CHAPTER 2 LITERATURE REVIEW 2.1 Introduction of Fungi Fungi Are One of the Most Diverse Life from on Earth and Predicting Number

CHAPTER 2

LITERATURE REVIEW

2.1 Introduction of fungi

Fungi are one of the most diverse life from on earth and predicting number of fungal species is considered important among mycologists (Hyde, 2001). Fungi are a group of organism that are classified within their own kingdom, the fungal kingdom, as they are neither plants nor animals. The fungi are fact, an ancient lineage that first appear in the fossil recode as spores in conjunction with the first appearance of land plants, about

500450 million years ago (Cairney, 2000). Fungi are eukaryotic and heterotrophic, lacking chlorophyll (Moncalvo, 2005). Most of fungi have an alternating haploid/diploid lifecycle, as seen in other sexual organism, but they also have an anamorphic lifecycle that persists without sexual recombination (Bidochka and De Koning, 2001). Most fungi are saprobic living on dead organic matter, in the soil or as pathogens and endophytes of plant and animal. The six fungal phyla accepted include the Ascomycota, Basidiomycota,

Chytridiomycota, Glomeromycota, Microsporidia and Zygomycota (Kirk et al., 2008).

Currently about 80,060 species are known. Rossman (1994) estimated the number of fungal species in the world was just over 1 million (Table 2.1) based on information in the US National Fungus Collection database, an All Taxon Biodiversity Inventory

(ATBI) of tropical site, and the literature. Recent studies suggested that fungal diversity is greater in the tropics than in temperate regions, and might prove to be hyper-diverse, 7

and as a consequence 1.5 million species will eventually be discovered (Fröhlich and

Hyde, 1999; Arnold et al., 2000).

Table 2.1 Major groups of fungi and estimated world species number (Rossman, 1994).

Group Estimated species world-wide Well-known Aphyllophorales 20000 Macrolichens 20000 Moderately well-known Agaricales 80000 Dematiaceous and aquatic hyphomycetes 80000 Uredinales 50000 Hypocreales and Xylariales 50000 Ustilaginales 15000 Gasteromycetes 10000 Erysiphales 10000 Jelly fungi 5000 Pezizales 3000 Myxomycetes 1500 Endomycetales (true yeasts) 1000 Poorly known Non-dematiaceous hyphomycetes 200000 Coelomycetes 200000 Other perithecioid ascomycetes 100000 Helotiales 70000 Insect-specific fungi 50000 Crustose lichens 20000 Mucorales 20000 Oomycetes 20000 Chytridiomycetes 20000 Endogonales and Glomales 1000 Total 1028500

2.2 Fungi in Thailand

Thailand is a country that includes a rich diversity of habitats, including, coral reefs, mangrove forest, limestone outcrops, deciduous forest, tropical rainforests and pine tree forest, but lagged behind with respect to research on biodiversity of its fungi (Jones 8

and Hyde, 2004; Tanticharoen, 2004). It’s geographical position in the tropics and climatic variation support a biological divers flora and fauna (Gray et al., 1994). Before

1990, reports on fungal diversity in Thailand were sporadic, and knowledge of Thailand’s fungal diversity was very poor. Tanticharoen (2004) reported that 15,000 flowering plants, 1,000 orchids, 600 ferns and more than 1,000 endemic vascular plant species have been recorded for Thailand. Moreover, the number of fungal records in Thailand has increased from 700 species (in 1990) to over 3,300 species in 2013 according to the database of BIOTEC (http://www.biotec.or.th/bcc/cat_fungi.asp) and indicated that the total number of fungi in Thailand may be higher with than 6,000 species (Jones and

Hyde, 2004). The number of new fungi to science have been described from Thailand e.g.

Acrodictys micheliae (Kodsueb et al., 2007), Amanita siamensis (Sanmee et al., 2003),

Astraeus odoratus (Prosri et al., 2004), Ascothailandia grenadoidia (Sri-indrasutdhi et al., 2010), Candida krabiensis, C. sithepensis, C. thaimueangensis, Kazachstania siamensis, Ogataea nakhonphanomensis, Pichia thermomethanolica, Torulaspora maleeae, (Limtong et al., 2004, 2005, 2007a, 2007b, 2007c, 2008), C. xylanilytica

(Boonmak et al., 2011), Craspedodidymum licualae, Cr. microsporum, Cr. siamense

(Pinruan et al., 2004), Cheiromyces magnoliae (Promputtha et al., 2005), Dictyosporium muase (Photita et al., 2002), Gaeumannomyces amomi (Bussaban et al., 2001a),

Lactarius formosus L. friabilis, L. lavandulus (Le et al., 2007a, 2007b, 2007c),

Leiosphaerella amomi (Bussaban et al., 2001a), Linocarpon lamiae, Li. siamensis, Li. suthepensis (Thongkantha et al., 2003), Ophioceras chiangdaoense (Thongkantha et al.,

2008), Pyricularia kookicola, P. longispora, P. variabilis (Bussaban et al., 2003a), 9

Stachybotrys suthepensis (Photita et al., 2003), Tortulomyces thailandicus, Nitschkia siamensis (Vasilyeva et al., 2013), Xenosporium amomi (Bussaban et al., 2003b) and

Talaromyces thailandensis, T. tratensis (Manoch et al., 2013).

From 2006 to 2013, many publication on microfungi communities from various plants in tropical area have been described from Thailand e.g. bamboo culms (Choeyklin et al., 2009), grasses (Bhilabutra et al., 2010), leaf litter (Wang et al., 2008), palms

(Pinruan et al., 2007, 2010a, 2010b; Pinnoi et al., 2006, 2007, 2009, 2010; Lumyong et al., 2009), teak (Chareprasert et al., 2006), wood (Vasilyeva et al., 2013; Kodsueb et al.,

2006, 2007. 2008a, b), freshwater fungi (Sri-indrasutdhi et al., 2010; Zhang et al., 2011), marine fungi (Pilantannapak et al., 2006; Jones et al., 2006, 2009; Dethoup and Manoch,

2009). In addition, macrofungi have been studies in Thailand e.g. Agaricus (Zhao et al.,

2011; Wisitrassameewong et al., 2012), Amanita (Sanmee et al., 2008), Boletes

(Seehanan and Petcharat, 2008; Thongklam, 2008; Pukahuta et al., 2009; Kumla et al.,

2012), Lactarius (Le et al., 2007a, 2007b, 2007c), Lentinus (Karunarathna et al., 2011) and Marasmius (Wannathes et al., 2009).

2.3 Endophytic fungi

2.3.1 Definition of endophytes

There have been many definitions of what an endophyte (Table 2.2), with that by

Petrini (1991), generally accepted. The “balanced antagonism” hypothesis was initially proposed to address how a fungal endophyte avoids activation the host plant defense and manages to grown within its host without causing visible manifestations of infection or 10

disease (Schulz and Boyle, 2005; Arnold, 2008). This hypothesis proposed that asymptomatic colonization is the balance of antagonisms between the host plant and fungal endophyte (Figure 2.1A).

Table 2.2 Definitions of what constitutes an endophyte (Hyde and Soytong, 2008).

Year Definition Reference 1866 Any organisms occurring within plant tissues De Bary, 1866 1971 An organism that lives in another organism Ainsworth, 1971 1986 Mutualists, those fungi that colonize aerial parts of living Carroll, 1986 plant tissues and do not cause symptoms of disease 1988 Fungi that form unapparent infections within leaves and Carroll, 1998 stem of healthy plans 1991 All organisms inhabiting plant organs that at some time in Petrini, 1991 their life, can colonize internal plant tissues without causing apparent harm to the host 1992 A group that colonize living, internal tissues of plants Hirsch and Braun, 1992 without causing any immediate, overt negative effects 1993 Fungi as colonizers of the living internal tissues of their Rollinger and Langenheim, 1993 plant host 1993 Endophytes are any fungi isolated from internal symtomless Cabral et al., 1993 plant tissues 1995 Fungi and bacteria which, for all or part of their life cycle, Wilson, 1995 invade the tissues of living plants and cause unapparent and asymptomatic infections entirely within plant tissues, but cause no symptoms of disease 1995 Infection strategy is regarded as important in the definition Wilson, 1995 of the term of endophyte 2000 True endophyte-fungi whose colonization never results in Mostert et al., 2000 visible disease symptoms 2005 Fungi that colonize a plant without causing visible disease Schulz and Boyle, 2005 symptoms at any specific moment

Endophytes and pathogens both possess many virulence factors that are countered by plant defense mechanisms. If fungal virulence and plant defense are balanced, the association remains apparently asymptomatic and avirulence. In addition, if the plant defense mechanisms completely counteract the fungal virulence factors, the fungus will perish. Conversely, if the plant succumbs to the virulence of the fungus, a plant-pathogen 11

relationship would lead to plant disease (Figure 2.1B). The interaction between host and endophyte is balanced or imbalance depened on the general status of the partner, virulence of the fungus, the defenses of the host plant, and both virulence and defense being variable and influenced by environmental factors (Kogel et al., 2006). Many endophytes could possibly be latent pathogens, they might be influenced by certain intrinsic or environmental factors to express factors that lead to pathogenicity (Schulz and

Boyle, 2005; Arnold, 2008). There are numerous examples of endophytes that become pathogens. Mostert et al. (2000) and Romero et al. (2001) reported that most fungi isolated as endophyte such as, Alternaria alternata, Fusarium sp., Phoma subglomerata,

Phomopsis viticola also grow and sporulate on chlorotic and necrotic leaf tissues of host plant. Photita et al. (2004) reported that some fungal endophytes of wild banana were able to cause leaf spots in living banana leaves. Recently, Begoude et al. (2010) found that the Botryosphaeriaceae are endophytic fungi and latent pathogens that can result in wood stain, cankers, die-back and death of trees, particularly when trees are under stress.

Endophytic fungi not only occur in living tissues but also in decomposing tissues as saprobes during the initial stages of their decomposition (Ghimire and Hyde, 2004;

Osono et al., 2004; Promputtha et al., 2007). Hyde et al. (2006) suggested that fungal endophytes become saprobes when plant leaves senescence. Promputtha et al. (2010) reported that the fungal endophytes isolated from Magnolia liliifera that have the capability to produce degrading enzymes should have an important role as litter decomposers, but they do not decompose host tissue in the living host. 12

The earliest studies endophytes were those isolated and cultured from seeds of

Lolium temulentum (Vogl, 1898, cited by Wilson, 1995). During the period 1933–1989, many studies of grass endophytes were undertaken (Sampson, 1938; Saha et al., 1987;

White, 1987; Leuchtmann, 1992). This led (1977–1983), to the study of endophytic fungi associated with conifers (Carroll et al., 1977; Carroll and Carroll, 1978; Carroll and

Petrini, 1983).

Figure 2.1 A balance of antagonism hypothesis between endophytic virulence and plant defense response results in asymptomatic colonization. Adapted from Schulz and Boyle

(2005).

Studies on endophytic fungi from palms were initiated in 19902000 (Rodrigues and Samuels, 1990; Rodrigues, 1994; Taylor et al., 1999; Fröhlich et al., 2000), while a book on “Endophytic Fungi in Grasses and Woody Plants” was published in 1996

(Redlin and Carris, 1996). Most knowledge of endophytic fungi comes from temperate regions (Fisher et al., 1994; Strobel, 1996; Saikkonen et al., 1998; Taylor et al., 1999;

Müller et al., 2001), but significant contributions on tropical endophytes have been made since 2000 (e.g. Suryanarayanan and Kumaresan, 2000; Bussaban et al., 2001; Gamboa and Bayman, 2001; Photita et al., 2001; Suryanarayanan et al., 2002, 2003; Arnold et al.,

2003; Pandey et al., 2003; Wiyakrutta et al, 2003; Bhilabutra, 2009; Pinruan, 2010).

Endophytic fungi have been found in all plants that have been examined (Arnold et al., 2000), and have been isolated from all plant tissues including bark, flowers, leaves, petioles, roots, seeds and twigs (Stone et al., 2000; Bussaban et al., 2001; Kumar and

Hyde, 2004; Pinruan, 2010). Individual plants are usually colonized by a diversity of endophytic fungi (Bussaban et al., 2001; Photita et al., 2001; Clay, 2004; Bhilabutra,

2009). Endophytic fungi have been studied for their biology, evolution, occurrence, taxonomy, potential source of bioactive compound, and also ability to inhibit pathogens

(Bussaban et al., 2001; Photita et al., 2001; Guo et al., 2003; Arnold et al., 2003; Kumar and Hyde, 2004; Saikkonen et al., 2004; Promputtha et al., 2006; Silva et al., 2005;

Bhilabutra et al., 2007; Pinruan, 2010).

2.3.2 Role of endophytic fungi

Endophytes and their hosts form mutualistic relationships that are reciprocally beneficial to the plant and fungus. However, endophyte-infected plants may affect animal health and production (Faeth, 2002), as infected plants may produce alkaloids and other mycotoxins (Wicklow et al., 2005). Endophytes are often advantageous to the host plant by increasing its resistance to mammalian and insect herbivores (Tintjer and Rudgers

2006; Gonthier et al., 2008), solubilization of phosphate, produced plant hormone such as auxin, abscisins, gibberellins and indole-3-acetic acid (IAA), which are important for plant growth and development regulation (Hamayun et al., 2009, 2010; Khan et al.,

2012), affording protection against fungal pathogens (Aly et al., 2010; Gao et al., 2010), improving host tolerance and increasing drought resistance (Malinowski and Belesky,

2000; Kannadan and Rudgers, 2008; Bayat et al., 2009). Infected plants can produce greater numbers of tillers and roots, making them more drought-tolerant, more competitive with weed species, able to recover more rapidly from injury and generally more persistent in the field (Kannadan and Rudgers, 2008). The higher performance is particular notable under stressful conditions such as high temperature, as well as nutrient and water deficiency. Endophytes are also of increasing interest to biotechnologists because of the intrinsic potential of genetically engineered endophytic organisms serving as genes to be introduced into economically important plant species (Schulz and Boyle,

2005; Yu et al., 2010).

2.3.3 Endophytic fungi in Thailand

Thailand is located in tropical zone which has a high biodiversity (Bills et al.,

2002). The endophytic fungi are significantly more diversity in tropical than in temperate regions (Arnold et al., 2001) and the numbers of publication that report the present of endophytic fungi in tropical are increasing, there have been few studies in Thailand although Thailand has rich plant diversity (Panthong et al., 1991; Promputtha, 2006).

Endophytic fungi from Thailand have been isolated from a wide range of plant species

(Table 2.3).

Table 2.3 Studying endophytic fungi from Thailand.

Host Reference Indigenous plant species Lumyong et al. (1998) Teak trees Mekkamol (1998) Mesua ferrea and Prunus arborea Hyde et al. (1997) Dimocarpus longana Sardsud et al. (1998) Bambusa spp. Lumyong et al. (2000) Musa acuminata Photita et al. (2001) Amomum siamense Bussaban et al. (2001) 81 Thai medicinal plants Wiyakrutta et al. (2004) Magnolia liliifera Promputtha et al. (2005) Tectona grandis and Samanea saman Chareprasert et al. (2006) Garcinia plant Phongpaichit et al. (2007) Elaeis guineensis Rungjindamai et al. (2008) Grasses Bhilabutra (2009) Calamus kerrianus and Wallichia caryotoides Lumyong et al. (2009) 9 dipterocarp plants Orachaipunlap et al. (2009) Elaeis guineensis and Licuala spinosa Pinruan (2010) Enhalus acoroides Sakayaroj et al. (2010) 10 mangrove plants Chareprasert et al. (2010) Terrestrial orchid Chutima (2012) Croton oblongifolius Panuthai et al. (2012) 6 Thai medicinal plants Theantana (2012)

Endophytic fungi have the potential to produce carbohydrase enzymes, especially mannanase, with higher activity than other enzymes tested (Lumyong et al., 2000; 16

Theantana et al., 2007), and also produce active compounds such as anti-cancer, anti- malarial, anti-microbial and anti-oxidant agents (Wiyakrutta et al., 2003; Bhilabutra et al., 2007 Theantana et al., 2007; Li et al., 2010; Sutjaritvorakul et al., 2011; Powthong et al., 2012). Most studies reported that endophytic fungi may provide an excellent source of isolates for screening and for the discovery of biological active novel compounds

(Hyde, 2000; Rukachaisirikul et al., 2008; Klaiklay et al., 2012).

2.3.4 Endophytic fungi from medicinal plants

Acquiring fungal endophytes which may display bioactivity, needs selection of plant species that may be of interest because of their unique biology, age, endemism, ethnobotanical history, and/or environmental setting (Selim et al., 2012). Yu et al. (2010) reported that medical plants and plants in special environments were frequently studied for screening of presence endophytes that produce antimicrobial agents (Figure 2.2).

Figure 2.2 Proportion of active endophytic fungal isolates from different sources with antimicrobial activities (Yu et al., 2010).

The previous work, endophytic fungi have been recovered from Thai medicinal plant species were used as source to isolated endophytic fungi. For example, Amomum siamense (Bussaban et al., 2001), 81 Thai medicinal plants (Wiyakrutta et al., 2004),

Urobotrya siamensis and Leea rubra (Chomcheon et al., 2005, 2006), Stemona sp.

(Sappapan et al., 2008), Adenanthera microsperma, Betula alnoides, Cassia alata,

Hiptage benghalensis, Houttuynia cordata, Eupatorium odoratum and Stemona tuberose

(Theantana, 2012). The attempt of fungal isolated from medicinal plants has been continuously report from several worldwide researches such as Chinese medicinal plants

(Li et al., 2005; Dai et al., 2008; Huang et al., 2008; Gong and Guo, 2009; Qiu et al.,

2010; Xing et al., 2010). India medicinal plants (Gond et al., 2007; Khan et al., 2007;

Gangadevi and Mathumary, 2008; Naik et al., 2008; Jalgaonwala et al., 2010; Khan et al., 2010; Srinivasan et al., 2010; Goveas et al., 2011; Nithya and Muthumary, 2011;

Srimathi et al., 2011), Indonesian medicinal plants (Ilyas et al., 2009), Iran medicinal plants (Ebrahimi et al., 2010) and Malaysia medicinal plants (Radu and Kqueen, 2002;

Tong et al., 2011) and Pakistan medicinal plants (Khan et al., 2010).

2.4 Molecular taxonomy

2.4.1 Molecular taxonomy in fungi

The traditional isolation and identification of endophytic fungi are mainly based on morphological methods, using phenotypic characters of the fungal culture, colony, hyphae, spore characters, reproductive structure, physiological, biochemical and ecological relationships if these features were discernible (Carmichael et al., 1980; 18

Barnett and Hunter, 1998; Guo et al., 1998). The fungi that do not sporulate on media have been termed mycelia sterilia and often been grouped as morphospecies (Guo et al.,

2000, 2003; Promputtha et al., 2005). Methods to promote sporulation in mycelia sterilia have been developed (Guo et al., 1998; Taylor et al., 1999; Fröhlich et al., 2000). The proportions of non-sporulating endophytes range from 11–54% (Fisher et al., 1994,

Fröhlich et al., 2000; Guo et al., 2000; Kumar et al., 2004). To resolve the problem of identifying non-sporulating isolates, DNA sequence-based methodologies have been successfully used for the phylogenetic placement and classification of morphospecies obtained as endophytes (Guo et al., 2003; Promputtha et al., 2005; Wang et al., 2005).

Molecular approaches have been used to resolve problems in fungal taxonomy and for direct detection and identification of fungi within natural habitats (Zhang et al., 1997;

Liew et al., 1998; Ranghoo et al., 1999). The most frequently accountered problem in endophytic fungi is the presence of mycelia sterilia, making their morphological identification difficult (Guo et al., 2000). Ribosomal DNA (rDNA) sequence analysis using specific PCR primers to amplify rDNA fragments of endophytes was used to validate the morphospecies of different groups of mycelia sterilia, and to resolve the identification problem associated with endophytic fungi (Andjic et al., 2005; Promputtha et al., 2005; Wang et al., 2005). Ribosomal DNA sequencing data are widely used for this purpose. Internal transcribed spacer (ITS) regions in most of the known fungi are too variable and help us only to group closely related isolates, while 5.8S is too conserved, as realized during the present work. Recently, several studies applied molecular tools and accessed to their DNA sequence data to identify mycelia sterilia (Wang et al., 2005; 19

Sánchez Márquez et al., 2008; Huang et al., 2009). Total fungal communities should be examined by extracting the entire host DNA (for example from various tissues of fungal host) with many methods to sequence individual taxa. Potentially successful methods include DNA cloning (Guo et al., 2001; Seena et al., 2008), denaturing gradient gel electrophoresis (Duong et al., 2006; Zuccaro et al., 2007) and terminal restriction fragment length polymorphism (Nikolcheva et al., 2003; Nikolcheva and Bärlocher,

2005; Mandyam et al., 2010; Sun et al., 2012).

Molecular techniques can show hidden diversity and help reveal identities and diversity of sterile mycelia. However, the careless use of named GenBank sequences without questioning whether their identifications are correct has lead to wrongly name of many species in endophyte studies (Koko et al., 2011). Extreme caution must be taken when using named sequences from GenBank as these are often wrongly named (Cai et al., 2009, Koko et al., 2011).

2.4.2 Genes useful for molecular taxonomy of fungi

The ribosomal RNA gene of fungi comprise two major regions the highly conserved region and variable region, with are slowly and rapidly evolving, respectively

(Figure 2.2). These genes are often used for taxonomic and phylogenetic relationships of fungi because they are found universally in living cells in which they have important functions; thus, their evolution might reflect the evolution of the whole genome. This multiple copy gene of fungi can be easily extracted from the fungal genome and amplified using universal primers (White et al., 1990). The more conserved regions, 20

namely the small subunit (SSU 16S) and large subunit (LSU 28S) rDNA, have been useful the finding relationships between distantly related taxa of family (Sri-indrasutdhi et al., 2010; Zhang et al., 2010a; Chen et al., 2013). Internal transcribed spacer (ITS1-

5.8S-ITS2) rDNA and some other genes e.g. β-tubulin and histone genes are now established to prove relationship of closely related taxa (Benerjee et al., 2010; Sakayaronj et al., 2010; Vega et al., 2010; Bhagobaty and Joshi, 2012; Chen et al., 2013). Universal primers used for gene amplification are listed in Table 2.4.

Figure 2.3 Nuclear ribosomal DNA internal transcribed spacer region and specific site of primer for amplification of 18S, ITS1-5.8S-ITS2 and 28S. Adapted from Jobes and Thien

(1997).

Table 2.4 Universal primers used to amplify 18S, ITS1-5.8S-ITS2 and 28S.

Primer Sequence (5'3') References NS1 GTAGTCATATGCTTGTCTC White et al., 1990 NS4 CTTCCGTCAATTCCTTTAAG White et al., 1990 ITS1 TCCGTAGGTGAACCTGCGG White et al., 1990 ITS2 GCTGCGTTCTTCATCGATGC White et al., 1990 ITS4 TCCTCCGCTTATTGATATGC White et al., 1990 ITS5 GGAAGTAAAAGTCGTAACAAGG White et al., 1990 LROR ACCCGCTGAACTTAAGC Vilgalys and Heater, 1990 LR5 TCCTGAGGGAAACTTCG Vilgalys and Heater, 1990

2.5 Fungal volatile organic compounds

2.5.1 Introduction of fungal volatile organic compounds

Many microorganisms, both prokaryotic and eukaryotic, generate an array of volatile organic compounds (VOCs). Volatile organic compounds are carbon-based solids and liquids that readiary enter the gas phase by vaporizing at 0.01 kPa at a temperature of approximately 20ºC (Pagans et al., 2006). Approximately 250 VOCs have been identified from fungi where they occur as mixtures of sample hydrocarbons, heterocycles, aldehydes, ketones, alcohols, phenols, thioalcohols, thioesters and their derivatives, including, among others, benzene derivatives, and cyclohexanes (Figure 2.5) (Chiron and

Michelot, 2005; Korpi et al., 2009; Ortiz-Castro et al., 2009).

Figure 2.4 Name and structures of selected common volatile compound by fungi.

Adapted from Morath et al. (2012). 22

Fungal VOCs are derived from both primary and secondary metabolic pathways

(Korpi et al., 2009), and because VOCs can diffuse through the atmosphere and soil, they are ideal “infochemicals”, a chemical that carries information that mediates an interaction among two individuals and results in an adaptive response in the receiver. Either the sender or the receiver, or both, benefits from the infochemical. Many VOCs have distinctive odors so it is not surprising that interest in fungal VOCs began with the fungi that humans can smell. For example, the distinct bouquets of macrofungi and microfungi include mixtures of different VOCs, of which alcohols, aldehydes, terpenes, aromatics and thiols dominate (Splivallo et al., 2007; Cho et al., 2008; Fraatz and Zorn, 2010;

Zhi-Lin et al., 2012). Current knowledge about fungal VOCs was shown in Figure 2.6.

Figure 2.5 Subdisciplines that have contributed to our knowledge of fungal VOCs

(Morath et al., 2012).

For examples, fungal VOCs have been used as part of biological control strategies to prevent the growth of plant pathogens in agriculture (Lutz et al., 2004; Mercier and

Manker, 2005; Kishimoto et al., 2007). Additionally, there is increasing interest in the study of the plant-growth promoting effects of these VOCs mixtures (Macias-Rubalcava et al., 2010). In the food industry, the same biological control properties are used to prevent post-harvest fungal growth, in termed of “mycofumigation” (Stinson et al., 2003;

Mercier and Jimenez, 2007). Most recently, fungal VOCs have been studied for their potential role as fuel sources, popularly referred to as “mycodiesel” (Griffin et al., 2010;

Strobel et al., 2011).

The VOCs profile of given species or strains will very depending on the substrates, duration of incubation, type of nutrients, temperature, and other environmental parameters (Nilsson et al., 2004; Fiedler et al., 2005). To assess the physiological functions of VOCs, bioassays must be conducted in a closed environment. Currently, gas chromatography/mass spectrometry (GC/MS), due to its powerful separation and highly sensitive detection capabilities, is the main method for detecting fungal VOCs (Matysik et al., 2009). The culture headspace can be concentrated using solid adsorbents and followed by thermal desorption into the GC/MS. Compounds are then identified using a library or database of mass spectra, or by comparison of retention times and spectra with those of known standards (Insam and Seewald, 2010). Several conventional techniques including diffusive sampling, purge and trap method, and steam distillation-extraction

(SDE), have been developed for sample concentration (Larsen and Frisvad, 1994, 1995).

The commonly used adsorbents for trapping volatile compounds are Tenax, Carbopack 24

B, and silica gel. Recently, improved sensitivity of new and popular techniques based on headspace sampling, such as solid-phase microextraction (SPME), stir bar sorptive extraction (SBSE) and headspace sorptive extraction (HSSE) employing polydimethylsiloxane (PDMS) as an extraction medium, are now available for absobtion of the volatile compound samples (Marsili et al., 2007; Wihlborg et al., 2008; Stoppacher et al., 2010; Zhang and Li, 2010). It should be noted that adsorbents used in SPME fibers can sometimes experience the “competitive absorption effects” making some important components undetectable (Zhang and Li, 2010), but this will not occur in HSSE.

Moreover, a very sensitive detection technique, named as proton-transferreaction mass spectrometry (PTR/MS), was developed to quantitate VOCs (Insam and Seewald, 2010;

Strobel, 2011). Furthermore, a combination of GC/MS with PTR/MS has proven to be an effective tool for totally detecting and identifying VOCs (Insam and Seewald, 2010). In some cases, the compounds cannot be accurately identified due to poor matches in mass spectral library databases. Booth et al. (2011) described a technique which rapidly traps and collects fungal VOCs that may have fuel potential. The trapping materials, Carbotrap

A and B (Supelco) and bentonite-shale, were placed in a stainless steel column and the trapped fungal VOCs were recovered via controlled heating of the column followed by passage of the gases through a liquid nitrogen trap at a recovery rate of approximately

65–70 %. This method allows the recovery of mg quantities of compounds normally present in the gas phase that may be used for bioassays, further separation, and analyses

(Booth et al., 2011), and potentially for nuclear magnetic resonance (NMR) spectroscopy to identify novel compounds produced by fungi. 25

2.5.2 Volatile-producing endophytic fungi

The several fungal endophytes in Ascomycota are capable of producing VOCs, but members of the Xylariaceae family may be an especially rich source (Table 2.5). In a recent study, an endophytic basidiomycete (Oxyporus latemarginatus) was shown to produce volatole antifungal compounds (Lee et al., 2009). The newly described genus

Muscodor has evoked general interest among mycologists and plant pathologists due to its obligate endophytism and comprehensive spectrum of antimicrobial activity. A large- scale investigation of endophytic fungi would likely uncover more taxa endowed with this feature. A common rationale, use of the volatiles produced by M. albus as a selection tool, has been used to discover further lethal gas-producing endophytes, both closely- and distantly related species (Strobel et al., 2001). Previously, only volatile-producing endophytic fungus genus Muscodor has been recorded from Thailand (Sopalum et al.,

2003; Phongpaichit et al., 2007). There is potential of fungal VOCs for biotechnological applications in agriculture, industry and medicine. In agriculture, the interest in fungal

VOCs is for their potential as biological control agents for controlling of fungal pests to employ a more environmentally sound pest management strategy by reducing fungicide use on crop plants. Some are lethal to a wide variety of plant and human pathogenic fungi and bacteria, and are also effective against nematodes and certain insects (Strobel, 2006;

Grimme et al., 2007). Thus, the mycofumigation concept has been introduced referring to use of volatile antibiotics produced by fungi for control of pathogens. The genus

Muscodor is one of the best-studied antibiotic volatile-producing endophyte fungal group.

Table 2.5 List of endophytic fungi taxa produce volatile organic compounds (Zhi-Lin et al., 2012).

Fungal taxa Host plants Main compound References Acremonium sp. GX4-1B Brachiaria brizantha Aromatic lactones Huang et al. (2010) Alternaria sp. CID 62 Centaurea stoebe Sesquiterpenes Newcombe et al. (2009) Ascocoryne sarcoides Eucryphia cordifolia Ketone, esters, alcohols, sesquiterpenes Griffin et al. (2010); Stroble et al. (2010) Aspergillus niger Rosa damacaena 2-Phenylethanol Wani et al. (2010) Botrytis sp. BTF21 Musa spp. 2-Butenedinitrile; 2-methylbutane Ting et al. (2010) Candida intermedia Strawberry 1,3,5,7-Cyclooctatetraene; 3-methylbutan-1-ol Huang et al. (2011) Cladosporium sp. MIF01 Mimosa pudica 2-Methylbutane; 2-Methylpropanol-1-ol Ting et al. (2010) Epicoccum sp. CID66 Centaurea stoebe Sesquiterpenes Newcombe et al. (2009) Fimetariella rabenhorstii Aquilaria sinensis Frabenol Tao et al. (2011) Fusarium sp. CID124 Centaurea stoebe Sesquiterpenes Newcombe et al. (2009) Gliocladium roseum Eucryphia cordifolia Hydrocarbon (Benzene, haptane, octan) Stroble et al. (2008) Hypoxylon sp. CI-4 Persea indica 1,8-Cineole; 1-medthyl-1,4-cyclohexadiene Tomsheck et al. (2010) Meliniomyces variabilis Pinus sylvestris Ethanol; acet-aldehyde Bäck et al. (2010) 26 Muscodor albus Cinnamomum zeylanicum Azulene and naphthalene derivative; 2-Butanone; Worapong et al. (2001); Ginkgo biloba, 2-methylfuran and 3-methylbutyl acetate Strobel et al. (2007); Guazuma ulmifolia, Sopalun et al. (2003); Myristica fragrans, Atmosukarto et al. (2005); Oryza granulata, Ezra et al. (2003); Terminalia prostrate, Banerjee et al. (2010); Unidentified smallvine Yuan et al. (2011) Muscodor crispans Ananas ananassoides 2-Methylpropanoic acid Mitchell et al. (2008) Muscodor cinnamomi Cinnamomum bejolghota 2-Methylpropanoic acid Suwannarach et al. (2010) Muscodor equiseti Equisetum debile 2-Methylpropanoic acid Suwannarach et al. (2013a) Muscodor fengyangensis Abies beshanzuensis, 2-Cyclohexen; Naphthalene derivatives; Zhang et al. (2010b) Actinidia chinensis, 2-methylpropanoic acid; -phellandrene; Pseudotaxus chienii β-phellandrene Muscodor musae Musa acuminata 2-Methylpropanoic acid Suwannarach et al. (2013a) Muscodor oryzae Oryza rufipogon 3-methylbutan-1-ol Suwannarach et al. (2013a) Muscodor roseus Erythophelum chlorostachys Ethyl crotonate; 1,2,4 trimethylbenzene; Worapong et al. (2002) Grevillea pteridifolia 2,3-nonadiene Muscodor suthepensis Cinnamomum bejolghota 2-Methylpropanoic acid Suwannarach et al. (2013a) Muscodor sutura Prestonia trifidi 2-Methylpropanoic acid Kudalkar et al. (2012)

Table 2.5 (Continued).

Fungal taxa Host plants Main compound References Muscodor vitigenus Paullinia paullinioides Naphtalene Daisy et al. (2002) Muscodor yucatanensis Burser simaruba 2-Methylbutylacetate; octane; 2-penthylfuran; González et al. (2009) caryophyllene Mycelia sterilia Nerium oleander Acetol; 2,3-butanediol Huang et al. (2007) Myrothecium inunduatum Acalypha indica 3-octanol; 3-octanone; 7-octen-4-ol Benerjee et al. (2010) Nodulisporium sp. CF016 Cinnamomum loureirii β-Elimene; -selinene; β-selinene; Park et al. (2010) 1-medthyl-1,4-cyclohexadiene Nodulisporium sp. CMU- Lagerstroemia loudoni Eucalyptol Suwannarach et al. (2013b) UPE34 Nodulisporium sp. 10-2-a, Lomatia fraseri, Caryophyllene; Eucalyptol; 1,3,8-p-menthatriene Mann et al. (2008) Nodulisporium sp. 2-1-c Olearia argophylla Oxyporus latemarginatus Capsicum annum 5-Pentyl-2-furaldehyde Lee et al. (2009) Penicillium sp. BTF08 Musa spp. Ting et al., (2010) 3-Methylbutan-1-ol; β-butyrolactone; 27

2-butenedinitrile Phialocephala fortinii Pinus sylvestris Ethanol; acet-aldehyde; tuluene Bäck et al. (2010) Phoma sp. Larrea tridentata Alcohols; naphthalene derivative; sesquiterpenes Strobel et al. (2011) Phomopsis sp. Odontoglossum sp. Benzeneethanol; 3-methylbutan-1-ol; Singh et al. (2011) 2-propanone; monoterpenes

2.5.3 Application of volatile-producing endophytic fungi

The application of microbial antagonists is widely considered as a safe and eco- friendly alternative to control fruit spoilage (Jamalizadeh et al., 2011). Of a number of candidate biological agents, the volatile antibiotics producing microbes show an equal or great degree of promise for development as attractive biological fumigants in the following aspects. The owing to their high volatility, these small organic molecules possess a long-distance mechanism of antagonistic action, leading to a direct penetration at spatial scales (Fialho et al., 2011). The most commonly-used biocontrol microbes require spraying or drenching as application methods, while volatile antibiotics do not require direct contact with fruits (Park et al., 2010). The VOCs of Muscodor albus are useful for the control of postharvest plant diseases (Stinson et al., 2003). In in vitro experiments, the VOCs of M. albus were toxic to the fruit pathogens, Botrytis cinerea,

Monilinia fructicola, Penicillium expansum and Sclerotinia sclerotiorum (Mercier and

Jimenez, 2004; Camp et al., 2008). Additionally, the VOCs of Oxyporus latemarginatus

EF069, an endophyte isolated from red peppers, inhibited the mycelial growth of several plant pathogens known to damage postharvest fruit and could be used in fumigation as the VOCs reduced postharvest decay of apples caused by B. cinerea and Rhizoctonia root rot of moth orchid (Lee et al., 2009). It is assumed that the antibiotic volatile released by

Muscodor may lead to direct competition at spatial scales in plant inner tissues (Yuan et al., 2011). The explicit ecological significance of Muscodor, however, remains to be explored. Yet there is some evidence that the VOCs of Muscodor act as a double-edged sword, as they inhibit most phytopathogens, but are also lethal to plant growth of high 29

concentration (Macías-Rubalcava et al., 2010). For exsample, Macías-Rubalcava et al.

(2010) reported that volatiles of M. yucatanensis inhibited root elongation in amaranth, tamato and barnyard grass. Although in vivo detection of VOCs production by endophytes is likely to be challenging, the effort is worth while since these organisms actively shape the plant endophytic microbial community due to the pressure exerted by their volatile antibiotics.

Recently, the monoterpene 1,8-cineole, an octane derivative, produced by

Hypoxylon sp. also has potential use antimicrobial VOC (Tomsheck et al., 2010). The endophytic fungus, Gliocladium roseum produces a series of high-energy volatile hydrocarbons (Strobel et al., 2008; Griffin et al., 2010; Strobel et al., 2010). This fungus has the unique capability of converting cellulose or glucose into the medium length hydrocarbon chains (mainly alkanes) typically found in diesel fuel. Therefore, this finding may have utility in commercial mycodiesel production. Further bioprospecting studies have shown endophytes such as Gliocladium spp., Myrothecium inundatum,

Phoma sp., Phomopsis sp. and Hypoxylon sp. to be potential hydrocarbon producers

(Banerjee et al., 2010; Tomsheck et al., 2010; Ahamed and Ahring, 2011; Singh et al.,

2011; Strobel et al., 2011).

2.6 Bioactive compounds

2.6.1 Potential of fungal bioactive compounds in drug discovery

The potential of fungal natural products in drug discovery it was not until

Alexander Fleming discovered penicillin G (Figure 2.7A) from Penicillium notatum 30

almost 80 years ago (1928) that fungal microorganisms suddenly became a hunting ground for novel drug leads (Strobel and Daisy, 2003; Larsen et al., 2005). Furthermore, griseofulvin (Figure 2.7B) was one of the first antifungal natural products found in filamentous fungi (Grove et al., 1952). Echinocandin B (Figure 2.7C) and pneumocandin

B (Figure 2.7D), isolated from Aspergillus rugulovalvus and Glarea lozoyensis, respectively, were the lead compounds and templates for the semisynthetic antifungal drugs anidulafungin and caspofungin (Butler, 2004). Another strongly immunosuppressive fungal metabolite that is used for organ transplantations and for treatment of autoimmune diseases is mycophenolic acid (Figure 2.7E) (Bentley, 2000).

This compound was produced by Penicillium, Aspergillus, Byssochlamys and Septoria species (Larsen et al., 2005). In addition, by the promising new screening strategy for antibiotics, aiming at inhibition of biofilm formation by Gram-negative bacteria, the quorum sensing inhibitory activity of two well known fungal mycotoxins, patulin (Figure

2.7F) and penicillic acid (Figure 2.7G) which isolated from Aspergillus and Penicillium sp. (Rasmussen et al., 2005). They are either fermentation derived for instance mevastatin

(Figure 2.7H) and lovastatin (Figure 2.7I), from P. citrinum and A. terreus, respectively

(Butler, 2004; Dewick, 2006). Thus, in the search for new sources of therapeutic agents endophytic fungi associated with plants were found to be a vast untapped reservoir of metabolic diversity producing a wide array of new biologically active secondary metabolites.

Figure 2.6 Some fungal bioactive compounds as drugs or drug lead compounds (Selim et al., 2012).

2.6.2 Endophytic fungi as a source of bioactive compounds

Endophytes are universally present in all of the world’s higher plants, so it was reasoned that plants might support certain endophytic microorganisms that could synthesize important phytochemicals of medicinal plants as well as the plant itself. Thus, if a microbial source of the drug was available, it could eliminate the need to harvest and 32

extract the slow growing and relatively rare trees. The price for the drug would also be reduced, since the drugs could be produced via fermentation in such the same way that penicillin is fermented (Strobel, 2003). There is growing evidence that bioactive substances produced by microbial endophytes may not only be involved in the host- endophyte relationship, but may also ultimately have applicability in medicine, agriculture and industry (Strobel, 2002). Additionally, the number of secondary metabolites produced by fungal endophytes is larger than any other endophytic microorganism classes (Zhang et al., 2006). Endophytic fungi have been proved useful for novel drug discovery as suggested by the chemistry diversity of their secondary metabolites. Many endophytic fungi have been reported to produce novel anti-cancer, anti-flammatory, anti-microbial, anti-tumor, and other compounds belonging to the alkaloids, steroid, flavonoid and terpenoids derivatives and other compound types (Guo et al., 2008; Yu et al., 2010; Zhao et al., 2010; Cui et al., 2012). De Souza et al. (2011) and Gutierrez et al. (2012) summarized in amazing reviews the up-to-date an comprehensive information on compounds from endophytic fungi during 1995–2012, together with the botany, phytochemistry, pharmacology and toxicology and discussed the possible trends and the scope for future research of endophytes.

Even though more than 30,000 diseases are clinically described today less than one third of these can be treated symptomatically and even a fewer can be cured. The increasing occurrence of multiresistant pathogenic strains has limited the effect of traditional antimicrobial treatment. Hence, there is an urgent need for new therapeutic agents with infectious disease control (Strobel and Daisy, 2003; Larsen et al., 2005). It is 33

believed that screening for antimicrobial compounds from endophytes is a promising way to overcome the increasing threat of drug resistant microbes of human and plant pathogen

(Tan and Zou, 2001; Yu et al., 2010). As the world becomes wary of ecological damage provoked by extensive use of synthetic insecticides, natural product research continues for the discovery of powerful, selective, and safe alternatives (Strobel and Daisy, 2003).

Many synthetic agricultural agents have been and currently being targeted for removal from the market, because of profound harmful effects on human health and environment.

Li et al. (2005) reported 30% of tested endophytic fungal isolates exhibited antifungal activity, also antimicrobial activity was demonstrated for 8%–92% of endophytic extracts in other studies (Banu and Kumar, 2009; Hazalin et al., 2009, Tong et al., 2011).

Guanacastepene A (Figure 2.8A) represent highly diverse diterpenoids produced by an unidentified endophytic fungus isolated from Daphnopsis americana tree. They exhibited pronounced antibiotic activity against drug resistant strains of S. aureus and

Enterococcus faecium (Brady et al., 2001). Rhizotonic acid isolated form Rhizoctonia sp., in Cynodon dactylon were reported to be active against fungal and bacterial human pathogen (Tikoo et al., 2000; Ma et al., 2004). Moreover, altersetin purified from an endophytic Alternaria sp. displayed potent activity against pathogenic Gram-positive bacteria (Hellwig et al., 2002). Cryptocin (Figure 2.8B) and cryptocandin (Figure 2.8C) are antifungal metabolites obtained from the endophytic fungus Cryptosporiopsis quercina. Cryptocandin demonstrated excellent antifungal activity against some important human fungal pathogens, including C. albicans and Trichophyton spp., and against a number of plant pathogenic fungi, including S. sclerotiorum and B. cinerea. 34

Cryptocandin and its related compounds are currently being considered for use against a number of fungi causing skin and nails diseases (Strobel and Daisy, 2003). Kim et al.

(2004) isolated antibacterial periconicins A (Figure 2.8D) and B (Figure 2.8E) from endophytic fungus Periconia sp. which isolated from Taxus cuspidate. Among metabolites produced by the endophytic fungus A. fumigatus CY018 asperfumoid, fumigaclavine A (Figure 2.8F), fumitremorgin C (Figure 2.8G), physcion (Figure 2.8H) and helvolic acid (Figure 2.8I) were shown to inhibit human pathogenic fungi C. albicans, Trichophyton rubrum and A. niger (Liu et al., 2004; Wang et al., 2007). The antimicrobial agents hypericin (Figure 2.8J) and emodin were produced by Hypericum perforatum. Both compounds possessed antimicrobial activity against several bacteria and fungi, including S. aureus, Klebsiella pneumoniae, Pseudomonas aeruginosa,

Salmonella enterica, and Escherichia coli, A. niger and C. albicans (Kusari et al., 2008).

The endophytic genus Xylaria was investigated as producers of many antimicrobial agents species produce griseofulvin, which is used for the treatment of human and veterinary animals mycotic diseases. Sordaricin (Figure 2.8L), xylacinic acid A, B and multiplolides had antimicrobial activity against C. albicans, S. aureus and methicillin- resistant S. aureus (MRSA), and 7-amino-4-methylcoumarin showed broad-spectrum inhibitory activity against several food spoilage microorganisms. It was suggested for use as natural preservatives in food. In vitro and in vivo antifungal activity of endophyte produced griseofulvin against plant pathogenic fungi were effective for effectively controlling the development of various food crops diseases (Park et al., 2005; Liu et al.,

2008; Pongcharoen et al., 2008; Klaiklay et al., 2013). 35

Figure 2.7 Structure of some bioactive compounds from endophytic fungi (Selim et al.,

2012).

Recently, phomoenamide isolated from endophytic fungi were found to inhibit

Mycobacterium aurum and M. tuberculosis, the causative organisms of tuberculosis

(Rukachaisirikul et al., 2008; Gordien et al., 2010; Verma et al., 2011). Curvularide B 36

isolated from the endophyte Curvularia geniculata was showed antifungal activity with increase in inhibition zone in the presence of fluconazole which indicated the synergistic effect of both drugs against C. albicans (Chomcheon et al., 2010). Chaetomium globosum isolated from Ginkgo biloba produced chaetoglobosin A and C which they reported as biocontrol agent, against Mucor miehei and Setosphaeria turcica (Qin et al., 2009; Zhang et al., 2013). They concluded that as so many antimicrobial compounds were isolated from endophytes which only occupied a small portion of total endophyte species, it is obvious that there is a great opportunity to utilize endophytes as a new source for production of reliable and novel antimicrobial agents. They also stated that this could be a promising way to solve the problem of microbial resistance to commonly used drugs and meet the emergency demand of discovering highly effective, low toxicity, and environmentally friendly antibiotics, which may be used as clinically effective antibiotics in future.