Proteomic Profile of Carbonylated Proteins Screen Regulation of Apoptosis Via Camk Signaling in Response to Regular Aerobic Exercise

Georgia Southern University Digital Commons@Georgia Southern

Health and Kinesiology Faculty Publications Health Sciences and Kinesiology, Department of

12-18-2018

Proteomic Profile of Carbonylated Proteins Screen Regulation of Apoptosis via CaMK Signaling in Response to Regular Aerobic Exercise

Wenfeng Liu

Li Li

Heyu Kuang

Yan Xia

Zhiyuan Wang

See next page for additional authors

Follow this and additional works at: https://digitalcommons.georgiasouthern.edu/health-kinesiology- facpubs

Part of the Kinesiology Commons, and the Medicine and Health Sciences Commons

This article is brought to you for free and open access by the Health Sciences and Kinesiology, Department of at Digital Commons@Georgia Southern. It has been accepted for inclusion in Health and Kinesiology Faculty Publications by an authorized administrator of Digital Commons@Georgia Southern. For more information, please contact [email protected]. Authors Wenfeng Liu, Li Li, Heyu Kuang, Yan Xia, Zhiyuan Wang, Shaopeng Liu, and Dazhong Yin Hindawi BioMed Research International Volume 2018, Article ID 2828143, 13 pages https://doi.org/10.1155/2018/2828143

Research Article Proteomic Profile of Carbonylated Proteins Screen Regulation of Apoptosis via CaMK Signaling in Response to Regular Aerobic Exercise

Wenfeng Liu ,1,2 Li Li ,3 Heyu Kuang,1 Yan Xia,1 Zhiyuan Wang,1 Shaopeng Liu,1 and Dazhong Yin 1,4

1 Hunan Provincial Key Laboratory of Physical Fitness and Sports Rehabilitation, Hunan Normal University, Changsha, Hunan 410012, China 2Department of Experimental and Clinical Pharmacology, University of Minnesota, Minneapolis, MN 55455, USA 3School of Health & Kinesiology, Georgia Southern University, Statesboro, GA 30460, USA 4Qingyuan People’s Hospital, Te Sixth Afliated Hospital, Guangzhou Medical University, Guangzhou, Guangdong, China

Correspondence should be addressed to Wenfeng Liu; [email protected] and Dazhong Yin; [email protected]

Received 7 September 2018; Accepted 26 November 2018; Published 18 December 2018

Academic Editor: Gianluca Coppola

Copyright © 2018 Wenfeng Liu et al. Tis is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

To research carbonylated proteins and screen molecular targets in the rat striatum on regular aerobic exercise, male Sprague- Dawley rats (13 months old, n = 24) were randomly divided into middle-aged sedentary control (M-SED) and aerobic exercise (M-EX) groups (n = 12 each). Maximum oxygen consumption (VO2max) gradually increased from 50%–55% to 65%–70% for a total of 10 weeks. A total of 36 carbonylated proteins with modifed oxidative sites were identifed by Electrospray Ionization- Quadrupole-Time of Flight-Mass Spectrometer (ESI-Q-TOF-MS), including 17 carbonylated proteins unique to the M-SED group, calcium/calmodulin-dependent protein kinase type II subunit beta (CaMKII�), and heterogeneous nuclear ribonucleoprotein A2/B1 (Hnrnpa2b1), among others, and 19 specifc to the M-EX group, ubiquitin carboxyl-terminal hydrolase isozyme L1 (UCH- L1), and malic enzyme, among others. Regular aerobic exercise improved behavioral and stereological indicators, promoted normal apoptosis (P < 0.01), alleviated carbonylation of the CaMKII� and Hnrnpa2b1, but induced carbonylation of the UCH-L1, and signifcantly upregulated the expression levels of CaMKII�,CaMKII�, and Vdac1 (p < 0.01) and Hnrnpa2b1 and UCH-L1 (p < 0.01), as well as the phosphoinositide 3-kinase/protein kinase B/mammalian target of rapamycin pathways (PI3K/Akt/mTOR) pathway-related genes Akt and mTOR. Regular aerobic exercise for 10 weeks (incremental for the frst 6 weeks followed by constant loading for 4 weeks) enhanced carbonylation of CaMKII�, Hnrnpa2b1, and modulated apoptosis via activation of CaMK and phosphoinositide 3-kinase/protein kinase B/mTOR signaling. It also promoted normal apoptosis in the rat striatum, which may have protective efects in neurons.

1. Introduction amyloid and neurofbrillary tangles, nuclear protein enrich- ment, and neuronal accumulation of lipofuscin pigment Posttranslational modifcations including phosphorylation, granules. glycosylation, and carbonylation alter the relative molecular Toxic carbonyl compounds are generated in the body as mass and isoelectric point of proteins and, consequently, byproducts of the reactions that form the major biological their activity and functions. Carbonyl stress refers to the macromolecules—i.e., lipids, carbohydrates, and proteins. production of reactive carbonyl species that exceeds the Tese compounds include unsaturated aldehydes and ketones body’s scavenging capacity, resulting in the carbonylation of related to oxidative stress such as 4-hydroxy-nonennal proteins and other macromolecules and pathophysiological (HNE), acrolein, formaldehyde, and malondialdehyde as changes including accelerated aging [1] through formation of well as advanced glycation end products and free radicals 2 BioMed Research International produced by the degradation of sugars. Carbonylation leads animals” (the provisions were issued in 2006 by the Ministry to the formation of oxidized proteins; carbonyl-ammonia of Science and Technology of the People’s Republic of reactions cause intramolecular or intermolecular cross- China). linking, which afects normal protein structure and function [2–5]. Carbonylated proteins are considered as a general 2.2. Exercise Protocol. Te aerobic exercise regime used in indicator of oxidative stress, in which reactive oxygen species this study was proposed by Koltai and Zhang [15], with accumulate in cells and cause irreversible damage to DNA, reference to the exercise load standards of Bedford [16]. All RNA, and lipids [6]. Oxidative stress has been implicated animals in the M-SED and M-EX groups were frst subjected in a variety of neurological diseases including Alzheimer’s to a 5-day adaptation period on a rat treadmill (slope gradient disease, PD, and amyotrophic lateral sclerosis. 0%, ZH-PT-1 Treadmill, Li Tai Bio-Equipment Co., Ltd., Lesions in diferent parts of the striatum can produce Hangzhou, Zhejiang, China). Adapted training was carried changes in muscle tone and involuntary movements such outataspeedof10m/minandagradientof0%,fora as dyskinesia in Parkinson’s disease (PD) and chorea in gradually increasing duration of time—10 min on the frst Huntington’s disease. Striatal dopamine content, as measured day,20minonthesecondday,and25minonthethird by positron emission tomography, is correlated with learning, day. During this period, they were placed on a belt facing hearing, and memory [7, 8]. On the other hand, learning away from the electrifed grid (0.6mA intensity), twice a day. and memory are thought to be dependent on the number For the actual experiment, the M-EX group underwent daily of dopamine receptors in the striatum; continuous depletion training by running at 15 m/min (equivalent to approx. 50% to ∘ of dopamine in the striatal system leads to dysfunction 60% peak oxygen uptake) [16], on a slope of 0 ,foraduration of memory or recognition in PD patients [9]. Impairment of 15 min. During the frst week at the start of the training, the of striatal function such as through aferent modulation exercise duration was increased gradually from 15 min to the of dopaminergic neurons of the midbrain is an important second week 20 min, the third week 25 min, the fourth week marker of PD [10, 11]. 30 min, and the ffh and sixth week 35 min. Te M-EX group Exercise is used in rehabilitation medicine to activate underwent daily training by running at 20 m/min and main- restorative biological processes. Long-term regular aerobic tained speed for a week (equivalent to approx. 65% to 70% ∘ exercise has been shown to improve the body’s antioxidant peak oxygen uptake) (Bedford et al., 1979), on a slope of 0 , capacity,reducedamagecausedbyfreeradicals,suppress for a duration of 35 min during the seventh to tenth week. Te lipid peroxidation, and reduce lipofuscin deposition, thereby acceleration of the treadmill was set such that, at about 3 min contributing to the maintenance of brain health and delay- afer the start of the training, the fnal speed of 20 m/min was ing brain aging. It was previously reported that long-term achieved. To ensure that the animals completed the exercise moderate-intensity exercise during middle age reduces the regime,weusedsoundstimulationandasmallwooden risk of PD development in later life [12–14]. stick to stimulate the animals’ tails, when necessary. We Te present study investigated whether regular aero- also used electrical stimulation to keep the rats at one-third bic exercise can prevent oxidative stress-associated protein distance on the treadmill runway. Animals were required to carbonylation in middle-aged rats by peptide mass and perform the training 6 days a week for a total of 10 weeks fngerprinting analysis. [17].

2. Materials and Methods 2.3.TissueSpecimenCollectionandAnalysis.On the day following the last exercise schedule, the rats were anesthetized 2.1. Experimental Animals and Ethics Statement. Specifc with chloral hydrate (400 mg/kg, i.p.) and decapitated. Te pathogen-free 13-month-old male Sprague-Dawley (SD) rats striatum (Stereotaxic Atlas of the Rat Brain; George Paxinos., (n=24, 693.21±68.85g) were supplied by the Animal Center 2005) [18] was excised from all rats. Tissue samples were ∘ of East Biotechnology Services Company (Changsha, Hunan, stored at −80 C until being ready to be used for carbonylation China; License number: Xiang scxk 2009-0012). Four rats proteomics and immunoblot assays. All surgical procedures were housed in each standard cage (3 cages/group) with free were performed under anesthesia induced by chloral hydrate. access to food and water. All animals were kept in an air- All eforts were made to minimize sufering and distress in conditioned room maintained at a constant temperature of animals. ∘ ∘ 20 Cto25C with a relative humidity of 45% to 55%. Rats At least three rats from each group were used for weresubjectedtoacycleof12hlightand12hdarkness. the parafn section sample preparation. Afer the above All animals were acclimated to laboratory conditions for 2 ascending aorta was infused with physiological saline, it weeks, prior to the start of the experiment. A total of 24 was then perfused with 4% paraformaldehyde 0.1M phos- ∘ rats were randomly assigned to two groups—middle-aged phate bufer (pH 7.4) (4 C) 400 ml-500 ml, until the ani- sedentary control group (M-SED, n=12) and aerobic exercise mal’s liver hardened and the tail was stif, and the per- runner group (M-EX, n=12) by elderly weight. All animal fusion was completed. Brains were taken and kept in a procedures were approved by the local ethics committee (the 4% paraformaldehyde 0.1M phosphate bufer overnight at ∘ Institutional Review Board of Hunan Normal University) 4 C (no more than 48 h). Te next day, they were trans- and the Guidelines for Care and Use of Laboratory Animals ferred to 30% sucrose and dehydrated to a low level. Ten (Washington (DC) 2011). Disposal of animals was done in they were routinely dehydrated, waxed, parafnized, and accordance with “Te guidance on the care of laboratory embedded. BioMed Research International 3

2.4. Behavioral Monitoring not considered to be apoptotic cells unless their staining intensity contrasts sharply with the background and they 2.4.1. Open-Field Experiment (OFT). Open-feld behavior are in a single distribution. Six sections were randomly apparatus: All equipment and sofware were purchased from observed per section under a light microscope (×400), and SD Instruments (San Diego). Te open-feld device was each feld was at least 500 cells. Te average number of divided into a central zone and a surrounding zone, which positive apoptotic cells per 100 cells, i.e., the Apoptosis Index × × consists of an uncovered cuboid device of length width (AI), was measured using the Simple PCI microscopic image × × height of 100 100 40 cm, with four walls being black and analysis sofware. the bottom being white. Te bottom is divided into 25 square squares (20 × 20 cm), and each large square is subdivided 2.7. Carbonylation Proteomics into 400 small squares (1 × 1 cm). Te device was placed in a room with a light intensity of 20 lux and no background 2.7.1. Protein Extraction. Tissue homogenization used a Bei- noise, placing the digital camera directly above the unit. Te jing Kangwei Century Technology animal cell (tissue) total bottomandwallsoftheopenfeldwerecleanedwith75% protein extraction kit (No. CW0891) and an F6/10-6G ultra- alcohol for removing odor. Each rat was preexposed for 5 min fne homogenizer (Fluko, Shanghai, China) in an ice bath. in the open-feld device; then 2 tests were performed. Hydrazide chemistry was employed to derivatize protein Open-feld behavior parameters: Te open-feld device carbonyls from the samples (at least 3-4 samples for each was divided into a central zone and the surrounding zone. concentration per treatment group) and the tissue weight Five behavioral patterns were recorded in the open-feld was about 200 mg to extract the carbonylated protein [21]. experiments, namely, motor behavior, exploration behav- Biotinylation was with 10% 50 mM biotin hydrazide added ior, thigmotaxic behavior, immobile-snifng, and grooming to a fnal concentration of 5 mM. Te reaction was at room ∘ behavior. All kinds of behaviors were mainly refected in the temperature for 2 h or at 4 C for 4 h to completely biotinylate central grid’s staying time, number of spans, number of erec- the carbonylated proteins. To obtain protein crude extracts, ∘ tions, number of cleansing, and number of defecations [19]. samples were centrifuged at 4 C, at 3000–4000 × g for 10 min; then centrifugation was repeated two to three times. 2.4.2. Adhesion Removal Experiment. Five rats in each group Reductive amination used 5 M NaCNBH3 added to a fnal were randomly selected for nasal adhesion removal and front concentration of 15 mM, and the reaction was performed at ∘ paw adhesion removal Experiment. Referring to the method 4 C for 1 h. Te Schif base was reduced to a secondary amine of Schallert et al. [20], training is adapted frstly and then using a mild reducing agent, sodium cyanoborohydride, to adherent removal experiments. preventhydrolysisoftheSchifbasetoformacarbonylgroup. Te protein solution was fltered through a 0.45 �mflter, 2.5. Hematoxylin and Eosin (HE) Staining. 5�msliceswere and protein quantifcation was performed using Coomassie sectioned by 820 Rotary Tissue Slicer (AO Company, Ameri- Brilliant Blue. can). Ten HE routine steps were as follows: dewaxing hydra- Te protein solution was transferred to an ultrafltration tion, hematoxylin staining for 10–15 min, color separation tube and ultrafltered using 200 times the volume of the with 1% hydrochloric acid alcohol, 5% eosin staining for solution in phosphate-bufered saline (PBS) to remove the 1 min, dehydration with gradient alcohol, clearing of tissue biotin hydrazide. To enrich for carbonylated proteins, 100 �L sections with xylene, sealing in neutral gum, and taking pho- of avidin beads was added to each protein sample, and the ∘ tos in 40× magnifcation with OLYMPUS BX52 Microscopic reaction was carried out at 4 C for 30 min before transferring Image Acquisition System (Olympus Corporation, Japan). to the Spin column. Te bottom cover was removed and centrifuged at 600 × g for 1 min. To separate the carbonylated 2.6. Assessment of Apoptosis by TUNEL. Te TdT-mediated proteins, afer sealing the Spin column cover, 100 �LPBSwas end-residues, deoxyribonucleotide-terminal transferase- added, and D-biotin was added at a fnal concentration of ∘ mediated nick end labeling (TUNEL), were used to detect 5mM;thereactionoccurredat4 C for 1 h. Afer addition the nuclear DNA fragmentation during the early stages of to D-biotin and replacement bufer, the supernatant was apoptosis, with In Situ Cell Death Detection Kit (POD) transferred to a 10 kD Ultra-0.5 ultrafltration tube and rinsed instructions. Under normal light microscope observation with 150–200 �Lof50mMNH4HCO3, centrifuged at 14,000 (OLYMPUS BX52 Microscopic Image Acquisition System × g for 10 min, and repeated three times to fully remove the andSimplePCIMicroscopicImageAnalysisSystem),the D-biotin. Te carbonylated proteins were collected, and afer positive apoptotic cells showed brown or brown nucleus the D-biotin was sufciently removed, 100 �LofNH4HCO3 staining. Part of the cytoplasm could also be positively stained was added to the ultrafltration tube, and the ultrafltration by spiking DNA fragments; normal nonapoptotic cells and tube was further rinsed with NH4HCO3 at 50 �L/rinse. Te ∘ negative control cell nuclei were stained. Hematoxylin is dyed carbonylated proteins were frozen and stored at 80 C. Te blue, the nucleus is relatively large, and the shape and size extracted carbonylated proteins were quantifed using the are the same. Te pigmented positive cells were identifed Coomassie Brilliant Blue assay. as apoptotic cells according to the following criteria: a single scattered distribution; a nuclear morphology with 2.7.2. Protein Enzymolysis. Afnity-purifed carbonylated apoptosis; no infammatory reaction around. For positive proteins were concentrated in a 10 kDa Ultra-0.5 ultrafltra- cells lacking apoptotic nuclear morphology, astrocytes are tion tube to near dryness. For denaturation, 8 �Lofureawas 4 BioMed Research International added to 200 �L of 0.1 M Tris/HCl, pH 8.5, and mixed for the MASCOT server (version 2013, Matrix Science-Mascot- 1 min and then centrifuged at 14,000 × g for 15 min. Disulfde MS/MS-Ions Search). Te parameters included the Swiss- bonds were disrupted using 180 �Lof8Mureaand20�Lof Prot/Uniprot database, and trypsin lysis, which allowed one 1 M dithiothreitol added to a fnal concentration of 100 mM. uncut site. Te species were as follows: rat; MS/MS fragment Afer shaking for 10–60 s, the incubation was performed at ion mass error set to 0.2 Da. Because Mascot has a limit ∘ 56 C for 1 h. Centrifugation was at 14,000 × g for 15 min. Free of nine modifcations per search, the variable modifers sulfydryl groups were blocked by adding 100 �Loffreshly were searched multiple times and each sample contained a prepared iodoacetamide (IAA) (fnal concentration, 50 mM) maximum of six modifers at a time. According to Madian ∘ and placing them in the dark at room temperature (or 4 C) for et al. [23], the oxidative modifcation sites of carbonylated 30 min; then the samples were centrifuged at 14,000 × g for proteins were searched in several steps. Te frst modifcation 15 min. In addition to dithiothreitol and IAA, 100 �Lof8M was fxed as follows: cysteine was iodoacetamidated to car- urea was added, mixed for 1 min, followed by centrifugation bamidomethyl (C) without variable modifcation; the second at 14,000 × g for 15 min, and the solution in the cannula was step was fxed. Modifcations included carbamidomethyl discarded twice. Displacement of urea was accomplished by (C), variably modifed to oxidation or hydroxylation (C- adding 200 �L of 50 mM ammonium bicarbonate, mixing for terminalG,D,F,HW,K,M,N,R,Y).Ten,changesinthe 1 min, and then centrifuging at 14,000 × g for 30 min. Te variable modifcation from cysteine sulfenic acid-tryptophan cannula solution was discarded, and rinsing was repeated two oxidationtooxolactonewereperformed.Teterm“keratin to three times [22, 23]. flaments” appears in the Gene Ontology (GO) Cellular For enzymolysis, the separated carbonylated proteins Component Ontology, and “Keratin, type I cytoskeletal 15” in the Ultra-0.5 tube were ultrafltered to dryness, then was included in the gene name. Protein abundance was based 20 �LofNH4HCO3 was added to the UF tube, and the on the protein-rich fraction database (PaxDb2.0), and protein solution was transferred to a clean centrifuge tube with function and subcellular localization were searched through 10 �LofNH4HCO3.Tesamplewasrinsedtwice,eachtime the Uniprot database. Information on signal pathway analysis with mixing and centrifugation. Te fnal protein solution of carbonylated proteins was obtained using the GeneMA- was mixed and subsequently trypsin digested. 10× trypsin NIA Prediction Server (Version 2.8). Te carbonyl protein was diluted to a fnal concentration of 20 �g trypsin in network was obtained from the GeneMANIA Cytoscape 50 �Lammoniumbicarbonate(100�L) and then reacted in plugin (version 3.2) and STRING9.0 multiple name analysis ∘ a37C for 18 h. Te enzymatically digested peptide sam- sofware. ples were freeze-dried using a vacuum freeze dryer and ∘ stored at −80 C until use for mass spectrometry analyses 2.8. Western Blot Analysis of CaMKII � and �. We used the [22, 23]. BCA Protein Assay Kit (Wellbio, American Diagnostica Inc., Bloomberg, USA) to determine total protein concentration andperformedtheassayaccordingtothemanufacturer’s 2.7.3. ESI-Q-TOF-MS. Te ESI-Q-TOF-MS (Brooke Inc., instructions. Total cellular protein extracts were separated USA) and the liquid chromatography mass spectrometer on 10% SDS-polyacrylamide gel and transferred to PVDF equipped with a C18 reversed-phase column, capillary liq- membranes. A T-Pro prestained protein ladder was used uid chromatograph, and nanoliter spray source were used as a molecular marker to estimate the size of the proteins. for mass spectrometry. Te ESI-Q-TOF-MS spectra were Te membranes were incubated with the primary antibod- measured on a micrOTOF-Q II mass spectrometer (Bruker ies, anti-CaMK II �(∼55 kD,11533-1-AP, Proteintech Group, Daltonics, Fremont, CA, USA) using nanocolumns (75 mm USA), anti-CaMK II� (∼55 kD, NO.20666-1-AP, Proteintech × 150 mm; Dionex, Sunnyvale, CA, USA) in conjunction Group, USA), and anti-GAPDH (∼36kDa, NO.10494-1-AP, with nano-liquid chromatography (LC) (Ultimate 3000; ProteintechGroup,USA)followedbyanHRP-conjugated Dionex) for protein identifcation (nanoLC-MS/MS) with an secondary antibody (Proteintech). Te separated proteins autosampler pump. were detected by developing the PVDF membranes (NO. Te digested peptide mixture produced by trypsin 10285-1-AP, Proteintech) with a ChemiLucent ECL Detection hydrolysis was injected into the mass spectrometer from System (Millipore, Billerica, MA, USA). Te exposed X-ray the autosampler dish. Te ESI source was as follows: 1.2 kV, ∘ flmswerescannedusingtheTanonGelImageShooting desolvation temperature, 150 C. Te sample was introduced System (Tanon, Shanghai, China), and data analysis was with a fow rate of 0.3 �L/min using a water/acetonitrile performed on the Tanon Gel Image Processing System and gradient. All mass spectra were in positive ion mode and Image J (National Institute of Mental Health, Bethesda, the collision gas was argon for MS/MS measurements. Te Maryland, USA). instrument calibration range was 100–3000 m/Z and the external calibration standard (Tunemix;Bruker) was supplied 2.9. Real-Time Quantitative Polymerase Chain Reaction (RT- by Agilent Technologies, Santa Clara, CA, USA. MS and qPCR) Detection of Target mRNA. Total RNA was extracted MS/MS data were automatically collected and processed by using the TRIzol (Invitrogen, Carlsbad, California, USA) Bruker 4.0 sofware (Bruker). and miRNeasy mini kit (QIAGEN, Hilden, Germany) kits, which efectively covers all types of RNA (Table 1). RNA 2.7.4. Carbonylation Proteomics Data Analyses and Bioinfor- solution was determined by UV spectrophotometer (ND- matics. Te MS data were searched by using the database of 1000, Nanodrop Technologies, Wilmington, USA) and the BioMed Research International 5

Table 1: Primers for RT-qPCR.

� � Target gene Accession number Sequence (5 —3 ) F: GAGATTACTGCTCTGGCTCCTA �-actin R: GGACTCATCGTACTCCTGCTTG CaMK IIa KCC2A RAT GeneCopoeia, Inc, USA Catalog#: RQP049239 Vdac1 VDAC1 RAT GeneCopoeia, Inc, USA Catalog#: RQP051105 Itpr1 PI3R RAT GeneCopoeia, Inc, USA Catalog#: RQP045271 Akt1 Akt1 RAT GeneCopoeia, Inc, USA Catalog#: RQP051482 mTOR mTOR RAT GeneCopoeia, Inc, USA Catalog#: RQP050125 UCH-L1 UCH-L1 RAT GeneCopoeia, Inc, USA Catalog#: RQP049756 Hnrnpa2b1 ROA2 RAT GeneCopoeia, Inc, USA Catalog#: RQP055531

Table 2: Te results of open-feld experiments.

Groups Central grid’s staying time (s) Spans Erections Cleansing Defecations M-SED 17.60±8.36 17.40±9.95 4.20±1.93 1.80±0.37 1.00±0.63 ∗∗ ∗ ∗ ∗ M-EX 6.40±3.34 23.60±9.64 7. 0 0 ±2.81 7. 6 0 ±1.96 1.00±0.45 M-SED, middle-aged sedentary control group; M-EX, middle-aged aerobic exercise runner group; ∗� < 0.05 ∗∗� < 0.01 vs. M-SED. ratio of 260/280 (the purity of RNA) ranged from 1.8 to 2.1, experiments to detect dopaminergic function activity def- indicating that the RNA solution can be used in the next ciency [24]. Central lattice retention time was signifcantly experiment. lower in the M-EX as compared to the M-SED group (P < Analyzed from the amplifcation profle and dissolution 0.01). On the other hand, the number of spans, erections, profle of the target mRNA by RT-qPCR, it is shown that and cleansing episodes was higher in the M-EX than in the theamplifcationefciencywashigh,theTmvaluewasof M-SED group (P < 0.05), while there was no signifcant uniform nature and specifcity, and there were no nonspecifc diference in defecation (P > 0.05) (Table 2). amplifcation and dimer formation. At least three samples were randomly assigned in each 3.1.2.ResultsofAdhesionRemovalExperiment.Te detec- group, and the RT-qPCR was performed for confrming the tion of adhesion removal experiment when detecting motor amplifcation curve and melting curve, and recording the defects may be a more sensitive experimental method than Ct (cycle threshold) value of each gene mRNA. Te mRNA the feld test and is ofen used to detect mild striatal pathway expression of the target gene was quantitatively determined dysfunction [20]. Te nasal adhesion removal experiment by using the method of 2-delta Ct as the internal reference. was completed within 3 min (Table 3). Te time to remove the nasal adhesions was shorter in the M-EX than in the M-SED −ûûCt Target gene mRNA relative quantity =2 group (P < 0.01). All rats removed the adhesive material from ûûCt their forepaws within 5 min, but the time taken was longer in < (1) theM-EXthanintheM-SEDgroup(P 0.01). =(Ct − Ct�− ) target actin Samples 3.2. HE Staining and Microscopic Imaging of the Striatum. −(Ct − Ct�− ) target actin Control A histological analysis of HE-stained striatal tissue sections revealed that the matrix was clearly separated and the gap 2.10. Statistical Analysis. Data from all experiments are pre- between the matrix and striatum was smaller in the M-SED sented as mean ± SEM. Statistical analysis was performed than in the M-EX group, in which the matrix was more using predictive analytics sofware statistics 16.0 (SPSS Inc., compact and the gap was larger (Figure 1). Chicago, IL, USA). Comparisons across the experimental groups were performed using one-way analysis of variance 3.3. Results of the TUNEL Assay. Normal nuclei in the (ANOVA). Te results of behavior experiments were ana- striatum were stained blue whereas apoptotic nuclei appeared lyzed by repeated measures of variance. Statistical signif- brown. Tere were more apoptotic nuclei in the M-SED icance of the efects of the experimental treatment was than in the M-EX group (Figure 2). Some apoptotic nuclei determined by comparing the areas under the curve (p<0.05). appeared vacuolated and some in the M-EX group appeared follicular with a darker color. 3. Results Apoptotic nuclei were detected in the rat striatum; the rate of apoptosis was 100% (Table 4). Te apoptotic index was 3.1. Behavioral Monitoring Indicators in Aging Rats 57% higher in the M-EX than in the M-SED group (P < 0.01). 3.1.1. Results of Open-Field Experiments. Te open-feld 3.4. Diferential Carbonyl Proteomics Analysis. Te ESI-Q- experiment is a sensitive method commonly used in animal TOF-MS/MS analysis identifed 36 carbonylated proteins 6 BioMed Research International

Table 3: Te results of adhesion removal experiment.

Groups Te nasal adhesion removal experiment (s) Te paw adhesion removal experiment (s) M-SED 26.13±7.42 8.97±1.86 ∗∗ ∗∗ M-EX 10.56±2.47 15.41±2.82 ∗ ∗∗ M-SED, middle-aged sedentary control group; M-EX, middle-aged aerobic exercise runner group; � < 0.05 � < 0.01 vs. M-SED.

Table 4: Apoptosis rates as determined by the TUNEL assay.

Groups apoptosis index (AI) M-SED 7.00±2.71 ∗∗ M-EX 10.99±2.93 M-SED, middle-aged sedentary control group; M-EX, middle-aged aerobic ∗ ∗∗ exercise runner group; � < 0.05 � < 0.01 vs. M-SED; AI, apoptotic index.

M-SED (×200) M-EX (×200 )

Figure 2: Microscopic images of TUNEL assay (arrows indicate apoptotic nuclei). M-SED, middle-aged sedentary control group; M-EX, middle-aged aerobic exercise runner group; TUNEL, TdT- mediated dUTP nick end labeling.

No information, 5.93% M-SED (×200) M-EX (×200 ) Nucleus,5.08%

Figure 1: Microscopic images of HE staining. M-SED, middle- Cell junction aged sedentary control group; M-EX, middle-aged aerobic exercise Secreted runner group; HE, haematoxylin and eosin (arrows indicate the Cytosol, 5.08% striatum matrix.).

Cytoplasm, 44.07% Mitochondrion, with oxidation modifcation sites in both the M-SED and M- 19.49% EX groups. Tere were 17 and 19 carbonylated proteins with such sites that were specifc to the M-SED and M-EX groups, respectively, whereas 40 of the proteins were common to both Cell membrane groups (Table 5). Membrane Carbonylated proteins with oxidation modifcation 20% sitesthatwereuniquetotheM-SEDgroupincluded CaMKII�, synaptosomal-associated protein 25 (Snap25), synapsin-2 (Syn2), heterogeneous nuclear ribonucleoprotein Figure 3: Subcellular localization of carbonylated proteins in rats’ (Hnrnp)a2b1, complement component 1q subunit-like striatum. protein (C1QBP), G protein/guanylate binding protein (GnB)4, T-complex protein 1 subunit epsilon (Cct5), and neuromodulin (Gap43). Tose specifc to the M-EX group the Ras-Raf-mitogen-activated protein kinase (MAPK)-ERK included isocitrate dehydrogenase [NAD] subunit alpha signaling pathway [25]. (Idh3a), synaptophysin (Syp), ubiquitin carboxyl-terminal A search of the Swiss-Prot/Uniprot database revealed hydrolase isozyme (UCH)-L1, elongation factor 1 (Eef1a1), the localization of the identifed carbonylated proteins as acid aldolase A fructose-diphosphate aldolase (ALDOA), cytoplasm (44.07%), mitochondria (19.49%), cell mem- myelin-oligodendrocyte glycoprotein (MOG), and malate brane (20.34%), nucleus (5.08%), junction/secreted/cytosol dehydrogenase (MDH)2 (Table 5). (5.08%), and no information (5.93%) (Figure 3). CAMKII� is a component of the N-methyl-d-aspartate Protein carbonyl modifcations include (1) carbonyl receptor (NMDAR) complex in excitatory synapses and may groups that can be oxidized by amino acid side chains (pro- regulate NMDAR-dependent potentiation of the �-amino- line, arginine, lysine, threonine, glutamic acid, and aspartate 3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor and residues) that are directly formed in proteins or the �-amide synaptic plasticity. HnRNPs bind to neonatal transcripts and or diamide pathway oxidatively cleaving the polypeptide are involved in messenger RNA biosynthesis, DNA repair, backbone;(2)proteinsthatcanalsobeanindirectcarbony- telomere biogenesis, cell signaling, and gene expression regulation product of lipid peroxidation, such as 4-hydroxy-2- lation. Studies have shown that Hnrnpa2b1 is closely related to nonenal, 2-propionaldehyde, and malondialdehyde (Michael BioMed Research International 7 1 5 5 3 5 4 ND ND ND ND ND ND ND ND ND ND ND 3(1) ND 3(2) 2(2) 4(2) 6(4) M-EX ND ND ND ND ND ND 4(1) 3(2) 5(2) 5(2) 10(7) 26(20) 14(13) 63 70 46 113 919 168 ND NDND ND ND ND ND ND ND ND 1 5 3 3 2 8 9 4 6 7 14 17 3(1) 2(1) 2(1) 7(5) 3(2) 5(2) 3(2) 3(2) 8(7) 5(4) 4(3) M-SED 7(1) 4(1) 3(2) 4(3) 6(3) 9(3) 4(3) 4(3) 9(4) 16(12) 14(10) 52 25 4(1) 2(1) 4 58 76 20 69 60 87 122 120 317 488 2062 66(52) 20(17) Table 5: Te screening of the diferent carbonylated proteins in rats’ striatum. Score Matches Sequences Unique Score Matches Sequences Unique Guanine Guanine Guanine Guanine GN=Tubb3 GN=Atp1b1 GN=Atp12a GN=Atp1a2 GN=CaMKIIb subunit alpha-2, beta-1,GN=Gnb1 beta-2, GN=Gnb2 G(o) subunit alpha Sodium/potassium- Sodium/potassium- type II subunit beta, transporting ATPase Tubulin beta-3 chain, Calcium/calmodulin- ATPase alpha chain 2, Cytochrome c oxidase Cytochrome c oxidase OS=Rattus norvegicus OS=Rattus norvegicus protein, mitochondrial GN=C1qbp PE=1 SV=2 GN=Gnao1 PE=1 SV=2 subunit 5B, GN=Cox5b subunit 5A, GN=Cox5a Potassium-transporting G(I)/G(S)/G(T) subunit G(I)/G(S)/G(T) subunit dependent protein kinase Q subcomponent-binding subunit beta-4, GN=Gnb4 Complement component 1 nucleotide-binding protein nucleotide-binding protein nucleotide-binding protein nucleotide-binding protein Neuromodulin, GN=Gap43 transporting ATPase beta-1, a a a a a a a a a a a a a RAT RAT RAT RAT RAT RAT RAT RAT RAT RAT RAT RAT RAT GBB1 AT1B1 C1QBP GBB4 COX5B Accession number carbonylated proteins AT12A TBB3 NEUM COX5A GBB2 AT1A2 KCC2B GNAO 8 BioMed Research International 3 3 3 3 5 5 2 2 2 3 2 8 4 4 4 4 6 12 10 ND ND ND ND 3(1) 3(1) 3(1) 5(1) 3(1) 2(1) 2(1) 2(1) ND ND ND ND 4(1) 4(1) 3(3) 8(2) 3(0) 2(0) 4(2) 2(0) 4(2) 12(1) M-EX 3(1) 2(1) 3(1) 3(1) 3(1) 3(1) 2(1) ND ND ND ND 4(1) 4(1) 5(2) 5(2) 8(2) 5(4) 2(0) 2(0) 6(2) 4(0) 12(1) 22(14) 11(7) 41 17 78 24 45 45 24 43 29 28 54 56 36 57 48 27 46 46 470 ND ND ND ND 5 3 2 4 9 ND ND ND ND ND ND ND ND ND ND ND ND ND ND 3(1) 2(1) ND ND ND ND ND ND ND ND ND ND ND ND ND ND 4(1) 2(2) Table 5: Continued. M-SED 3(1) 2(1) ND ND ND ND ND ND ND ND ND ND ND ND ND ND 4(1) 5(3) 30(20) 11(6) 56 57 64 6(1) 6(1) 6 66 46 682 ND ND ND ND ND ND ND ND ND ND NDND ND ND ND ND ND ND ND ND Score Matches Sequences Unique Score Matches Sequences Unique Ubiquitin GN=Mdh1 GN=Idh3a 1,GN=Arf1 GN=Mdh2 GN=Ywhae GN=Ywhab 1,GN=Actc1 1,GN=Eef1a1 L1,GN=Uchl1 Adenylate kinase carboxyl-terminal hydrolase isozyme ribonucleoproteins Drebrin, GN=Dbn1 ND Proflin-2,GN=Pfn2 ND T-complex protein 1 Succinyl-CoA ligase [ADP/GDP-forming] Synapsin-2,GN=Syn2 isoenzyme 1,GN=Ak1 [NAD] subunit alpha, aldolase A,GN=Aldoa 14-3-3 protein epsilon, Fructose-bisphosphate Myosin-10,GN=Myh10 ND Malate dehydrogenase, Malate dehydrogenase, A2/B1,GN=Hnrnpa2b1 Heterogeneous nuclear protein 25,GN=Snap25 Hexokinase-1,GN=Hk1 ND glycoprotein, GN=Mog ADP-ribosylation factor Myelin-oligodendrocyte Synaptophysin, GN=Syp ND Isocitrate dehydrogenase Elongation factor 1-alpha Synaptosomal-associated 14-3-3 protein beta/alpha, subunit epsilon,GN=Cct5 subunit alpha, GN=Suclg1 Alpha-actinin-1,GN=Actn1 ND Actin, alpha cardiac muscle b b b b b b b b a b b b a b b b b a b a b b b RAT RAT RAT RAT RAT RAT RAT RAT RAT RAT RAT RAT RAT RAT RAT RAT RAT RAT RAT RAT RAT RAT RAT 1433E SYPH PROF2 MOG MYH10 SNP25 EF1A1 HXK1 MDHC SYN2 SUCA DREB TCPE IDH3A ALDOA KAD1 1433B Accession number carbonylated proteins ROA2 ARF1 ACTN1 ACTC UCHL1 MDHM M-SED, middle-aged sedentary control group; M-EX, middle-aged aerobic exercise runner group; letter a is M-SED; letter b is M-EX. BioMed Research International 9

8 ∗∗ M-SED M-EX 7 CaMKII 55KD 6 5 CaMKII 55KD ∗∗ 4 GAPDH 36KD 3 2 1.4

mRNA expression levels expression mRNA ∗∗ 1 1.2 ∗∗ 0 1 M-SED M-EX 0.8

Hnrnpa2b1 0.6 Uchl1 0.4 0.2

Figure 4: mRNA expression levels of Hnrnpa2b1 and UCH-L1 as CaMKII  and  /GAPDH determined by RT-qPCR. M-SED, middle-aged sedentary control 0 ∗∗ group; M-EX, middle-aged aerobic exercise runner group; � < M-SED M-EX ∗∗ 0.05 � < 0.01 vs. M-SED; Hnrnpa2b1, heterogeneous nuclear CaMKII ribonucleoproteins A2/B1; UCH-L1, ubiquitin carboxyl-terminal CaMKII hydrolase isozyme L1. Figure 5: CaMKII� and � expression in the rat striatum. M-SED, middle-aged sedentary control group; M-EX, middle-aged aerobic ∗ � ∗∗� and/or Schif bases are added to cysteine, histidine, or lysine exercise runner group; < 0.05 < 0.01 vs. M-SED; CaMKII � � 2+ � � residues); and (3) the formation of advanced glycation end and ,Ca /calmodulin-dependent protein kinases and ; products and free radical-oxidized proteins that formed GAPDH, glyceraldehyde-3-phosphate dehydrogenase. carbonylated proteins. Tese proteins can be oxidized in more than 35 ways and all three of these basic posttranslational modifcations can be distinguished by mass spectrometry. We hydroxykynurenine]; Trp->Kynurenin(W)[tryptophanoxi- found that oxidatively modifed sites involved 28 species, as dation to kynurenine]; Trp->Oxolactone (W) [tryptophan follows: Oxidation (C-term G), Oxidation (D), Oxidation (F), oxidation to oxolactone]. Oxidation (HW), Oxidation (K), Oxidation (M), Oxidation (N), Oxidation (R), Oxidation (Y) [oxidation or hydroxylation]; Oxidation (C) [cysteine sulfenic acid]; Oxidation (P) 3.5. Screening Target Genes from Diferentially Carbonylated [proline oxidation to glutamic semialdehyde]; Dioxidation Proteins. Te results revealed that further studies are needed (C) [sulfnic acid]; Dioxidation (F) [phenylalanine oxidation to elucidate the role of protein carbonylation of Hnrnpa2b1 to dihydroxyphenylalanine]; Dioxidation (M) [sulphone]; and UCH-L1. Te mRNA expression levels of UCH-L1 Dioxidation (W) [tryptophan oxidation to formylkynure- andHnrnpa2b1weresignifcantlyupregulatedintheM- < nine]; Dioxidation (K), Dioxidation (P), Dioxidation (R) EX group, as compared with the M-SED group (P 0.01; [dioxidation or dihydroxy]; Trioxidation (C) [cysteine oxi- Figure 4). dation to cysteic acid]; HNE (C), HNE (H), HNE (K) [4-hydroxynonenal Michael adduct]; glucosone (R) [con- 3.6. Screening of the CaMK Pathway by Diferential Carbony- densation product of glucosone]; Lys->Allysine (K) [lysine lation Proteomics. Te carbonylated proteins with oxidation oxidation to aminoadipic semialdehyde]; 3-deoxyglucosone modifcation sites unique to the M-SED group included (R) [3-deoxyglucosone adduct]; Arg->GluSA (R) [arginine CaMKII�. CaMKII� and CaMKII� are of the most abundant oxidation to glutamic semialdehyde]; Delta:H(2)C(5) (K) protein kinases in the brain that regulate calcium signaling, [adduct formed from malondialdehyde (MDA) ]; 4-ONE (C) a critical molecule in multiple signal transduction pathways, [4-Oxononenal]; Arg biotin hydrazide (R) [oxidized argi- andplayakeyroleinsynapticplasticity,learning,and nine biotinylated with biotin hydrazide]; Lysbiotinhydrazide memory [26]. In addition, they are highly expressed in a (K) [oxidized lysine biotinylated with biotin hydrazide]; specifc subcellular localization in neurons, wherein they OxLysBiotin (K) [oxidized lysine biotinylated with biotin- convert the intracellularly elevated calcium signals to a range LC-hydrazide]; probiotinhydrazide (P) [oxidized proline of target proteins, including ion channels and transcriptional biotinylated with biotin hydrazide]; Trbiotinhydrazide (T) activators; the synaptic transmission has regulatory roles in [oxidized Treonine biotinylated with biotin hydrazide]; downstream signaling pathway-associated proteins [27]. Didehydro (T) [2-amino-3-oxo-butanoic acid]; Pro->pyro- CaMKII � and � protein level was upregulated in Glu (P) [proline oxidation to pyroglutamic acid]; Pro- theM-EXascomparedtotheM-SEDgroup(P< 0.01; >Pyrrolidinone (P) [proline oxidation to pyrrolidinone]; Figure 5). Additionally, CaMKII� and voltage-dependent Trp->Hydroxykynurenine (W) [tryptophan oxidation to anion-selective channel protein (VDAC)1 mRNA levels were 10 BioMed Research International

6.0 1.6 ∗∗ 5.0 1.4 ∗∗

4.0 1.2 ∗ ∗∗ 1.0 3.0 0.8 2.0 0.6 1.0 mRNA expression levels expression mRNA 0.4 0.0 levels expression mRNA M-SED M-EX 0.2 CaMKII 0.0 Vdac1 M-SED M-EX � PI3K Figure 6: mRNA expression levels of CaMKII and Vdac1 by Akt1 RT-qPCR. M-SED, middle-aged sedentary control group; M-EX, MTOR ∗ ∗∗ middle-aged aerobic exercise runner group; � < 0.05 � < 0.01 vs. 2+ M-SED; CaMKII�,Ca /calmodulin-dependent protein kinases or Figure 7: mRNA expression levels of PI3K, Akt, and mTOR, as � determined by RT-qPCR. M-SED, middle-aged sedentary control CaM kinases ; Vdac1, voltage-dependent anion-selective channel ∗ group; M-EX, middle-aged aerobic exercise runner group; � < protein 1. ∗∗ 0.05 � < 0.01 vs. M-SED; PI3K, phosphoinositide 3-kinase; Akt, protein kinase B; and mTOR, mammalian target of rapamycin. upregulatedintheM-EXascomparedtotheM-SEDgroup (P < 0.01; Figure 6). On the other hand, CaMKII� and Hnrnpa2b1 mRNA levels were upregulated in the M-EX group. HNE inhibits 3.7. Screening of the Phosphoinositide 3-Kinase/Protein Kinase 2+ B/Mammalian Target of Rapamycin (PI3K/Akt/mTOR) Path- oxidant-induced Ca release from the mitochondria in a concentration-dependent manner (10–50 �M) [32, 33]; waybyDiferentialCarbonylationProteomics.mTOR not + this requires oxidation of NADH to NAD ,whichin only regulates cell proliferation and survival but also par- + ticipates in membrane transport and protein degradation, turn hydrolyzes NAD to niacinamide and mono-ADP- especially in the regulation of protein translation levels. ribose following transient binding of mono ADP-ribose to mitochondrial proteins. Inhibition of pyridine nucleotide Recently, rapamycin has been shown to promote autophagy 2+ hydrolysis by HNE results in Ca overload in mitochondria andapoptosis,removeabnormalproteinssuchasamyloid 2+ polypeptide in AD and mutated �-synuclein in familial PD, and inhibition of Ca -dependent mitochondrial enzymes, and thus treat related diseases [28]. leading to disruption of the cell cycle, and inhibition of DNA PI3K mRNA level was downregulated (P > 0.05) whereas synthesis and cell proliferation [34, 35]. the mRNA levels of Akt (P < 0.01) and mTOR (P < 0.05) were Carbonylated proteins unique to the M-EX group upregulatedintheM-EXascomparedtotheM-SEDgroup included Idh3a, Syp, Uchl1, Eef1a1, ALDOA, MOG, and (Figure 7). MDH2. Interestingly, the mRNA levels of UCH-L1 were upregulated in this group, suggesting that regular aerobic exercise modulates proteins associated with mitochondrial 4. Discussion and striatum development-related signaling transduction proteins. However, additional studies are needed to clarify the 4.1. Efects of Regular Aerobic Exercise on Protein Carbony- specifc mechanisms involved. Exercise leads to stress (oxida- lation in the Rat Striatum. Te ESI-Q-TOF-MS/MS analysis tive and ischemia-reperfusion) mainly from diferences in identifed 36 carbonylated proteins in the rat striatum, of energy metabolism and demand [36, 37]. which 17 and 19 were specifc to the M-SED and M-EX groups, respectively. Te carbonylated proteins were related to energy metabolism, mitochondrial inner membrane, 4.2. Efects of Regular Aerobic Exercise on Apoptosis and ATPase activity, development, synaptic conduction, axonal Regulation of the CaMK/mTOR Signaling Pathway in the targeting, and aging, suggesting that protein carbonylation Rat Striatum. Accumulation of carbonylated proteins can isselectiveandthattherelativeamountofproteindoesnot lead to polymerization of damaged proteins, dysregulation of determine the degree of modifcation. Protein carbonylation cellular function, and other pathophysiological changes that increases with aging and is especially abundant in elderly accelerate aging. Proteins that are overoxidized and cross- individuals; nearly one-third of all proteins are carbonylated linked cannot be degraded by the proteasome, possibly due to [29, 30]. Erroneously translated proteins are prone to and structural changes that render the catalytic site of the enzyme become less stable afer carbonylation [31]. complex unrecognizable or inaccessible, eventually leading to Carbonylated proteins specifc to the M-SED group apoptosis [38]. In the present study, we detected apoptotic included CaMKII�, Snap25, Syn2, Hnrnpa2b1, and Gap43. nuclei in the rat striatum; the rate of apoptosis was 100%, and BioMed Research International 11 the apoptotic index of the striatum was 57% higher in the M- Acknowledgments EX as compared to the M-SED group. CaMKII, among the most abundant protein kinases in Tis study was supported by the National Natural Science the brain, regulates calcium signaling and plays an important Foundation of China (grant nos. 81702236 and 31271257), role in multiple signal transduction pathways involved in CSC (grant no. 201706720028), Hunan Provincial Natural synaptic plasticity, learning, and memory [26, 39]. We found Science Foundation of China (grant nos. 2018JJ3363 and here that carbonylation of CaMKII� was specifc to the 11JJ6082), Scientifc Research Fund of Hunan Provincial M-SED group, whereas the CaMK pathway-related genes Education Department (grant no. 12B088), and Hunan CaMKII� and VDAC1 were signifcantly increased in the Normal University for Distinguished Young Scholars M-EX group, indicating that regular aerobic exercise is (grant no. ET1507). We thank International Science Editing benefcial for maintaining calcium regulation. CaMKII is an (http://www.internationalscienceediting.com/) for editing important component of postsynaptic densities, accounting this manuscript. for 30%–50% of all synaptic proteins [40]; it is thought to play an important role in long-term memory. CaMKII phospho- References rylates synaptophysin I, which then fuses to the presynap- tic membrane and stimulates neurotransmitter release [41]. [1] D. Yin and K. Chen, “Te essential mechanisms of aging: irrep- Maintaining intracellular calcium homeostasis is critical for arable damage accumulation of biochemical side-reactions,” neuronal functions; a perturbation of this process can lead to Experimental Gerontology,vol.40,no.6,pp.455–465,2005. cell damage or death [42, 43]. [2] E. A. Kosenko, I. N. Solomadin, L. A. Tikhonova, V. Prakash Te PI3K/Akt/mTOR signaling pathway is involved in Reddy, G. Aliev, and Y. G. Kaminsky, “Pathogenesis of Alz- cellsurvival[44],aswellascellproliferation,apoptosis, heimer disease: Role of oxidative stress, Amyloid-� peptides, and diferentiation and metabolism [45, 46]. Interestingly, systemic ammonia and erythrocyte energy metabolism,” CNS Akt and mTOR transcript levels were upregulated by regular and Neurological Disorders - Drug Targets,vol.13,no.1,pp.112– 119, 2014. aerobic exercise, which is known to induce CaMK and PI3K/Akt/mTOR signaling pathways to prevent excessive [3]R.J.Castellani,P.I.Moreira,G.Perry,andX.Zhu,“Terole apoptosis in the rat striatum as a neuroprotective mechanism. of iron as a mediator of oxidative stress in Alzheimer disease,” BioFactors,vol.38,no.2,pp.133–138,2012. In the injured spinal cord, treadmill exercise promoted the recovery of motor function by suppressing apoptosis [47]. [4]X.Zhu,A.K.Raina,H.-G.Leeetal.,“Oxidativestressand Te benefcial efects of exercise may be attributed to the neuronal adaptation in Alzheimer disease: the role of SAPK pathways,” Antioxidants & Redox Signaling,vol.5,no.5,pp.571– increased release of neurotrophic factors via activation of 576, 2003. the PI3K/Akt pathway: exercise afer brain injury increased the production of nerve growth factor and brain-derived [5] W. R. Markesbery, “Te role of oxidative stress in Alzheimer disease,” JAMA Neurology,vol.56,no.12,pp.1449–1452,1999. neurotrophic factor and the activation of TrkA/B receptor, which activated the PI3K/Akt pathway and inhibited [6] K. H. Cooper, M. L. Pollock, R. P. Martin, S. R. White, A. C. apoptosis of hippocampal neurons [48]. Long-term regular Linnerud, and A. Jackson, “Physical Fitness Levels vs Selected Coronary Risk Factors: A Cross-Sectional Study,” Journalofthe aerobic exercise itself is a stress stimulus [17]; however, a American Medical Association,vol.236,no.2,pp.166–169,1976. moderate amount of physical activity strengthens the body [49–51] and can improve the functioning of various organs, [7] H. Kawaguchi, T. Obata, H. Takano, T. Nogami, T. Suhara, and H. Ito, “Relation between dopamine synthesis capacity and cell- reduce the incidence of disease, and improve quality of life level structure in human striatum: A multi-modal study with [52, 53]. positron emission tomography and difusion tensor imaging,” PLoS ONE,vol.9,no.1,2014. 5. Conclusions [8]R.Cools,S.E.Gibbs,A.Miyakawa,W.Jagust,andM. D’Esposito, “Working memory capacity predicts dopamine syn- Regular aerobic exercise for 10 weeks (incremental for the frst thesis capacity in the human striatum,” Te Journal of Neuro- 6 weeks followed by constant loading for 4 weeks) enhanced science,vol.28,no.5,pp.1208–1212,2008. � carbonylation of CaMKII and Hnrnpa2b1 and modulated [9] I. Willuhn and H. Steiner, “Motor-skill learning in a novel apoptosis via activation of CaMK and phosphoinositide 3- running-wheel task is dependent on D1 dopamine receptors in kinase/protein kinase B/mTOR signaling. It also promoted the striatum,” Neuroscience,vol.153,no.1,pp.249–258,2008. normal apoptosis in the rat striatum, which may have pro- [10] A. C. Kreitzer and R. C. Malenka, “Endocannabinoid-mediated tective efects in neurons. rescue of striatal LTD and motor defcits in Parkinson’s disease models,” Nature,vol.445,no.7128,pp.643–647,2007. Data Availability [11] F. Remmers, M. D. Lange, M. Hamann, S. Ruehle, H.-C. Pape, and B. Lutz, “Addressing sufciency of the CB1 receptor Tedatausedtosupportthefndingsofthisstudyare for endocannabinoid-mediated functions through conditional available from the corresponding author upon request. genetic rescue in forebrain GABAergic neurons,” Brain Struc- ture & Function,vol.222,no.8,pp.3431–3452,2017. Conflicts of Interest [12]H.Chen,S.M.Zhang,M.A.Schwarzschild,M.A.Hernan,´ and A. Ascherio, “Physical activity and the risk of Parkinson Teauthorshavedeclarednoconfictsofinterest. disease,” Neurology,vol.64,no.4,pp.664–669,2005. 12 BioMed Research International

[13]E.L.Tacker,H.Chen,A.V.Pateletal.,“Recreationalphysical [29] E. R. Stadtman, “Protein oxidation and aging,” Free Radical activity and risk of Parkinson’s disease,” Movement Disorders, Research,vol.40,no.12,pp.1250–1258,2006. vol.23,no.1,pp.69–74,2008. [30] E. R. Stadtman and R. L. Levine, “Free radical-mediated oxida- [14]Q.Xu,Y.Park,X.Huangetal.,“Physicalactivitiesandfuture tion of free amino acids and amino acid residues in proteins,” risk of Parkinson disease,” Neurology,vol.75,no.4,pp.341–348, Amino Acids,vol.25,no.3-4,pp.207–218,2003. 2010. [31] S. Dukan, A. Farewell, M. Ballesteros, F. Taddei, M. Rad- [15]E.Koltai,N.Hart,A.W.Tayloretal.,“Age-associateddeclines man, and T. Nystrom,¨ “Protein oxidation in response to in mitochondrial biogenesis and protein quality control fac- increased transcriptional or translational errors,” Proceedings of tors are minimized by exercise training,” American Journal of the National Acadamy of Sciences of the United States of America, Physiology-Regulatory, Integrative and Comparative Physiology, vol. 97, no. 11, pp. 5746–5749, 2000. vol. 303, no. 2, pp. R127–R134, 2012. [32] S. D. Klein, M. Schweizer, and C. Richter, “Inhibition of the [16] T. G. Bedford, C. M. Tipton, N. C. Wilson, R. A. Oppliger, pyridine nucleotide-linked mitochondrial Ca(2+) release by and C. V. Gisolf, “Maximum oxygen consumption of rats and 4-hydroxynonenal: the role of thiolate-disulfde conversion,” its changes with various experimental procedures,” Journal of Redox report : communications in free radical research,vol.2,no. Applied Physiology,vol.47,no.6,pp.1278–1283,1979. 6, pp. 353–358, 2016. [17] W.Liu, G. Chen, F. Li, C. Tang, and D. Yin, “Calcineurin-NFAT [33] C. Richter and P. Meier, “Inhibition of pro-oxidant-induced signaling and neurotrophins control transformation of myosin mitochondrial pyridine nucleotide hydrolysis and calcium heavy chain isoforms in rat soleus muscle in response to aerobic release by 4-hydroxynonenal,” Biochemical Journal,vol.269,no. treadmill training,” JournalofSportsScienceandMedicine,vol. 3, pp. 735–737, 1990. 13,no.4,pp.934–944,2014. [34] E. Wawra, H. Zollner, R. J. Schaur, H. M. Tillian, and E. [18] J. Glowinski, J. Axelrod, and L. L. Iversen, “Regional studies Schauenstein, “Te inhibitory efect of 4-hydroxy-nonenal on of catecholamines in the rat brain. IV. Efects of drugs on the DNA-polymerases alpha and beta from rat liver and rapidly disposition and metabolism of H3-norepinephrine and H3- dividing Yoshida ascites hepatoma,” Cell Biochemistry & Func- dopamine.,” Te Journal of Pharmacology and Experimental tion,vol.4,no.1,pp.31–36,1986. Terapeutics, vol. 153, no. 1, pp. 30–41, 1966. [35] S. Hauptlorenz, H. Esterbauer, W.Moll, R. Pumpel,¨ E. Schauen- stein, and B. Puschendorf, “Efects of the lipidperoxidation [19] G. Zhang, G. Shi, H. Tan, Y. Kang, and H. Cui, “Intranasal product 4-hydroxynonenal and related aldehydes on prolif- administration of testosterone increased immobile-snifng, eration and viability of cultured ehrlich ascites tumor cells,” exploratory behavior, motor behavior and grooming behavior Biochemical Pharmacology,vol.34,no.21,pp.3803–3809,1985. in rats,” Hormones and Behavior,vol.59,no.4,pp.477–483,2011. [36] L. L. Ji, M. Gomez-Cabrera, and J. Vina, “Exercise and hormesis: [20] T.Schallert, M. Upchurch, N. Lobaugh et al., “Tactile extinction: activation of cellular antioxidant signaling pathway,” Annals of Distinguishing between sensorimotor and motor asymmetries the New York Academy of Sciences,vol.1067,no.1,pp.425–435, in rats with unilateral nigrostriatal damage,” Pharmacology 2006. Biochemistry & Behavior,vol.16,no.3,pp.455–462,1982. [37] L. L. Ji, “Exercise-induced modulation of antioxidant defense,” [21] C. Coughlan, D. I. Walker, K. M. Lohr et al., “Comparative Annals of the New York Academy of Sciences,vol.959,pp.82–92, proteomic analysis of carbonylated proteins from the striatum 2002. and cortex of pesticide-treated mice,” Parkinson’s Disease,vol. [38]I.Kruman,A.J.Bruce-Keller,D.Bredesen,G.Waeg,andM.P. 2015, 2015. Mattson, “Evidence that 4-hydroxynonenal mediates oxidative [22] X. Hu, Z. Duan, H. Hu et al., “Proteomic profle of carbonylated stress-induced neuronal apoptosis,” Te Journal of Neuroscience, proteins in rat liver: exercise attenuated oxidative stress may be vol.17,no.13,pp.5089–5100,1997. involved in fatty liver improvement,” Proteomics,vol.13,no.10- [39] A. Ghosh and M. E. Greenberg, “Calcium signaling in neurons: 11, pp. 1755–1764, 2013. Molecular mechanisms and cellular consequences,” Science,vol. [23] A. G. Madian and F. E. Regnier, “Proteomic identifcation 268, no. 5208, pp. 239–247, 1995. of carbonylated proteins and their oxidation sites,” Journal of [40] J. Lisman, “Te CaM kinase II hypothesis for the storage of Proteome Research, vol. 9, no. 8, pp. 3766–3780, 2010. synaptic memory,” Trends in Neurosciences,vol.17,no.10,pp. [24] L. Chen, B. Cagniard, T. Mathews et al., “Age-dependent motor 406–412, 1994. defcits and dopaminergic dysfunction in DJ-1 null mice,” Te [41] P.Greengard,F.Valtorta,A.J.Czernik,andF.Benfenati,“Synap- JournalofBiologicalChemistry,vol.280,no.22,pp.21418–21426, tic vesicle phosphoproteins and regulation of synaptic func- 2005. tion,” Science,vol.259,no.5096,pp.780–785,1993. [25] S. P. Han, Y. H. Tang, and R. Smith, “Functional diversity of the [42] M. J. Berridge, M. D. Bootman, and P. Lipp, “Calcium—a life hnRNPs: Past, present and perspectives,” Biochemical Journal, and death signal,” Nature, vol. 395, no. 6703, pp. 645–648, 1998. vol. 430, no. 3, pp. 379–392, 2010. [43] J. Mar´ın, A. Encabo, A. Briones, E.-C. G. Cohen, and M. J. [26] R. C. Malenka and R. A. Nicoll, “Long-term potentiation—a Alonso, “Mechanisms involved in the cellular calcium home- decade of progress?” Science,vol.285,no.5435,pp.1870–1874, ostasis in vascular smooth muscle: calcium pumps,” Life Sci- 1999. ences,vol.64,no.5,pp.279–303,1999. [27] W. Lucchesi, K. Mizuno, and K. P. Giese, “Novel insights into [44] D.MorgenszternandH.L.McLeod,“PI3K/Akt/mTORpathway CaMKII function and regulation during memory formation,” as a target for cancer therapy,” Anti-Cancer Drugs,vol.16,no.8, Brain Research Bulletin, vol. 85, no. 1-2, pp. 2–8, 2011. pp. 797–803, 2005. [28] M. A. Lynch-Day, K. Mao, K. Wang, M. Zhao, and D. J. Klionsky, [45] N. Fujita, S. Sato, K. Katayama, and T. Tsuruo, “Akt-dependent “Te role of autophagy in Parkinson’s disease,” Cold Spring phosphorylation of p27Kip1 promotes binding to 14-3-3 and Harbor Perspectives in Medicine,vol.2,no.4,ArticleIDa009357, cytoplasmic localization.,” TeJournalofBiologicalChemistry, 2012. vol. 277, no. 32, pp. 28706–28713, 2002. BioMed Research International 13

[46] S. Sato, N. Fujita, and T. Tsuruo, “Modulation of Akt kinase activity by binding to Hsp90,” Proceedings of the National Acadamy of Sciences of the United States of America,vol.97,no. 20, pp. 10832–10837, 2000. [47] S.-Y. Jung, D.-Y. Kim, T. Y. Yune, D.-H. Shin, S.-B. Baek, and C.-J. Kim, “Treadmill exercise reduces spinal cord injury- induced apoptosis by activating the PI3K/Akt pathway in rats,” Experimental and Terapeutic Medicine,vol.7,no.3,pp.587– 593, 2014. [48] T. L. X. Nguyen, C. K. Kim, J.-H. Cho, K.-H. Lee, and J.-Y. Ahn, “Neuroprotection signaling pathway of nerve growth factor and brain-derived neurotrophic factor against staurosporine induced apoptosis in hippocampal H19-7 cells,” Experimental & Molecular Medicine, vol. 42, no. 8, pp. 583–595, 2010. [49] D. P. Jones, “Redefning oxidative stress,” Antioxidants & Redox Signaling,vol.8,no.9-10,pp.1865–1879,2006. [50]L.Li,G.Li,S.Sheng,andD.Yin,“Substantialreactionbetween histamine and malondialdehyde: A new observation of carbonyl stress,” Neuroendocrinology Letters,vol.26,no.6,pp.799–805, 2005. [51] D. Suzuki, T. Miyata, and K. Kurokawa, “Carbonyl stress,” Contributions to Nephrology,vol.134,pp.36–45,2001. [52] Z. Radak, H. Y. Chung, and S. Goto, “Exercise and hormesis: oxidative stress-related adaptation for successful aging,” Biogerontology,vol.6,no.1,pp.71–75,2005. [53] Z. Radak, H. Y. Chung, E. Koltai, A. W. Taylor, and S. Goto, “Exercise, oxidative stress and hormesis,” Ageing Research Reviews,vol.7,no.1,pp.34–42,2008. The Scientifc Case Reports in Multiple Sclerosis Scientica World Journal Neurological Medicine Neural Plasticity International Hindawi Hindawi Publishing Corporation Hindawi Hindawi Hindawi www.hindawi.com Volume 2018 http://www.hindawi.comwww.hindawi.com Volume 20182013 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018

Behavioural Stroke Neurology Research and Treatment Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018

Submit your manuscripts at www.hindawi.com

Advances in BioMed Medicine Research International Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018

Computational and Mathematical Methods Depression Research Autism International Journal of Neurology in Medicine and Treatment Research and Treatment Alzheimer’s Disease Research International

Hindawi Hindawi Hindawi Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018

Neuroscience Psychiatry Parkinson’s Journal Journal Disease

Schizophrenia Sleep Disorders Research and Treatment Hindawi Hindawi Hindawi Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018