCGACGGCTTTACATCGG- and Pays, E. 1988. Structure and transcription of the actin gene of CCTAGGTGTC; TGR12: CCCAACGGAACTAGAGCGCACACA Trypanosoma brucei. Mol. Cell. Biol. 8: 2166–2176. GGATA; TGR13: GCCCTCCCGAGGCCGT; SLA: TCTCGCT Benz, C., Nilsson, D., Andersson, B., Clayton, C., and Guilbride, D.L. 2005. Messenger RNA processing sites in Trypanosoma brucei. Mol. CTCCAGTTTCGTG; TBR02: ATCAGATATTGTTCACCCAT; Biochem. Parasitol. 143: 125–134. Sno RNA-B2 TTTCACATGCACGAGCATCC. The sites of spliced Berriman, M., Ghedin, E., Hertz-Fowler, C., Blandin, G., Renauld, H., leader addition for XRND were mapped by RT-PCR as described Bartholomeu, D.C., Lennard, N.J., Caler, E., Hamlin, N.E., in Hug et al. (1994). Haas, B., et al. 2005. The genome of the African trypanosome, Trypanosoma brucei. Science 309: 416–422. Bevilacqua, A., Ceriani, M.C., Capaccioli, S., and Nicolin, A. 2003. Post-transcriptional regulation of gene expression by degradation ACKNOWLEDGMENTS of messenger RNAs. J. Cell. Physiol. 195: 356–372. Biebinger, S., Wirtz, L.E., and Clayton, C.E. 1997. Vectors for This work was supported by the Croucher Foundation (Stipen- inducible over-expression of potentially toxic gene products in dium to C.-H.L.) and the Deutsche Forschungsgemeinshaft (H.I., bloodstream and procyclic Trypanosoma brucei. Mol. Biochem. A.M.E.). We thank Sarah Melville (University of Cambridge) for Parasitol. 85: 99–112. the P1 clones and Noreen Williams (State University of New York Blattner, J. and Clayton, C.E. 1995. The 39-untranslated regions from at Buffalo) for antibody to p34/p37 and Mark Carrington (University the Trypanosoma brucei phosphoglycerate kinase genes mediate of Cambridge) for useful discussions. The Kinetoplastid genomes developmental regulation. Gene 162: 153–156. Bousquet-Antonelli, C., Presutti, C., and Tollervey, D. 2000. Identi- were sequenced by TIGR and the Sanger Centre, with support fication of a regulated pathway for nuclear pre-mRNA turnover. from the National Institutes of Health and the Wellcome Trust. Cell 102: 765–775. H.I. initiated this project by cloning and sequencing the genes and Brems, S., Guilbride, D.L., Gundlesdodjir-Planck, D., Busold, C., supervised S.F. S.F. made stem–loop XRNA, XRNB, and XRNC Luu, V.D., Schanne, M., Hoheisel, J., and Clayton, C. 2005. The

14 RNA, Vol. 12, No. 12 JOBNAME: RNA 12#12 PAGE: 15 OUTPUT: Friday October 27 16:36:56 2006 csh/RNA/125784/rna2915

Downloaded from rnajournal.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press

Trypanosoma brucei 59/39 exoribonuclease

transcriptomes of Trypanosoma brucei Lister 427 and TREU927 strand exchange protein 1 (Sep1/Xrn1/Kem1), a multifunctional bloodstream and procyclic trypomastigotes. Mol. Biochem. Para- exonuclease. Mol. Cell. Biol. 15: 2728–2736. sitol. 139: 163–172. Hotz, H.-R., Hartmann, C., Huober, K., Hug, M., and Clayton, C.E. Caponigro, G. and Parker, R. 1996. Mechanisms and control of 1997. Mechanisms of developmental regulation in Trypanosoma mRNA turnover in Saccharomyces cerevisiae. Microbiol. Rev. 60: brucei: A polypyrimidine tract in the 39- 233–249. untranslated region of a trypanosome surface protein mRNA Chen, C.Y., Gherzi, R., Ong, S.E., Chan, E.L., Raijmakers, R., affects RNA abundance and translation. Nucleic Acids Res. 25: Pruijn, G.J., Stoecklin, G., Moroni, C., Mann, M., and Karin, M. 3017–3025. 2001. AU binding proteins recruit the exosome to degrade ARE- Hsu, C.L. and Stevens, A. 1993. Yeast cells lacking 59 / 39 exo- containing mRNAs. Cell 107: 451–464. nuclease 1 contain mRNA species that are poly(A) deficient and Clayton, C.E. 1987. Import of fructose bisphosphate aldolase into the partially lack the 59 cap structure. Mol. Cell. Biol. 13: 4826–4835. glycosomes of Trypanosoma brucei. J. Cell Bio. 105: 2649–2653. Hug, M., Carruthers, V., Sherman, D., Hartmann, C., Cross, G.A.M., Clayton, C.E. 2002. Developmental regulation without transcriptional and Clayton, C.E. 1993. A possible role for the 39-untranslated control? From fly to man and back again. EMBO J. 21: 1881–1888. region in developmental regulation in Trypanosoma brucei. Mol. Clayton, C.E., Este´vez, A.M., Hartmann, C., Alibu, V.P., Field, M., and Biochem. Parasitol. 61: 87–96. Horn, D. 2005. Down-regulating gene expression by RNA Hug, M., Hotz, H.R., Hartmann, C., and Clayton, C.E. 1994. interference in Trypanosoma bruci. In RNA. interference (ed. G. Hierarchies of RNA processing signals in a trypanosome surface Carmichael).. Humana Press, Totowa, NJ. antigen mRNA precursor. Mol. Cell. Biol. 14: 7428–7435. Cougot, N., Babajko, S., and Seraphin, B. 2004. Cytoplasmic foci are Ingelfinger, D., Arndt-Jovin, D.J., Luhrmann, R., and Achsel, T. 2002. sites of mRNA decay in human cells. J. Cell Biol. 165: 31–40. The human LSm1-7 proteins colocalize with the mRNA-degrading Coulson, R.M., Connor, V., Chen, J.C., and Ajioka, J.W. 1996. enzymes Dcp1/2 and Xrnl in distinct cytoplasmic foci. RAN 8: Differential expression of Leishmania major b-tubulin genes 1489–1501. during the acquisition of promastigote infectivity. Mol. Biochem. Irmer, H. and Clayton, C.E. 2001. Degradation of the EP1 mRNA in Parasitol. 82: 227–236. Trypanosoma brucei is initiated by destruction of the 39-untrans- Decker, C.J. and Parker, R. 1994. Mechanisms of mRNA degradation lated region. Nucleic Acids Res. 29: 4707–4715. in eukaryotes. Trends Biochem. Sci. 19: 336–340. Ivens, A.C., Peacock, C.S., Worthey, E.A., Murphy, L., Aggarwal, G., Dorn, P.L., Aman, R.A., and Boothroyd, J.C. 1991. Inhibition of Berriman, M., Sisk, E., Rajandream, M.A., Adlem, E., Aert, R., et protein synthesis results in super-induction of procyclin (PARP) al. 2005. The genome of the kinetoplastid parasite, Leishmania RNA levels. Mol. Biochem. Parasitol. 44: 133–140. major. Science 309: 436–442. Durand-Dubief, M., Kohl, L., and Bastin, P. 2003. Efficiency and Johnson, A.W. 1997. Rat1p and Xrn1p are functionally interchange- specificity of RNA interference generated by intra- and intermo- able exoribonucleases that are restricted to and required in the nucleus and cytoplasm, respectively. Mol. Cell. Biol. 17: 6122– lecular double-stranded RNA in Trypanosoma brucei. Mol. Bio- 6130. chem. Parasitol. 129: 11–21. Johnson, A.W. and Kolodner, R.D. 1995. Synthetic lethality of sep1 Dykstra, C.C., Hamatake, R.K., and Sugino, A. 1990. DNA strand (xrn1) ski2 and sep1 (xrn1) ski3 mutants of Saccharomyces cerevisiae transfer protein from yeast mitotic cells differs from strand is independent of killer virus and suggests a general role for these transfer protein from meiotic cells. J. Biol. Chem. 265: 10968– genes in translation control. Mol. Cell. Biol. 15: 2719–2727. 10973. Kastenmeier, J.P. and Green, P.J. 2000. Novel features of the XRN- El-Sayed, N.M., Myler, P.J., Blandin, G., Berriman, M., Crabtree, J., family in Arabidopsis: Evidence that AtXRN4, one of several Aggarwal, G., Caler, E., Renauld, H., Worthey, E.A., Hertz- orthologs of nuclear Xrn2p/Rat1p, functions in the cytoplasm. Fowler, C., et al. 2005a. Comparative genomics of trypanosomatid Proc. Natl. Acad. Sci. 97: 13985–13990. parasitic protozoa. Science 309: 404–409. Kenna, M., Stevens, A., McCammon, M., and Douglas, M.G. 1993. An El-Sayed, N.M., Myler, P.J., Blandin, G., Berriman, M., Crabtree, J., essential yeast gene with homology to the exonuclease-encoding Aggarwal, G., Caler, E., Renauld, H., Worthey, E.A., Hertz- XRN1/KEM1 gene also encodes a protein with exoribonuclease Fowler, C., et al. 2005b. The genome sequence of Trypanosoma activity. Mol. Cell. Biol. 13: 341–350. cruzi, etiologic agent of Chagas disease. Science 309: 409–415. Kim, M., Krogan, N.J., Vasiljeva, L., Rando, O., Nedea, E., Este´vez, A., Kempf, T., and Clayton, C.E. 2001. The exosome of Greenblatt, J.F., and Buratowski, S. 2004. The yeast Rat1 exo- Trypanosoma brucei. EMBO J. 20: 3831–3839. nuclease promotes transcription termination by RNA polymerase Fang, F., Phillips, S., and Butler, J.S. 2005. Rat1p and Rai1p function II. Nature 432: 517–522. with the nuclear exosome in the processing and degradation of Kolodner, R., Evans, D.H., and Morrison, T.P. 1987. Purification and rRNA precursors. RAN 11: 1571–1578. characterization of an activity from Saccharomyces cerevisiae that Graham, S.V. and Barry, J.D. 1996. Polysomal, procyclin mRNAs catalyzes homologous pairing and strand exchange. Proc. Natl. accumulate in bloodstream forms of monomorphic and pleomor- Acad. Sci. 84: 5560–5564. phic trypanosomes treated with protein synthesis inhibitors. Mol. Larimer, F.W. and Stevens, A. 1990. Disruption of the gene XRN1, Biochem. Parasitol. 80: 179–192. coding for a 59/39 exoribonuclease, restricts yeast cell growth. Grummt, I. 2003. Life on a planet of its own: Regulation of RNA Gene 95: 85–90. polymerase I transcription in the nucleolus. Genes & Dev. 17: Lee, C.Y., Lee, A., and Chanfreau, G. 2003. The roles of endonucleo- 1691–1702. lytic cleavage and exonucleolytic digestion in the 59-end processing Guerra-Giraldez, C., Quijada, L., and Clayton, C.E. 2002. Compart- of S. cerevisiae box C/D snoRNAs. RAN 9: 1362–1370. mentation of enzymes in a microbody, the glycosome, is essential Liang, X., Haritan, A., Uliel, S., and Michaeli, S. 2003. Trans and cis in Trypanosoma brucei. J. Cell Sci. 115: 2651. splicing in trypanosomatids: Mechanism, factors, and regulation. Haile, S., Este´vez, A.M., and Clayton, C. 2003. A role for the exosome Eukaryot. Cell 2: 830–840. in the initiation of degradation of unstable mRNAs. RAN 9: 1491– Liu, Z. and Gilbert, W. 1994. The yeast KEM1 gene encodes a nuclease 1501. specific for G4 tetraplex DNA: Implication of in vivo functions for Hendriks, E.F., Abdul-Razak, A., and Matthews, K.R. 2003. TbCPSF30 this novel DNA structure. Cell 77: 1083–1092. depletion by RNA interference disrupts polycistronic RNA process- Luo, W., Johnson, A., and Bentley, D. 2006. The role of Rat1 in ing in Trypanosoma brucei. J. Biol. Chem. 278: 26870–26878. coupling mRNA 39-end processing to transcription termination: Heyer, W.-D., Johnson, A.W., Reinhart, U., and Kolodner, R.D. 1995. Implications for a unified allosteric–torpedo model. Genes & Dev. Regulation and intracellular location of Saccharomyces cerevisiae 20: 954–965.

www.rnajournal.org 15 JOBNAME: RNA 12#12 PAGE: 16 OUTPUT: Friday October 27 16:36:59 2006 csh/RNA/125784/rna2915

Downloaded from rnajournal.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press

Li et al.

Martinez-Calvillo, S., Yan, S., Nguyen, D., Fox, M., Stuart, K., and Shen, S., Arhin, G.K., Ullu, E., and Tschudi, C. 2001. In vivo epitope Myler, P.J. 2003. Transcription of Leishmania major Friedlin tagging of Trypanosoma brucei genes using a one step PCR-based chromosome 1 initiates in both directions within a single region. strategy. Mol. Biochem. Parasitol. 113: 171–173. Mol. Cell 11: 1291–1299. Sheth, U. and Parker, R. 2003. Decapping and decay of messenger RNA Martinez-Calvillo, S., Nguyen, D., Stuart, K., and Myler, P.J. 2004. occur in cytoplasmic processing bodies. Science 300: 805–808. Transcription initiation and termination on Leishmania major Shi, H., Djikeng, A., Mark, T., Wirtz, E., Tschudi, C., and Ullu, E. chromosome 3. Eukaryot. Cell 3: 506–517. 2000. Genetic interference in Trypanosoma brucei by heritable and McNally, K.P. and Agabian, N. 1992. Trypanosoma brucei spliced- inducible double-stranded RNA. RAN 6: 1069–1076. leader RNA methylations are required for trans splicing in vivo. Solinger, J.A., Pascolini, D., and Heyer, W.-D. 1999. Active-site Mol. Cell. Biol. 12: 4844–4851. mutations in the Xrn1p exoribonuclease of Saccharomyces cerevi- Muhlrad, D., Decker, C.J., and Parker, R. 1994. Deadenylation of the siae reveal a specific role in meiosis. Mol. Cell. Biol. 19: 5930–5942. unstable mRNA encoded by the yeast MFA2 gene leads to Souret, F.F., Kastenmayer, J.P., and Green, P.J. 2004. AtXRN4 decapping followed by 59-39 digestion of the transcript. Genes & degrades mRNA in Arabidopsis and its substrates include selected Dev. 8: 855–866. miRNA targets. Mol. Cell 15: 173–183. Muhlrad, D., Decker, C.J., and Parker, R. 1995. Turnover mechanisms Stoecklin, G., Mayo, T., and Anderson, P. 2005. ARE-mRNA of the stable yeast PGK1 mRNA. Mol. Cell. Biol. 15: 2145–2156. degradation requires the 59-39 decay pathway. EMBO Rep. 7: Mukherjee, D., Gao, M., O’Connor, J.P., Raijmakers, R., Pruijn, G., 72–77. Lutz, C.S., and Wilusz, J. 2002. The mammalian exosome mediates Szankasi, P. and Smith, G.R. 1996. Requirement of S. pombe exo- the efficient degradation of mRNAs that contain AU-rich ele- nuclease II, a homologue of S. cerevisiae Sep1, for normal mitotic ments. EMBO J. 21: 165–174. growth and viability. Curr. Genet. 30: 284–293. Nakai, K. and Horton, P. 1999. PSORT: A program for detecting the Till, D.D., Linz, B., Seago, J.E., Elgar, S.J., Marujo, P.E., Elias, M.L., sorting signals of proteins and predicting their subcellular local- Arraiano, C.M., McClellan, J.A., McCarthy, J.E., and ization. Trends Biochem. Sci. 24: 34–35. Newbury, S.F. 1998. Identification and developmental expression Newbury, S. and Woolard, A. 2004. The 59-39 exoribonuclease xrn-1 is of a 59-39 exoribonuclease from Drosophila melanogaster. Mech. essential for ventral epithelial enclosure during C. elegans embryo- Dev. 79: 51–55. genesis. RAN 10: 59–65. Tishkoff, D.X., Johnson, A.W., and Kolodner, R.D. 1991. Molecular Ngo, H., Tschudi, C., Gull, K., and Ullu, E. 1998. Double-stranded and genetic analysis of the gene encoding the Saccharomyces RNA induces mRNA degradation in Trypanosoma brucei. Proc. cerevisiae strand exchange protein Sep1. Mol. Cell. Biol. 11: Natl. Acad. Sci. 95: 14687–14692. 2593–2608. Orban, T.I. and Izaurralde, E. 2005. Decay of mRNAs targeted by Ullu, E. and Tschudi, C. 1991. Trans splicing in trypanosomes RISC requires XRN1, the Ski complex, and the exosome. RAN 11: requires methylation of the 59 end of the spliced leader RNA. 459–469. Proc. Natl. Acad. Sci. 88: 10074–10078. Page, A.M., Davis, K., Molineux, C., Kolodner, R.D., and Ullu, E., Matthews, K.R., and Tschudi, C. 1993. Temporal order of Johnson, A.W. 1998. Mutational analysis of exoribonuclease I from Saccharomyces cerevisiae. Nucleic Acids Res. 26: 3707–3716. RNA-processing reactions in trypanosomes: Rapid trans splicing Parker, R. and Song, H. 2004. The enzymes and control of eukaryotic precedes polyadenylation of newly synthesized tubulin transcripts. mRNA turnover. Nat. Struct. Mol. Biol. 11: 121–127. Mol. Cell. Biol. 13: 720–725. Pays, E., Hanocq-Quertier, J., Hanocq, F., Van Assel, S., Nolan, D., van Deursen, F.J., Shahi, S.H., Turner, C.M., Hartmann, C., Guerra- and Rolin, S. 1993. Abrupt RNA changes precede the first cell Giraldez, C., Matthews, K.R., and Clayton, C.E. 2001. Character- division during the differentiation of Trypanosoma brucei blood- isation of the growth and differentiation in vivo and in vitro of stream forms into procyclic forms in vitro. Mol. Biochem. Para- bloodstream-form Trypanosoma brucei strain TREU 927. Mol. sitol. 61: 107–114. Biochem. Parasitol. 112: 163–172. Petfalski, E., Dandekar, T., Henry, Y., and Tollervey, D. 1998. Warner, J. 1999. The economics of ribosome biosynthesis in yeast. Processing of the precursors to small nucleolar RNAs and rRNAs Trends Biochem. Sci. 24: 437–440. requires common components. Mol. Cell. Biol. 18: 1181–1189. Webb, H., Burns, R., Ellis, L., Kimblin, N., and Carrington, M. 2005. Poole, T.L. and Stevens, A. 1995. Comparison of features of the RNase Developmentally regulated instability of the GPI-PLC mRNA is activity of 59-exonuclease-1 and 59-exonuclease-2 of Saccharomyces dependent on a short-lived protein factor. Nucleic Acids Res. 33: cerevisiae. Nucleic Acids Symp. Ser. 33: 79–81. 1503–1512. Quijada, L., Hartmann, C., Guerra-Giraldez, C., Drozdz, M., West, S., Gromak, N., and Proudfoot, N.J. 2004. Human 59-39 Irmer, H., and Clayton, C.E. 2002. Expression of the human exonuclease Xrn2 promotes transcription termination at cotran- RNA-binding protein HuR in Trypanosoma brucei induces differ- scriptional cleavage sites. Nature 432: 522–525. entiation-related changes in the abundance of developmentally- Wilson, M., Paetz, K., Ramamoorthy, R., and Donelson, J. 1993. The regulated mRNAs. Nucleic Acids Res. 30: 1–11. effect of ongoing protein synthesis on the steady state levels of Gp63 Redmond, S., Vadivelu, J., and Field, M.C. 2003. RNAit: An RNAs in Leishmania chagasi. J. Biol. Chem. 268: 15731–15736. automated web-based tool for the selection of RNAi targets in Zeiner, G.M., Sturm, N.R., and Campbell, D.A. 2003. Exportin 1 Trypanosoma brucei. Mol. Biochem. Parasitol. 128: 115–118. mediates nuclear export of the Kinetoplastid spliced leader RNA. Roberts, T.G., Sturm, N.R., Yee, B.K., Yu, M.C., Hartshorne, T., Eukaryot Cell 2: 222–230. Agabian, N., and Campbell, D.A. 1998. Three small nucleolar Zhang, J., Ruyechan, W., and Williams, N. 1998. Developmental RNAs identified from the spliced leader-associated RNA locus in regulation of two nuclear RNA binding proteins, p34 and p37, kinetoplastid protozoans. Mol. Cell. Biol. 18: 4409–4417. from Trypanosoma brucei. Mol. Biochem. Parasitol. 92: 79–88.

16 RNA, Vol. 12, No. 12 Downloaded from rnajournal.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press

Roles of a Trypanosoma brucei 5 →′ 3′ exoribonuclease homolog in mRNA degradation

Chi-Ho Li, Henriette Irmer, Drifa Gudjonsdottir-Planck, et al.

RNA published online October 31, 2006

P

License

Email Alerting Receive free email alerts when new articles cite this article - sign up in the box at the Service top right corner of the article or click here.

To subscribe to RNA go to: http://rnajournal.cshlp.org/subscriptions

Copyright © 2006 RNA Society