Calcium/Calmodulin-Dependent Kinase I And

Research Article

Calcium/Calmodulin-Dependent Kinase I and Calcium/Calmodulin- Dependent Kinase Kinase Participate in the Control of Cell Cycle Progression in MCF-7 Human Breast Cancer Cells

Oswaldo G. Rodriguez-Mora,1 Michelle M. LaHair,1 James A. McCubrey,1,2 and Richard A. Franklin1,2

1Department of Microbiology and Immunology and the 2Leo Jenkins Cancer Center, Brody School of Medicine at East Carolina University, Greenville, North Carolina

Abstract The calcium/calmodulin-dependent kinases (CaM-K) are a Calcium is universally required for cell growth and prolifer- family of structurally related serine/threonine protein kinases that ation. Calmodulin is the main intracellular receptor for include CaM-K kinase (CaM-KK), phosphorylase kinase, myosin calcium. Although calcium and calmodulin are well known light chain kinase (MLCK), and CaM-KI to CaM-KIV (reviewed in to be required for cell cycle regulation, the target pathways for ref. 5). CaM-KI, CaM-KII, and CaM-KIV have broad substrate their action remain poorly defined. Potential targets include specificity. CaM-KIII, phosphorylase kinase, and MLCK have the calcium/calmodulin-dependent kinases (CaM-K). The aim limited substrate specificity. CaM-KK is an upstream activator/ of this study was to determine the role of the CaM-Ks on cell kinase for CaM-KI (6) and CaM-KIV (7). The traditional mechanism proliferation and progress through the cell cycle in breast of activation for the CaM-Ks is through calcium/calmodulin cancer cells. CaM-KI inhibition with either KN-93 or specific complex binding, which induces phosphorylation of other CaM- interfering RNA (siRNA) caused an arrest in the cell cycle in Ks (CaM-KI and CaM-IV) by CaM-KK or via autophosphorylation. the human breast cancer cell line, MCF-7. This arrest occurred In certain cell types, oxidative stress can lead to the calcium- independent activation of the CaM-Ks (8, 9). CaM-KI is broadly in the G1 phase of the cell cycle. Supporting this finding, CaM- K inhibition using KN-93 also resulted in a reduction of cyclin distributed and is localized in the cytosol. CaM-KIV is mainly D1 protein and pRb phosphorylation when cells were expressed in neurons but is also expressed in T cells and testis. compared with control cultures. Furthermore, inhibition of CaM-KII is clearly the best characterized of the multifunctional the upstream activator of CaM-KI, CaM-KK, using siRNA also CaM-Ks and is expressed in a variety of tissues (10). Multiple resulted in cell cycle arrest. In summary, CaM-KK and CaM-KI isoforms of CaM-KK and CaM-KII are reported to exist (11, 12). Cell proliferation can be regulated by growth factors, cytokines, participate in the control of the G0-G1 restriction check point of the cell cycle in human breast cancer cells. This arrest and hormones and is often deregulated in the case of cancer (13). seems due to an inhibition in cyclin D1 synthesis and a Many signaling pathways are capable of transmitting proliferative reduction in pRb phosphorylation. To the best of our signals from the cell membrane or cytoplasm to the nucleus. The knowledge, this is the first time that CaM-KK has been role of intracellular calcium has been extensively demonstrated to reported to be involved in mammalian cell cycle regulation be required for cell proliferation (reviewed in ref. 14). It is also well and that CaM-Ks are regulating breast cancer cell cycle. known that calcium binds calmodulin and this complex can induce (Cancer Res 2005; 65(12): 5408-16) the activation of the CaM-Ks. The CaM-Ks have also been implicated in cell cycle regulation; however, the characterization Introduction and magnitude of this involvement has not been well defined. Kahl and Means (14) have noted that a weakness with the majority of Breast cancer is the most common malignancy in women. the studies describing the role of the CaM-Ks in proliferation is that Approximately 1.5 million cases are diagnosed worldwide every they have solely involved the use of chemical inhibitors, such as year. In the United States, breast cancer is the leading type of KN-62 or KN-93. These inhibitors are known to suppress CaM-KII cancer and the second leading cause of death by cancer in women activity but have also been shown effective in inhibiting CaM-KI (1). In addition to or in conjunction with surgical approaches, and CaM-KIV (5). In a recent article, Kahl and Means showed that systemic therapy (chemotherapy and hormone therapy) and CaM-KI is involved in the regulation of the cell cycle at the G1 radiotherapy improve the survival of patients with breast cancer. checkpoint in primary fibroblasts (15). The role of the CaM-Ks in However, these therapies have a number of detrimental side effects. the regulation of the cell cycle in breast cancer cells has not been Because of these negative side effects, research efforts have not studied. only focused on chemosensitization and radiosensitization but also We investigated the effect of CaM-K inhibition on cell cycle in identifying new molecular targets that would allow limited progression in MCF-7 human breast cancer cells, an extensively cancer treatment side effects. This is the case of Imatinib (Gleevec) used cellular model for breast cancer research. We found that the for chronic myeloid leukemia (2) or the recently reported Gefitinib CaM-K inhibitor KN-93, but not its inactive analogue KN-92, (Iressa) for non–small cell lung cancer (3, 4). inhibited the proliferation of MCF-7 breast cancer cells. These studies show that arrest occurs primarily in the G1 phase of the cell cycle. Furthermore, we show by silencing specific CaM-K Requests for reprints: Richard A. Franklin, Department of Microbiology and expression with siRNA that CaM-KI and not CaM-KII is responsible Immunology, Brody School of Medicine at East Carolina University, Brody Building, for the G1 cell cycle progression in MCF-7 human breast cancer Greenville, NC 27834. Phone: 252-744-2705; Fax: 252-744-3104; E-mail: franklinr@ mail.ecu.edu. cells. In support of this finding, we found that CaM-KK inhibition I2005 American Association for Cancer Research. with siRNA also resulted in cell cycle arrest.

Cancer Res 2005; 65: (12). June 15, 2005 5408 www.aacrjournals.org

Materials and Methods Sulforhodamine B assay. Either MCF-7 or MCF-10A cells in exponential proliferation were trypsinized, counted, and seeded at 6,000 cells in 1 mL of Cells and cell culture. MCF-7 human breast cancer cells, MCF-10A complete DMEM per well in 24-well plates. Optimal seeding densities were human breast epithelial cells, and Jurkat T lymphocytes were purchased determined to ensure exponential growth for 7 days (data not shown). The from American Type Culture Collection (Rockville, MD). MCF-7 cells were sulforhodamine B (SRB) assay was done as previously described (18). Briefly, grown in complete DMEM supplemented with 10% fetal bovine serum all the culture medium was aspirated and the cells were fixed with cold A (FBS), 2 mmol/L L-glutamine, 100 units/mL penicillin, and 100 g/mL trichloroacetic acid. Following incubation at 4jC, cells were washed with streptomycin. MCF-10A cells were maintained in complete DMEM/F12 deionized water. The cells were stained with 0.1% SRB dissolved in 1% A supplemented with 5% FBS, 0.5 g/mL hydrocortisone, 20 ng/mL epidermal acetic acid for 30 minutes and subsequently washed with 1% acetic acid to A growth factor (EGF), 5 g/mL insulin, and 10 ng/mL cholera toxin. Jurkat remove unbound stain. The plates were then left to dry overnight at room T cells were grown in complete RPMI 1640 supplemented with 5% FBS, temperature. The protein-bound stain was solubilized with 10 mmol/L 2 mmol/L L-glutamine, 100 units/mL penicillin, and 100 Ag/mL streptomy- unbuffered Tris base and transferred to 96-well plates for absorbance j cin. All three cell lines were maintained at 37 C with 5% CO2. DMEM, readings at 540 nm with background at 690 nm (Anthos Labtec DMEM/F12, and RPMI 1640 were purchased from Invitrogen Life Instruments, Anthos Reader 2001, Pasadena, CA). Technologies, Inc. (Carlsbad, CA). FBS was obtained from Atlanta Reverse transcription-PCR analysis of human CaM-KKA and CaM- Biologicals (Norcross, GA). EGF, insulin, hydrocortisone, and cholera toxin KKB mRNAs. One microgram of total RNA per reaction was DNase I were purchased from Sigma (St. Louis, MO). treated and converted to cDNA, which was used as a template for PCR. Reagents and antisera. Anti-CaM-KII, anti-CaM-KIV, and anti-CaM-KK Thirty cycles (95jC for 1 minute, 51jC for 1 minute, and 72jC for 1 minute) antibodies were purchased from BD Biosciences Transduction Labs were done with the following primers: for CaM-KKa sense primer, (San Diego, CA). Anti-CaM-KI and anti-cyclin E antibodies were purchased ACTCACTTGGAGGAGGCAGA and antisense primer, GCTGGGAG- from Santa Cruz Biotechnology (Santa Cruz, CA). Anti-cyclin D1, anti-cyclin CAGTCTTGAAGT; for CaM-KKh, we used primers previously described D3, anti-cdk4, anti-cdk6, anti-p27, and anti-pRb antibodies were purchased (11). Reverse transcription-PCR (RT-PCR) reactions were done using Ready- from Cell Signaling Technologies (Beverly, MA). Anti-actin antibody was To-Go RT-PCR Beads from Amersham Biosciences Co. (Piscataway, NJ). purchased from Sigma. Alkaline phosphatase–conjugated-goat anti-rabbit RNA silencing. SMART pool interfering RNA (siRNA) to target human IgG (Fc), alkaline phosphatase–conjugated-goat anti-mouse immunoglob- CaM-KI (Genbank accession no. NM_003656), CaM-KII y (Genbank ulin G (H + L), and the 5-bromo-4-chloro-3-indolyl phosphate (BCIP), and accession nos. NM_001221, NM_172115, NM_172127, NM_172128), CaM- nitroblue tetrazolium (NBT) Color Development Substrate (ProtoBlot II AP KII g (Genbank accession nos. NM_001222, NM_172169, NM_172170, System) were purchased from Promega (Madison, WI). KN-92 and KN-93 NM_172171, NM_172172, NM_172173), CaM-KK a (Genbank accession nos. were obtained from Calbiochem (San Diego, CA) and were dissolved in NM_032294, NM_172206, NM_172207), and CaM-KK h (Genbank accession DMSO. LipofectAMINE 2000 and Opti-MEM I were purchased from nos. NM_006549, NM_153499, NM_153500, NM_172214, NM_172215, Invitrogen Life Technologies. All other reagents were purchased from Sigma. NM_172216, NM_172226) were designed and synthesized by Dharmacon Cell lysis and immunoblot analysis. Cell lysates were prepared as (Lafayette, CO). siRNA (100 nmol/L) was transfected into MCF-7 cells previously described (8). Following harvest, the cells were centrifuged for according to the manufacturer’s instructions using LipofectAMINE 2000 in 1 minute, supernatants were removed, and cell pellets were resuspended in Opti-MEM I. A nonspecific RNA duplex was used in control experiments. cold lysis buffer [25 mmol/L Tris (pH 7.4), 50 mmol/L sodium chloride, 2% Seventy-two hours post-transfection, cells were replated and allowed to IGEPAL, 0.2% SDS, and 0.5% sodium deoxycholate] and placed on ice for grow for 48 hours. Cells were harvested for cell cycle and immunoblot 15 minutes. Lysates were centrifuged for 10 minutes at 14,000 rpm in a analysis. microcentrifuge. Supernatants were removed and placed into fresh tubes. Cell cycle analysis by flow cytometry. Cells (0.5-1.0 Â 106) were Protein concentrations were calculated using the Bio-Rad DC Protein Assay trypsinized, centrifuged, and resuspended in 1 mL PBS buffer (1Â PBS and (Hercules, CA). Lysates were mixed with 3.3Â sample buffer [200 mmol/L 2% FBS). Three milliliters of ethanol were added and cells were fixed at Tris (pH 6.8), 33% glycerol, 6.6% SDS, 16.6% 2-mercaptoethanol, and 0.04% À20jC for a minimum of 1 hour. Cells were washed and resuspended in bromophenol blue]. Samples were boiled for 5 minutes and then frozen 1 mL of PBS buffer. DNA extraction buffer [200 mmol/L sodium phosphate, at À20jC. dibasic (pH 7.8) and 100 mmol/L citric acid] was added (500 AL) and cells Immunoblotting was done as previously described (16). Twenty micro- were incubated for 5 minutes at room temperature. Cells were centrifuged grams of protein per sample were electrophoresed through SDS-PAGE gels and resuspended in 1 mL of propidium iodide (PI) solution (50 Ag/mL), and electrophoretically transferred to polyvinylidene fluoride membranes. 50 AL of RNase A solution (10 mg/mL) was added to each tube, and cells Membranes were incubated overnight at 4jC in blocking buffer [25 mmol/L were incubated for 30 minutes. DNA profiles of PI-stained cells were Tris (pH 8.0), 125 mmol/L sodium chloride, 0.1% Tween 20, 1% bovine analyzed on a Becton Dickinson FACScan (San Jose, CA) and cell cycle plots serum albumin, and 0.1% sodium azide]. Membranes were then incubated generated by data analysis in ModFit LT 3.1 software. for 2 hours with primary antibody diluted in blocking buffer (anti-CaM-KI, DNA fragmentation assay. The DNA fragmentation assay was done as 1:1,000; anti-CaM-KII, 1:2,500; anti-CaM-KIV, 1:1,000; anti-CaM-KK, 1:1,000; previously described (19). Cells were washed with 1Â PBS, centrifuged, and anti-actin, 1:250; anti-cyclin D1, 1:2,000; anti-cyclin D3, 1:1,000; anti-cyclin E, resuspended in lysis buffer [50 mmol/L Tris-HCl (pH 7.5), 20 mmol/L EDTA, 1:1,000; anti-cdk4, 1:2,000; anti-cdk6, 1:1,000; anti-pRb, 1:2,000; and anti- and 1% NP40]. DNA was extracted with isopropanol/ethanol. The degree of p27,1:1000). The blots were washed twice in TBST [25 mmol/L Tris (pH 8.0), fragmentation was analyzed using 3% agarose gel electrophoresis followed 125 mmol/L sodium chloride, and 0.025% Tween 20] and incubated with an by ethidium bromide staining. alkaline phosphatase–conjugated goat anti-rabbit immunoglobulin or goat anti-mouse immunoglobulin antibody (Promega; 1:10,000 in TBST) for 1 hour at room temperature. The blots were washed thrice in TBST and Results developed with the colorigenic substrates BCIP/NBT (Promega ProtoBlot II The calcium/calmodulin-dependent kinase inhibitor KN-93 AP System). reduces proliferation of MCF-7 cells in culture. To determine if Trypan blue exclusion assay. Cell numbers and viability were evaluated inhibition of the CaM-Ks would alter the proliferation of MCF-7 by assessing trypan blue exclusion of cells under light microscopy and scoring the percentage of cells that did not exhibit blue staining as previously human breast cancer cells, we cultured these cells with the CaM-K described (17). Floating and attached cells were isolated by trypsinization, inhibitor KN-93. The potential nonspecific effects of KN-93 were recovered by centrifugation, and resuspended in complete DMEM. The assessed with its inactive analogue KN-92. DMSO, the diluent for resuspension was mixed with PBS (1:5) and a serial dilution (1:1) with 0.2% both KN-93 and KN-92, also served as a control. When compared trypan blue solution. Cells were counted using a hemocytometer. with untreated cells neither DMSO nor KN-92 altered the number www.aacrjournals.org 5409 Cancer Res 2005; 65: (12). June 15, 2005

Downloaded from cancerres.aacrjournals.org on September 30, 2021. © 2005 American Association for Cancer Research. Cancer Research of cells in these cultures from the time of treatment (day 0) until When KN-93 (5 Amol/L) was added to the cultures, the day 8. The number of cells increased from 2,600/cm2 (day 0) to proliferation of MCF-10A cells was 67% in comparison with the f50 to 60,000/cm2 (day 8). However, the CaM-K inhibitor KN-93 DMSO-treated cells (Fig. 2). When this same concentration was significantly reduced cell proliferation in comparison with the used on MCF-7 cells, they proliferated only to a level of 40% of the controls (Fig. 1A). When cells were treated with KN-93, the number controls. The apparent discrepancy in proliferation between the of cells in the culture did not increase at all over the 8 days of these KN-93–treated MCF-7 cells and the same group in Fig. 1A, where studies. Cell viability was confirmed the same for all experimental the KN-93–treated cells did not proliferate may be due to technical groups by acridine orange/ethidium bromide staining and differences for proliferation analysis (SRB versus trypan blue assay). observation under fluorescence microscopy (data not shown). When the KN-93 concentration was increased to 7.5 Amol/L, the These outcomes show that specific inhibition of the CaM-Ks in proliferation of the MCF-10A cells was 57%, whereas the MCF-7 breast cancer cells results in a decrease in cell proliferation and not cells proliferated to a level of 24% of the controls. These data in immediate cell death. As can be seen from the photographs of indicate the proliferation of tumorigenic MCF-7 cells was more cells treated with DMSO, KN-92, or KN-93 (Fig. 1B), MCF-7 cells susceptible to CaM-K inhibition in comparison with nontumori- treated with either DMSO or the inactive analogue KN-92 formed genic MCF-10A cells. visually similar colonies of cells by day eight of culture. However, Differential expression of the calcium/calmodulin-depen- the cells treated with the CaM-K inhibitor KN-93 failed to establish dent kinases in MCF-7 and MCF-10A cells. Because of the colonies 8 days after treatment. These results support our data in difference in the susceptibility of MCF-10A and MCF-7 cells to Fig. 1A that demonstrates that inhibition of the CaM-Ks results in a the down-regulatory effects of CaM-K inhibition, we determined decrease in the proliferation of MCF-7 breast cancer cells. the expression profiles of the different CaM-Ks in these cell lines. Tumor-forming MCF-7 cells are more susceptible to the Immunoblots (Fig. 3A) showed that CaM-KIIy and CaM-KIIg antiproliferative effects of KN-93 than the nontumor-forming isoforms were both expressed in MCF-7 and MCF-10A cells as it MCF-10A breast epithelial cell line. MCF-7 and MCF-10A cells has been previously shown (12). The expression of these two were cultured 8 days with DMSO, KN-92, or KN-93. Following the isoforms seemed similar in both cell lines. CaM-KI expression was 8-day culture, cell proliferation was determined by SRB assay. detected in MCF-7 cells but not in MCF-10A cells. It is possible that

Figure 1. CaM-K inhibitor KN-93 reduces the proliferation of MCF-7 human breast cancer cells in culture. On day À1, MCF-7 cells were trypsinized, washed, and seeded at 2,500 cells/cm2 in 1 mL of complete DMEM in 24-well plates. A, twenty-four hours later (day 0), the cells were treated with either DMSO (0.1%), KN-92 (5 Amol/L), or KN-93 (5 Amol/L). Cell counts of floating and adherent cells were done by trypan blue exclusion assay at days 0, 2, 4, 6, and 8 after the treatments mentioned above. Average of four independent experiments. The error bars for the KN-93 time points are not too small to be visible over the squares. B, twenty-four hours after plating out (day 0), the cells were treated with either DMSO (0.1%), KN-92 (5 Amol/L), or KN-93 (5 Amol/L). Cells were observed in an inverted microscope and photographs were obtained at days 0 and 8 after treatment.

Cancer Res 2005; 65: (12). June 15, 2005 5410 www.aacrjournals.org

Following 2 days in culture, 54% and 61% of the cells were found in the G1 peak of DMSO- and KN-92–treated cells, respectively. When cells were incubated for 2 days with KN-93, 75% of the viable cells could be found in the G1 peak. Following 5 days in culture, 62% and 67% of the cells were found in the G1 peak of DMSO- and KN-92– treated cells, respectively. When cells were incubated for 5 days with KN-93, 79% of the viable cells could be found in the G1 peak. In contrast to the number of cells in G1, treatment of cells with KN- 93 caused around a 50% reduction in the number of cells in the S phase when compared with the control cultures. These effects were not seen in the cell cycle profile of MCF-10A cells (Fig. 4B), showing the specificity of the CaM-K inhibitor KN-93 for the tumorigenic MCF-7 breast cancer cell line. The MCF-7 breast cancer cells arrested in the G0-G1 phase of the cell cycle showed an increase in the subgenomic population at Figure 2. MCF-7 human breast cancer cells are more susceptible to the antiproliferative effects of KN-93 than the nontumor forming MCF-10A breast 120 hours (up to 20%) suggesting that the growth-arrested cells epithelial cell line. MCF-7 and MCF-10A cells were trypsinized, washed, enter the apoptotic pathway. This increase in subgenomic resuspended, and seeded at 6,000 cells per well in 1 mL of complete DMEM or complete DMEM/F12 respectively, in 24-well plates. Twenty-four hours later, the population was not observed at 48 hours suggesting that the cells were treated with either DMSO (0.1%), KN-92 (2, 5, and 7.5 Amol/L), or KN-93–induced apoptosis is due to the prolonged G0-G1 arrest KN-93 (2, 5, and 7.5 Amol/L). At day 8, wells were processed by the SRB assay. rather than the toxic effects of KN-93. The increases in the Optical readings were obtained at A 540 nm. The relative proliferation was determined by comparison of the optical readings of the treated groups in relation subgenomic population were correlated with DNA fragmentation to their control. Average of six independent experiments. (Fig. 4C) showing that apoptosis is happening in the KN-93– treated MCF-7 cells. This effect was completely reversed when the CaM-KI is being expressed in MCF-10A; however, it must be at a cell medium was changed to complete DMEM at 72 hours after level below detection on our immunoblots. The expression of the treatment (data not shown). CaM-KKs has not been characterized in breast cells. In other cell types, there are two reported isoforms for CaM-KK (CaM-KKa and CaM-KKh; ref. 20). In addition, some cells express multiple variants of CaM-KKh (21, 22). In our experiments, the antibody used recognized two bands of CaM-KK in MCF-7 cells and only one band in MCF-10A cells (Fig. 3A). To determine if the two bands seen in MCF-7 cells were either multiple isoforms of CaM-KKh or represented CaM-KKa and CaM-KKh, RNA was obtained and RT- PCR analysis was done. Three variants of human CaM-KKa mRNA have been identified (Genbank). All three mRNA variants result in the amplification of a 116-bp fragment using the CaM-KKa primers. MCF-7 cells express both a and h1 mRNA isoforms of CaM-KK based on the primers used and the sizes of the fragments obtained (Fig. 3B). We do not know the identity of the slightly smaller fragment that is identified using the CaM-KKa primers. It may represent a spliced variant or a yet to be identified isoform. It is known that CaM-KK is alternatively spliced (11). The CaM- KKh2 isoform was not expressed at readily detectable levels in the MCF-7 cells. Furthermore, MCF-10A cells express only the CaM- KKa mRNA isoform (data not shown), suggesting that the unique band observed in the immunoblots for MCF-10A cells is likely the CaM-KKa isoform. Consequently, the higher molecular weight band observed in immunoblots for MCF-7 cells may be CaM-KKh1. CaM-KIV was not expressed in either of the breast cell lines but was seen in our positive control (Jurkat). These results would suggest that the specificity of the anti-proliferative effect of KN-93 on MCF-7 breast cancer cells may be due to the inhibition of CaM-KI. Figure 3. Expression profile of endogenous CaM-Ks in MCF-7 and MCF-10A Inhibition of the calcium/calmodulin-dependent kinases cells. MCF-7 and MCF-10A cells were trypsinized, washed, and resuspended in complete DMEM or complete DMEM/F12, respectively. A, cellular lysates were with KN-93 reduces cell cycle progression. To further elucidate prepared, protein concentrations were determined, and 20 Ag of protein per lane the antiproliferative effects of the CaM-K inhibitor KN-93, MCF-7, were loaded. Immunoblot analysis was done using antibodies against CaM-KK, CaM-KI, CaM-KII, and CaM-KIV. Jurkat cell lysate was used as a control for the and MCF-10A cells were stained with PI and cell cycle analysis was absence of CaM-KIV in the breast cells. Anti-actin antibody was used as a done by flow cytometry. The cell cycle profile of MCF-7 cells loading control. Representation of three independent sets of immunoblots with treated with the CaM-K inhibitor KN-93 was characterized by an similar results. B, MCF-7 total RNA was extracted. One microgram of total RNA was used in first-strand DNA synthesis and subjected to PCR. PCR products increase in the percentage of cells in the G0-G1 phase of the cell were separated by 3% agarose gel, ethidium bromide stained, and UV light cycle and a reduction of the fraction of cells in the S phase (Fig. 4A). examined. The image was acquired using a Bio-Rad ChemiDoc XRS system. www.aacrjournals.org 5411 Cancer Res 2005; 65: (12). June 15, 2005

Figure 4. Inhibition of the CaM-Kinases with the CaM-K inhibitor KN-93 prevents cell cycle progression, induces apoptosis, and down-regulates cyclin D1 expression in MCF-7 human breast cancer cells. MCF-7 (A) and MCF-10A (B) cells were trypsinized, washed, resuspended, and seeded at 50,000 cells per well in 2 mL of complete DMEM or complete DMEM/F12 respectively, in 6-well plates. Twenty-four hours later, the cells were treated with either DMSO (0.1%), KN-92 (5 Amol/L), or KN-93 (5 Amol/L). The day of treatment (0 hours), 48 and 120 hours after treatments, cells were trypsinized, washed, and resuspended in complete medium. Cells were stained with PI as previously described. Flow cytometric analysis of the DNA content was done. Analysis of the cell cycle was done using ModFit LT 3.1 for Macintosh. Representation of six independent experiments with similar results. C and D, MCF-7 cells were trypsinized, washed, resuspended, and seeded at 2 Â 106 cells per T75 flask in 15 mL of complete DMEM. Seventy-two hours later, the exponentially growing cells were treated with either DMSO (0.1%), KN-92 (5 Amol/L), or KN-93 (5 Amol/L). C, DNA was precipitated, electrophoretically separated on a 3% agarose gel, visualized by ethidium bromide staining and photographed using the BioRad ChemiDoc XRS system. D, forty-eight and 72 hours after treatment cellular lysates were prepared, protein concentrations were determined, and 40 Ag of protein per lane were loaded. Immunoblot analysis was done using antibodies against cyclin D1, cyclin D3, cyclin E, cdk4, cdk6, pRb, p27, and actin. Representation of three independent sets of immunoblots with similar findings.

Cancer Res 2005; 65: (12). June 15, 2005 5412 www.aacrjournals.org

Calcium/calmodulin-dependent kinase inhibitor KN-93 D1. This decrease would result in decreased pRb phosphorylation inhibits cyclin D1 expression. To examine the mechanisms by and the subsequent G0-G1 cell cycle arrest. which KN-93 causes cell cycle arrest in breast cancer cells, CaM-KI siRNA blocks cell cycle progress in the G0-G1 phase exponentially growing MCF-7 cells were treated with KN-93 and of the cell cycle. Because it has been shown that KN-93 can inhibit cell lysates were obtained at 48 and 72 hours. As observed (Fig. CaM-KI, CaM-KII, and CaM-KIV (5, 23); that MCF-7 cells are more 4D), cyclin D1 protein levels were moderately reduced at 48 hours sensitive than MCF-10A cells to the anti-proliferative effects of KN- and disappeared at 72 hours after treatment with KN-93. The 93; and that MCF-7 cells, but not MCF-10A cells, express detectable levels of cyclin D1 were not affected in the cells treated with levels of CaM-KI, we decided to determine if CaM-KI could be DMSO or mildly affected with the negative analogue KN-92. There responsible for the disruption of the cell cycle progression. Cells was a slight decrease in cyclin D3 immunoreactivity in cells were transfected with specific siRNA directed to silence the treated with KN-93 for 72 hours. A slower migrating band expression of CaM-KI, CaM-KIIy, or CaM-KIIg. Treatment of the appeared above cyclin D3 in the same treatment group in cells with siRNA directed towards CaM-KIIg resulted in a decrease comparison with controls. It is possible that cyclin D3 is of CaM-KIIg protein but not CaM-KKy protein (Fig. 5A). phosphorylated, leading to a decreased cyclin D3 electrophoretic Conversely, treatment of the cells with CaM-KIIy siRNA resulted migration. Furthermore, Rb was found in its unphosphorylated in the down-regulation of CaM-KIIy protein but not CaM-KIIg form (110 kDa) in cells treated with KN-93. Cells treated with protein. When cells were treated with both CaM-KIIy and CaM- DMSO or KN-92 conserved the phosphorylated form of pRb that KIIg, siRNA suppression of both proteins could be noted. The is characterized by slower migration (115 kDa). Cyclin E levels did suppression of CaM-KIIy was not complete in this case; however, it not change in any case. It is possible that the lack of cyclin D1 should be noted that the cells in all of the experiments were results in nontitrated p21/p27. Consequently, these cyclin- transfected with a total of 100 nmol/L of siRNA (in this case, dependent kinase (CDK) inhibitors may suppress the cyclin E/ 50 nmol/L of each siRNA). When the MCF-7 cells were treated with cdk2 complex kinase activity. This could explain the lack of pRb siRNA directed to CaM-KI, suppression in the expression of CaM- phosphorylation even in the presence of normal cyclin E levels. KI protein could be noted. Suppression of any nonsilenced CaM-K The levels of the CDK inhibitor p27 did not change in any case. or actin was not observed when the cells were transfected with any CaM-K inhibition did not alter the levels of cdk4 and cdk6. siRNA (Fig. 5A) indicating the specificity of the siRNA. Overall, these results indicate that treatment of breast cancer Five days following the transfection of MCF-7 cells with CaM-KI cells with the CaM-K inhibitor results in decreased levels of cyclin siRNA an increase in the percentage of cells in the G0-G1 phase of

Figure 5. CaM-KI siRNA and not CaM-KII siRNA blocks the cell cycle progression in human breast cancer cells. MCF-7 cells were trypsinized, washed, resuspended, and seeded at 1.5 Â 105 cells per well in 1 mL of complete DMEM, in 24-well plates. Twenty-four hours later, complete DMEM was replaced by 1 mL of Opti-MEM I. Cells were transfected with either 100 nmol/L of individual specific siRNA (NS siRNA, CaM-KI, CaM-KIIg, and CaM-KIIy) or a mixture of 50/50 nmol/L of specific siRNA for CaM-KIIg and CaM-KIIy, dissolved in Opti-MEM I in the presence of LipofectAMINE 2000 according to manufacturer’s instructions. Opti-MEM I was replaced with complete DMEM 6 hours after the transfection was done. Seventy-two hours later, cells were trypsinized, washed, and resuspended in complete DMEM. The cells were seeded in T25 flasks. A, cellular lysates were prepared, protein concentration was determined, and 20 Ag of protein per lane were loaded. Immunoblot analysis was done using antibodies against CaM-KI, CaM-KII, CaM-KK and actin. B, forty-eight hours later, cells were stained with PI as previously described. Flow cytometry analysis of the DNA content was done. Analysis of the cell cycle was done using ModFit LT 3.1 for Macintosh. Representation of three independent experiments with similar results.

www.aacrjournals.org 5413 Cancer Res 2005; 65: (12). June 15, 2005

Figure 6. CaM-KK siRNA prevents the cell cycle progression in MCF-7 human breast cancer cells. MCF-7 cells were trypsinized, washed, resuspended, and seeded at 1.5 Â 105 cells per well in 1 mL of complete DMEM, in 24-well plates. Twenty-four hours later, complete DMEM was replaced by 1 mL of Opti-MEM I. Cells were transfected with either 100 nmol/L of individual specific siRNA (NS siRNA, CaM-KKa, and CaM-KKh) or a mixture of 50/50 nmol/L of specific siRNA for CaM-KKh and CaM-KI, dissolved in Opti-MEM I in the presence of LipofectAMINE 2000 according to manufacturer’s instructions. Opti-MEM I was replaced with complete DMEM 6 hours after the transfection was done. Seventy-two hours later, cells were trypsinized, washed, and resuspended in complete DMEM. The cells were seeded in T25 flasks. A, cellular lysates were prepared, protein concentrations were determined, and 20 Ag of protein per lane were loaded. Immunoblot analysis was done using antibodies against CaM-KK, CaM-KI, CaM-KII, and actin. B, forty-eight hours later, cells were stained with PI as previously described. Flow cytometry analysis of the DNA content was done. Analysis of the cell cycle was done using ModFit LT 3.1 for Macintosh. Representation of three independent experiments with similar results. the cell cycle could be noted (Fig. 5B). Furthermore, a reduced on cell cycle progression. Our results indicate that CaM-KK and fraction of the cells in the S and G2-M phases was evident, when CaM-KI are required for G1 phase progression in the cell cycle of compared with the cells transfected with nonspecific siRNA. In MCF-7 human breast cancer cells and consequently their these same experiments, we found that CaM-KIIg and CaM-KIIy proliferation. siRNA did not induce cell cycle arrest. These results suggest that it In the cell cycle G1 phase, the cells respond to extracellular cues is CaM-KI and not CaM-KII that controls the G0-G1 phase to make the decision whether to replicate DNA and divide or to progression of the cell cycle in MCF-7 human breast cancer cells exit into a resting state (G0; ref. 13). The time point in G1 phase in and suggests a mechanism for the requirement of both calcium which this decision is made is called the ‘‘restriction point’’ because and calmodulin in cell proliferation. after this point the cells are irreversibly committed to complete the Calcium/calmodulin-dependent kinase kinase siRNA causes cycle (24). This restriction point transition is controlled by CDKs cell cycle arrest of breast cancer cells in the G1 phase of the (25, 26). These enzymes contain both regulatory (cyclin) and cell cycle. CaM-KK has a role in the phosphorylation and catalytic (cdk) subunits. Calcium and its intracellular receptor activation of CaM-KI (6). MCF-7 cell transfection with siRNA for calmodulin are common to all regulatory transitions of the cell either the CaM-KKa or CaM-KKh isoform down-regulates both cycle (14). Mouse or human cells cultured in medium containing bands of immunoreactivity (Fig. 6A). It is possible that the low concentrations of calcium cease cellular division and sequences of the siRNAs are targeted to a similar region in CaM- accumulate in G1 (27). The calmodulin inhibitors W-7 and W-13 KKa and CaM-KKh RNA. Regardless, when MCF-7 cells were prevent proliferation and colony formation in breast cancer cells transfected with siRNA to either CaM-KKa or CaM-KKh,we and other cell lines (28). Traditionally, it has been thought that observed cell arrest in the G1 phase of the cell cycle when CaM-KII is controlling the G1 phase restriction point based on compared with cells either untransfected or transfected with results obtained with KN-93 or KN-62. These inhibitors were once nonspecific siRNA (Fig. 6B). When 50 nmol/L siRNA to CaM-KKh thought to be CaM-KII specific (29–31). However, a recent article was used in combination with 50 nmol/L siRNA to CaM-KI, a by Kahl and Means (15) found that overexpression of a kinase- similar increase in the number of cells in G1 over those seen using deficient CaM-KI but not a kinase-deficient CaM-KII prevented G1 siRNA to CaM-KKh alone was noted. These findings would suggest progression in normal fibroblasts. Although their research was that CaM-KK is acting via CaM-KI. done in nonimmortalized, nontransformed WI-38 fibroblasts and ours in a tumorigenic cell line, our results corroborate that it is CaM-KI and not CaM-KII that is involved in the regulation of the Discussion G1 phase of the cell cycle. Furthermore, our study defined that The aim of this study was to determine if the CaM-Ks were CaM-KK, an upstream activator of CaM-KI, is also participating in involved in the proliferation and cell cycle regulation of breast the control of the G1 restriction point of the cell cycle of MCF-7 cancer cells. By culturing MCF-7 human breast cancer cells in the breast cancer cells. presence of the CaM-K inhibitor KN-93, or by cell transfection with Cyclin D1 function is essential for regulation of the progression specific siRNA, we were able to test the effects of CaM-K inhibition through the restriction point from G1 to S phase (32). Cyclin D1

Cancer Res 2005; 65: (12). June 15, 2005 5414 www.aacrjournals.org

Downloaded from cancerres.aacrjournals.org on September 30, 2021. © 2005 American Association for Cancer Research. Role of CaM-K in the Breast Cancer Cell Cycle binds cdk4/6, allowing the phosphorylation of pRb. pRb is the (ERK) activation; thus, ERK may be a potential substrate in breast restriction point gate keeper as phosphorylated pRb is not able to cancer cells (48). Joseph and Means have reported that CaM-KK repress E2F transcriptional activity (13). Consequently, cyclin D1 and CaM-KI in Aspergillus nindulans are involved in the has been proposed to be a potential target for chemoprevention/ regulation of DNA synthesis (49). Whether CaM-KI is exclusively treatment of cancer (33). The role of the CaM-Ks with regard to the controlled by CaM-KK for G1-to-S phase transition remains to be G1 restriction point seems mediated in part by cyclin D1 elucidated. accumulation. Cyclin D1 is one of the most commonly overex- The distribution of MCF-7 cells in the different phases of the cell pressed oncogenes in breast cancer (34–37). Forty-five percent to cycle suggests that the cells are not cycling, as time-dependent cell 50% of the primary ductal carcinomas overexpress this protein (38, accumulation in G1 phase is not happening. This would imply a 39). It was recently shown that cyclin D1 is essential for the block not only in G1 phase but also in S-G2 phases. A potential role development of mammary cancers induced by c-neu and v-Ha-ras was described for CaM-KII in regulating centrosome duplication in (40). Cyclin D1 plays a major role in estrogen-induced mitogenesis Xenopus eggs (50). However, the role of CaM-KII in regulating in breast cancer cells (38, 41–45). Our results suggest that inhibition centrosome duplication in mammalian cells is unknown. In of CaM-KK and CaM-KI induces a decrease in the levels of cyclin addition, it has been suggested that CaM-KII participates in the D1; consequently, pRb phosphorylation is reduced. Previous studies G2-M transition in HeLa cells controlling cdc25 phosphorylation have also found a down-regulation of cyclin D1 in NIH-3T3 (51). Furthermore, CaM-Ks involvement in the S phase is unknown fibroblasts treated with KN-93 (31). Kahl and Means reported that (14). It is possible that when we treat the cells with KN-93, CaM-KI CaM-KI inhibition causes down-regulation of the activity of the is inhibited, and this leads to a block in the G1 phase. In addition, cyclin D1/cdk4 complex but not a reduction in cyclin D1 protein KN-93 may inhibit CaM-KII and induce a block in G2. However, the levels (15). In our studies, we observed a decrease in cyclin D1 percentages of distribution would suggest that the cells are also levels following treatment with KN-93. This may reflect the blocked in the S phase as the number of cells in G2 remains the tumorigenic nature of the cells, as the studies that showed a same. Nevertheless, CaM-KII silencing with siRNA did not cause down-regulation of cyclin D1 by KN-93 used transformed cells, and any apparent cell cycle arrest in S or G2 phase. Another potential those that did not used primary cells. explanation is that the lack of cycling cells is an artificial effect The mechanisms by which the inhibition of CaM-KI causes because G1-arrested cells are suffering apoptosis as shown. Thus, down-regulation of cyclin D1 protein levels in MCF-7 cells are not the distribution would remain similar with no more cell clear. Cyclin D1 expression can be regulated either by transcrip- accumulation in G1. tion, translation, or protein stability (32). We observed that cyclin Our laboratory has previously shown that CaM-KII and CaM-KIV D1 protein levels did not increase in serum-deprived growth- can be activated by certain forms of oxidative stress (8, 9). We have arrested cells released in complete medium in the presence of observed that CaM-KII can be activated by oxidative stress in MCF- KN-93 (data not shown). This suggests that CaM-KI may be 7 breast cancer cells. In the presence of KN-93, MCF-7 cells are inducing cyclin D1 transcription and/or translation. CaM-KI is more sensitive to the effects of oxidative stress-inducing treat- localized in the cytoplasm; however, whether it can translocate to ments like radiotherapy and photodynamic therapy.3 Considering the nucleus is not known (46). If CaM-KI remains in the that one compound may inhibit CaM-KI and CaM-KII, causing cytoplasm, it must be regulating a substrate that can translocate proliferation arrest in addition to sensitization to oxidative stress- to the nucleus and modulate transcription. Very little is known inducing treatments, the idea of treating breast cancer through about physiologically relevant substrates for CaM-KI. It has been CaM-K inhibition may be possible. shown that CaM-KI can cause cyclic AMP–responsive element binding (CREB) protein phosphorylation in vitro. Although there Acknowledgments is a CRE sequence on the cyclin D1 promoter, MCF-7 cells do not Received 1/26/2005; revised 3/14/2005; accepted 3/21/2005. express detectable CREB (47). Recently, it has been shown that Grant support: American Heart Association Scientist Development grant CaM-KI can participate in extracellular signal-regulated kinase 9930099N (R.A. Franklin) and grant-in-aid 0355834U (R.A. Franklin), NIH grants R01 CA51025 (J.A. McCubrey) and R01 CA98195 (J.A. McCubrey and R.A. Franklin), and Fundacio´n para la Ciencia y la Technologı´a, Ecuador scholarship (O. Rodriguez-Mora). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance 3 Manuscript in preparation. with 18 U.S.C. Section 1734 solely to indicate this fact.

References 6. Matsushita M, Nairn AC. Characterization of the 10. Colbran RJ. Targeting of calcium/calmodulin- mechanism of regulation of Ca2+/calmodulin-dependent dependent protein kinase II. Biochem J 2004;378:1–16. 1. Jemal A, Murray T, Samuels A, Ghafoor A, Ward E, Thun protein kinase I by calmodulin and by Ca2+/calmodulin- 11. Hsu LS, Chen GD, Lee LS, Chi CW, Cheng JF, MJ. Cancer statistics, 2003. CA Cancer J Clin 2003;53:5–26. dependent protein kinase kinase. J Biol Chem 1998;273: Chen JY. Human Ca2+/calmodulin-dependent protein 2. Crossman LC, O’Brien SG. Imatinib therapy in chronic 21473–81. kinase kinase h gene encodes multiple isoforms that myeloid leukemia. Hematol Oncol Clin North Am 2004; 7. Tokumitsu H, Brickey DA, Glod J, Hidaka H, Sikela J, display distinct kinase activity. J Biol Chem 2001;276: 18:605–17; viii. Soderling TR. Activation mechanisms for Ca2+/calmodu- 31113–23. 3. Blagosklonny MV. Gefitinib (Iressa) in oncogene- lin-dependent protein kinase IV. Identification of a brain 12. Tombes RM, Krystal GW. Identification of novel addictive cancers and therapy for common cancers. CaM-kinase IV kinase. J Biol Chem 1994;269:28640–7. human tumor cell-specific CaMK-II variants. Biochim Cancer Biol Ther 2004;3:436–40. 8. Howe CJ, LaHair MM, Maxwell JA, et al. Participation Biophys Acta 1997;1355:281–92. 4. Ciardiello F, De Vita F, Orditura M, Tortora G. The role of the calcium/calmodulin-dependent kinases in hydro- 13. Sherr CJ. The Pezcoller lecture: cancer cell cycles of EGFR inhibitors in nonsmall cell lung cancer. Curr gen peroxide-induced InB phosphorylation in human T revisited. Cancer Res 2000;60:3689–95. Opin Oncol 2004;16:130–5. lymphocytes. J Biol Chem 2002;277:30469–76. 14. Kahl CR, Means AR. Regulation of cell cycle 5. Hook SS, Means AR. Ca(2+)/CaM-dependent kinases: 9. Howe CJ, Lahair MM, McCubrey JA, Franklin RA. progression by calcium/calmodulin-dependent path- from activation to function. Annu Rev Pharmacol Redox regulation of the calcium/calmodulin-dependent ways. Endocr Rev 2003;24:719–36. Toxicol 2001;41:471–505. protein kinases. J Biol Chem 2004;279:44573–81. 15. Kahl CR, Means AR. Regulation of cyclin D1/Cdk4 www.aacrjournals.org 5415 Cancer Res 2005; 65: (12). June 15, 2005

complexes by calcium/calmodulin-dependent protein 27. Hickie RA, Wei JW, Blyth LM, Wong DY, Klaassen DJ. 40. Yu Q, Geng Y, Sicinski P. Specific protection against kinase I. J Biol Chem 2004;279:15411–9. Cations and calmodulin in normal and neoplastic cell breast cancers by cyclin D1 ablation. Nature 2001;411: 16. Howe CJ, LaHair MM, Robinson PJ, Rodriguez-Mora growth regulation. Can J Biochem Cell Biol 1983;61: 1017–21. O, McCubrey JA, Franklin RA. Models of anergy in the 934–41. 41. Wilcken NR, Prall OW, Musgrove EA, Sutherland RL. human Jurkat T cell line. Assay Drug Dev Technol 2003; 28. Wei JW, Hickie RA, Klaassen DJ. Inhibition of human Inducible overexpression of cyclin D1 in breast cancer 1:537–44. breast cancer colony formation by anticalmodulin cells reverses the growth-inhibitory effects of anties- 17. Cartee L, Vrana JA, Wang Z, et al. Inhibition of the agents: trifluoperazine, W-7, and W-13. Cancer Chemo- trogens. Clin Cancer Res 1997;3:849–54. mitogen activated protein kinase pathway potentiates ther Pharmacol 1983;11:86–90. 42. Prall OW, Sarcevic B, Musgrove EA, Watts CK, radiation-induced cell killing via cell cycle arrest at 29. Rasmussen G, Rasmussen C. Calmodulin-dependent Sutherland RL. Estrogen-induced activation of Cdk4 the G2/M transition and independently of increased protein kinase II is required for G1/S progression in and Cdk2 during G1-S phase progression is accompa- signaling by the JNK/c-Jun pathway. Int J Oncol 2000; HeLa cells. Biochem Cell Biol 1995;73:201–7. nied by increased cyclin D1 expression and decreased 16:413–22. 30. Tombes RM, Grant S, Westin EH, Krystal G. G1 cell cyclin-dependent kinase inhibitor association with 18. Pauwels B, Korst AE, de Pooter CM, et al. Compar- cycle arrest and apoptosis are induced in NIH 3T3 cells cyclin E-Cdk2. J Biol Chem 1997;272:10882–94. ison of the sulforhodamine B assay and the clonogenic by KN-93, an inhibitor of CaMK-II (the multifunctional 43. Ahamed S, Foster JS, Bukovsky A, Wimalasena J. assay for in vitro chemoradiation studies. Cancer Ca2+/CaM kinase). Cell Growth Differ 1995;6:1063–70. Signal transduction through the Ras/Erk pathway is Chemother Pharmacol 2003;51:221–6. 31. Morris TA, DeLorenzo RJ, Tombes RM. CaMK-II essential for the mycoestrogen zearalenone-induced 19. Herrmann M, Lorenz HM, Voll R, Grunke M, Woith inhibition reduces cyclin D1 levels and enhances the cell-cycle progression in MCF-7 cells. Mol Carcinog W, Kalden JR. A rapid and simple method for the association of p27kip1 with Cdk2 to cause G1 arrest in 2001;30:88–98. isolation of apoptotic DNA fragments. Nucleic Acids Res NIH 3T3 cells. Exp Cell Res 1998;240:218–27. 44. Altucci L, Addeo R, Cicatiello L, et al. 17h-Estradiol 1994;22:5506–7. 32. Fu M, Wang C, Li Z, Sakamaki T, Pestell RG. induces cyclin D1 gene transcription, p36D1-p34cdk4 20. AndersonKA,MeansRL,HuangQH,etal. Minireview: Cyclin D1: normal and abnormal functions. complex activation and p105Rb phosphorylation during Components of a calmodulin-dependent protein Endocrinology 2004;145:5439–47. mitogenic stimulation of G(1)-arrested human breast kinase cascade. Molecular cloning, functional 33. Sutherland RL, Musgrove EA. Cyclin D1 and mam- cancer cells. Oncogene 1996;12:2315–24. characterization and cellular localization of Ca2+/ mary carcinoma: new insights from transgenic mouse 45. Foster JS, Wimalasena J. Estrogen regulates activity of calmodulin-dependent protein kinase kinase h. J Biol models. Breast Cancer Res 2002;4:14–7. cyclin-dependent kinases and retinoblastoma protein Chem 1998;273:31880–9. 34. Bartkova J, Lukas J, Muller H, Lutzhoft D, Strauss M, phosphorylation in breast cancer cells. Mol Endocrinol 21. Sakagami H, Umemiya M, Saito S, Kondo H. Distinct Bartek J. Cyclin D1 protein expression and function in 1996;10:488–98. immunohistochemical localization of two isoforms of human breast cancer. Int J Cancer 1994;57:353–61. 46. Soderling TR. The Ca-calmodulin-dependent protein Ca2+/calmodulin-dependent protein kinase kinases in 35. BuckleyMF,SweeneyKJ,HamiltonJA,etal. kinase cascade. Trends Biochem Sci 1999;24:232–6. the adult rat brain. Eur J Neurosci 2000;12:89–99. Expression and amplification of cyclin genes in human 47. Boulon S, Dantonel JC, Binet V, et al. Oct-1 22. Uemura A, Naito Y, Matsubara T, Hotta N, Hidaka H. breast cancer. Oncogene 1993;8:2127–33. potentiates CREB-driven cyclin D1 promoter activation Demonstration of a Ca2+/calmodulin dependent protein 36. Gillett C, Fantl V, Smith R, et al. Amplification and via a phospho-CREB- and CREB binding protein- kinase cascade in the hog heart. Biochem Biophys Res overexpression of cyclin D1 in breast cancer detected by independent mechanism. Mol Cell Biol 2002;22:7769–79. Commun 1998;249:355–60. immunohistochemical staining. Cancer Res 1994;54: 48. Schmitt JM, Wayman GA, Nozaki N, Soderling TR. 23. Hidaka H, Yokokura H. Molecular and cellular 1812–7. Calcium activation of ERK mediated by calmodulin pharmacology of a calcium/calmodulin-dependent pro- 37. Nielsen NH, Emdin SO, Cajander J, Landberg G. kinase I. J Biol Chem 2004;279:24064–72. tein kinase II (CaM kinase II) inhibitor, KN-62, and Deregulation of cyclin E and D1 in breast cancer is 49. Joseph JD, Means AR. Identification and character- proposal of CaM kinase phosphorylation cascades. Adv associated with inactivation of the retinoblastoma ization of two Ca2+/CaM-dependent protein kinases Pharmacol 1996;36:193–219. protein. Oncogene 1997;14:295–304. required for normal nuclear division in Aspergillus 24. Blagosklonny MV, Pardee AB. The restriction point of 38. Prall OW, Rogan EM, Musgrove EA, Watts CK, nidulans. J Biol Chem 2000;275:38230–8. the cell cycle. Cell Cycle 2002;1:103–10. Sutherland RL. c-Myc or cyclin D1 mimics estrogen 50. Ohta Y, Ohba T, Miyamoto E. Ca2+/calmodulin- 25. Foster JS, Henley DC, Ahamed S, Wimalasena J. effects on cyclin E-Cdk2 activation and cell cycle dependent protein kinase II: localization in the inter- Estrogens and cell-cycle regulation in breast cancer. reentry. Mol Cell Biol 1998;18:4499–508. phase nucleus and the mitotic apparatus of mammalian Trends Endocrinol Metab 2001;12:320–7. 39. Foster JS, Henley DC, Bukovsky A, Seth P, cells. Proc Natl Acad Sci U S A 1990;87:5341–5. 26. Doisneau-Sixou SF, Sergio CM, Carroll JS, Hui R, Wimalasena J. Multifaceted regulation of cell cycle 51. PatelR,HoltM,PhilipovaR,etal.Calcium/ Musgrove EA, Sutherland RL. Estrogen and antiestrogen progression by estrogen: regulation of Cdk inhibitors calmodulin-dependent phosphorylation and activation regulation of cell cycle progression in breast cancer and Cdc25A independent of cyclin D1-Cdk4 function. of human Cdc25-C at the G2/M phase transition in HeLa cells. Endocr Relat Cancer 2003;10:179–86. Mol Cell Biol 2001;21:794–810. cells. J Biol Chem 1999;274:7958–68.

Cancer Res 2005; 65: (12). June 15, 2005 5416 www.aacrjournals.org

Downloaded from cancerres.aacrjournals.org on September 30, 2021. © 2005 American Association for Cancer Research. Calcium/Calmodulin-Dependent Kinase I and Calcium/Calmodulin-Dependent Kinase Kinase Participate in the Control of Cell Cycle Progression in MCF-7 Human Breast Cancer Cells

Oswaldo G. Rodriguez-Mora, Michelle M. LaHair, James A. McCubrey, et al.

Cancer Res 2005;65:5408-5416.

Updated version Access the most recent version of this article at: http://cancerres.aacrjournals.org/content/65/12/5408

Cited articles This article cites 50 articles, 20 of which you can access for free at: http://cancerres.aacrjournals.org/content/65/12/5408.full#ref-list-1

Citing articles This article has been cited by 8 HighWire-hosted articles. Access the articles at: http://cancerres.aacrjournals.org/content/65/12/5408.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/65/12/5408. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.