Evaluation of Their Potential As a Biological Control Agent for Ganoderma Boninense, a Pathogenic Fungus of Elaeis Guineensis

Characterization of new Muscodor padawan and Muscodor sarawak, isolated from Sarawak, Malaysia: evaluation of their potential as a biological control agent for Ganoderma boninense, a pathogenic fungus of Elaeis guineensis

Noreha Mahidi

A thesis

presented in fulfilment of the requirements for the degree of

Doctor of Philosophy

at Swinburne University of Technology

2015

Abstract

The aim of this thesis is to isolate endophytic Muscodor-like fungi that produces anti-Ganoderma volatile chemicals, from the rich biodiversity resources of Sarawak. These fungi were then examined for their potential to be developed as biological control agents to control Ganoderma boninense, a pathogenic fungus that causes basal stem rot disease in oil palm, Elaeis guineensis. Ten new isolates of endophytic Muscodor-like fungi were successfully obtained from leaves of different plants of Cinnamomum javanicum collected from the Padawan forest in Kuching, Sarawak, Malaysia, using a co-culture technique with Muscodor albus as the selection organism. Two isolates, Muscodor padawan and Muscodor sarawak were selected for further investigation. Muscodor padawan, when grown on potato dextrose agar, exhibits poor production of aerial mycelia, a yellowish colour, with 20 to 28mm colony diameter after 10 days of incubation at 250C. Muscodor sarawak forms whitish colony with a diameter of 23 to 30mm after 10 days of incubation at 250C and produces moderate aerial mycelia on potato dextrose agar. Scanning electron micrograph of the aerial mycelia of M. padawan showed hyphal formed coiled-like structures, spider mat-like attachments on the surface of hyphae and occasionally the presence of chlamydospores and clumps of hyphae. Formation of new hyphae at lateral main hyphae, chlamydospores at intermediate hyphae, half coiled hyphae at the tip and a strip of hyphae attached by lateral hyphae that formed short bridge-like structure were found in M. sarawak. Analysis on volatiles chemicals produced by both strains using Micro Extraction Gas Chromatography/ Mass Spectrograph showed Bicyclo [3.3.1] nona-2, 6-diene as a major compound in M. padawan. M. sarawak produces a musty odour and a major compound identified as (-) delta- Panasinsine. The ITS-5.8S rDNA sequence of both strains showed 96 to 99% similarities to Muscodor equiseti, indicating that both strains are representative members of Muscodor group. Phylogenetic analysis based on ITS-5.8S sequence showed that M. sarawak is clustered with M. vitigenus, M. sutura and M. equiseti but M. padawan clustered as an independent cluster. The anti-Ganoderma volatile chemicals produced by M. padawan and M. sarawak were affected by physicochemical conditions. Ganoderma boninense was completely killed by volatile chemicals produced by 5-day-old M. padawan and 7-day-old M. sarawak. Volatile chemicals produced by M. sarawak grown on all tested media were capable of killing G. boninense, but only volatile chemicals produced by M. padawan grown on oat extract agar and potato dextrose agar were able to kill G. boninense. At 250C and 300C, M. sarawak produced i volatile chemicals that kill G. boninense but M. padawan was only effective at 250C. At pH 5 and 9, M. padawan effectively killed G. boninense but M. sarawak showed the capability to kill G. boninense at all range of tested pH. In a pot assay system, volatile and non-volatile chemicals produced by M. sarawak did not show destructive impact to the growth rate (height, leaflet production, disease symptom and viability) of oil palm seedlings, although M. padawan showed suppressive impact towards the growth rate of the seedlings. M. padawan and M. sarawak showed success in killing G. boninense and also indirectly suppressed the growth rate of the air borne fungus, Trichoderma spp. This thesis discusses the isolation, characteristics and bioactivities of M. padawan and M. sarawak. The findings from this study suggest potential for the new endophytic fungi, M. sarawak, to be used as an alternative remedy to control the infection of G. boninense at the nursery stage, as well as to control the spread of basal stem rot disease in new or replanted area of oil palm plantations. The application of this newly discovered biofumigant agent could be expanded to other pre and post plant disease problems in the horticultural and agricultural industry. The isolated Muscodor strains described in this thesis may hold a lot of potential in the field of fungal biocontrol and this thesis can serve as a useful reference to the oil palm industries, researchers, and marketers.

Acknowledgements

I would like to thank the following departments and individuals that directly or indirectly contributed to my PhD project: • Dr. Rita Manurung, Ex-Chief Executive Officer (CEO) of Sarawak Biodiversity Centre who have always motivated me to achieve the goals in my study, • Dr. Yeo Tiong Chia, Chief Executive Officer (CEO) of Sarawak Biodiversity Centre and also as my co-supervisor in this project. He has always supported me to drive this project till completion, • Jabatan Ketua Menteri (Chief Minister’s Office) Sarawak, for funding the operational cost of this project, • Swinburne University of Technology Sarawak , for the fee waiver to support my study, • Sarawak Forest Corporation (SFC) and Sarawak Forest Department (SFD) for the information of targeted plants in Sarawak, • My supervisor Assoc. Prof. Dr. Peter Morin Nissom and ex-supervisor Prof. Clem Kuek for their guidance and support throughout my studies, • My Co-supervisor Dr. Moritz Mueller, who always supported and his trust in me on the direction that I selected, • My beloved family for their trust, support and encouragement to me to do the best in my life, • Prof. Dr. Gary Strobel from Montana University, US, and Dr. Hj. Idris Abu Seman, Head of Ganoderma and Diseases Research for Oil Palm Unit of Malaysian Palm Oil Board for their valuable and constructive comments, • My colleague at Sarawak Biodiversity Centre and Swinburne University of Technology Sarawak for their support and encouragements, • Norhayati Ahmed Sajali and Prof. Dr. Sepiah Muid, who assisted me in identification and encouraged me to persevere until completion of this project

iii

• Luming Chen and Onn May Ling , who assisted me in proof-read my thesis Thank you very much………..

Declaration

I hereby declare that this thesis contains no material which has been accepted for the award to the candidate of any other degree or diploma, except where due reference is made in the text of this thesis. To the best of the candidate’s knowledge contains no material previously published or written by another person except where due reference is made in the text of this thesis. Where the work is based on joint research or publications, I have disclosed the relative contribution of the respective workers or authors.

Noreha Mahidi 4 September 2015

Table of Contents

Content Page

Abstract i Acknowledgements iii Declaration v Table of Contents vi List of Abbreviations x List of Figure xi List of Table xiii List of Appendix xv

Chapter 1 Introduction and Literature Reviews 1.1 Soil Borne Fungus: Enemies in Agricultural Sector 1 1.2 Infection Court of Basal Stem Disease (BSR) 3 1.3 Biological Control Agent for BSR 6 1.4 Endophytic Fungi: New Candidates for Biological Control Agent 9 1.5 Discovery of Muscodor and Its Roles 10 1.6 Borneo: Sarawak an Ideal Location for Potential Untapped Resources 13 1.7 Aim of the Thesis 15

Chapter 2 Isolation and Characterization of Endophytic Muscodor-like Isolates Obtained from Cinnamomum javanicum in Sarawak 2.1 Introduction 16 2.2 Materials and Methods 19 2.2.1 Collection of Plant Samples 19 2.2.2 Isolation of Putative Endophytic Fungi Producing 21 Volatile Chemicals

2.2.3 Preparation of Standard Strains 22 2.2.3.1 Muscodor albus, cz-620 22

2.2.3.2 Plant Pathogenic Fungi: Rhizoctonia solani, 23 Phytophthora capsici, Ganoderma boninense and Fusarium oxysporum 2.2.3.3 Preparation of Isolation Plate 23

2.2.4 In vitro Screening of Putative Endophytic Fungi Producing 23 Volatiles Chemicals 2.2.5 In vitro Screening of Endophytic Fungi Producing 24 Volatile Compounds 2.2.6 Preliminary Identification 25 2.2.6.1 Morphology of Colony 25 2.2.6.2 Molecular Identification 26 2.2.7 Storage 28 2.2.8 Viability and Productivity Test 29 2.3 Result and Discussion 30 2.3.1 Plant Collection 30 2.3.2 Isolation of Endophytic Fungi 31 2.3.3 In-vitro Screening of Endophytic Fungi Producing Volatile Chemicals 33 2.3.4 Preliminary Identification 34 2.3.5 Maintenance and Preservation 43 2.4 Conclusion 45

Chapter 3 Novel Endophytic Fungus from Borneo, Sarawak, Malaysia 3.1 Introduction 46 3.2 Materials and Methods 48 3.2.1 Morphological Identification 48 3.2.2 Analyses of the Chemical Composition in Volatile Chemicals 50 Produced by L3R3a and L5R1c 3.3 Results and Discussion 51 3.4 Conclusion 63

vii

Chapter 4 Effect of Physicochemical Conditions on the Efficiency of Muscodor sarawak and Muscodor padawan as Biological Control Agent of Ganoderma boninense 4.1 Introduction 65 4.2 Materials and Methods 66 4.2.1 Effect of Inoculum Age 66 4.2.2 Effect of Culture Media 67 4.2.3 Effect of Temperature 67 4.2.4 Effect of pH 67 4.3 Results and Discussion 68 4.3.1 Anti-Ganoderma Volatile Chemicals Produced in All Stages 68 of Growth of the Test Strains 4.3.2 Media Composition Affects Efficiency of Muscodor padawan, 70 but not Muscodor sarawak, in producing Anti-Ganoderma Volatile Chemicals 4.3.3 250C and 300C are the Best Temperature for Muscodor sarawak 72 to Produce anti-Ganoderma Volatile Chemicals 4.3.4 pH affects the capability of Muscodor padawan in Producing 74 Anti-Ganoderma Volatile Chemicals 4.4 Conclusion 75

Chapter 5 Efficiency of Muscodor sarawak and Muscodor padawan in Preventing Ganoderma boninense From Infecting Oil Palm Seedlings 5.1 Introduction 77 5.2 Materials and Methods 78 5.2.1 In vitro Screening on the Capability of Barley Infected with 78 Muscodor padawan and Muscodor sarawak to Produce Volatiles Anti-Ganoderma Chemicals, Using a Double Plate Assay System 5.2.2 In vitro Screening on the Capability of Muscodor padawan and 79 Muscodor sarawak to Produce Non-volatiles Anti-Ganoderma Chemicals, Using a Dual Cultures Assay System.

viii

5.2.3 Establishment of Muscodor padawan and Muscodor sarawak 80 Inside the Tissue of Oil Palm to Evaluate Their Effects on Oil Palm Seedlings as well as Controlling Ganoderma boninense Infection. 5.2.4 Statistical analysis 83 5.3 Results and Discussions 83 5.3.1 In vitro Screening on the Capability of Barley infected with 84 Muscodor padawan and Muscodor sarawak in Producing Volatiles Anti-Ganoderma Chemicals, Using a Double Plate Assay System 5.3.2 In vitro Screening on the Capability of Muscodor padawan and 86 Muscodor sarawak in Producing Non-volatiles Anti-Ganoderma Chemicals, Using a Dual Culture Assay System 5.3.3 Establishment of M. sarawak and M. padawan inside the Tissue of 88 Oil Palm Seedlings 5.4 Conclusion 97

Chapter 6 General Summary and Recommendations 6.1 Aim of the thesis 98 6.2 Enrichment and Isolation 98 6.3 Taxonomy and Characterization 99 6.4 Volatile Chemicals Composition 99 6.5 Key Factors that Affect Volatile Chemicals Production 99 6.6 Development of a Biocontrol Agent 100 6.7 Future Directions and Recommendations 100

Appendix 1 102 References 105

List of Abbreviations

Basal Stem Rot BSR

Dead Seedlings DS

Diameter Base Height DBH

Disease Incidence DI

Electron Impact EI

Fresh Fruit Bunches FFB

HeadSpace Solid Phase Micro Extraction Gas Chromatography HS-SPME-GC-MS

Internal Transcribed Spacer ITS

Malaysia Palm Oil Board MPOB

National Institute of Standards and Technology NIST

Polymerase Chain Reaction PCR

Potato Dextrose Agar PDA

Pressure Injection Apparatus PIA

Sarawak Biodiversity Centre SBC

Sarawak Forestry Corporation SFC

Sarawak Forestry Department SFD

Sarawak Oil Palm Plantation Owner’s Association SOPPOA

Scanning Electron Microscope SEM

Severity of Foliar Symptoms SFS

University Putra Malaysia UPM

Upper Stem Rot USR

Volatile Organic Compound VOC

List of Figures

Figure Page

Figure 1: Location of National Parks, Wildlife Sanctuaries and 14 Nature Reserves in Sarawak.

Figure 2a: Map of Sarawak and the Kuching area, circled in red. 19

Figure 2b: Map of enlarged Padawan area

Figure 3: Isolation plate showing 10-day-old M. albus on one side of the 22 agar and the other side inoculated with three sterilized plants segments of L02.

Figure 4a: A specimen of Cinnamomum javanicum. 32

Figure 4b: Split plates assay with M. albus. 32

Figure 5 to 7: Colony descriptions of Muscodor-like isolates. Refer to Table 6 35 for description.

Figure 8 to 10: Colony descriptions of Muscodor-like isolates. Refer to Table 6 36 for description.

Figure 11 to 13: Colony descriptions of Muscodor-like isolates. Refer to Table 6 37 for description.

Figure 14: Colony descriptions of Muscodor-like isolates. Refer to Table 6 38 for description.

Figure 15: Hyphae structure of isolate L3R3a (A) and L5R1c (B) using light 38 microscopy with 40x magnification (Bar = 5µm).

Figure 16: Gel electrophoresis of PCR products obtained from the 10 isolates. 40

Figure 17: Phylogenetic analyses of the Muscodor spp and the isolated strains 43 from this study.

Figure 18: Host of L3R3a, Cinnamomum javanicum (L05). This plant was 57 sourced at Padawan.

Figure 19: Mycelial characteristics of L3R3a. 58

Figure 20: Micro-morphological structures of L3R3a visualised using 59 scanning electron microsope (SEM)

xi Figure 21: Mycelial characteristics of L5R1c. 61

Figure 22: Micro-morphological structures of L5R1c visualised using 63 scanning electron microscope (SEM)

Figure 23: Percentage inhibition of radial growth on G. boninense after exposed 70 to volatile chemical produced by various age of Muscodor padawan (MP) and Muscodor Sarawak (MS).

Figure 24: The effect of media composition on the efficiency of M. padawan (L3R3a) 71 and M. sarawak (L5R1c) in producing volatile anti-Ganoderma compounds.

Figure 25: The effect of temperature on the production of volatile anti-Ganoderma 73 chemical by M. padawan (L3R3a) and M. sarawak (L5R1c).

Figure 26: Effect of pH on the efficiency of M. padawan (L3R3a) and 74 M. sarawak (L5R1c) in controlling the growth of G. boninense.

Figure 27: Evaluation of capability of M. padawan on barley grains to produce 85 anti-Ganoderma VOC.

Figure 28: Evaluation of capability of M. sarawak to produce non-volatile 87 anti-Ganoderma chemicals.

Figure 29: M. padawan showed selective pressure against G. boninense 88 in dual culture assay.

Figure 30: Pot trails of seedlings exposed to Muscodor. 91

Figure 31: Pot trails of seedlings unexposed to Muscodor. 92

Figure 32: Abundance of greenish fungus (Trichoderma sp.) growing from 94 the roots of untreated seedlings.

Figure 33: Survivability of treated seedlings upon exposure to G. boninense. 96

xii List of Table

Table Page

Table 1: Effects of commercial biofertilisers towards reduction of 8 Basal Stem Rot (BSR) disease

Table 2: Bioactivity of volatile chemicals produced by members of Muscodor 12

Table 3: Members of Muscodor isolated from plant hosts worldwide 17

Table 4: List of plant species collected from Padawan dan Bako National Park 30

Table 5: Percentage of radial inhibition growth of plant pathogenic fungi 34 after exposure to endophytic isolates.

Table 6: Colony description of Muscodor-like isolates 35

Table 7: Percentage of similarity between isolates and top three 41 sequences in the Genbank database

Table 8: Isolates were grouped using Multiple Sequence Alignment (MSA) 42

Table 9: GC/MS analysis of the volatile compounds produced by 53 a 10-day-old culture L3R3a

Table 10: GC/MS analysis of the volatile compounds produced by 53 a 10-day-old culture L5R1c

Table 11: Effect of 5 days exposure to volatile chemicals produced 86 by M. padawan and M. sarawak on barley grains, towards the growth of G. boninense

Table 12: The inhibition of radial growth of G. boninense by 88 M. padawan and M. sarawak observed in a dual culture assay

Table 13: Effect of M. padawan and M. sarawak treatment on 91 physical appearance of one-month-old oil palm seedling

Table 14: Effect of G. boninense on the physical appearance 93 of one-month-old treated and untreated oil palm seedlings

Table 15: Effect of M. sarawak and M. padawan on the 95 physical appearance of six-month-old oil palm seedlings

xiii

Table 16: Effect of G. boninense on the physical appearance 96 of six-month-old treated and untreated oil palm seedlings

xiv

List of Appendix

Appendix Page

Appendix 1: List of collected plants from Padawan and Bako National Park 102

xv Chapter 1

Introduction and Literature Reviews

1.1 Soil Borne Fungus: Enemies of the Agricultural Sector

In agriculture, soil-borne diseases can cause major economic losses in crop products by reducing 50-70% of potential yields (Stewart et al., 2009). The world economic crop losses due to diseases caused by soil-borne plant pathogens are estimated to be billions of dollars per year (Drenth & Sendall, 2004 and Stewart et al., 2009). In Malaysia alone, with regards to the major crop oil palm, the economic losses per year caused by the soil borne fungus called Ganoderma boninense is estimated between USD 70 to 464 million (Arif et al., 2011; Idris et al., 2011; Khairil & Hasmadi, 2010 and Ommelna et al., 2012). The total revenue collected from this industry in Malaysia is USD 226 million, thus any threat to this industry will also influence revenue to Malaysia.

Soil borne diseases are difficult to control because of the ability of pathogens to produce persistent survival structures that allow their populations to build up over time. Most fungi from the Oomycete group and certain species of Basidiomycete are the main causal pathogens for soil-borne diseases (Lee & Lum, 2004). Phytophthora capsici is one of the most common soil borne species from Oomycete, causing foot rot disease in pepper crop worldwide (Drenth & Guest, 2004). In the mid-1950s Phytophthora capsici was reported to cause an outbreak of root rot disease in Sarawak black pepper, with crop losses estimated at 100% (Holliday & Mowat, 1963). However, by adopting disease integrated management control, the incidence declined to 10-15 % (Kueh, 1979).

In the oil palm industries, the soil borne fungus, G. boninense from the Basidiomycete group is the most significant pathogen. The disease caused by this fungi, BSR, is also considered to be the most serious and deadly oil palm disease in Southeast Asian countries, especially in Malaysia and Indonesia, which are the major producers and exporters of palm oil in the world (Idris et al., 2000, Susanto et al., 2005 and Wong et al., 2012). Basal Stem Rot (BSR) and Upper Stem Rot (USR) diseases affect the production of Fresh Fruit Bunches (FFB), lower oil extracted

1 from mesocarp and also kill the trees (Singh, 1991; Khairuddin, 1993; Rao et al., 2003 and Pilotti, 2005). BSR disease occurs at different ages in the oil palm lifecycle (Thompson, 1931; Turner, 1981; Khairuddin, 1990; 1995; Singh, 1991; Ariffin et al., 1996; 2000; Hasan & Turner, 1998; Flood et al., 2000; Idris et al., 2004; 2005 and Lim & Udin, 2010). This disease has the potential to collapse the oil palm industries such as in Malaysia (Singh 1990 and Ariffin et al., 1996). The total production of crude palm oil (CPO) will be decreased and reposition the rank of Malaysia as the major producers and exporters of palm oil and palm oil by products in the world with 39% and 44%, respectively (PORIM, 2011). Consequently, it also reflects the total revenue received from those products whereby in 2011, Malaysia received total revenue from oil palm products of about USD 226 million (Khairil & Hasmadi, 2010).

The total revenue of Sarawak might also be affected as oil palm is among the major crops that contribute to the economy of Sarawak. Sarawak Oil Palm Plantation Owner’s Association (SOPPOA) claimed that 59,000 hectares of oil palm planted areas in Sarawak are already infected by G. boninense. Meanwhile more than 60% of plantation area in Peninsula Malaysia has been affected by G. boninense (Borneo Post, 2012). The disease incidence in Sarawak is lower compared to Peninsula Malaysia due to high percentage of mature oil palm and replanting programme in the same location with mature oil palm (Wahid & Simeh, 2008). Up to 2011, Malaysia has 5 million hectares of land that are planted with oil palm (PORIM, 2011). Sabah became the largest oil palm planted state with 1.43 million hectares (PORIM, 2011). Sarawak is the second highest oil palm producer in Malaysia with expanding areas for planting oil palm whereby in 2011, 102,169 hectares of land have been deforested for new plantation area (Wahid & Simeh, 2008 and PORIM, 2011;). This number is expected to increase in the near future. The increase in the area of plantations will inevitably become vulnerable to the threat of BSR disease. Thus, early actions to manage the threat must be taken into consideration in the attempt to optimize the growth performance of the trees. Even though, the best planting material or best variety of oil palm like tenera that could produce high yield of oil is used (Yusof & Chan, 2004). It will be meaningless if the oil palm did not prolong to their economic lifespan of 20 to 25 years because of infection by BSR disease (Loh, 1999). Due to that, proper and urgent solutions for controlling the current disease incidence from expanding to new areas are required. It is important, due to potential economic impact and deforested lands has been invested and sacrificed to plant the oil palms.

2 1.2. Infection Court of Basal Stem Disease (BSR)

Infection court is defined as a site on or in a plant where an infection can take place (Zitter et al., 1996). Understanding the infection court of the Basal Stem Rot disease (BSR) and Upper Stem Rot (USR) diseases is very important in order to establish a method to control the infection. In this aspect, G. boninense is the main target as this species has been identified as the main cause of BSR and USR, and is known as the most aggressive species as compared to G. zonatum and G. miniatocinctum (Turner, 1981; Ho & Nawawi, 1985; Khairuddin, 1990; Idris & Ariffin, 2004 and Wong et al., 2012).

Ganoderma boninense is a whitish fungus from the family Polyporaceae and is also known as white wood rot fungus as they are able to degrade lignin (Gilberston & Adarkaveg, 1993; Roy and De, 1996; Ostrofsky et al., 1997; Jones & Ostry, 1998; Lee, 2003; Farid et al., 2005 and Bernicchia, 2007). This fungus forms fruiting bodies through sexual reproduction as a response to the low supply of food (Pegler, 1997 and Ingold, 2002). The fruiting body structure can last up to 100 years as long as new hymenium is formed. Between 2 to 110,000 spores’ m-3 basidiospores can be released from the fruiting body (Corner, 1932; Pegler, 1997 and Rees et al., 2011). This fungus possesses trimitic hyphal system that supports their viability in unfavourable conditions which means they can withstand all weather conditions and survive for years with very minimal metabolic activity (Corner, 1983 and Roy & De, 1996).

Fragments of mycelium and basidiospores have been identified as two main sources of primary infection (Miller, 1995 and Ariffin et al., 1996). Rhizomorph mycelium was reported as the major propagul that spread the incidence of BSR infection to the new host instead of basidiospores (Turner, 1965; Ramasamy, 1972; PORIM, 1988 and Jennings & Lysek, 1996). This is due to the mycelium developmental pattern of rhizomorphs that allow this fungus to withstand dry conditions. Additional to that, closely packed hyphae and thick melanized walls on the outer region of the rhizomorph mycelia assists in minimizing water loss to the external environment (Jennings & Lysek, 1996). Indirectly these structures also prolong their life span and contribute to their success as pathogens to spread the disease onto new areas. This could explain why the rhizomorph mycelium of G. boninense is highly successful as a source of propagules to spread BSR disease incidence in replanted areas.

3 In USR scenario, the primary disease inoculum develops from basidispore that were dispersed from the basidiocarp which was carried by the insect vector, Episcapha 4-maculata, air movement and strong winds to infect healthy palms (Turner, 1981; Ho & Nawawi, 1986; Sanderson et al., 2000 and Idris & Ariffin, 2004).

The BSR and USR diseases were dispersed and spread by initiating primary infection through two methods: a) Root to root contact - the mycelium of root rot pathogens from infected stumps or other woody debris that remained in soil could infect adjacent healthy palm through root colonization, whereby roots of healthy palm contact with infected stumps or woody debris. b) Wounded tree - Wounded trees are commonly caused by insects or breaking off of fronds. The infection on the wounded area is caused by G. boninense basidiospores. Basidiospores were released from the pathogen fruiting bodies called basidiocarp. The basidiospores initiate infection on the wounded surface by germinating appresorium structure that then penetrates and infects the epidermis of plant tissues.

Oil palm replanted after 20 to 35 years when yield of fresh fruit bunches, (FFB) becomes increasingly low and difficulty in harvesting the tall palm (> 10 m) (Loh, 1999). Rapid incidence of BSR disease was highly recorded in replanting area with the age of oil palm above 10 years (Idris et al., 2004; 2005). Mature oil palm tree is favourable for G. boninense to form basidiocarp due to higher cellulose content. The cellulose is the main component to support the formation of oil palm. Besides that, planting density was also recorded as a factor that influences the outbreak of Ganoderma disease (Idris et al., 2013). This situation might be contributed by root to root contact from the close distance of planted palms. It has been recorded that plantation with 200 palms/ha had the highest BSR disease incidence (Idris et al., 2013). Integrated management, mechanical, synthetic chemicals and bio-control agents are current methods that have been used to control BSR disease (Bong & Ibrahim, 1985; Jelani et al., 2004; Idris et al., 2004; 2005 and Idris & Arifurrahman, 2008).

Several mechanical methods have been practiced to overcome the spread of BSR disease to healthy palms. The most effective mechanical approach was removing the diseased palms by digging a pit of 2 m width x 2 m length x 5 m depth and refilling with the nearby and inter- row soil (Idris et al., 2004; 2005). Then, the diseased palm were destroyed by shredding the trunk, 4 stump and root masses into small fragment and stacking them in the frond piles to decompose (Zulkifli et al., 2010). This method was able to significantly reduce the incidence of disease in seedlings that were planted in the same area as the diseased palm that was removed. The rate of disease incidence was influenced by the size of pit (Idris et al., 2005). Pits with sizes less than 2 x 2 x 2 m were found to cause approximately half of the root of diseased palm to still remain in the soil as length of roots spread in the soil is estimated to be similar to the length of the fronds of the palm (Idris et al., 2005). The remaining diseased roots will act as suitable inoculum which can attack the oil palm soon after planting (Singh, 1991 and Flood et al., 2000). Due to that, in clearing new replanting area, ploughing and harrowing the soil up to a depth of 60cm was suggested (Idris et al., 2005). This procedure fragments the buried roots into small pieces, preventing the diseased root from spreading the disease to healthy palms (Flood et al., 2000 and Hoong & Idris, 2010). Ploughing, harrowing and soil moulding approaches also have shown reductions in disease incidence in oil palm seedlings as well as preventing the spread of BSR disease (Idris et al., 2004). However, soil moulding only prevented the palm from being felled by heavy wind and was not effective in controlling BSR disease but helped in prolonging the productive life span of oil palms (Lim et al., 1993; Ho & Khairuddin, 1997; Tuck & Khairuddin, 1997 and George et al., 2000). These mechanical solutions showed significant reductions in disease incidence at seedlings stages. However, high cost was involved because specialised machinery and manual labour are required.

In the chemical approach, Idris et al. (2010) suggested that hexaconazole has the potential of reducing the risk of Ganoderma infection in healthy mature oil palms. In this approach, the soil surrounding the healthy mature palm was injected with a solution contained 9g of the active ingredient hexaconazole (Idris et al., 2010). This approach achieved 43% reduction in disease incidence as compared to non-treated palms (Idris et al., 2010). Similarly in Ganoderma- infected palms, hexaconazole (0.00045g/ml), and also bromoconazole (0.00045g/ml) were effective at slowing down the Ganoderma spread (Idris et al., 2002 and Jelani et al., 2004). This fungicide was injected into the infected palm (area with the presence of basidiocarp) using pressure injection apparatus (PIA) to deliver the fungicides to the target area (Idris et al., 2002 and Jelani et al., 2004). These approaches showed effectiveness in delaying the death of the infected palms whereby lower mortality rate and higher number of palm producing fruit bunches were also observed (Idris et al., 2004; 2010 and Jelani et al., 2004). Besides hexaconazole, dazomet was also shown to be effective in controlling the growth of G.

5 boninense. Ganoderma-infected palms that were treated with dazomet showed a longer productive life of the oil palm as well as an increase of 36.6 % to 53.3% in the production of fruit bunches (Idris & Maizatul, 2012). Dazomet could also act as a fumigant for treating infected stump as well as to kill the Ganoderma inoculum colonizing the inside of the stump (Idris & Maizatul, 2012). However, chemical residue drenching in the soils might also reduce the population of micro-flora and might also create pathogens that are resistant to the chemical (Idris et al., 2005) included might harmful to planter that handling the chemicals. Due to such negative impacts, new solutions are required to control BSR that can work effectively and with minimal harm to our health and the environment. Alternative treatment such as biocontrol is highly required to produce effective and eco-friendly methods to control the pathogen and the disease.

1.3 Biological Control Agent for BSR

Natural mechanisms of controlling pests and plant diseases using other living organisms are known as biological control. It is based on the strategy that organisms in the natural environment compete for food and space. The natural enemies are used as biological control agent via antagonism, predatory and parasitism interactions (Sankaran & Syed, 1972; Susanto et al., 2005 and Shahid et al., 2012).

Trichoderma harzianum is an example of biological control agents that have been commercialized by mimicking the antagonism interactions. Trichoderma harzianum is capable of controlling agricultural pests, soil borne fungi as well as to induce plant growth (Chang et al., 1989; Grondona et al., 1997 and Shamala & Idris, 2010). In the oil palm industry, T. harzianum is used against G. boninense (Shamala & Idris, 2010). It has been shown to successfully supress the growth of G. boninense and promotes the growth of oil palm (Shamala & Idris, 2010). Besides all the benefits using T. harzianum as a biological control agent, the main obstacle is in applying and adapting T. harzianum (Chang et al., 1989). The fertilizer that is mixed with the spores of T. harzianum gets flushed away during heavy rain and is worst in the flooded oil palm plantation area. Therefore success rate of this approach is affected by environmental conditions. New approaches are required to overcome BSR and to inhibit the dispersal/spread to other new planted areas which hasten potential collapse of the oil palm industry in Sarawak as well as Malaysia.

6 Other endophytic fungi, arbuscular mycorrhiza and bacteria also show similar significant activities as T. harzianum, i.e., ability to suppress the growth of G. boninense and promote the growth of oil palm (Susanto et al., 2005; Sapak et al., 2008; Sharmala & Idris, 2009 and Idris et al., 2010). From 2011 to 2012, the Malaysia Palm Oil Board (MPOB) had been commercializing numerous biofertilizers, in granules and powder form, that comprised endophytic fungi (Hendersonia, GanoEF1 GanoEF), bacteria (Burkholderia, GanoEB2; Pseudomonas, GanoEB3) and Streptomyces (Streptomyces, GanoSA1) for controlling Ganoderma-infected palms (Ramle et al., 2009; Nasyaruddin & Idris, 2011; Nurrashyeda et al., 2011; Idris et al., 2012; Shariffah Muzaimah et al., 2012 and Maizatul et al., 2012). Microorganisms mixed with fertilizers have been shown to be effective at supressing the growth of G. boninense on in vitro and nursery trials (Zaiton et al., 2008; Idris et al., 2008; 2010 and Nurrashyeda et al., 2011). The performance of biofertilizer, GanoEF1, GanoEF, GanoEB1, GanoEB2 and GanoSA1 towards disease incidence (DI), severity of foliar symptoms (SFS) and dead seedlings (DS) of oil palm seedling is described in Table 2 (Nasyaruddin & Idris, 2011; Nurrashyeda et al., 2011; Idris et al., 2012; Shariffah Muzaimah et al., 2012 and Maizatul et al., 2012). The comparison of performance of biofertilizer towards disease reduction showed that biofertilizers managed to reduce the disease of BSR by more than 50%, with Hendersonia fertilizer in powder form being the most effective treatment compared to GanoEF1, GanoEB, GanoEB3 and GanoSA (Nurrashyeda et al., 2011; Maizatul & Idris, 2009; Nasyaruddin & Idris, 2011 and Sharifah et al., 2012).

Muscodor, which produce volatile chemicals, is another group of endophytic fungi that may show potential as biological control agent against Ganoderma boninense as in the previous studies showed this group of fungi shown capability to control a wide range of soil borne fungus included Basidiomycete (Strobel et al., 2002 and Ezra et al., 2002). Ganoderma boninense that caused BSR and USR disease in oil palm is classified under class of Basidiomycete (Khairudin, 1990 and Idris & Ariffin, 2004).

To date, no publications on Muscodor have been recorded in Sarawak. In this study, the isolation of Muscodor-like from selected plant in Sarawak was performed to screen their potential as effective biological control agents against Ganoderma boninense as discussed in Chapter 2. Two of the Muscodor-like isolates have been examined as potential Biological Control Agent (BCA) against G. boninense and suggested as novel species as described in

7 Chapter 3. The physicochemical effect towards their efficiency to control G. boninense will be revealed in Chapter 4, while in Chapter 5, the efficiency of two novel strains in preventing G. boninense from infecting oil palm seedling was discussed. The overall conclusions and recommendations are discussed in Chapter 6.

Table 1: Effects of commercial biofertilisers towards reduction of Basal Stem Rot (BSR) disease

Treatment Disease Assessment (%) (Biofertilizer) Disease Severity of Dead Disease Reference Incidence foliar seedlings reduction (DI) symptoms (DS) (DR) (SFS)

Treated with GanoEF 46.7 48.4 26.7 69.5

Untreated with 93.3 83.8 86.7 Idris et al., 2012 GanoEF

Treated with GanoEF1 39.2 54.5 34.2 54.2

Untreated with 95.0 90.5 80.8 Nurrashyeda et al., GanoEF1 2011

Treated with GanoEB2 57.4 48.2 26.7 57.4

Untreated with 93.3 86.4 80.0 Maizatul & Idris, GanoEB2 2009

Treated with GanoEB3 53.3 40.6 33.3 51.8

Untreated with 93.3 84.7 73.3 Nasyaruddin & Idris, GanoEB3 2011

Treated with GanoSA 53.3 49.7 40.0 59.8

Untreated with 93.3 83.8 86.7 Sharifah et al., 2012 GanoSA

8 1.4 Endophytic Fungi: New Candidates for Biological Control Agent

An estimated 300,000 number of plant species exist on the earth and each plant hosts at least one or more endophytic microorganisms (Strobel et al., 2001). Endophyte is derived from the latin word, endon meaning within and phyton, which means plant and is most commonly defined as those organisms whose “infections are inconspicuous, the infected host tissues are at least transiently symptomless, and the microbial colonisation can be demonstrated to be internal” (Saikkonen et al., 1998, 2004; Bacon & White, 2000 and Stone et al., 2000). Endophyte is also defined as host-organism interaction or adaptation of host and endophyte to one another without causing apparent harm to each other via asymptomatic colonisation (Petrini 1991; Petrini et al., 1992; Hallmann et al., 1997; Boyle et al., 2001; Sieber, 2001; Lumyong et al., 2002 and Schulz & Boyle, 2005).

Fungus is the largest group of endophytic microorganisms that live inside plants and it is estimated that there are about 1.3 million fungi species on earth (Dreyfuss & Chappela, 1994). The total estimated number of fungi on the earth might greatly change to 2.8 million as a result of the huge population of endophytic fungi that have been recently discovered (Hawksworth & Rossman, 1997 and Hawksworth, 2001). For example, in Panama, 418 species of endophytic fungi were obtained from the leaves of Heisteria concinna (Arnold et al., 2001). It is expected that tropical endophytic fungi are hyperdiverse just as tropical forests are inhabited by a diverse species of plants.

Endophytic fungi are potential candidates for new sources of biological active compounds and biological control agents that could be applied in pharmaceutical and agricultural sectors. For example, endophytic fungi that have been isolated from Wollemia pine, Justicia gendarusa and Taxus spp. trees have been discovered to produce potential active compounds as a new source of antibiotics as well as anticancer drugs (Strobel et al., 1997; Guo et al., 2006; Gangadevi & Muthumary, 2008 and Somjaipeng et al., 2012). The fungi extracted from those trees showed chemotherapeutic activity. Taxol, an anticancer drug obtained from Taxus brevifolia, could also be obtained from endophytic fungi such as Pestalotiopsis spp. without only depending on the Taxus plant which took longer time to grow before harvesting the taxol from their bark (Strobel et al., 2012 and Somjaipeng et al., 2012).

9 In addition, endophytic fungi also display similar activities to biological control agents. They may exhibit a mutualistic relationship within the host plant, protecting the host plant from being invaded and destroyed by pathogen or herbivores via producing toxin or triggering the defence system of the host (Kobayashi & Palumbo, 2000 and Tudzynski & Sharon, 2002). In return, endophytic fungi use secreted exudates from the host as a food source. For example, the presence of endophytic fungi in tropical trees has been reported to be able to limit the damage of tropical trees by pathogens through reducing the leaf necrosis and mortality of the tree (Arnold et al., 2003). In some cases, endophytic fungi possess different life histories, such as grow as saprophytic or virulent pathogens in early stage following an endophytic growth stage in latent stage due to reliable supply of nutrients and environmental stress (Stone et al., 2000).

An endophytic fungus, Muscodor albus (cz-620) isolated from Cinnamomum zeylanicum (Worapong et al., 2001) was shown to have potential as a biological control agent (Strobel et al., 2001). A mixture of volatile chemicals produced by M. albus (Strobel et al., 2001) was able to inhibit and kill certain pathogenic fungi and bacteria. A broad spectrum effectiveness of M. albus towards various type of pathogens led to extensive investigation in other species of untapped endophytic Muscodor all over the world (Worapong et al., 2002; Daisy et al., 2002; Gonzalez et al., 2009; Suwannarach et al., 2010; 2013; Mitchell et al., 2010; Zhang et al., 2010; Kudalkar et al., 2011; Mehram et al., 2012; 2013 and Saxena et al., 2014).

1.5 Discovery of Muscodor and Its Roles

Muscodor is a group of endophytic fungi from the family Xylariaceae that was first discovered in 2001 (Worapong et al., 2001). This group of fungi have been widely studied in America by the group of Prof. Dr. Gary Strobel from Montana University. Up to December 2014, 15 species of Muscodor have been discovered all over the world. Namely; M. albus (Worapong et al., 2001), M. sutura (Kudalkar et al., 2011), M. strobelli, M. kasyahum (Meshram et al., 2012; 2013), M. roseus (Worapong et al., 2002), M. fengyangensis (Zhang et al., 2010), M. yucatanensis (Gonzalez et al., 2009), M. vitigenus (Daisy et al., 2002), M. crispans (Mitchell et al.,2010), M. cinnanoni, M. musae, M. oryzae, M. suthepensis, M. equiseti (Suwannarach et al., 2013) and M. tigerii (Saxena et al., 2014). Most of the species in this group have been found to live inside woody trees except for M. vitigenus (Daisy et al., 2002) and 3 new species from

10 Thailand (Suwannarach et al., 2013) that were recently described. Muscodor vitigenus (Daisy et al., 2002) has been found in vines while M. musae, M. oryzae and M. equiseti (Suwannarach et al., 2013) have been isolated from vascular plants, Musa acuminate, Oryza rufipogon and Equisetum debile, respectively. They also shared common characteristics including the production of volatile chemicals, non-sporulation they are mostly white and slow growing.

Volatile chemicals produced by this group showed different capabilities of inhibiting and killing microorganisms; gram negative and positive bacteria, filamentous fungi, yeast and certain insects as showed in Table 1. The fungus, M. albus was the most studied for various applications especially as a potential biofumigant agent. It was also being used to control important pathogenic fungi especially from the class of Oomycete which is commonly found to cause rot disease in postharvest fruits and vegetables. Biofumigant agents like Muscodor could be considered to replace the function of the synthetic fumigant, methyl bromide that is commonly used on fruits for export. As an endophytic biofumigant, Muscodor could naturally minimise rotting problems by producing volatile chemicals which are able to inhibit pathogens causing rot diseases.

In Sarawak, oil palm, pepper and local fruit industries face prevailing pest and disease problems. Therefore, tapping new Muscodor species from Sarawak resources that have the potential to be used to overcome pest and disease problems in Sarawak is crucial. Discovering new Muscodor species is greatly possible, as Sarawak comprises large swathes of dense tropical forests with a diversity of potential host plants.

11 Table 2: Bioactivity of volatile chemicals produced by members of Muscodor

No Member of Major compound in Bioactivity Reference Muscodor Volatile 1. M. albus 1-Butanol, 3-methyl, Anti-fungal Ezra & Strobel, 2003; C5H12O Anti- yeast Stinson et al., 2003; Anti-bacteria Jimenez, 2004; Anti-insect Atmosukarto et al., 2005; Jimenez & Mercier, 2005; Mercier & Manker, 2005; Gabler et al., 2006; Schnabel & Mercier, 2006; Lacey et al., 2007; 2009 2. M. roseus 2- butenoic acid, Anti-fungal Worapong et al., 2002 C4H6O2 3. M. vitigenus Naphthalene, C10H8 Anti-insect Daisy et al., 2002 4. M. cinnanomi Azulene, C10H8 Anti-fungal Mitchell et al., 2010 Anti-bacteria Anti-insect

5. M. yucatanensis Octane, C8H18 Anti-fungal Gonzalez et al., 2009 Anti-bacteria 6. M. crispans Propanoic acid, 2- Anti-fungal Mitchell et al., 2010 methyl-, methyl ester, Anti-bacteria C5H10O3 Anti-insect

7. M. fengyangensis a-phellandrene, C10H16 Anti-fungal Zhang et al., 2010 Anti-bacteria 8. M. sutura Propanoic acid, 2- Anti-fungal Kudalkar et al., 2012 methyl, C4H8O2 Anti- yeast Anti-bacteria Anti-insect 9. M. strobelli Octadecylmorpholine, Anti-fungal Meshram et al., 2012 C22H45NO Anti-bacteria

10. M. oryzae Isoamyl alcohol, C5H12O Anti-fungal Suwannarach et al., 2013 11. M. musae Isobutyric acid, C4H8O2 Anti-fungal Suwannarach et al., 2013

12. M. equiseti Isobutyric acid, C4H8O2 Anti-fungal Suwannarach et al., 2013

13. M. suthepensis Isobutyric acid, C4H8O2 Anti-fungal Suwannarach et al., 2014 14. M. kasyahum 3-Cyclohexen-1-ol-(1,5- Anti-fungal Meshram et al., 2013 dimethyl-4-hexenyl)-4- Anti- yeast methyl (β-Bisabolol), Anti-bacteria C15H26O Anti-insect 15. M. tigerii 4-Octadecylmorpholine, Anti-fungal Saxena et al., 2014 C22H45NO Anti- yeast Anti-bacteria Anti-insect

12 1.6 Borneo: An Ideal Location for Potential Untapped Resources

Borneo is one of the twelve mega biodiversity regions and the third largest island in the world with a total area of 743,330 square kilometres. Human population in Borneo is approximately about 17.7 million but it is still covered with dense tropical forests. Besides that, diverse habitats such as mangrove swamps, peat swamps, and heath (kerangas) and dipterocarp forests are also found in Borneo (Forest Department Sarawak, 2013). An estimated 15,000 plants species (5,000 trees, 17,000 species orchids and more than 50 carnivorous pitcher plants) inhabit Borneo (Forest Department Sarawak, 2013). These plants host a great diversity of endophytic microorganisms. The diversity of flora and fauna in Borneo might be supported by an ideal climate. Temperature ranges between 25-350C and received 2000-4000 mm rainfall yearly so it is ideal for the development and growth of a diversity of flora and fauna. This makes Borneo an ideal region to offer new discoveries, especially in Sarawak as the total land area that is still covered with forest is about 80% or almost 10 million hectares (Sarawak Government, 2013).

Sarawak is the largest state and the largest peat land area (1.5 million hectares) in Malaysia with total land area 124,449.51 square kilometres (37.5% of the Malaysia total land). Additional to that, Sarawak has 512,387.47 hectares of protected area which comprises 18 National Parks, 4 wildlife sanctuaries and 5 nature reserves (Sarawak Forest Corporation, 2013). Gunung Mulu National Park which is located at south of Sarawak was acknowledged as the most studied tropical karst area and the largest cave chamber in the world (World Heritage, 2000). It is also a UNESCO world heritage site due to the high diversity and karst features (World Heritage, 2000 and Sarawak Government, 2013).

Figure 1: Location of National Parks, Wildlife Sanctuaries and Nature Reserves in Sarawak. (Source: http://www.forestry.sarawak.gov.my)

Numerous plants grow in various types of land in Sarawak. Out of 490 trees species, 102 of these which are endemic to Borneo are located in Sarawak (Ng, 2004). The local people in Sarawak, which comprises 14 ethnic groups, use native plants as medicine, timber, food, and for ritual purposes (Sarawak Biodiversity Centre, 2013). This information has been studied by researchers in order to search for potential plants that might have active compounds and thus could be exploited for medical (Kogure et al., 2013), agricultural (Jeffrey et al., 2008) and industrial sectors (Ahmad & Holdsworth, 1994). Those plants were inhabited by various unknown types of endophytic fungi that could have potential value to be used as biological agents. The high diversity of plants increases the likehood of the discovery of new species that might have potential to be exploited in agricultural and industrial sectors (Strobel et al., 2002).

14 1.7 Aim of the Thesis

In this thesis, the aim is to develop local endophytic fungi isolates with capability to produce volatile anti-Ganoderma compound as biological control agents for Ganoderma boninense. In achieving the main aim, the specific objectives of the chapters of this thesis are: a). Chapter 1: To isolate and test the effectiveness of volatile chemicals produced from new endophytic Muscodor-like fungi from plants obtained from Sarawak, b). Chapter 2 and 3: To describe new species of Muscodor fungi that have been isolated, c). Chapter 4: To examine the physicochemical effects and chemical composition of volatile chemicals of Muscodor isolates, including temperature, pH and culture media, d). Chapter 5: To evaluate the potential for use of the Muscodor-like isolates within oil palm seedlings as BCAs against G. boninense.

15 Chapter 2

Isolation and characterization of endophytic Muscodor-like isolates obtained from Cinnamomum javanicum in Sarawak

2.1 Introduction

Muscodor species have been discovered all over the world and show potential as candidates in the oil palm industry, for the biological control of Basal Stem Rot (BSR) disease caused by the fungi, Ganoderma boninense. These group of endophytic fungi produce anti-microbial volatile organic chemicals (VOC) that can inhibit the growth of plant and human pathogens like Rhizoctonia solani, Bacillus subtilis and Aspergillus niger (Strobel et al., 2001). It was first discovered in 2001 by Worapong et al., (2001) and described as a new genus. The DNA sequence has a 96 to 98 % similarity to its closest relative in the order of Xylariales. Most species in this group were isolated from woody plants (Table 3) except for Muscodor vitigenus which was found in vines (Daisy et al., 2002; Worapong et al., 2001, 2002; Mitchell et al., 2008; Gonzalez et. al., 2009; Suwannarach et al., 2010; Zhang et al., 2010; Kudalkar et al., 2011 and Meshram et al., 2012). The capacity to produce anti-microbial volatile compound coupled with the endophytic (living inside the tissues of healthy plants) nature of these fungi present excellent potential for the Muscodor group to be candidates for the biological control of pest and plant diseases. The host plants are symptomless, which indicates that the toxic chemicals that are produced by the fungi do not harm the host. AgraQuest, a well-known company that produces the bio-fungicides SERENADE SOIL®, SONATA® and RHAPSODY, has used the endophytic fungus Muscodor albus, as a replacement or alternative to methyl bromide in controlling the soil borne fungi, Rhizoctonia solani.

To date, there are no publications elucidating the occurrence and bio-activity of Muscodor in Sarawak. The discovery of Muscodor isolates from Sarawak is novel and any usage derived from these isolates can lead to new approaches for biological control of plant pathogens. The use of a local isolate is preferred because it is well adapted to the local environment and is less likely to become a pathogen when stressed.

Table 3: Members of Muscodor isolated from plant hosts worldwide

Member of Muscodor Plant Host Isolated from Reference

M. albus Cinnamomum zeynalicum Bark Worapong et al., 2001

M. roseus Grevillea pteridifolia Limb Worapong et al., 2002

M. vitigenus Paullinia paullinioides Vines Daisy et al., 2002

M. cinnanomi Cinnamomum bejolghota Leaf Suwannarach et al., 2010

M. yucatanensis Bursera simaruba Leaf Gonzalez et. al., 2009

M. crispans Ananas ananassoides Bark Mitchell et al., 2010

M. fengyangensis Actinidia chinensis Leaf Zhang et al., 2010

M. sutura Prestonia trifida Twig Kudalkar et al., 2011

M. strobelli Cinnamomum zeylanicum stem Meshram et al., 2012

M. oryzae Oryza rufipogon leaf Suwannarach et al., 2013

M. musae Musa acuminate leaf Suwannarach et al., 2013

M. equiseti Equisetum debile stem Suwannarach et al., 2013

M. suthepensis Cinnamomum bejolghota stem Suwannarach et al., 2013

M. kashayum Aegle marmelos leaf Meshram et al., 2013

M. tigerii Cinnamomum camphora stem Saxena et al., 2014

The search for host plants that harbour Muscodor in a mega-biodiversity region such as Sarawak requires strategic collection plans. Strobel & Daisy, (2003) highlighted several reasonable hypotheses for selecting such plants. These included selecting the plants from unique environments, plants that have an ethno-botanical history, endemic plant and plants growing in areas of great biodiversity. Based on previous records, Muscodor species were mostly obtained from aromatic woody plants such as Lauraceae, Sapindaceae and Myristiceae families. These groups of plants are commonly found in Sarawak (Adema et al., 1996 and Wilde, 2000). In this study, Lauraceae, Sapindaceae and Myristiceae families were selected as targeted plants with the hypothesis that at least one isolate of Muscodor-like will be isolated from them.

Isolation techniques are also important to optimise the success rate in isolating Muscodor-like as well as reduce the cost and time spent. The method described by Strobel et al., (2001) and Wheatley et al., (1997) was adapted in this study as it had been shown that with the combined treatment (surface sterilization plus volatile chemicals produced by M. albus), a large number of endophytic fungi that were suspected to be non-volatile chemical producers were successfully eliminated, thus enriching for Muscodor spp. fungi that produce volatile chemicals (Table 3).

The endophytic fungus that survived repeated exposure to Muscodor albus could either be resistant towards the volatile chemicals or is a producer of volatile chemicals. To test this hypothesis, the isolated endophytic fungus was tested with plant pathogenic fungi in a dual plate assay system, whereby the pathogenic fungi are exposed to the environment in which the test endophyte grows. Retardation in growth of the pathogenic fungi would indicate that the test endophyte produced volatile antifungal chemicals.

In this chapter, the details on new Muscodor spp. which were isolated from Cinnamomum javanicum in Sarawak are described. The aim in this chapter is to isolate and test the effectiveness of volatile chemicals produced from new endophytic Muscodor-like fungi from target plants from Sarawak.

2.2 Materials and Methods

2.2.1 Collection of Plant Samples

In this study, plants from the family of Lauraceae, Sapindaceae and Myristicaceae were targeted. The list of species and location of the plants from the corresponding families were obtained from Sarawak Forestry Corporation (SFC) and Tree Flora Vol. 6. Based on SFC records, target plants were located in the areas around Padawan and Bako National Park (Figure 2a).

Bako National Park (BNP)

Padawan Forest

(A)

Figure 2a: Map of Sarawak and the Kuching area, circled in red. (A). Enlarged map area show the plant samples collection areas, which are enclosed within black circles (Padawan Forest and Bako National Park (BNP). (Source: Department of Land and Survey Kuching Division)

Figure 2b: Map of enlarged Padawan area (B: Padawan area – dark blue circle) where five samples of Cinnamomum javanicum were collected at Padawan Forest area as shown in black circle. (Source: Department of Land and Survey Kuching Division)

Five plants from the Lauraceae family were collected from the Padawan area (Figure 2b) and forty-five plants from Lauraceae, Sapindaceae and Myristicaceae families were collected from Bako National Park. These plants were identified and recorded during the collection activity. Other ancillary data such as the plant height, diameter base height (DBH), geographical location, weather and photos of individual plants were also collected. Twigs (10cm long) and leaves (2 leaflets) from plants were collected using secateurs and placed into zipper bags. List of target plants collected from Padawan and Bako National Park are listed in Appendix 1.

2.2.2 Isolation of Putative Endophytic Fungi Producing Volatile Chemicals

Twigs and leaves from each plant were processed within 24 hours of collection. Each sample was washed in running tap water to remove debris and other organisms on the plant surfaces. Washed samples were cut into 1cm X 1cm segments with a sterilized scalpel. Plant segments were then surface sterilized by sequential washes in 0.8% sodium hypochlorite (3 mins) and 70% ethanol (3 mins), rinsed thrice with sterile distilled water and then surface dried on sterile tissue paper (Arnold et al., 2001 and Evans et al., 2003). Three sterilized plant segments from each plant were plated per half plate containing Potato Dextrose Agar (PDA), Difco (39g/ L), thereby exposing them to the VOCs of M. albus plated in the other half in the plate (Figure 3) as prepared in section 2.2.3. For control, three sterilized plant segments from the same plant were plated in half plate containing PDA without M. albus on the other half in the plate. The plates were double sealed with parafilm and incubated at 250C for 5 to 10 days. Double sealing was performed to minimize the release of volatile chemicals produced by M. albus. Endophytic fungi growing from the plated plant tissue were picked and transferred onto new PDA plates. The purity of endophytic fungi was determined based on their morphological appearances.

In order to confirm that M. albus used in this isolation process produces volatile chemicals, agar plugs of plant pathogenic fungi as prepared in section 2.2.3.2 were inoculated on the other side of agar in the isolation plate inoculated with M. albus. For the control plate, the isolation plate was similarly prepared but without M. albus inoculation. The plates were double sealed with parafilm and incubated at 250C for 5 days. Reduction on the radial growth of plant pathogenic fungi after exposure to M. albus was compared with the control plate to determine if the M. albus produced volatiles chemicals.

Figure 3: Isolation plate showing 10-day-old M. albus on one side of the agar and the other side inoculated with three sterilized plants segments of L02. A strip of agar of 2cm width was removed from the middle of the plate

2.2.3 Preparation of Standard Strains

2.2.3.1 Muscodor albus, cz-620

Muscodor albus is a well-known strain producing antimicrobial volatile chemicals and widely used as selection strain for isolating new endophytic fungus from environmental samples (Strobel et al., 2001; Worapong et al., 2001 and Ezra et al., 2002). The strain of M. albus used in this study was obtained from Prof. Dr. Gary Strobel from Montana University. Prior to testing, this strain was grown on PDA medium and incubated at 250C for 10 days. Active mycelia on the edge of colony were used as the inoculum source. In order to confirm that M. albus used in this isolation process produces volatile chemicals similar testing as section 2.2.2 paragraph 2 was conducted.

2.2.3.2 Plant Pathogenic Fungi: Rhizoctonia solani, Phytophthora capsici, Ganoderma boninense and Fusarium oxysporum

Plant pathogenic fungi were used to confirm the production of antifungal volatile chemicals by M. albus in the control plates and to screen for endophytic fungi that produce antifungal volatile chemicals. The growth rates of plant pathogenic fungi on the PDA media were measured prior to preparing the inoculum for testing. The plant pathogenic fungi; R. solani and P. capsici covered the whole surface of the PDA media in a 90mm diameter plate within 2 days. Meanwhile, G. boninense and F. oxysporum required 7 days to cover the same surface area. The preparation of the standard strains is based on these observations and samples were grown on PDA plate and incubated at 250C for a day (R. solani and P. capsici) and 5 days (G. boninense and F. oxysporum) prior to testing. The incubation period was shortened to prevent the hyphae extension from reaching the edge of the plate and to facilitate detection of contamination by other filamentous fungi, which normally occurs on the edge of the plate.

2.2.3.3 Preparation of Isolation Plate

Potato Dextrose Agar (PDA), Difco (39g per L) was used as isolation media. The isolation plates were prepared 10 days prior to the isolation by removing a strip of agar (2cm width) from the middle of the plate as described by Strobel et al., 2001. Agar strips were removed to prevent compound diffusion from one side of the agar to the other. On one side of the agar was inoculated with an agar plug of M. albus (that was removed from a 10 days M. albus in the same media as prepared in section 2.2.3.2.). The plates were single sealed with parafilm and incubated at 250C for 10 days. After 10 days incubation, only fungus that grows out from plant segment that exposed with M. albus will be picked and transferred onto new PDA media.

2.2.4 In-vitro Screening on Putative Endophytic Fungi Producing Volatile Chemicals

In each isolation plate, false positives isolate producing volatile chemicals might also occur. Two types of plate assay system were prepared to evaluate and reconfirm the capacity of individual endophytic fungi in producing volatile chemicals which are:

(a) Double Plate This method was modified from Wheatley et al., 1997. The PDA plates were inoculated with 9 points of agar plugs of M. albus and incubated at 250C for 10 days prior to testing. In a separate PDA plate, 9 agar plugs from different isolates of endophytic fungi were inoculated. The lids were removed and the plate containing the endophytic fungi was inverted over the plate with M. albus. As the control, plates inoculated with endophytic fungi were inverted over an un- inoculated PDA plate.

(b) Split Plate This assay was to confirm that the isolates that failed to grow after exposure to M. albus in the double plate assay was not caused by the diffusion of chemicals produced by neighbouring isolates. The split plate assay was prepared as described by Strobel et al., (2001). PDA was used as a growth media, and a 2 cm width of agar strip was removed from the middle of PDA media in a 90mm Petri dish, to create an empty trench. One side of the trench was inoculated an agar plug of 10 days’ old M. albus, grown on the same growth medium. The plate was single sealed with parafilm and incubated at 250C for 10 days prior to testing. In the same plate, the other side of the trench was inoculated with a 10 days old agar plug of endophytic fungi. As control, an endophytic fungus was inoculated on one side of the agar in a control plate without M. albus.

Three set of plates were prepared for each isolate (with and without M. albus). The plates were then double sealed with two strips of parafilm and incubated at 250C for 5 days. The capacity of the endophytic fungi to withstand the presence of volatile chemicals produced by M. albus was evaluated based on reduction in radial colony growth of endophytic fungi compared with control plate.

2.2.5 In-vitro Screening of Endophytic Fungi Producing Volatile Chemicals

An endophytic fungus that survived repeated exposure to M. albus could either be resistant towards the volatile chemicals or is a producer of volatile chemicals. Exposure to plant pathogenic fungi was used to confirm that an endophytic fungus is producing volatile chemicals. The ability of the endophytic fungus to control the plant pathogenic fungi is an

24 indication of its VOC production capability. This was evaluated in split and double plate assay as adapted from Section 2.2.4. The endophytic fungi was prepared in split plate and incubated for 10 days before being inoculated with plant pathogenic fungi on the other side on the agar trench. For control, plant pathogenic fungi were inoculated on one of the agar, in a plate without endophytic fungi. In double plate assay, 4 points of agar plugs of endophytic fungi were inoculated onto PDA plate for 10 days prior to testing, and on the separate plate 4 points of different species of plant pathogenic fungi were inoculated. The lid of the plates was removed and plate containing the plant pathogenic fungi was inverted over the plate containing the endophytic fungi. For control, a plate containing plant pathogenic fungi was inverted over an un-inoculated PDA plate. The plates were sealed with double layers of parafilm and incubated at 250C for 5 days. The radial growth of plant pathogenic fungi after exposure to the endophytic fungi was measured and the percentage inhibition of radial growth, PIRG, was calculated according to Skidmore & Dickenson, (1976):

Percentage Inhibition of Radial Growth (PIRG) = [C – T]/C x 100 Where; C - Growth of plant pathogenic fungi eg. G. boninense in control plate T - Growth of plant pathogenic fungi eg. G. boninense in test plate

All tests were conducted in triplicates. Values are given as Mean ± SE (n= 3), where SE refers to Standard Error. Statistical analyses were conducted with Statistical Package for the Social Sciences (SPSS) version 17.0 (SPSS Science Inc., IL) and Excel software (Microsoft, Redmond, WA). Oneway ANOVA and a post hoc analysis [Tukey’s honestly significant difference (HSD)] were applied to the data. The level of significance was P<0.05.

2.2.6 Preliminary Identification

2.2.6.1 Morphology of Colony

(a) Macroscopic Study Agar plugs of each isolate were inoculated onto PDA media and incubated at 250C for a further 10 days. The colony appearance was recorded; the presence of aerial mycelium, pigment

25 production, colony pattern, and colour and exudate production were noted. The radial growth of the isolate and changes in colour (during the 10 days of incubation) was also recorded.

(b) Microscopic Study The microscopic features were examined under a light microscope. Two main features of the isolates were examined carefully i) Hyphal structure - size, colour, surface and mitic system ii) Fruiting body structure - spore, rest spore, structure, pattern, size, colour and shape

2.2.6.2 Molecular Identification

(a) DNA Extraction, Amplification, Purification and Sequencing i. DNA Extraction Mycelia from a colony of 10 day old Muscodor-like isolates were picked using a sterilized toothpick. Each sample was then placed into individual wells of a 96 wells plate containing 50µl Tris-EDTA solution and then deep frozen at -800C freezer for 24 hours as described by Muramatsu et al., 2003. The plate was then thawed by shaking at 250rpm at room temperature for 15 minutes. The lysate obtained was used as crude DNA template for PCR. ii. DNA Amplification The mixture for DNA amplification was prepared as follows, per sample: Pfu Polymerase (Fermentas), 0.2µl; 10x dNTP, 0.2µl; Polymerase buffer, 2µl; 20µm ITS 4 (5’ TCCTCCGCTTATTGATATGC 3’), 0.4µl; 20µm ITS 5 (5’GGAAGTAAAAGTCGTAACAAGG 3’) (White et al., 1990), 0.4µl; sterilized water, 16.8µl; Crude DNA, 1µl. Amplification was carried out with the following settings: Initial denaturation at 960C for 1 minute, denaturation at 960C for 5 minutes, annealing at 530C for 1 minute, elongation at 720C for 5 minutes, final elongation at 720C for 2 minutes. The process was repeated for 30 cycles. iii. Visualization of PCR Product Amplified DNA (PCR product) was visualized on a 1% agarose gel incorporated with ethidium bromide. The PCR product (5µl) was mixed with 1µl of 6x Mass Ruler loading dye #R0621 and loaded into the well of the 1% agarose gel. Mass ruler DNA ladder mix # SM 0403 was used as standard to determine the size of the target DNA. The DNA was separated according to size by

26 gel electrophoresis at 50 volts for five minutes, followed by 75 volts for another 35 minutes. The DNA bands were visualized with a UV transilluminator the image was captured using an Alphaimager. iv. DNA Purification Amplified DNA was purified using GE Healthcare PCR purification kit. The procedure for the purification followed manufacturer’s instructions. The eluted solution (pure DNA) was stored at -200C until needed. v. Cycle Sequencing of PCR Products Sequencing was performed on an Applied Biosystems 3130xl Genetic Analyser, using BigDye® Terminator V3.1 Cycle Sequencing Kit according to the protocol in the user manual. Two PCR primers were used. ITS 5 (5’ TCCTCCGCTTATTGATATGC 3’) was used as forward primer and ITS 4 (5’ TCCTCCGCTTATTGATATGC 3’) as reverse primer.

vi. Comparison of Sequences with Existing Sequences in GenBank Database The raw sequences were edited using BioEdit programme in FASTA format. The forward and reverse primer sequence was removed before the sequence was blasted with existing sequences in GenBank database (www.ncbi.nlm.nih.gov/BLAST/). Sequence was compared using BlastN to search for the closest best match sequence. The top three similarities to the query sequence were used as estimated reference species for further investigation of the identity of the isolate with 94% similarities for genus and 99% similarities for species confirmation (Keswani et al., 2001 and Muramatsu et al., 2003)

(b) Phylogenetic analysis DNA sequences were aligned using BioEdit (Hall, 2005) with other sequences obtained from GenBank. A BLAST search was performed to find the possible sister group of the newly sequenced isolate. Phylogenetic analyses were performed using Molecular Evolutionary Genetics Analysis (MEGA) Version 6 (Tamura et al., 2013). Prior to phylogenetic analysis, ambiguous sequences at the start and the end were deleted and gaps were manually adjusted to optimize alignment. The evolutionary distances were inferred by using the Neighbour- Joining method (Saitou & Nei, 1987). Bootstrap replicates (1000) were taken into account to infer the bootstrap consensus tree for the representation of evolutionary history. The

27 evolutionary distances were computed using the Maximum Composite Likelihood method (Tamura et al., 2004).

2.2.7 Storage

Four methods of long-term storage were evaluated in this study for maintenance and preservation of the active vegetative mycelium condition of the Muscodor-like isolates. These methods were:

(a) Infected Grains with Mycelium of Muscodor-like Isolate Barley and rice grain were evaluated as substrates that could retain the viability of Muscodor- like isolates for long term storage. In preparation of the substrate, 100g of grains were prepared and washed twice with deionized water. The grains were soaked in PDA broth for 15 minutes. Grains (10-15) were placed into universal (McCartney) bottles and autoclaved thrice at 1210C for 15 minutes. An agar plug containing the mycelia of the isolate was transferred onto the grains aseptically and incubated at 250C for 2 weeks or until the barley grains were fully colonized by mycelia. The grains were stored at 250C in an incubator and at 40C in the cold room.

(b) PDA Agar Slant The slant was prepared by pouring 7ml autoclaved PDA solution into each universal (McCartney) bottle. The bottle was slanted at a 45 degree angle and left to solidify at room temperature. An agar plug of a 10-day-old Muscodor-like isolate was inoculated onto the slant and incubated at 250C incubator for 10 days prior before storage in a 40C cold room.

(c) Sterilized Water Three 10-day-old agar plugs with mycelia of Muscodor-like isolates were placed aseptically in universal (McCartney) bottles containing 7 ml sterilized water. The bottles were kept at 40C cold room.

(d) Encapsulated Hypha in Alginate Beads A 2% alginate solution was prepared and mixed with 1% blended mycelium of Muscodor- like isolates. The broth culture of Muscodor-like isolates were prepared by placing 6 agar plugs with mycelia of isolate into 250ml conical flask containing 50ml PDA broth and shaken at 200rpm at 250C for 10 days. Then the broth culture with mycelia was fragmented using a blender for approximately 2 minutes. Hypha that were mixed with alginate solution were pipetted into 0.1

M CaCl2.H2O solution to form beads and washed with 0.025 M CaCl2.H2O thrice. These beads were stored in: (i) universal (McCartney) bottles containing sterilized water (10-15 beads per bottle) and kept at 40C in the cold room (ii) vacuum ampoules, whereby the beads were dried in vacuum using L-Drying machine and kept at room temperature.

2.2.8 Viability and Productivity Test

All Muscodor-like isolates that were kept in different substrates and conditions were tested for viability. After 2 weeks, 1, 3, 6, 10 and 12 months incubation, the stored isolates were transferred onto new PDA plates. The plates were incubated at 250C for 10 days. Viable isolates would produce new hyphal and from that the shelf life of that isolate in the different conditions can be estimated. Viable isolates that recovered after different period of incubation were also tested on their productivity. This was evaluated by incubating them with plant pathogenic fungi following the assay system as described at section 2.2.5.

2.3 Results and Discussion

2.3.1 Plant Collection

The collection of twigs and leaves from target plants: Lauraceae, Myristicaceae and Sapindaceae in Padawan and Bako National Parks were performed randomly. A total of 45 target plant samples were collected from both locations. The samples consisted of 33, 10 and 7 plants species from the families of Lauraceae, Myristicaceae and Sapindaceae, respectively. The collected plants were categorized as small to moderate based on the size of the woody plants with plant height that ranges in between 1 to 50cm in diameter base height (DBH) and 30 to 1200cm in height, respectively. Plant samples were collected from Cinnamomum javanicum (23 samples) under the Lauraceae family followed by Myristica fragrans (6 samples) from the Myristicaceae family, Nephelium lappaceum (5 samples) from the Sapindaceae family, and other species as shown in Table 4.

Table 4: List of plant species collected from Padawan dan Bako National Park No Plant Species Total Collected 1 Actinodaphne sesquipedalis 3 2 Cinnamomum javanicum 23 3 Cinnamomum cassia 4 4 Cinnamomum zeylanicum 3 5 Dimocarpus longan 1 6 Horsfieldia paucinervis 1 7 Knema viridis 3 8 Myristica cinnamomea 1 9 Myristica fragrans 6 10 Nephelium lappaceum 5

2.3.2 Isolation of Endophytic Fungi

In this study, at least 3 morphospecies of fungi including Trichoderma spp. and Botrydiplodia spp. grew from each plant segment that had undergone surface sterilization treatment without exposure to volatile chemicals produced by M. albus. An additional treatment by exposure to M. albus in the isolation process resulted in a threefold decline in the total number of fungal morphospecies isolated from the plant segments (Figure 4b). In the samples collected from Bako National Park, exposure to M. albus inhibited all fungal growth while lack of M. albus exposure resulted in outgrowth of at least 3 morphospecies from the plant segments. Volatile chemicals released by M. albus in the plate environment exhibited a killing effect towards certain endophytic fungus like Trichoderma spp. and Botrydiplodia spp. inside the plant tissues, which was also demonstrated by Strobel et al., (2001), Ezra et al. (2004), Worapong et al., (2002) and Zhang et al., (2010).

Using an adaption of the aforementioned technique in the isolation process, a total of 75 putative VOC producing endophytic fungal isolates were successfully obtained from the plated plant samples. All were isolated from five plant samples of Cinnamomum javanicum (Figure 4a) collected from Padawan. Unfortunately, no endophytic fungus grew from C. javanicum and other plant samples that were collected from Bako National Park. This result suggests that the occurrence of Muscodor spp. may be environmentally specific as opposed to species specific.

Leaf and Stem of C. javanicum

Figure 4a: A specimen of Cinnamomum javanicum. Endophytic fungi producing volatile chemicals were isolated from the leaves of this plant which was collected from Padawan.

Figure 4b: Split plates assay with M. albus. The pictures show that only two colonies of fungi grew from the plants segments of L05 (Left) compared to the control plate which has more than five colonies of fungi (Right). Picture was taken after the samples have been exposed to M. albus for 3 days.

2.3.3 In-vitro Screening of Endophytic Fungi Producing Volatile Chemicals

The observation that an endophytic fungus that survives after repeatedly being exposed to the volatile chemicals (VOCs) produced by M. albus, is also capable of producing volatile chemicals (Strobel et al., 2001 and Ezra et al., 2002), was adapted in this study to eliminate false positive among the 75 putative endophytic isolates that were obtained from the plant samples.

Each isolate was exposed to VOCs produced by M. albus in split and double plate assays. Of the 75 isolates evaluated, 33 showed consistent activity after repeated exposure to M. albus and displayed normal growth characteristics when compared to the corresponding control plate in both assay systems. The remaining isolates showed retarded or no growth. This also indicated that the 33 isolates tested did not produced chemicals secrete any chemicals into the PDA agar that had the capacity to kill or retard the growth of other isolates grown on the same plate. The 33 isolates that survived in the presence of volatile chemicals produced by M. albus were considered to be volatile chemicals producing fungi as they could tolerance with that chemical.

Resistance towards the volatile chemicals produced by M. albus could be a factor that allows the isolates to remain alive and grow normally. To confirm whether these isolates are producing volatile chemicals or are just resistant to the volatile chemicals, the isolates were then exposed to plant pathogenic fungi using a double plate assay. All tested isolates that were grown on the same plate did not kill or inhibit each other.

Out of 33 isolates screened, 10 of them exhibited the capacity to control the growth of plant pathogenic fungi (Table 5). The volatile chemicals produced by these isolates were capable of killing plant pathogenic fungi G. boninense, P. capsici, and R. solani and inhibited the growth of F. oxysporum. This result shows that the isolates produced volatile chemicals that contain antifungal compounds. Freire et al., (2012), demonstrated that F. oxysporum also produces antimicrobial volatile chemicals. This may the possible reason that F. oxysporum was able to withstand the exposure to the volatile chemicals produced by the 10 isolates.

Table 5: Percentage of radial inhibition growth of plant pathogenic fungi after exposure to endophytic isolates.

The Percentage of Radial Inhibition Growth (PIRG) of Plant No Isolate Pathogenic Fungi After 5 days exposed with isolates R. solani P. capsici F. oxysporum G. boninense 1 L1R1f 100 ± 0.00a 100 ± 0.00a 66.15 ± 1.76e 100 ± 0.00a 2 L2R2f 100 ± 0.00a 100 ± 0.00a 49.74 ± 2.24bcd 100 ± 0.00a 3 L2R3a 100 ± 0.00a 100 ± 0.00a 60.51 ± 2.24de 100 ± 0.00a 4 L3R2a 100 ± 0.00a 100 ± 0.00a 49.23 ± 2.66bcd 100 ± 0.00a 5 L3R3a 100 ± 0.00a 100 ± 0.00a 46.67 ± 2.23abc 100 ± 0.00a 6 L4R2a 100 ± 0.00a 100 ± 0.00a 38.46 ± 1.78ab 100 ± 0.00a 7 L4R2e 100 ± 0.00a 100 ± 0.00a 43.59 ± 4.89abc 100 ± 0.00a 8 L4R2f 100 ± 0.00a 100 ± 0.00a 36.92 ± 3.55a 100 ± 0.00a 9 L5R1c 100 ± 0.00a 100 ± 0.00a 35.38 ± 1.78a 100 ± 0.00a 10 L5R3e 100 ± 0.00a 100 ± 0.00a 50.77 ± 0.89cd 100 ± 0.00a 11 M. albus 100 ± 0.00a 100 ± 0.00a 67.69 ± 0.89e 100 ± 0.00a 12 Control 100 ± 0.00a 100 ± 0.00a 100 ± 0.00f 100 ± 0.00a

The Percentage of radial inhibition growth (mean ± standard error, N=3) after 5 days exposed with endophytic isolates producing antifungal volatile chemicals. Different letters in the same column indicate a significant difference (Tukey’s HSD after one-way ANOVA, P<0.05) between isolates.

2.3.4 Preliminary Identification

The ten isolates that produced volatile antifungal chemicals were identified using morphological and molecular methods. This preliminary identification was conducted to assign the genus and species level of each isolates as well as to eliminate redundancy in studies on the same species.

(a) Morphological Characteristics The colony morphology of the isolates on PDA media was observed in detail as described in Table 6. Presence of septa and absence of clamp connection indicated that these isolates grouped into Ascomycete even though no fruiting bodies or spores were produced. Moreover, the macro and micro-morphological characteristics of the isolates are similar to Muscodor group whereby most of the colonies were white to dark brick, round to irregular, slow growing

(≤ 30 mm diameters in 10 days); Hyphal: hyaline, septate, branched, 1-3um diameter, absent of asexual stages and pigments (Figure 5 to 14).

Table 6: Colony description of Muscodor-like isolates

Isolate Photograph

(a) L1R1b

Description: Colonies white, reverse cream, rounded, growing slowly to 24-28 mm diameter in 10 days incubation at 25°C. Mycelium production moderate for aerial and poor production of vegetative. Hyphal hyaline, smooth to finely rough, spiral, branched, septate, 1-2um diameter, thick walled. Asexual stage (non-sporulation), pigment and exudate absent.

(b) L2R2f

Description: Colonies white, reverse white, rounded, formed concentrically lines, slowly growing to 24-28 mm diameter in 10 days incubation at 25°C. Aerial mycelium abundance, poor production of vegetative mycelium. Hyphal hyaline, branched, septate, 1-3 um diameter. Asexual stage (non-sporulation), pigment and exudate absent.

Description: Colonies white, reverse white, rounded, growing slowly to 22-28 mm diameter in 10 days incubation at 25°C. Aerial mycelium abundance on mature area and slowly decreased towards edge of the colony. Poor production of vegetative mycelium. Hyphal hyaline, branched, septate, 1-3 um diameter. Asexual stage (non-sporulation), pigment and exudate absent.

(d) L3R2b

Description: Colonies were initially pale brick then became dark brick after 14 days, reverse dark brick, rounded and growing slowly to 16-26mm diameter in 10 days incubation at 25°C. Mycelium production was poor for aerial and moderate production of vegetative mycelium. Hyphal hyaline, septate, 1-2 um diameter, thick walled, branched. Asexual stage (non- sporulation) and pigment absent. Exudate produced after 20 days incubation on PDA media at 25°C.

(e) L3R3a

Description: Colonies were initially yellowish then became dark brick after 10 days, reverse was cream, rounded and concentrically lines, slowly growing to 20-28 mm diameter in 10 days incubation at 25°C. Mycelium production was poor for aerial and moderate production of vegetative mycelium. Hyphal hyaline, septate, 1-3 um diameter, thick walled, branched. Asexual stage (non-sporulation) and pigment absent. Exudate produced after 20 days incubation on PDA media at 25°C.

(f) L4R2a

Description: Colonies white, rounded, slowly growing to 18-24 mm diameter in 10 days incubation at 25°C. Reverse cream. Moderate production of aerial mycelium and poor production of vegetative mycelium. Hyphal hyaline, septate, 1-2 um diameter, thick walled, branched. Asexual stage (non- sporulation), pigment and exudate absent.

(g) L4R2e

Description: Colonies white, rounded, slowly growing to 22-26 mm diameter in 10 days incubation at 25°C. The reverse was white. Aerial mycelium abundance on mature area and moderate towards edge of colony. Poor production of vegetative mycelium. Hyphal hyaline, septate, 1-2 um diameter, thick walled, branched. Asexual stage (non- sporulation), pigment and exudate absent.

(h) L4R2f

Description: Colonies was initially white then became creamed coloured after 14 days incubation. The reverse was cream. Rounded shape of colony growing to 24-28 mm diameter in 10 days incubation at 25°C. Poor production of aerial mycelium on mature area and moderate towards edge of colony. Vegetative mycelium was poor production. Hyphal hyaline, branched, 1-3um diameter, thick-walled. Asexual stage (non-sporulation), pigment and exudate absent.

(i) L5R1c

Description: Colonies was initially white then become black after 20 days incubation at 25°C. The reverse was white. Rounded to irregular shape of colony formed concentric lines, slow growing to 23- 30 mm diameter in 10 days incubation at 25°C. Moderate production of aerial and reverse mycelium. Hyphal hyaline, branched, 1-2um diameter, thick-walled. Asexual stage (non-sporulation), pigment absent. Exudate produced after 20 days incubation at 25°C.

(j) L5R3e

Description: Colonies white, rounded, slowly growing to 24- 28 mm diameter in 10 days incubation at 25°C. The reverse was white. Moderate production of aerial and reverse mycelium. Hyphal hyaline, branched, 1-2um diameter, thick- walled. Asexual stage (non-sporulation), pigment, exudate absent.

A B

Figure 15: Hyphae structure of isolate L3R3a (A) and L5R1c (B) using light microscopy with 40x magnification (Bar = 5µm). (A) A group of L3R3a hyphal assembled together to form a strip-like structure (B) Intermediate formation of chlamydospore in L5R1c was observed

(b) Molecular Identification The crude DNAs from the 10 isolates and the M. albus strain were successfully extracted using a deep freeze and thaw method modified from Muramatsu et al., (2003). PCR products obtained ranged between 600 to 700bp (Figure 16). The products were sent for sequencing using the Sanger method and the sequences obtained were compared to sequences in GenBank using BLAST. The results showed that the isolates exhibited 97 to 100% similarities to the genus of Muscodor equiseti as per Table 7. This also indicated that these isolates belong to the Muscodor genus (Keswani et al., 2001). Out of the 10 isolates that were compared against the GenBank database, eight of them were closely related to the species equiseti (99%

38 similarity) except for L3R2a and L3R3a, which showed 97% and 96% similarities, respectively to the same species. Muscodor was accepted for the genus of all tested isolates following the criterion for genus determination as suggested by Keswani et al., 2001 which is a 94% homolog value. Species level determination, set at 99% similarity showed isolate L1R1b, L2R3a, L2R2f, L4R2a, L4R2e, L4R2f, L5R1c and L5R3a are closely correlated to M. equiseti with a 99% homolog value which met the criterion for species level as suggested by Muramatsu et al., (2003).

Further investigation on the identity of all ten isolates was conducted to eliminate duplicate species. Multiple sequence alignment (MSA) was used to search for duplicate species whereby all isolates were aligned to search for dissimilar base and gap in the sequences. Alignment with the L3R3a sequence as reference showed that no gap occurred and less than five bases were dissimilar with the reference sequence for all tested sequences. The ten isolates were grouped into five groups (Table 8).

The phylogenetic tree that was constructed using the neighbour-joining method (Saitou & Nei, 1987) showed that Muscodor member and the new isolates were grouped into 7 clusters (Figure 17). Six of isolates, L4R2a, L4R2e, L4R2f, L2R2f, L5R1c and L5R3a shared similar cluster with M. vitigenus, M. sutura and M. equiseti under Cluster 1. However, L1R1b and L2R3a was grouped as independents in Cluster 2 but were derived from a common ancestor with L4R2a, L4R2e, L4R2f, L2R2f, L5R1c and L5R3a, which suggests that they inherited similar physical traits (Baldauf, 2003). Isolate L3R2a and L3R3a were also located at a different cluster with other members of Muscodor and the new isolates under Cluster 3.

According to BLAST results, MSA (100% matched for every base that has been aligned) and phylogenetic analysis showed L3R2b and L3R3a were 100% identical through molecular identification and morphological characteristics. They showed similar characteristics especially poor production of aerial mycelium. Both isolates were named as Muscodor sp. as the percentage of similarity to GenBank database was below 99%.

The other 8 tested isolates, even though they showed 99% similarity to M. equiseti but MSA showed there were gaps between the bases. The MSA showed that L4R2a, L4R2e, L2R2f, L5R1c and L5R3a came under the same group and phylogenetic analysis also grouped them in Cluster 1, which is also shared by M. vitigenus, M. sutura, M. equiseti and L4R2f. However,

39 morphological characteristics showed that L4R2a, L4R2e, L2R2f, L5R1c and L5R3a were different from the closest sequence match, M. equiseti, as the colony pattern of these isolates did not formed cottony-like mycelium and coiling hyphae (Suwannarach et al., 2013).

The multiple sequence alignment showed that the bases of isolate L1R1b, L2R3a and L4R2f did not have a 100% alignment with other tested isolates, which indicated that there are differences in molecular identity. Phylogenetic analysis also supported that these isolates are different from other tested isolates as well as other Muscodor’s member as they were grouped in different clusters. However, blast sequence analysis showed that these isolates had 99% similarity with M. equiseti but the colony characteristics did not support these isolates as belonging to the species of M. equiseti. Further identification is required to determine their species. The viability of cultures, after several period of time is also important to evaluate their potential as biological control agent. A viability study was conducted to determine their shelf life.

Figure 16: Gel electrophoresis of PCR products obtained from the 10 isolates. DNA bands with estimated sizes between 600-700bp were obtained (A to K) after PCR reaction. The samples were analysed on 1% agarose gel. M is DNA marker, Mass ruler (#SM0403) from Fermentas

Table 7: Percentage of similarity between the isolates and the top three sequences in the GenBank database.

No Isolate Comparison with GenBank Database % Query Cover E- Closest Species Similarity (%) value 1 LIR1b Fungal sp. ARIZ B342 [FJ612989] 99 99 0 Muscodor equiseti strain CMU-M2 [JX089322] 99 99 0 Muscodor sp. RTM5-IV2 [KF850711] 99 99 0 2 L2R2f Muscodor sp. RTM5-IV2 [KF850711] 99 100 0 Muscodor equiseti strain CMU-M2 [JX089322] 99 100 0 Fungal sp. ARIZ B342 [FJ612989] 99 100 0 3 L2R3a Muscodor sp. RTM5-IV2 [KF850711] 99 98 0 Muscodor equiseti strain CMU-M2 [JX089322] 99 98 0 Fungal sp. ARIZ B342 [FJ612989] 99 98 0 Muscodor yucatanensis strain B110 4 L3R2b [FJ917287] 97 100 0 Muscodor sp. KF229762.1 96 100 0 Muscodor sp. KF229758.1 96 100 0 Muscodor yucatanensis strain B110 5 L3R3a [FJ917287] 96 100 0 Muscodor sp. KF229762.1 96 100 0 Muscodor sp. KF229758.1 96 100 0 6 L4R2a Fungal sp. ARIZ B342 [FJ612989] 99 99 0 Muscodor equiseti strain CMU-M2 [JX089322] 99 99 0 Muscodor sp. RTM5-IV2 [KF850711] 99 98 0 7 L4R2e Muscodor sp. RTM5-IV2 [KF850711] 99 100 0 Muscodor equiseti strain CMU-M2 [JX089322] 99 100 0 Fungal sp. ARIZ B342 [FJ612989] 99 100 0 Muscodor equiseti strain CMU-M2 8 L4R2f [JX089322] 99 99 0 Fungal sp. ARIZ B342 [FJ612989] 99 99 0 Muscodor sp. RTM5-IV2 [KF850711] 99 97 0 9 L5R1c Muscodor sp. RTM5-IV2 [KF850711] 99 100 0 Muscodor equiseti strain CMU-M2 [JX089322] 99 100 0 Fungal sp. ARIZ B342 [FJ612989] 99 100 0 10 L5R3a Muscodor sp. RTM5-IV2 [KF850711] 99 100 0 Muscodor equiseti strain CMU-M2 [JX089322] 99 100 0 Fungal sp. ARIZ B342 [FJ612989] 99 100 0

Table 8: Isolates were grouped using Multiple Sequence Alignment (MSA).

Group Isolates Species Compared with GenBank Database 1 L3R2b Muscodor yucatanensis, 97%

L3R3a Muscodor yucatanensis, 96%

2 L4R2f Muscodor equiseti, 99%

3 L1R1b Muscodor equiseti, 99%

4 L2R3a Muscodor equiseti, 99%

5 L2R2f Muscodor equiseti, 99%

L4R2a Muscodor equiseti, 99%

L4R2e Muscodor equiseti, 99%

L5R1c Muscodor equiseti, 99%

L5R3a Muscodor equiseti, 99%

L4R2a L4R2f L4R2e Muscodor sp. E8514iHQ117854.1 87 L2R2f Cluster 1 L5R1c L5R3a 99 Muscodor vitigenus AY100022.1 Muscodor sutura JF938595.1 Muscodor equiseti JX089322.1 94 L1R1b Cluster 2 86 L2R3a 100 L3R2b Cluster 3 L3R3a 64 Muscodor strobelli FJ664551.1 Cluster 4 99 Muscodor yucatanensisFJ917287.1 Muscodor suthepensis JN558830.1 Cluster 5 68 Muscodor kashayum KC481680.3 15 Muscodor sp. RTM5-IV4KF850713.1 7 Muscodor crispansEU195297.1 100 9 Muscodor oryzae JX089321.1 Cluster 6 18 Muscodor musae JX089323.1 Muscodor cinnanomi GQ848369.1 97 Muscodor albusAF324336.1 Muscodor fengyangensis HM034856.1 Cluster 7

0.01 Figure 17: Phylogenetic analyses of the Muscodor spp and the isolated strains from this study. This was constructed using Molecular Evolutionary Genetics Analysis (MEGA) Version 6 (Tamura et al., 2013), based on the ITS rDNA gene sequences.

2.3.5 Maintenance and Preservation

In this study, the 10 positive isolates were cultured on PDA agar slants for 7, 14, 21 and 30 days, at 250C to evaluate their viability. The growth media PDA was selected as the reference media. This is a commonly used medium that supports the growth of a wide range of fungi including the Muscodor spp. Results from the time course study towards their viability show all the isolates were viable except for isolate L4R2a which died on day 21. Due to the short shelf life of isolate L4R2a and labour intensive sub-culturing necessary for maintenance, isolate L4R2a was eliminated from further study.

Long term storage requires a suitable passage medium and storage condition to maintain and preserve the active condition of the vegetative mycelium of the isolates. Barley is the main target for long term passage medium, as it has been successfully used for long term storage of Muscodor spp. Other passage medium and storage conditions including rice grain, PDA agar slants, beads, and agar plugs containing fungi mycelia were also evaluated. The results showed that barley and rice grains were suitable passage substrates for storage of up to 3 years. This 43 was probably because of the long chains of carbon contained in cellulose and carbohydrates, which are major components in barley and rice grains. The long chained carbon needs to be degraded into glucose, slowing the growth of isolates due to the high energy requirement to breakdown the carbon chains into a usable food source. A rich source of carbon in the grain might act as long term food storage to support and prolong the active vegetative mycelium condition. This factor may contribute to the reason why isolates retained viability after long term storage on barley and rice grains (Strobel et al., 2001)

Isolates that were kept on PDA agar slant, agar plugs and beads, in sterilized water show selective pressure on the replicates. Some of the replicates failed to grow after 10 months of storage at 40C in the cold room. This shows that the active shelf life is 6 months for isolates kept on PDA agar slant, agar plugs, beads and in sterilized water. Based on the results, throughout this study, barley was selected as passage substrate for long term storage of the isolates. PDA agar slant was selected as passage media for working storage which requires sub- culturing every 6 months.

All the isolates were viable after being kept for six months on PDA agar, agar plug, beads, and sterilized water, and after being kept for three years in barley and rice grains as passage media. Bioactivity or consistent production of antifungal volatile chemicals is crucial and important to measure the suitability of these isolates as potential candidate for biological control agent towards plant pathogenic fungi such as G. boninense. The isolates that have been kept for three months in various passage media showed unaltered bioactivity, and the volatile chemicals produced by those isolates were capable of controlling G. boninense. However, after 6 months, most of the tested isolate except isolate L3R3a and L5R1c showed selective pressure within the replicates with at least one replicate only showing inhibition on the growth of G. boninense.

Similar result was obtained after 10 months, all infested isolates on barley and rice grain except for L3R3a and L5R1c showed selective bioactivity among replicates and created “sector on colony” pattern. After 12 months of incubation, isolate L2R2f, L2R3a and L4R2f grown on barley grains lost their capacity to produce antifungal volatile chemicals. However, L3R3a and L5R1c consistently show their ability to produce anti-Ganoderma volatile chemicals after storage for 6, 10 and 12 months.

2.4 Conclusion

Ten Muscodor-like isolates producing volatile chemicals were successfully isolated from the leaves of Cinnamomum javanium, collected from Padawan area in Kuching, Sarawak. These isolates produced volatile chemicals that effectively controlled the growth of the plant pathogenic fungi: Rhizoctonia solani, Phytophthora capsici and Ganoderma boninense.

DNA sequence identification classified these isolates as belonging to the genus Muscodor and most of them showed 99% similarity to Muscodor equiseti. However, the morphological characteristics of the isolates did not match M. equiseti, and required detailed microscopic and chemical analyses to elucidate the identity of the isolates.

While ten isolates exhibited the ability to inhibit pathogenic fungal growth, the viability test showed only isolate L3R3a and L5R1c to have the potential to be developed further as biological control agents. Both of them remained viable and were capable of controlling G. boninense, after storage on barley and rice grain for more than 12 months. Further studies on both isolates, especially on their microscopic and chemical characteristics are required to reveal their identity before they can be optimized for field trials.

CHAPTER 3

Novel Endophytic Fungi from Borneo, Sarawak, Malaysia

3.1 Introduction

Studies on endophytic fungi have intensified, after the discovery of paclitaxel (taxol) produced by Pestalotiopsis microspore, which was isolated from the yew tree in Himalaya (Strobel et al., 1996). In addition, the discovery of their potential in producing antibacterial, antiviral, anticancer, antioxidant, antidiabetic, immunosuppressive, and bioremediation compounds have attracted many researchers to investigate these microorganisms (Othman et al., 2008; Dompeipen et al., 2011; Hazalin et al., 2009; 2012; Liang et al., 2012 and Russell et al., 2011). The relationship between endophytic fungi and plants is commonly described as communalistic (Saikkonen et al., 1998 and Sturz & Nowak 2000) and mutualistic, especially for the endophytes that colonize the root area (Bai et al., 2002). The production of secondary metabolites that trigger the plant defences system is the symbiotic rewards of endophytic fungi towards the host plant (Picard et al., 2000 and Benhamau & Garand, 2001). The host plant provides the glucose as a carbon source to support the growth of endophytic fungi (Schulz et al., 1999; Arnold & Herre, 2003 and Mucciarelli et al., 2003). Outcomes from this relationship allow the plants to grow in stressed conditions as well as to protect the plant from invasion by pathogens. Their occurrence in the world is estimated to be about 1.3 million and most of them are from the class of Ascomycete and with fewer being Basidiomycetes (Dreyfuss & Chappela, 1994).

Strobel et al., (2001); (2003) claimed that each individual plant may host at least one but often many endophytes. This fact might change the estimated total number of fungi of 1.5 million drastically (Hawksworth, 2001). The total estimated number of plant species present in the world is approximately 300,000 (Strobel et al., 2002). In Panama, 418 morphospecies of endophytic fungi were isolated from the leaf of just one plant (Arnold et al., 2001). Firakova et al., (2007) and Arnold et al., (2000) found that plants in high density and diversity forests in tropical and subtropical regions possess a higher number and variety of endophytic fungi and bacteria. Borneo is ranked as the sixth megabiodiversity region in the world and is predicted to

harbour a hyperdiversity of endophytic fungi. This also means there is a high potential of finding new natural bioactive products.

In Sarawak, very few studies on endophytic fungi have been conducted and were mostly focused on their bioactivity such as antibacterial and anticancer compounds (Jeffrey et al., 2008). Muscodor is among the group of endophytic fungi that is interesting to be investigated as they have the ability to produce volatile chemicals capable of controlling a wide range of fungi, bacteria and certain insects. This group of endophytic fungi was found to grow in numerous types of plants worldwide and was first discovered in Honduras and allocated as a new genus. In total, Muscodor comprises nine species; M. albus, M. roseus, M. vitigenus, M. yucatanensis, M. crispans, M. sutura, M. cinnanoni, M. fengyangensis and M. strobelli which were isolated from trees growing in Honduras, Australia, Peru, Mexico, America, China and India, respectively (Worapong et al., 2001; 2002; Daisy et al., 2002; Gonzalez et al., 2009 and Kudalkar et al., 2011). However, recent reports on the discovery of four new species of Muscodor in Northern Thailand namely; M. musae, M. oryzae, M. suthepensis and M. equiseti shows the trend of Muscodor’s host is diverting to non-woody trees (Suwannarach et al., 2013). Three out of four new species found in Thailand were isolated from the vascular plants; Musa acuminate (banana), Oryza rufipogon (paddy) and Equisetum debile (greges otot). All members under this genus possess similar characteristics and are capable of producing volatile chemicals, and also are lacking the teleomorph stage. These characteristics are widely used as preliminary identification of a Muscodor. Prior to this study, there are no published reports on Muscodor isolated from Sarawak.

As described in Chapter 2, two endophytic fungi, L3R3a and L5R1c, have the potential to be developed as biological control agents against Ganoderma boninense. The endophytes were successfully isolated from Cinnamomum javanicum, which was collected at Padawan Forest, Kuching, Sarawak. In this chapter, the aim is to describe the species of L3R3a and L5R1c based on their morphological structures, molecular characteristics, and the chemical composition of the volatile products. Our hypothesis is that L3R3a and L5R1c possess characteristics distinct from existing members in the Muscodor group.

In this chapter, the characteristics of L3R3a and L5R1c will be described in a taxonomical format to support the establishment of both isolates as novel species with the proposed name of Muscodor padawan and Muscodor sarawak, respectively.

3.2 Materials and Methods

3.2.1 Morphological Identification

The morphological characteristic of the isolates were examined in detail using the scanning electron microscope (SEM). The study was performed at the Institute of Bioscience, University Putra Malaysia (UPM), Serdang, Selangor, Malaysia. As the samples are living organism and isolated from natural resources in Sarawak, four permits were required to bring the samples from Sarawak to Selangor. The permits were obtained from Sarawak Biodiversity Centre (SBC), Sarawak Forest Department (SFD), Agriculture Department Kuala Lumpur and Department of Agriculture, Plant Protection and Quarantine Services Kuching, Sarawak. Preparation of the fungi samples was adapted and modified from procedures used in Malone & Ashworth, (1991) as follows:

1. Primary Fixation In the fume hood, agar blocks containing the mycelia were cut into 1 cm2 squares using a sterile blade. Agar blocks (3-5) were transferred into a vial that was labelled with the corresponding sample number. Glutaraldehyde (4%) was pipetted into the vial using a disposable pipette until the samples were fully covered. Vials were capped and stored at 40C for 4 hours

2. Preliminary Washing After 4 hours at 40C, the 4% glutaraldehyde solution was discarded. Using a new disposable pipette, 0.1M sodium cacodylate was added into the vials until the samples were fully covered. The vials were stored at room temperature inside the fume hood for 10 minutes. The 0.1M sodium cacodylate solution was removed from the vials and pipetted into a waste bottle. The washing steps were repeated twice.

3. Post Fixation Osmium tetroxide (1%) was pipetted into the vials until the samples were fully covered. The vials were kept for 2 hours at 40C.

4. Washing After 4 hours at 40C, the 1% osmium tetroxide solution was discarded and 0.1M sodium cacodylate was added into the vials until the samples were fully covered. The vials were stored at room temperature inside the fume hood for 10 minutes. The 0.1M sodium cacodylate solution was removed from the vials and pipetted into a waste bottle. The washing steps were repeated twice.

5. Dehydration Ethanol (20%) was added into the vials until the sample was fully covered, and the vial was left to stand for 10 minutes inside a fume hood. The 20% ethanol solution was discarded and the process was repeated in 10% increments of ethanol concentration, until 100%. After the last step with 100% ethanol, acetone was added into the vials until the samples were fully covered. This was left to stand for 15 minutes. The acetone solution was discarded from the vials and the acetone wash step was then repeated.

6. Critical Point Drying The specimen was transferred into a basket. Each basket with 1cm diameter was capable of containing up to two blocks while a 3 cm diameter basket can contain up to 5 blocks. During the transfer, the blocks were soaked in 70% ethanol to maintain the fixed structure of the mycelia. The basket was capped tightly and placed into the critical point drying (Baltec-CPD- 030) machine for 45 mins. During this process, the samples were flushed with liquid carbon dioxide thrice, to fix the mycelia structure.

7. Mounting Each block was stuck onto the stub using double sided tapes. The mycelia area was arranged upwards, for visualization under SEM.

8. Coating The stubs with the dry mycelia block stuck on the top was loaded into the sputter coater, baltec SCD 005 machine to coat the sample with gold.

9. SEM Viewing The coated stubs were placed inside the SEM machine. The structures were visualized from low magnification up to 15,000 magnifications. The JOEL-JSM 6400 Scanning Microscope was used to visualize the overlapping hyphae.

3.2.2 Analyses of the Chemical Composition in Volatile Chemicals Produced by L3R3a and L5R1c

Prior to the analyses of volatile contents, isolate L3R3a and L5R1c were inoculated individually on PDA agar slants in 15ml vial. The inoculated and un-inoculated vials (control) contained similar amounts of PDA media and were incubated at 250C for 10 days prior to analyses.

The Volatile chemicals produced by 10-day-old tested isolates was analysed using HeadSpace Solid Phase Micro Extraction Gas Chromatography/ Mass Spectrograph (HS-SPME-GC-MS) as described by Griffin et al., (2010). Syringe (Supelco) consisting of 50/30 divinylbenzene/carburen on polydimethylsiloxane on a stable flex fiber was preconditioned at 2400C for 20 minutes under a flow of helium gas using CTC CombiPAL autosampler. In order to trap the volatiles produced in the headspace above the sample or media, the syringe was injected at 22mm into the vial and the fibre was exposed to the headspace above the sample for 35 minutes without agitation. After exposure, the syringe was then inserted into the split- /splitless injection port of the gas chromatograph (Hewlett Packard 6890) for 2 minutes and the fibre was exposed to HP5-MS column, 30m x 0.25 mm I.D. ZB Wax capillary column with a film thickness of 0.25 um (Agilent Inc., Santa Clara, US) to separate the volatiles.

The column was programmed at 400C for 2 minutes and followed with 1000C at 70C/min and further held for 5 minutes with a constant flow rate of 1.0mL/min purified Helium gas, 99.99% purity (Eastern Oxygen). Electron impact (IE) spectra were obtained from electron impact ionization at 70eV (source temperature 2400C, quadrupole 1500C) and data were collected over the mass range of 30-300 atomic mass unit (amu).

Data acquisition and data processing was performed on the MSD Chemstation E.02:01.1177 (Agilent Inc. Little, Falls, U.S) software system. The mass spectra of chromatographic peaks of samples were compared with the NIST 08 and Wiley 8n database (Griffin et al., 2010). Comparative analyses were conducted by subtracting the compound produced on uninoculated vials (control) containing PDA media and the compounds produced by test samples in vial containing isolates grown on the same media.

3.3 Results and Discussion

In this study, a 10-day-old isolate was used to evaluate morphological structures of each species in PDA media. The comparison of morphological characteristic between isolate L3R3a and L5R1c with existing members in Muscodor was performed.

The presences of septate hyphal indicate that these isolates came under the class of Ascomycete or Basidiomycete (Corner, 1932; Pegler, 1973; Roy & De, 1996 and Watkinson et al., 2005). However, the absence of clamp connection structures (structures that differentiate between Ascomycete and Basidiomycete) and hyphal accessories classifies them under the class of Ascomycete (Dix & Webster, 1995). The asexual stage is unknown owing to the absence of fruiting bodies or spore structures, suggesting that these isolates can be classified under Deuteromycetes (Dix & Webster, 1995). Based on a newly described genus by Worapong et al., (2001), these isolates fulfil the basic criterion of the Muscodor group; produces distinct smell (odour), slow grower <5 cm diameter in 10 days, light colony colour (white to pinkish), hyphal ≤2.5um diameter and non-sporulation. Using morphological and molecular data, these isolates can be classified as members of the Ascomycete, Muscodor genus. Production of volatile chemicals that are capable of inhibiting or killing pathogenic fungi is characteristic of Muscodor fungi and this characteristic is also present in these isolates (Worapong et al., 2001; 2002; Daisy et al., 2002; Gonzalez et al., 2009; Mitchell et al., 2010 and Kudalkar et al., 2011). The Internal Transcribed Spacer (ITS) sequences also supported the conclusion that these isolates are members of Muscodor. Their homolog value when compared to Muscodor was over 94% which met the standard parameter of genus determination as suggested by Keswani et al., (2001).

Detailed observations on the morphological structure via scanning electron microscope (SEM), DNA arrangement (phylogenetic tree and multiple sequence alignment) and major volatile compounds produced by these isolates vary largely. Phylogenetic studies and multiple sequence alignment also showed that the isolates did not group together in the same cluster with the existing members in Muscodor as discussed at Chapter 2. The major compound produced by 10-day-old isolates L3R3a and L5R1c also supports the recommendation that the isolates are novel. In existing members in Muscodor, the major compound produced showed high similarity (more than 90%) to chemical profiles in NIST database and the compound was identified according to search results with NIST database. However, in this study, the major compounds produced by test isolates showed low similarity to NIST database which was in the range 74-78%. The major compound produced by isolate L3R3a, Bicyclo [3.3.1] nona-2,6-diene chemical profile had a low similarity with existing chemical profiles in NIST database (Table 9). It is suggested that the compound produced by this isolate L3R3a is new to the existing chemical profile in NIST database and it should be noted that the compound is different from the existing major compound produced by members of Muscodor. Similar to L5R1c, (-) delta- panasinsine which is the major compound in the volatiles produced by this isolate only showed 78% similarity to the NIST database (Table 10). This also supports the recommendation that the isolates are novel as no other members in Muscodor produced these compounds as the major compound at the specific retention times. Detailed descriptions of the isolates are presented below.

Table 9: GC/MS analysis of the volatile compounds produced by a 10-day-old culture L3R3a

RT (min) Area (%) Possible Compound Quality 14.8644 18.415 Bicyclo[3.3.1]nona-2,6-diene 74 9.2155 11.1736 3-Octanone 96 3.7327 3.221 1-Butanol, 3-methyl- 90 22.4136 1.9122 1H-Cycloprop[e]azulene, 90 decahydro-1,1,7-trimethyl-4-methylene-, [1aR-(1a.alpha.,4a.alpha.,7.alpha., 7a.beta.,7b.alpha.)]- 15.1448 1.6443 Cyclopropanecarboxylic acid, 83 2-phenylethyl ester 12.1127 1.514 Phenylethyl Alcohol 93 RT, retention time in minutes

Table 10: GC/MS analysis of the volatile compounds produced by a 10-day-old culture L5R1c

RT (min) Area (%) Possible Compound Quality 17.7306 12.6611 (-)-delta.-Panasinsine 78 3.0371 3.9967 Propanoic acid, 2-methyl-, methyl ester 91 1.7599 3.0864 Cyclobutanol 39 22.4138 2.8512 1H-Cycloprop[e]azulene, 92 decahydro-1,1,7-trimethyl-4-methylene-, [1aR-(1a.alpha.,4a.alpha.,7.alpha., 7a.beta.,7b.alpha.)]- 1.573 2.5044 Ethyne, fluoro- 5 RT, retention time in minutes

(a) Isolate L3R3a

Muscodor padawan Mahidi, Mueller, Yeo, Kuek and Nissom sp. nov. (Fig. 18)

Fungal Taxonomy Fungus in nature is associated with the plant from Lauraceae, Cinnamomum javanicum as shown in Figure 18. Fungal colonies exhibit cream mycelia when exposed to direct light or placed in the dark, are occasionally yellowish to brackish after repeated sub culturing on rich media such as PDA, cream at reverse, mycelia growing in a circular shape and initially form radial then rhizomorph lines, slowly growing to 20-28 mm diameter in 10 days incubation at 25°C with poor production of aerial mycelia, moderate production of vegetative mycelia, produces a sweet fruit odour at 5 days. Hyphae hyaline, smooth, septate, 1-3 um diameter, thick walled, branched, clump rope-like strands, overlapping hyphal form well shape, spider mat attached on hyphal (Figure 20). Fruiting body or spore structures were absent, chlamydospore present. Exudate produced after 20 days of incubation at 25°C on PDA media, pigment colour absent.

Holotype Endophytic on Cinnamomum javanicum. Collections were made at Padawan forest which is located at 20 km from Kuching City, Sarawak, Malaysia. The holotype came from one of the Cinnamomum species trees collected in February, 2010 by Noreha Mahidi. A living culture was deposited as Muscodor padawan in the SBC Fungi Collection as acquisition-L3R3a. ITS sequence of M. padawan have been submitted to GenBank with the assigned serial number SBC102010

Telomorph Unknown

Etymology The genus name, Muscodor, is taken from the Latin word which means musty (Worapong et al., 2001). This is consistent with the quality of the odour produced by the first twelve isolates of the genus. The species epithet is- Padawan, named after the collection site of the Cinnamomum javanicum host.

Molecular Biology of Muscodor padawan Comparison with the existing sequences in the GenBank databasen, the sequencing of the ITS- 5.8S ribosomal gene, (563 bp) showed that M. padawan was 96% similar to Muscodor yucatanensis, FJ917287.1, Muscodor sp., KF229762.1 and Muscodor sp., KF229758. Phylogenetic analysis showed that this fungus shared a common ancestor with M. strobelli and M. yucatanensis but grouped with a different cluster (Figure 17 at Chapter 2).

Fungal Biology The fungus produced a cream mycelium on agar based media either exposed to direct light or placed in the dark. Occasionally it exhibits yellow to brick mycelium after repeated sub- culturing on rich media (e.g PDA, Difco), twigs and leaves of Cinnamomum javanicum. Cream at reverse and produces moderate production of vegetative mycelium. This fungus was slow growing with a size of 20-28 mm diameter in 10 days incubation at 25°C. In comparison, M. albus takes 21-28 days to reach 90 mm colony diameter (Worapong et al., 2001). Production of aerial mycelium was poor and produced a sweet odour at 5 days. Hyphal were hyaline, smooth and occasionally rough, septate, 1-3 µm diameter, thick walled, generative to arboriform branched, occasionally clump rope-like strands, overlap hyphal form a well shape, spider mat attached on hyphal (Figure 20). No coiled hyphal were observed in this fungus as found in M. vitigenus (Daisy et al., 2001). All attempts to obtain fruiting body of this fungus were unsuccessful, including exposure with UV light, near to blue light, growth on poor substrate such as water agar, corn meal agar (CMA, Oxoid), or natural media containing C. javanicum twigs and leaves.

Non-sporulation fungus is one of the characteristics of the genus of Muscodor (Worapong et al., 2001; 2002; Daisy et. al., 2002; Kudalkar et al., 2011 and Mitchell et. al., 2010). However unusually in this fungus there were chlamydospore observed (Worapong et al., 2001; 2002; Daisy et. al., 2002; Kudalkar et al., 2011 and Mitchell et. al., 2010). A hyaline exudate was produced after 20 days incubation at 25°C on PDA media but there was no pigment produced either by young or older cultures. This fungus retained viability for 6 months on PDA slant in a universal bottle and distilled water under storage conditions between 250C and 40C. This fungus has a prolonged shelf life of up to 3 years when cultured on barley, rice grain, twigs and leaves of C. javanicum and stored at 40C. The morphology characteristics alone were unable to distinguish and compare the fungus from existing members in the genus of Muscodor.

Therefore, studies on molecular characteristics and chemical compositions in the VOC produced by this fungus were also performed to compare this fungus with other members in Muscodor.

The sweet fruity odour of the cultures became apparent after 5 days of incubation at 250C and became concentrated as the mycelia spread across the entire plate. After one month of incubation, no growth was detected and the odour diminished. This may occur as a response to depleted nutrients in the media. A study on the chemical composition in the VOC produced by a 10-day-isolate of this fungus was performed. HeadSpace Solid Phase Micro Extraction Gas Chromatography/ Mass Spectrograph (HS-SPME-GC-MS) was used to analyse the compound and the mass spectrum and retention times of the compound were compared with the NIST database. Bicyclo [3.3.1] nona-2,6-diene was detected as a major compound in the range of 18.42% at retention time 14.86 mins, followed by 3-Octanone and 1-Butanol, 3-methyl- with a covering area of 11.17% and 3.22%, respectively. However, the peak quality of Bicyclo [3.3.1] nona-2, 6-diene was less than 90% (Table 7). The VOC produced by this fungus was capable of killing Ganoderma boninense, Phytophthora capsici and Rhizoctonia solani, which are soil borne fungi that causes diseases in oil palm, pepper and vegetables, respectively

Strain Deposited at: (i) Swinburne University of Technology Sarawak (SUTS) with reference number L3R3a (ii) Sarawak Biodiversity Centre (SBC) with reference number L3R3a

Figure 18: Host of L3R3a, Cinnamomum javanicum (L05). This plant was sourced at Padawan.

Figure 19: Mycelial characteristics of L3R3a. (a) A 10-day-old L3R3a in 90cm Petri Dish contained PDA media (b) The reverse appearance of 10-day-old L3R3a (c) A 30-day-old L3R3a (d) Reverse appearance of 30-day-old L3R3a

Figure 20: Micro-morphological structures of L3R3a visualised using scanning electron microsope (SEM): (a) Formed coiled-like hyphal (b) Spider-mat-like attached on the surface of hyphal (c) Chlamydospores formed in the intermediate hyphal (d) A clump of hyphal occasionally present.

(b) Isolate L5R1c

Muscodor sarawak Mahidi, Mueller, Yeo, Kuek and Nissom sp. nov.

Fungal Taxonomy Fungus in nature is associated with the plant from Lauraceae family, Cinnamomum javanicum. Fungal colonies exhibit white mycelia in all media, reverse is white, concentric lines, rounded to irregular shape, slow growing at 23-30 mm diameter in 10 days (Figure 21) incubation at 250C, moderate production of aerial and vegetative mycelium. After 20 days of incubation at 250C the mature mycelium began to turn black and was completely black after 60 days. Hyphae hyaline, branched, 1-2um diameter, thick-walled, smooth to rough, coiled at tip, rope- like strands, two hyphae connecting to form a bridge, which was similar to typical Zygomycete structures (Figure 22). Fruiting body was absent. Exudate produced after 20 days of incubation at 25°C on PDA, Difco media, and pigment colour absent.

Holotype Endophytic on Cinnamomum javanicum. Collections were made at Padawan forest which is located 20 km from Kuching City, Sarawak, Malaysia. The holotype came from one of Cinnamomum javanicum trees collected in February, 2010 by Noreha Mahidi. A living culture was deposited as Muscodor sarawak in the SBC Fungi Collection as acquisition-L5R1c. ITS sequence of M. sarawak have been submitted to GenBank with the assigned serial number SBC112010

Telomorph Unknown

Etymology The genus name, Muscodor, is taken from the Latin word which means musty (Worapong et al., 2001). This is consistent with the quality of the odour produced by the first eight isolates of the genus. The species epithet is- Sarawak, named after the state of Sarawak, where the plant sample was collected.

Molecular Biology of Muscodor sarawak Comparison with the existing sequences in the GenBank database, the sequence of the ITS- 5.8S ribosomal gene, (563 bp) showed that fungus was 99% maximum identity to Muscodor equiseti, Muscodor sp. RTM5-IV2, KF850711 and Fungal ARIZ B342, FJ612989. Phylogenetic analysis showed this fungus was grouped in the same cluster with M. vitigenus, M. sutura and M. equiseti.

Fungal Biology The fungus produced a white mycelium on all media included plant based which mimicked the characteristics of M. albus (Worapong et al., 2001). This fungus became black completely after 60 days. The reverse was white and then became cream and lastly black after 60 days of incubation. This fungus also displayed similar characteristics as members of Muscodor which is slow growing with 23-30 mm colony diameter in 10 days incubation at 250C (Worapong et al., 2001; 2002; Daisy et al., 2002; Kudalkar et al., 2011 and Mitchell et al., 2010). Production of aerial and vegetative mycelia was moderate. Mycelium was circular and irregular in shape and formed concentric lines mimicking colony characteristic of Phomopsis spp. Hyphal were

hyaline, smooth to rough, septate, 1-2 µm diameter, thick walled, generative to arboriform branched. This fungus also formed coiled hyphal at the tip but not as complete as found in M. vitigenus (Daisy et al., 2001). Fruiting body and spores stage was unknown. All attempts at obtaining fruiting bodies failed, including growing this fungus on twigs and leaves of C. javanicum. In traditional fungus classification, any fungus which lacks asexual stage was placed under Deuteromycete. Therefore in the genus of Muscodor , the members were placed under the family of Ascomycetes as their morphological and molecular characteristics was similar to characteristic of Ascomycetes, even though this fungus did not produced spores but hyphae to hyphae connection was similar with Zygomete group. The two different lateral hyphal were growing toward one another and form aseptate hyphal as contact to diffuse any materials from each other. This two hyphal did not form thick-walled septate progametangia as end product from sexual stage in Zygomete. The rest spore structure, chlamydospore (one or two sections) was also observed in this fungus but no report on occurrence of this structure in other members of Muscodor (Worapong et al., 2001; 2002; Daisy et. al., 2002; Kudalkar et al., 2011 and Mitchell et. al., 2010). A hyaline exudate was produced after 20 days incubation at 25°C on PDA, Difco media but there was no pigment even in older cultures. This fungus retained viability for 6 months on PDA slant in universal (McCartney) bottle and distilled water under storage conditions 250C and 40C. Their shelf life could be prolonged up to 3 years when cultured on barley, rice grain, twigs and leaves of C. javanicum and stored at 40C. This isolate was capable of withstanding the presence of VOC produced by M. albus and non-sporulation was preliminary characteristic in classifying this fungus under the group of Muscodor. Therefore detailed morphology characteristics were used to distinguish and compare the fungus from existing members in genus of Muscodor. Studies on molecular characteristics and chemical composition in the VOC produced by this fungus were also performed to compare this fungus with other members in Muscodor.

The musty odour of the cultures became apparent after 3 days of incubation at 250C and became concentrated as the mycelia spread across the entire plate. After a month of incubation, almost no growth was detected and the odour diminished. This may occur as a response to depleted nutrients in the media. The chemical composition in the VOC produced by a 10-day-old isolate was analysed using Headspace Solid Phase Micro-extraction Gas Chromatography/Mass Spectrograph (HS-SPME-GC/MS). The mass spectrum and the retention times of each compound detected were compared with existing compounds in NIST database.

The major compound produced by this fungus was (-) delta-Panasinsine with a coverage area of 12.66% at retention time 17.73 minutes. However, the similarity of the peak with existing peak or chemical profile in NIST database was 78%, lower than 91%. The second major compound produced with 91% similarity to the chemical profile in NIST database was Propanoic acid, 2-methyl, methyl ester with coverage area of 4% at retention time 3.04 minutes. The third highest coverage area (3.09%) in volatiles produces by this fungus was Cyclobutanol at retention time 1.76 minutes but the similarity towards the chemical profile in NIST database was only 39%. In total, the volatile chemicals produces by a 10 days old isolate of strain comprised 5 different compounds. The volatiles produces by this fungus showed antifungal activities towards soil borne fungi, G. boninense, a pathogenic fungus that causes basal stem rot disease in oil palm.

Strain Deposited at: (i) Swinburne University of Technology Sarawak (SUTS) with reference number L5R1c (ii) Sarawak Biodiversity Centre (SBC) with reference number L5R1c

a b

c d

Figure 21: Mycelial characteristics of L5R1c. (a) A 10-day-old L5R1c in 90cm Petri Dish contained PDA media (b) The reverse appearance of 10-day-old L5R1c (c) A 30-day-old L5R1c (d) The reverse appearance of 30-day-old L5R1c

Figure 22: Micro-morphological structures of L5R1c visualised using scanning electron microscope (SEM): (a) Formation of new hyphal at lateral main hyphae (b) Chlamydospores formed in the intermediate hyphal (c) Half-coiled hyphal at the tip (d) A strip of hyphal attached by lateral hyphal that formed short bridge-like structure

3.4 Conclusion

The ability of L3R3a and L5R1c isolates to withstand the presence of volatile chemicals produced by the standard strain, Muscodor albus, suggests that both of the isolates are members of the Muscodor genus. Further study on their colony morphology has shown that these isolates almost mimicked the Muscodor group with the characteristics of; slow growth (takes 4-6 weeks to cover the 90mm media surface) and low production of aerial mycelium. Absence of intertwining hyphal, lacking of right-angle branching position from lateral hyphal differentiate the two isolates from other members of Muscodor as those characteristics were common in members of Muscodor. Occasionally the presence of chlamydospores was also characteristic of these two strains which were not reported in any of the existing members of Muscodor.

In the molecular study, comparative sequence analysis of ITS sequence with the GenBank database also showed these fungi were identical to Muscodor spp. with similarities ranging between 96-99% with Muscodor equiseti. Study on the chemical composition of volatiles produced by 10-day-old isolates showed that the major compound produced by those two isolates were new, as the similarity of the compounds to existing chemicals profile in the NIST database was below 80%. The major compounds produced by the isolates were also different from the major compound produced by existing members of Muscodor group. The distinct taxonomy, molecular characteristic and volatile chemical profiles produced by both isolates suggest that L3R3a and L5R1c are novel species with the proposed name of Muscodor padawan and Muscodor sarawak, respectively. Further studies on the analysis and elucidation of the chemical profile of the major compound in the volatiles produced by those isolates needs to be further investigated. The possibility to obtain novel compound from these new isolates is promising based on the results from NIST database and also the differences in their morphology and DNA sequences as compared with other species in Muscodor.

Muscodor padawan and Muscodor sarawak are proposed to be novel species with the potential to become biological control agents against Ganoderma boninense. Further studies on their capacity to control G. boninense under different conditions are important to sustain and optimize their capabilities and will be discussed in Chapter 4.

Chapter 4

Effect of Physicochemical Conditions on the Efficiency of Muscodor sarawak and Muscodor padawan as Biological Control Agents of Ganoderma boninense

4.1 Introduction

Ganoderma boninense is a soil-borne fungus that causes the destructive Basal Stem Rot (BSR) disease of oil palm, affecting plantation especially in Malaysia and Indonesia (Singh, 1991; Flood et al., 2000; Idris et al., 2009; Susanto, 2009 and Susanto & Huan, 2010). The success of this fungus as a pathogen to oil palm is due to its ability to survive and reproduce in stressful conditions such as acidic soil, inconsistent weather, and nutritional imbalance, especially in peat soil, which contains low potassium (Gourmit et al. 1987 and Hasnol et al., 2007). In order to establish an effective biological control agent (BCA) to control the growth of G. boninense, the BCA has to have similar capability as G. boninense, which is to survive and reproduce under stress.

Reflecting on field situations, Nelson et al., (2011) and Ng et al., (2011) reported that the soil pH in oil palm plantations especially in re-planted areas is acidic compared to new plantation areas as fertilizers were repeatedly applied to the soil. An estimated 2.5 million hectares of land bank in Malaysia is peat land and 33.9% of the peat land which is slightly acidic has been devoted to planting oil palm (Miettinen et al., 2012). In order to develop an effective BCA against G. boninense, the tested strains must be capable of growing in a wide range of pH, especially the acidic soil of most of the land in Malaysia (Akbar et al., 2010).

On the basis of Muscodor features, different species show different optimum condition for the growth and bio-activity against plant pathogens (Strobel et al., 2001; 2003). Studies done by Gabler et al. (2006) and Lacey et al., (2008), showed that the efficacy of the biofumigant fungus, Muscodor albus, to control pathogenic fungi and insects was affected by physicochemical conditions such temperature. Muscodor albus was found to be an effective BCA in controlling pathogenic fungi and insects at 200C and 240C, respectively. Nutrients are also another physiochemical factor that affect the performance of BCA. Ezra and Strobel, 65

(2003) and Wheatley et al., (1996) have reported that the composition of the media greatly influenced the number and type of chemicals in the volatile chemicals released by the fungi, as well as their effectiveness in killing and inhibiting the pathogens. Muscodor albus performed the best in media that was rich in sucrose.

Two VOC producing endophytic fungi, Muscodor padawan and Muscodor sarawak have been isolated from Cinnamomum javanicum. The two isolates produced anti-Ganoderma volatile chemicals and were revealed, in this study, to have the potential to act as biological control agents (BCA) against G. boninense. Their capabilities to grow and produce anti-Ganoderma volatile chemicals in different cultural media and environmental parameters have not been studied as these two isolates were suggested as novel strains. One of the objectives of this thesis is to develop the isolate M. padawan and M. sarawak as biological control agent against G. boninense. The aim of this chapter is to determine the influences of media and environmental parameters on the growth and VOC production, so as to enable optimization of the growth and culture conditions for the two test isolates.

4.2 Materials and Methods

Four parameters that were examined in this study were temperature; pH, media, and the age of inoculum. The experiments were performed as described below:

4.2.1 Effect of Inoculum Age Muscodor padawan (L3R3a) and Muscodor Sarawak (L5R1c) are slow growing fungi and in order to obtained sufficient inoculum for testing, both isolates were cultured on PDA at 250C for up to 10 days prior. An agar plug (7mm diameter) was cut from each isolate and inoculated on the middle of a 90mm petri dish containing PDA media. The inoculated plates were incubated at 250C for 0 until 10 days in triplicates for each examined day (age of inoculum). After incubation on the target days, the plate was exposed to G. boninense using a double plate assay procedure as described in Chapter 2, Section 2.2.5b. As a control plate, a plate of G. boninense was inverted over the plate with uncultured PDA media. The purpose of inverting G. boninense over the test isolate was to confirm that only the volatile chemicals present in the plate environment retarded the growth or killed the G. boninense. The plates were sealed with

double layers of parafilm to minimize the escape of volatile chemicals produced by tested isolates. The plates were then incubated at 250C for 5 days. After 5 days exposure to the test isolate, the Percentage Inhibition of Radial Growth (PIRG) of G. boninense was measured (see Chapter 2 section 2.2.5). The inoculum age of the tested isolate that showed effectiveness in controlling the growth of G. boninense was selected as the standard age for further studies.

4.2.2 Effect of Culture Media The media: (a) Potato Dextrose Agar (PDA) (b) Corn Meal Agar (CMA) (c) Malt Extract Agar (MEA) (d) Oat Extract Agar (OEA) were selected based on their composition and their effect towards production of secondary metabolite (Wang & Zabel, 1990). The experiment was performed similarly as an experiment of effect of inoculum age section (a) above. The best media that supported the effectiveness of the test isolate against G. boninense was selected as standard media.

4.2.3 Effect of Temperature Three temperatures: 250C, 300C, 350C were selected for use in this study. An inoculum of the test isolates was first grown on PDA at 250C for 10 days and this culture was used as an inoculum source for this study. An agar plug was cut from the 10 days old culture and inoculated on the middle of a new PDA plate. The inoculated plates with test isolates was incubated at 250C, 300C and 350C for 5 days prior before being exposed with G. boninense as described in section (a). Ganoderma boninense that was exposed to uncultured PDA media was used as a control. The effective temperature for the test isolate to produce volatile chemicals that can kill the G. boninense was used as a standard temperature for the test isolates.

4.2.4 Effect of pH In this study, a range of pH: 5, 5.6, 7 and 9 was selected. However, the main target in this study was for acidic conditions as most soils in Malaysia are slightly acidic (Nelson et al., 2011 and Ng et al., 2011). The lowest pH we could use was 5, because the agar would not set at higher acidities. PDA media was used as standard media with an adjustment on the pH. The test isolate was inoculated on the middle of the plate and incubated at 250C for 5 days prior to being exposed together with G. boninense as described in section (a) above.

4.3 Results and Discussion

Four parameters (temperature, pH, media and age of inoculum) have been reported to affect the efficiency of the Muscodor group in controlling test pathogens (Strobel et al., 2001; 2003; Ezra & Strobel, 2003 and Lacey et al., 2008). Based on these reports, the efficiencies of test strains Muscodor padawan and Muscodor sarawak might also be affected by age of inoculum, media, temperature and pH. With reference to the data from studies conducted on other members of Muscodor, this study examined the optimum condition for the test strains. The experiments were designed according to protocols used by Gomori (1955), Xiao & Sitton (2004), Ezra & Strobel, (2003) and Mathan et al., (2013) with the purpose of comparing the optimized conditions with existing members in Muscodor. In addition, this study was also performed to examine if the ability of the test fungi to produce anti-Ganoderma volatile chemicals is dependent on, or associated with culturing conditions and/or environmental parameters.

Since the target of the study was to develop effective biological control agents (BCA) against pathogens that caused basal stem rot (BSR) disease, G. boninense was selected as the standard pathogen. The efficiency of the test isolates was observed by measuring the growth rate of G. boninense after exposure to volatile chemicals produced by test isolates under different conditions using a dual plate assay system (Wheatley et al., 1997).

4.3.1 Anti-Ganoderma Volatile Chemicals Produced in All Stages of Growth of the Test Strains

In this study, test isolates; M. padawan and M. sarawak with ages of 0 up to 10 days old were used to evaluate their efficiency in controlling G. boninense. The age of test strains partially influences their capacity to inhibit the growth of G. boninense (Figure 23). Muscodor padawan and Muscodor sarawak, as early as 0 days old, have the capacity to inhibit the growth of G. boninense with 73% and 79.75% inhibition, respectively (Figure 23). Muscodor padawan and Muscodor sarawak show differences in their capacity to inhibit the growth of G. boninense with increasing age. Ganoderma boninense was inhibited after exposure to 1, 3 and 4-day-old cultures of M. sarawak. However, volatile chemicals produced by 2, 5, and up to 10-day-old

cultures of M. sarawak caused 100% inhibition in the growth rate of G. boninense as compared with the growth rate of G. boninense in the control plate.

In contrast, M. padawan, at the earlier stages between the ages of 0 up to 6 days old, was only able to inhibit the growth rate of G. boninense in the range of 79% to 96% inhibition, as compared with the control plates (Figure 23). At 7 to 10 days old, M. padawan started to kill the G. boninense with a PIRG value of 100%. This suggests that volatile chemicals produced by M. sarawak at the early ages (day 0 to day 4) are different from the volatile chemicals produced in day 5 up to day 10 as the PIRG value in these two stages differ. Similarly with M. padawan, the age of inoculum used in this study showed differences in their capability to inhibit the G. boninense at an early stage (day 0 up to day 6) and the late stages (day 7 to day 10). This suggests that the effective age of inoculum for controlling G. boninense for M. padawan and M. sarawak was 5 to 10 days olds and 7 to 10 days, respectively. This result also concluded that the types and chemicals composition in the volatiles produced by different age of inoculum might vary with age.

Figure 23: Percentage inhibition of radial growth on G. boninense after exposed to volatile chemical produced by various age of Muscodor padawan (MP) and Muscodor Sarawak (MS). Each value is the mean PIRG ± Standard Error (N=3) from each tested age of each tested strain according to One-Way ANOVA with Tukey’s HSD test (P<0.05)

4.3.2 Media Composition Affects Efficiency of Muscodor padawan, but not Muscodor sarawak, in Producing Anti-Ganoderma Volatile Chemicals

Previous reports showed that the volatile chemicals composition and bio-activity of the member of Muscodor towards pathogens is greatly influenced by media composition (Ezra et al., 2003). A similar approach was adapted in this study to evaluate the capability of volatile chemicals produced by tested isolates. Four different media (PDA; MEA; OEA, and CMA) were used in this study to evaluate the influence of media on the capacity of the test isolates (M. padawan and M. sarawak) in controlling G. boninense. The results showed that M. padawan and M. sarawak grew on all tested media and were able to produce volatile chemicals that inhibited the growth of G. boninense at different percentage of inhibition (Figure 24). However, the percentage of inhibition rate of G. boninense that was exposed to M. padawan grown on MEA, and CMA, was 91.67% which was slightly lower compared to PDA and OEA

media. Volatile chemicals produced by M. padawan grown on PDA and OEA inhibited G. boninense with the percentage of inhibition of 100%. Ezra and Strobel, (2003), and Wheatley et al., (1996) also reported that the composition of the media greatly influences the number and type of volatile chemical composition as well as their effectiveness in killing and inhibiting the pathogens. This might explain why the activity of tested isolates towards G. boninense, especially M. padawan showed partial difference in tested media.

The results obtained from M. sarawak showed that this fungus was not dependent on types of media in producing effective anti-Ganoderma volatile chemicals. In all test media, M. sarawak showed the capacity to produce volatile chemicals that caused 100% inhibition of G. boninense as compared with control plates.

Figure 24: The effect of media composition on the efficiency of M. padawan (L3R3a) and M. sarawak (L5R1c) in producing volatile anti-Ganoderma compounds. The results presented in this figure showed the percentage inhibition of radial growth (PIRG) of G. boninense after 5 days of exposure to M. padawan (L3R3a) and M. sarawak (L5R1c) grown on different growth media. Each value is the mean PIRG ± Standard Error (N=3) from each media of each tested strain

4.3.3 250C and 300C are the Best Temperatures for Muscodor sarawak to Produce Anti- Ganoderma Volatile Chemicals

Temperature is another environmental factor that was used as parameter to evaluate the efficiency of the two test fungi in inhibiting the pathogen. South East Asia (SEA), especially Indonesia and Malaysia are the main producers of oil palm products that face problems from the BSR disease. In this study, three different sets of temperature were used to mimic the normal temperature range in South East Asia especially Malaysia and Indonesia with an average daily temperature range of 28-320C (Sarawak Government, 2013). The range of temperature tested in this study was within 25-320C, the average daily range in Malaysia (Cheong et al., 2013 and Sarawak Government, 2013).

The ability of M. padawan, M. sarawak and G. boninense to grow in the tested set of temperature was evaluated. The growth of all test strains decreased as the set temperature increased. Effect on efficiency of M. padawan and M. sarawak against G. boninense was calculated based on the comparison with a control plate that was also incubated at the same temperature. In Figure 25, the efficiency of M. padawan to control G. boninense was influenced by temperature. Muscodor padawan (L3R3a) inhibited the growth of G. boninense by 100% at 250C. The percentage of inhibition declined to 91.88% and 75% at 300C and 350C, respectively.

In contrast, the PIRG of G. boninense after exposure to M. sarawak at 250C and 300C did not show any difference. However, M. sarawak inhibitory activity towards the growth of G. boninense declined to 75% as compared with the PIRG of G. boninense that was exposed to M. padawan at 250C and 300C. This suggests that the capacity of M. padawan to produce volatile chemicals that inhibited the growth of G. boninense was influenced by temperature. Muscodor sarawak could be partially temperature-dependent as there was no difference on the effect of two temperatures, 250C and 300C, but their inhibition activity declined at 350C as similarly observed in the M. padawan experiments. In conclusion, the effective temperature for M. padawan and M. sarawak to kill G. boninense completely was between 250C to 300C.

Figure 25: The effect of temperature on the production of volatile anti-Ganoderma chemical by M. padawan (L3R3a) and M. sarawak (L5R1c). The bars in this figure show the percentage of inhibition on radial growth (PIRG) of G. boninense after 5 days of exposure to M. padawan and M. sarawak at different temperatures. Each value is the mean PIRG ± Standard Error (N=3) from each temperature dataset of each tested strain

4.3.4 pH Affects the Capability of Muscodor padawan in Producing Anti-Ganoderma Volatile Chemicals

To study the effects of pH, four different pH were selected, representing acidic, neutral and alkaline conditions. In the earlier study pH 3 was included. However, as this assay was conducted with solid agar in the double plate assay, the PDA media at pH 3 failed to solidify. Thus, pH 3 was excluded from further study. The relationship between pH and the ability of the test strains to produce volatile chemicals that have inhibitory effect on G. boninense is shown in Figure 26.

The productivity of M. padawan was affected by pH even though it could suppress the growth of G. boninense. Muscodor padawan showed the capability to inhibit the growth of G. boninense with the percentage inhibition of radial growth (PIRG) of 71.43% at pH 5. This increased to 100% at pH 5.6. However at neutral condition of pH 7, the bioactivity of M. padawan against G. boninense declined with a PIRG of 60.71%. The bioactivity of M. padawan

against G. boninense increased at an alkaline condition of pH 9, with a PIRG value of 100%, effectively killing the G. boninense. This suggests that the capacity of M. padawan to produce volatile chemicals that were lethal to G. boninense was affected by pH. The favourable pH condition for M. padawan to produce volatile chemicals that caused 100% inhibition to G. boninense was at pH 5.6 and 9.

Muscodor sarawak did not show differences in the activity towards G. boninense at any pH conditions tested. Muscodor sarawak showed the capability to produce volatile chemicals that caused 100% inhibition to G. boninense when grown on various ranges of pH. This suggests that M. sarawak is not pH-dependent in its capability to produce volatile chemicals.

Figure 26: Effect of pH on the efficiency of M. padawan (L3R3a) and M. sarawak (L5R1c) in controlling the growth of G. boninense. The bars in the figure show percentage of inhibition on radial growth (PIRG) of G. boninense after 5 days of exposure to M. padawan and M. sarawak that were grown on PDA media with different pH. Each value is the mean PIRG ± Standard Error (N=3) from each temperature dataset of each tested strain

The rationale for this study was to evaluate the survivability as well as productivity of test isolates under stress, such as acidic and alkaline conditions. With the ability to withstand stressful conditions, the potential of these test isolates to perform as biological control agents (BCA) of G. boninense was high. In nurseries or plantations, application of chemical fertilizers causes rapid growth and development of oil palm but at same time, reduces resistance towards pathogenic organisms such as G. boninense. In addition, the fertilizers also cause the soil to become more acidic as well as reduce the population of beneficial microorganisms that 74

sustain the growth of the oil palm. Besides that, 5 million hectares of land that is currently planted with oil palm comprises areas with different pH conditions. Accordingly, the potential BCA candidate for G. boninense in oil palm industry must have the characteristic to withstand and show high productivity in various ranges of pH.

In this study, M. sarawak met one of the criterions as potential BCA for G. boninense in oil palm industry as it was capable of producing anti-Ganoderma volatile chemicals in vitro regardless of pH. Muscodor sarawak showed the ability to grow in acidic and alkaline condition and was effective in controlling the growth of G. boninense with a PIRG of 100%.

4.4 Conclusion

The effect of physicochemical factors towards the viability and productivity of Muscodor padawan and Muscodor sarawak are important aspects to evaluate their potential as biological control agent (BCA) for G. boninense in the oil palm industry. Viability and high productivity at stress condition are key factors that contribute to the success of the potential BCA.

In this study, M. padawan and M. sarawak have shown their viability and capacity in controlling G. boninense in various ranges of inoculum age, media, temperature and pH by displaying different Percentage Inhibition of Radial Growth (PIRG). The PIRG value was a parameter used to evaluate the effective physiochemical factors that contributed to the productivity of M. padawan and M. sarawak as the suitability as a BCA for G. boninense.

In all ranges of inoculum age that were tested including at 0 day, M. padawan and M. sarawak have the capacity to control G. boninense. However, the most productive inoculum age of M. padawan to control G. boninense with a PIRG of 100% was at ages 5 to 10 days. The productive inoculum age for M. sarawak was at ages 7 up to 10 days old.

Similarly, when evaluating the factor of media, M. padawan and M. sarawak has the capacity to control G. boninense in all test media. However the productive media that supported M. padawan in killing G. boninense was PDA and OEA, each with a PIRG value of 100% as

compared to MEA, and CMA. In contrast, media did not show distinct influence on the ability of M. sarawak to control G. boninense. All test media supported M. sarawak in producing volatile chemicals that has the capability of controlling the growth of G. boninense with a PIRG of 100%.

It was found that the effectiveness of M. padawan and M. sarawak in controlling G. boninense was affected by temperature. The effective temperature for M. padawan was at 250C with a PIRG value of 100%. Meanwhile, for M. sarawak it was at 250C and 300C. In contrast with the pH factor, M. sarawak did not show differences in controlling G. boninense at all tested pH. The productive pH for M. sarawak was at all tested pH with a PIRG of 100% whereas for M. padawan it was at pH 5.6 and 9. This study thus shows that physiochemical factors greatly and partially influence the effectiveness of M. padawan and M. sarawak as biological control agents of G. boninense.

Chapter 5

Efficiency of Muscodor sarawak and Muscodor padawan in Preventing Ganoderma boninense From Infecting Oil Palm Seedlings

5.1 Introduction

In the agricultural sector, especially in Malaysia and Indonesia, G. boninense is a major threat to the oil palm industry. Ganoderma boninense causes BSR disease in all growth stages of the oil palm (Gurmit, 1990; Khairuddin, 1990; 1995; Singh, 1991 and Ariffin et al., 1996). Ganoderma boninense-infected oil palm show reduced production of fruit fresh bunch (FFB), reduction in number of palm stands, high mortality of mature palms from 10 to 25 years, and reduced total oil extract per bunch due to high moisture in the mesocarp (Singh, 1991 and Khairuddin, 1995). A survey on Ganoderma disease in Malaysia for the years 2009-2010 showed that 3.71% of palms had been infected with the total affected area of 59,148 hectares and the losses derived from this destructive disease was estimated to be USD 176 to 557 million (Arif et al., 2011).

Ganoderma boninense infection occurs mostly through root to root contact (Turner, 1981; Khairuddin, 1993; Hasan & Turner, 1998 and Rees et al. 2009). Healthy palms are infected through contact of rhizomorph mycelium of G. boninense on the diseased root with the root of replanted or healthy palms. Hasan and Turner (1998), reported that the tissue of the former stand of oil palm were the primary source of infection at replanting area. Studies by Idris et al. (2004; 2005), showed that 87.5% of seedlings planted around diseased palm in the field became infected within two years. As the diseased palm was identified as the primary source of infection, several solutions have been implemented in the oil palm industry, to combat the BSR disease, as reviewed in Chapter 1. Manipulating the symbiotic interaction of endophytic organisms and host plants for controlling pathogens and promoting the growth of plants is an eco-friendly approach. The advantages of endophytes compared to saprophytes are that they grow inside the tissues of the host plant, thus acting as internal guardians for the host plant from invasion by plant pathogenic organism as well as helping the host plant to survive under stressful conditions (Saikkonen et al., 1998, 2004). 77

This thesis describes the isolation of ten endophytic fungi from the host plant, Cinnamomum javanicum obtained from Sarawak. They were found to be producing volatile chemicals and are members of the group of Muscodor. These ten isolates displayed the capability in producing anti-Ganoderma volatile chemicals by killing the G. boninense in in-vitro studies. Out of the ten, two of them are novel endophytic fungi and named (tentatively) as Muscodor padawan and Muscodor sarawak as described in Chapter 3. In this chapter, the efficiency of M. padawan and M. sarawak to control G. boninense from infecting oil palm seedlings as well as promoting the growth of oil palm seedlings is described.

5.2 Materials and Methods

5.2.1 In-vitro Screening on the Capability of Barley Infected with Muscodor padawan and Muscodor sarawak to Produce Volatile Anti-Ganoderma Chemicals, Using a Double Plate Assay System

A double plate assay system, adapted from Wheatley et al., (1997) with modification, was used to examine the capacity of test fungi in controlling G. boninense. Infected barley grains used in this study were prepared as follows: (i) 100g barley grain was washed with deionized water three times and placed into 250ml bottles, (ii) these bottles containing the barley grains were sterilized thrice using an autoclave, (iii) five agar plugs from 10-days old M. padawan or M. sarawak culture were cut out and transferred into bottles containing the sterilized barley (iv) these bottles were incubated at 250C until the barley grains were covered in mycelium, which was approximately 30 days.

In preparing the double plate assay, a 90cm petri dish was filled with barley grains infected with either M. padawan or M. sarawak to form a layer. On another 90cm petri dish containing PDA media, an agar plug of G. boninense cut from 7-days old G. boninense culture was placed on the centre of the PDA plate. At 7-days, the mycelium G. boninense is in its active stage and exhibits hyphal growth of 2-4mm per day, making it a suitable age as an inoculum (Seo, 1987 and Adaskaveg & Gilberston, 1989). The covers of both petri dishes were discarded and the dish with the G. boninense was inverted over the dish containing the infected barley grains. The dishes were sealed with two layers of parafilm to minimize the volatile chemicals

produced by the infected barley from escaping. In control plates, the steps involved were similar but the petri dish with the G. boninense was inverted over a dish containing sterilized uninfected barley. In this study, 10 replicates were prepared for each tested strains inclusive of control plates. After five days of incubation at 250C, the radial growth of G. boninense was measured and the percentage inhibition of radial growth was calculated according to Skidmore & Dickenson, 1976.

5.2.2 In-vitro Screening on the Capability of Muscodor padawan and Muscodor sarawak to Produce Non-volatile Anti-Ganoderma Chemicals, Using a Dual Cultures Assay System

Muscodor padawan and Muscodor sarawak have been known to produce antifungal volatile chemicals as discussed at Chapter 2. However, both isolates might also produce non-volatile anti-Ganoderma chemicals that could dissolve in agar media. To test on their capability to produce non-volatile anti-Ganoderma chemicals, the dual culture assay system were used in this study adapted from Skidmore & Dickenson, (1976) and Huang et al., (2005).

In preparing the dual culture assay system, the test fungi M. padawan and M. sarawak was cultured on PDA medium for 10 days. Concurrently, G. boninense was also cultured on PDA medium for 7 days. Agar plugs of M. padawan or M. sarawak were then cut from the active growing mycelium of the 10 day old cultures and inoculated at a point of 2cm distance from the centre of a new PDA in a 90cm Petri dish. An agar plug of G. boninense was then cut from an active growing mycelium of a 7-day-culture and inoculated on the same PDA plate, on the opposite side with a 2cm distance from the centre of the dish. The distance between agar plug of M. padawan or M. Sarawak, and G. boninense was 4cm. The plates were sealed with a layer of parafilm and incubated for 15 days at 25OC. Similar procedures were applied to control plates but no agar plugs of both test fungi were inoculated on the opposite side. In this study, 10 replicates were prepared for each test strains including the control plates. After 15 days of incubation at 250C, the radial growth of G. boninense was measured and the percentage inhibition of radial growth was calculated according to Skidmore & Dickenson, 1976.

5.2.3 Establishment of Muscodor padawan or Muscodor Sarawak Inside the Tissue of Oil Palm to Evaluate Their Effects on Oil Palm Seedlings as well as Controlling Ganoderma boninense Infection

(a) Preparation of Infected Barley (M. padawan, M. sarawak and G. boninense) In this study, the root system of oil palm seedlings was selected as the target area for introducing M. padawan and M. sarawak into the tissues of oil palm as root to root contact is a major area where the BSR disease spreads (Turner, 1981; Khairuddin, 1993; Hasan & Turner, 1998 and Rees et al. 2009). Barley grain was selected as a carrier to introduce M. padawan or M. sarawak to the root system of oil palms as their viability on the barley could be prolonged to 3 years at 250C. Barley grains infected with M.albus has shown success in supporting the growth of kale as well as controlling the pathogenic fungus, Phythium ultimum that caused root rot in kale (Worapong & Strobel, 2009).

The infected barley grains used in this study were prepared as follows: (i) 250g barley grains were washed thrice with deionized water and placed into a 500ml container (ii) The container containing the barley was autoclaved thrice at 1210C for 15 minutes, (iii) 15 agar plugs from 10-day-old M. padawan or M. sarawak culture was cut and transferred into the container containing the sterilized barley, (iv) The inoculated container was incubated at 250C, until the grains were fully covered by mycelia. During the incubation period, the container was shaken every 10 days to detach the barley grains that were attached together by the mycelia. Similar procedures were applied in preparing infected barley of G. boninense except the agar plug was cut from a 7-day-old G. boninense culture.

(b) Preparation of Oil Palm Seedlings In oil palm plantations, it is common practice to plant oil palm seedlings that are 6 to 12 months old. In this experiment, we used 1-month and 6-month old seedlings with 20 replicates per treatment. One month old seedlings were selected because at this stage, a low number of endophytic fungi grow inside them. These were compared to 6-month old seedlings. One month old seedlings were obtained by growing a germinated seed that was bought from Sarawak Plantation Agriculture Development (SPAD), on sterilized soil for 30 days. The sterilized soil was prepared by mixing topsoil, coco peat and sand in the ratio of 3:2:1 and aliquot into 200g per bag before autoclaving thrice at 1210C for 15 minutes.

After 30 days, the seedling with 1-2 leaflets was uprooted and re-planted into a new pot containing sterilized soil mixed with 2g of infected barley of M. padawan or M. sarawak. The seedling was incubated at room temperature (28 ± 20C), and exposed alternately to light for 12 hours and watered daily until day 30. The pots with different treatments were placed on a different rack that was at least 1m away from each other to prevent cross contamination. Twenty pots of oil palm seedlings that have been exposed to barley grains infected with either M. padawan or M. sarawak for 30 days were examined. After the oil palm seedlings were uprooted, their height from tip to bole, number of leaflet production, disease symptoms and their viability were measured before being replanted into the same pot and then exposed to G. boninense.

The physical examination was adapted from Worapong & Strobel (2009). The height was measured from the leaf tips to the base of the stem. The number of completely open leaflets was also counted and browning on the leaves or whole part of the seedling recorded as an indication of disease symptoms. The viability of the seedlings was noted by observing new root formation and the occurrence of discoloration.

After physical examination, the seedling was re-planted back in the same pot and the same soil. The control seedlings were incubated in the same conditions as seedlings treated with M. padawan and M. sarawak. After 30 days of exposure to G. boninense, M. padawan or M. sarawak-treated seedling was uprooted for physical examination using the similar characteristics as described in the previous paragraph. The seedlings were also separated into three parts which was the root, bole, and leaves to test for the presence of M. padawan, M. sarawak and G. boninense inside the internal tissue of treated and untreated seedlings using endophytic fungi isolation and molecular methods.

In endophytic fungi isolation, the seedling segments were surface sterilized using 0.8% commercial Clorox and 70% ethanol. The sterilized segments from seedlings that were exposed to M. padawan was placed onto PDA media and inverted over a Petri dish that contained a 10-day-old M. padawan. The two plates was double sealed with two layers of parafilm and incubated at 250C for 15 days. Triplicates were prepared per part of each treated and untreated seedlings. The plates were examined for any fungi that grew out from the sterilized segment after 7 days, up to 15 days of incubation as M. padawan was a slow growing

fungus with whitish mycelia. Fungi that grew out from the sterilized segments with whitish mycelia after 7 days, was picked and transferred onto new PDA media. The identity of that fungus was examined by comparing the growth pattern and hyphal structure with the original M. padawan. Similar procedures were adapted to examine for the presence of M. sarawak in the sterilized segments from seedling that were treated with M. sarawak.

The DNA molecular method was adapted to detect for the presence of the test strains in the oil palm seedlings. The plant parts were washed with deionized water thrice and cut into approximately 0.5mm of internal tissue from every parts. Crude DNA was extracted from the internal tissues using the freeze-thaw method as described by Muramatsu et al., 2003. The tissues were placed into 96 well plates containing 50ul Tris-EDTA solution. The plate containing the plant a tissue was then deep frozen at -800C for 24 hours. The plate was thawed at room temperature for 15 minutes and the solution in the 96 well plates was used as crude DNA. Then crude DNA was amplified following the same procedures as stated in Chapter 2, section 2.2.7.2 with the following modifications. Bands within the size range of 600-700bp were cut from the agarose and purified using GE Healthcare PCR purification kit according to the manufacturer’s instructions. The purified DNA was stored at -200C until required. The purified DNA was ethanol precipitated and sequenced using the same procedure as stated in Chapter 2, section 2.2.7.2. The sequences obtained were aligned together with sequences of M. padawan and M. sarawak to determine the identity of the fungi DNA isolated. The sequences were also searched against the GenBank database using BlastN.

This was repeated for the six month old oil palm seedlings obtained from Igan plantation in Sarawak. The seedlings were planted in pots containing 500g of soil that had been mixed with 5g of barley grains infected with either M. padawan or M. sarawak. The seedlings were placed in an open space environment to mimic nursery conditions and the seedlings were watered daily. After 30 days of exposure to M. padawan and M. sarawak, the seedlings were uprooted and their physical appearances were examined using similar procedures as for a month old oil palm seedling. Then, the seedling was re-planted into the same pot contained the same soil. The seedling was placed in the same position and incubated for 90 days with daily watering. After 90 days of exposure to G. boninense the physical appearance of the oil palm seedlings were examined as described for a month old oil palm seedlings.

The seedlings were separated into 3 parts which was root; bole and leaves to examine for the presence of the test fungus; M. padawan, M. sarawak and G. boninense inside the internal tissue of treated and untreated seedlings using the methods as described in the protocol for endophytic isolation and molecular biology methods for a month old oil palm seedling.

5.2.4 Statistical analysis

The data were analyzed and plotted using Statistical Package for the Social Sciences (SPSS) version 17.0 (SPSS Science Inc., IL) and Excel software (Microsoft, Redmond, WA). To test the significance of the exposure studies, One way ANOVA with Tukey’s HSD test was performed with the replicated data. The test determine if there are significant differences between two datasets: the control and VOC exposed cultures. For each experiment, ten replicate plates, with two independent experiments, for a total of 30 plates. For vegetative plant exposure, 20 plants were used. There were three independent experiments for each experiment, for a total of 60 plants

5.3 Results and Discussions

In this chapter, the efficiency of Muscodor padawan and Muscodor sarawak as biological control agents against G. boninense was evaluated. The main aim in this chapter was to establish M. padawan and M. sarawak in the internal tissues of the host plant without causing a negative impact on the host plants. This would permit potential utilization of M. padawan and M. sarawak as biocontrol agents to prevent G. boninense from infecting the oil palm seedling. Oil palm seedling was used as a model to demonstrate the effect of volatile and non- volatile chemicals produced by M. padawan and M. sarawak towards their growth, as well as to prevent G. boninense from infecting the oil palm seedling. The root system of oil palm seedling was the main area to be protected by M. padawan and M. sarawak as that area was the point to be infected by G. boninense in Basal Stem Rot (BSR).

Prior to that, the capability of barley grains infected with M. padawan and M. sarawak, in producing volatile and non-volatile anti-Ganoderma chemicals was evaluated using a dual plate assay system. Confirming this was important to increase the chances of M. padawan and

M. sarawak to perform similar to the in vitro result. M. padawan and M. sarawak that were capable of producing anti-Ganoderma chemicals will be used as inoculum to introduce these fungi into the internal tissue of oil palm seedling.

5.3.1 In-vitro Screening on the Capability of Barley infected with Muscodor padawan and Muscodor sarawak in Producing Volatile Anti-Ganoderma Chemicals, Using a Double Plate Assay System

The result described in Chapter 2 showed that barley infected with Muscodor padawan and Muscodor sarawak had the capability to control G. boninense as well as prolonging their active life. Due to that, barley was selected in this study as a carrier for introducing M. padawan and M. sarawak into the root system of palm oil seedlings. Prior to that stage, an experiment to confirm that the M. padawan and M. sarawak growing on the barley grains used in the in vivo (greenhouse pot assay) was capable of producing volatile and non-volatile chemicals which were able to kill G. boninense were conducted. The efficiency of the strains in producing volatiles chemicals for controlling the G. boninense in plate assay system was performed by exposing agar plugs of G. boninense inoculated in separate plates with a layer of infested barley plated in 90 cm Petri dish similar to the double plate assay concept.

The capability of M. padawan and M. sarawak in producing anti-Ganoderma chemicals was determined by comparing the growth rate of G. boninense that have been exposed to the barley grains infected with M. padawan or M. sarawak and control plate without infected barley. According to Pegler, (1931), in normal condition at 250C, the diameter of a colony of G. boninense was in the range of 5 cm to 7 cm after 5 days, with new hyphal growth from the agar plug on day three of incubation. However, in this study, G. boninense that has been exposed to the infected barley grains did not show any occurrence of new hyphal growth out of the agar plug after three days of incubation. According to the time course study described in Chapter 4, the peak period for M. padawan and M. sarawak to completely kill G. boninense was on day 5 and 7, respectively. Due to that, the evaluation on growth rate of G. boninense in this study was prolonged to 7 days even though on day 3, there was no growth of new hyphae. The final evaluation of the growth of G. boninense was measured and observed after 7 days of being exposed to the infected barley grains carrying the Muscodor fungi. The results showed similar condition as observed on day 3 which was no new hyphae growth from agar plug of G.

boninense, indicating that volatile chemicals produced by M. padawan and M. sarawak in plate environment were able to kill the G. boninense (Figure 27).

In order to validate that the volatile chemicals produced by M. padawan or M. sarawak caused death to G. boninense, a viability test of G. boninense that had been exposed to infected barley grains (M. padawan or M. sarawak) was performed. An agar plug of G. boninense that had been exposed to M. padawan or M. sarawak was transferred onto new Potato Dextrose Agar (PDA) media to observe the ability of G. boninense to resume their growth upon removal from exposure to the test fungi. No new hyphae grew out from the agar plug after 7 days of incubation at 250C. The incubation period was prolonged up to 15 days as further confirmation on the viability of G. boninense. There was no new growth observed even after this length of incubation. This showed that the agar plug of G. boninense which contained the active mycelia was killed by the volatile chemicals produced in plate environment by M. padawan and M. sarawak that had colonized the barley (Table 11).

Figure 27: Evaluation of capability of M. padawan on barley grains to produce anti-ganoderma VOC. (a) A layer of infected barley of M. padawan (b) G. boninense was dead after 5 days of exposure to the infected barley of M. padawan (c) Control plate: A 5-day-old G. boninense incubated at 250C on PDA media.

Table 11: Effect of 5 days exposure to volatile chemicals produced by M. padawan and M. sarawak on barley grains, towards the growth of G. boninense.

Strain The percentage of inhibition on radial growth (PIRG) of G. boninense M. padawan 100.00 ± 0.00b M. sarawak 100.00 ± 0.00b Control 0.00 ± 0.00a Each value is the mean of PIRG ± standard error of ten replicates from each tested strain. Different letters indicate a significant difference according to One-Way ANOVA with Tukey’s HSD test (P<0.05)

5.3.2 In vitro Screening on the Capability of M. padawan and M. sarawak in Producing Non-Volatile Anti-Ganoderma Chemicals, Using a Dual Culture Assay System Non-volatile chemicals might also be produced by M. padawan and M. sarawak which would diffuse into the media. The diffused chemicals might directly be in contact with G. boninense thus contributing to the killing activity; in vivo study soil will be used as media. In order to verify the presence of non-volatile chemicals produced by M. padawan and M. sarawak, a dual culture assay was performed and G. boninense was inoculated on the same media with either M. padawan or M. sarawak. Then, the growth of G. boninense was measured and compared with the control plate which is G. boninense without the test fungi. In this study, G. boninense incubated together M. sarawak at 250C for five days showed perfect score in which all 10 replicates of plate assay shown the consistent killing of G. boninense (Figure 28). In order to verify that the G. boninense was indeed dead and not just inhibited by the non-volatile chemicals produced by M. sarawak, a viability test was performed by transferring agar plugs of G. boninense that have been grown together with M. sarawak onto new PDA plates. The result indicated G. boninense was dead as no new hyphae were observed even though the incubation periods at 250C was prolonged up to 15 days (Table 11). This dual culture assay showed M. sarawak has the potential to become a curative agent for BSR as this fungus is capable of killing G. boninense in vitro. In comparison with the current biological control agents; T. harzianum, Hendersonia, Burkholderia, Pseudomonas and Streptomyces that have been adapted for controlling infection of G. boninense in oil palm seedling, these were only effective in supressing the growth of G. boninense (Shamala & Idris, 2009; Shariffah Muzaimah et al., 2012; Maizatul et al., 2012; Nasyaruddin et al., 2011; Nurrashyeda et al., 2011 and Idris et al., 2010; 2012).

A different result was obtained from M. padawan whereby selective pressure in the replicates was observed. Of the 10 replicates studied, 60% or 6 plates showed the capacity to kill G. boninense in dual culture assay (Figure 29). The remaining 40% showed that the growth of G. boninense was retarded after a challenge with M. padawan. This experiment was repeated twice and similar result was obtained. A viability test as described earlier for M. sarawak was conducted. The original agar plug of G. boninense that was inoculated next to M. padawan was transferred onto a new PDA media and the capacity of G. boninense to resume their growth was observed. The result showed that the cultures in which G. boninense was observed to be completely killed, also show similar activity in this viability assay, that is, there was no new hyphal growth from the agar plug. This meant that chemicals produced by M. padawan had diffused into the media and killed the G. boninense (Table 12). However, replicates in which G. boninense was observed to be supressed, the agar plug started to show new hyphae growth on day 5 and took 15 days to reach 9 cm radial growth inside of 7 days in normal condition at 250C on PDA media. The growth rate of that replicates was reduced by approximate half of their normal growth rate. This study showed volatile chemicals produces by M. padawan is strong or consistence against G. boninense compared to non-volatiles chemicals. Even though in certain replicates M. padawan did not fully kill the G. boninense but by inhibiting their growth also showed M. padawan produces chemicals that are capable of inhibiting, or killing G. boninense. Through this dual culture assay, M. padawan and M. sarawak was suggested to also produce non-volatile anti-Ganoderma chemicals.

a b

Figure 28: Evaluation of capability of M. sarawak to produce non-volatile anti-Ganoderma chemicals. (a) M. Sarawak (top) caused death of G. boninense on dual culture of PDA media at 15-day after incubation at 250C (b) A 15-day-old G. boninense incubated at 250C on PDA media.

Figure 29: M. padawan showed selective pressure against G. boninense in dual culture assay. (a) M. padawan (ii) caused death of G. boninense (i) on dual culture of PDA media at 15-day after incubation at 250C (b) M. padawan (ii) inhibited the growth of G. boninense (i) on dual culture of PDA media at 15-day after incubation at 250C (c) A 15-day-old G. boninense incubated at 250C on PDA media

Table 12: The inhibition of radial growth of G. boninense by M. padawan and M. sarawak observed in a dual culture assay

Strain The percentage inhibition of radial growth (PIRG) of G. boninense M. padawan 28.42 ± 8.98b M. sarawak 100.00 ± 0.00c Control 0.00 ± 0.00a Each value is the mean of PIRG ± standard error of ten replicates from each tested strain. Different letters indicate a significant difference at P<0.05 according to One-Way ANOVA with Tukey’s HSD test

5.3.3 Establishment of M. sarawak and M. padawan Inside the Tissue of Oil Palm Seedlings

In this study, M. padawan and M. sarawak were established inside the tissue of oil palm seedlings and the endophytes conveyed the added benefit of protecting the host from pathogens, like G. boninense. Section 5.3.1 showed that M. padawan and M. sarawak both produced volatile and non-volatile chemicals. The effect of volatile and non-volatile chemicals towards oil palm seedling was evaluated to ensure that there was no destructive effect towards the oil palm seedling.

The in vitro plate assay system has shown that volatile and non-volatile chemicals produced by M. padawan and M. sarawak have the capacity to inhibit and kill the G. boninense fungus. Thus far, no study has been conducted on the effects of volatile and non-volatile chemicals produced by any member of Muscodor towards the growth of oil palm seedling. This study is the first such attempt to generate new knowledge on the Muscodor spp. and their effects on oil palm seedlings. In this study, carrier (infected barley) was used to introduce the M. padawan and M. sarawak into the internal tissue of oil palm seedlings. The effects of M. padawan and M. sarawak that were delivered using the carrier method on the growth of oil palm seedling was evaluated by observing and measuring the height, leaflet production, disease symptoms (browning) and the viability of the seedlings.

Establishment of M. padawan and M. sarawak inside the tissues of oil palm is proposed here, as an alternative method to controlling the incidence of basal stem rot (BSR) disease in early stages such as seedlings (plant materials). The approach was to generate plant seedlings that are resistant to G. boninense especially in the replanting area that having BSR disease record. In this study, two outcomes were used to examine the effects of M. padawan and M. sarawak. These were the physical appearance of one month and six month old oil palm seedlings as well as successful prevention of G. boninense from infecting the seedlings.

(a) Effect of Infected Barleys of M. padawan and M. sarawak on the Physical Appearance (Growth Rate, Disease Symptom & Viability) of a Month Old Oil Palm Seedlings Out of twenty seedlings that were treated with M. sarawak, 3 (15%) of them showed appearance of disease symptoms which was browning at the tip of the oldest leaves. Meanwhile, seedlings that were treated with M. padawan showed 90% viability after treatment with volatile and non-volatile chemicals produced by M. padawan (Table 12). Out of 20 seedlings that were treated with M. padawan, 13 (65%) of them showed appearance of disease symptoms (browning) and two of these were completely dead. The first disease symptoms on the oil palm seedlings was browning at the tip of oldest leaves after two weeks of exposure to M. padawan. The browning symptom spread to the youngest leaves, then to the stem and eventually, the entire seedling turned brownish before collapsing. A study conducted by Idris et al., (2006) also showed that disease symptoms caused by G. boninense on oil palm seedlings first developed from the oldest to the youngest leaves. In contrast, non- treated seedlings showed that 1 out of 20 had developed disease symptoms.

This result showed that, the M. padawan had deleterious effects on oil palm seedlings as compared with seedlings that were treated with M. sarawak and non-treated seedlings.

The effect of M. padawan or M. sarawak towards the height of oil palm seedlings was also evaluated. The height from the tip to the bole represented the effect of the treatments towards the growth rate of oil palm seedlings. In this study, the height from the tip to the bole, was not significantly different between seedlings treated with M. sarawak and non-treated seedling (Table 12). However, seedlings treated with M. padawan showed reduction in growth rate. The average height from the tip to the bole of treated seedlings with M. padawan was 8.3 cm, which was reduced approximately 50% as compared with non-treated seedlings (Table 12). These results indicated that M. padawan had suppressive impact towards the growth rate of oil palm seedling as compared to M. sarawak and non-treated seedlings.

In leaflet production, the result showed oil palm seedlings that were treated either with M. padawan or M. sarawak did not showed significant reduction in their leaflet production. The leaflet produced by seedlings treated with M. sarawak and non-treated seedlings were three leaflets. Meanwhile, seedlings treated with M. padawan produced two leaflets. It was concluded neither M. sarawak nor M. padawan had any significant impact towards the leaflet production.

Based on the viability results, oil palm seedlings that were treated with M. sarawak and non- treated one showed 100% viability (Table 13). However, out of 20 seedlings that were treated with M. padawan, three of them were dead (the whole plant turned brown and there was no new production of roots). This suggests that M. padawan might impact the viability of oil palm seedlings.

Overall, M. sarawak treated seedlings did not affected the leaflet production, height, disease symptoms and viability as compared with non-treated oil palm seedlings. However, M. padawan showed slightly impact in reducing the number of leaflet production, height, viability and increasing the presence of disease symptoms on oil palm seedlings compared to control pots. The viable oil palm seedlings were then used to determine their efficacy in controlling G. boninense from infecting the root systems.

Table 13: Effect of M. padawan and M. sarawak treatment on physical appearance of one- month-old oil palm seedling

Treatment Height of No. of leaflet Disease Viability (%) tip to bole (cm) Symptom (%) 1 (M. sarawak) 14.1 ± 0.44b 2.85 ± 0.08b 15.00 ± 8.19b 100.00 ± 0.00b 2 (M. padawan) 8.2 ± 0.54a 2.1 ± 0.10a 65.00 ± 10.94a 90.00 ± 6.88a 3 (Control) 13.5 ± 0.48b 2.75 ± 0.10b 5.00 ± 5.00b 100.00 ± 0.00b

Each value is the mean of PIRG ± standard error of twenty replicates from each treatment. Different letters in the same column indicate a significant difference at P<0.05 according to One-Way ANOVA with Tukey’s HSD test

Figure 30: Pot trails of seedlings exposed to Muscodor. Whitish mycelium grew from infected barley and colonized the soil surface

Oil palm seedlings that had been exposed to M. sarawak and M. padawan were re-planted in the pot containing soil that has been mixed with barley grains infected with G. boninense. The seedlings were exposed to the G. boninense for 30 days before the seedlings were uprooted for examination on their physical appearance as well as for the presence of test fungus inside the internal tissue of the seedling via DNA molecular and endophytic isolation.

In the first week of incubation, all pots containing untreated oil palm seedlings showed whitish mycelia growing out from the barley grains infected with G. boninense and started to colonize the soil (Figure 30). However, this situation was not observed on the pots containing the

treated seedlings. A small sample of soil with mycelia was taken out from the pot and placed onto PDA with ampicillin. After 7-days, the growth of mycelium was observed and the identity was determined by comparing the colony growth pattern with that of G. boninense. The pattern was similar to G. boninense and the mycelium was suggested to be from the infected barley. However, after 14 days incubation, the presence of whitish fungi declined and greenish mycelia started to cover the soil. At 24 days, the soil surface in all pots containing untreated oil palm seedlings were covered by a greenish fungus, suspected to be Trichoderma spp. (Figure 31). This situation was not observed on the pots containing oil palm seedlings treated with M. sarawak. It was occasionally observed (small (10-30%) part of the soil surface) on some pots containing oil palm seedlings treated with M. padawan. It was suggested that G. boninense produced chemicals that supported the growth of Trichoderma, as no abundance of Trichoderma was observed on the pots containing M. padawan and M. sarawak -treated seedlings.

Figure 31: Pot trails of seedlings unexposed to Muscodor. Greenish mycelia covered the soil surface in the pots containing untreated oil palm seedlings

The effect of G. boninense towards treated and untreated seedlings is described in Table 14. Height and leaflet production by M. sarawak-treated seedlings did not show significant difference from untreated seedlings after 30 days of exposure to G. boninense. However disease symptoms occurrence on the M. sarawak-treated seedlings was significantly higher than untreated seedlings. In M. padawan-treated seedlings, height and leaflet production was significantly different from untreated seedlings. Occurrence of disease symptoms on M. padawan-treated seedlings was not significantly different from M. sarawak-treated seedlings. 92

Out of 18 M. padawan-treated seedlings, one of the seedlings was dead after exposure to G. boninense. In contrast with the viability result, there was no impact of G. boninense towards treated and untreated seedlings.

Table 14: Effect of G. boninense on the physical appearance of one-month-old treated and untreated oil palm seedlings

Treatment Height of No. of leaflet Disease Viability (%) tip to bole (cm) Symptom (%) M. padawan- 11.32 ± 0.99a 1.89 ± 0.18a 66.67 ± 11.43a 94.44 ± 5.56a treated seedling + G. boninense M. sarawak -treated 16.45 ± 0.83b 2.60 ± 0.11b 60.00 ± 11.24a 100.00 ± 0.00a seedling + G. boninense Untreated seedling + 17.18 ± 0.80b 2.75 ± 0.10b 35.00 ± 10.94b 100.00 ± 0.00a G. boninense

In the endophytic fungi isolation method, the occurrence of whitish hyphae with slow growth rate growing out from the sterilized parts of root, leaves and bole of seedlings treated with M. sarawak and M. padawan was examined. However, there were no whitish hyphae observed growing out from the sterilized tissue after 5 days of incubation at 250C. The incubation period was extended to 15 days but the results were still negative. Bacteria were detected in all replicates that contained root parts. In non-treated seedlings, the presence of G. boninense was not detected but there was a high presence of Trichoderma spp. observed (Figure 32). The occurrence of Trichoderma on the untreated pots might explain the observation that untreated seedlings showed lower occurrence of disease symptoms and high viability rate. According to Shamala et al., (2009), Trichoderma is a potential biological control agent that has antagonistic activity towards G. boninense. It is interesting to note from this observation, the question “Why Trichoderma, a fungus that is present ubiquitously in the environment, does not prevent the spread of BSR disease or kill G. boninense?”.

Figure 32: Abundance of greenish fungus (Trichoderma sp.) growing from the roots of untreated seedlings.

In the molecular detection approach, genomic DNA was extracted from the tissues of treated and non-treated seedlings using a deep freeze and thaw method. The crude DNA was used as template to perform PCR. The PCR products with sizes of 600-700bp were selected, purified and sequenced to obtain their identity. Three bands with the sizes stated above were obtained from seedlings treated with M. sarawak, four were obtained from M. padawan samples, and three were obtained from the non-treated seedlings. However, the sequences obtained after sequencing, did not match with M. sarawak, M. padawan or G. boninense sequences in the GenBank database.

The results and observations suggest that M. sarawak and M. padawan only grew externally in the soil surrounding the root systems of oil palm seedlings. Chemicals produced by M. padawan caused destructive impact to the oil palm seedlings by reducing the number of leaflet, height of tip to the bole and caused browning on the oldest leaves of 65% of tested seedlings. These chemicals were also effective in controlling G. boninense, as no occurrence of G. boninense was observed in the soil samples. In contrast with M. sarawak, the chemical produced showed no significant impact on treated oil palm seedlings as compared to untreated seedlings. The occurrence of G. boninense was also not detected from the soil collected from M. sarawak-treated seedling pots. This suggests that the chemicals released or diffused into the soil were effective in controlling G. boninense. It also further suggests that M. sarawak would be a better BCA candidate than M. padawan.

(a) Effect of Infected Barleys of M. padawan and M. sarawak on the Physical Appearance (Growth Rate, Disease Symptom and Viability) of Six-Month-Old Oil Palm Seedlings A six-month-old healthy oil palm seedling was used in this study and conducted in the lab to mimic the situation at nursery stage. The infected barley of M. sarawak or M. padawan was mixed with sterilized soil and a six-month-old healthy oil palm seedling was planted in the soil. After 30 days of treatment, all seedlings with 3 replicates per treatment were up-rooted and examined for their physical appearance of height, leaflet production, disease symptoms and their viability (Table 15).

Table 15: Effect of M. sarawak and M. padawan on the physical appearance of six-month-old oil palm seedlings

Height Leaflet Disease Treatment (Tip to bole) Production Symptoms (%) Viability (%) M. sarawak 27.9 ± 0.21a 3.67 ± 0.33a 33.33 ± 33.33b 100 ± 0.00a M. padawan 26.67 ± 1.42a 3.67 ± 0.33a 66.67 ± 33.33b 66.67 ± 33.33a Control 27.43 ± 1.03a 4 .00 ± 0.00a 0.00 ± 0.00a 100 ± 0.00a

Based on the results, there were no significant difference on the height, leaflet production and the viability of the treated and untreated seedlings. Disease symptoms were only detected on oil palm seedling that were treated with M. padawan and M. sarawak. It was concluded that oil palm seedlings treated with M. padawan and M. sarawak showed no statistical difference with untreated seedlings.

The treated and untreated seedlings were subjected to G. boninense treatment to test for their ability to resist infection. The treatment period was prolonged to three months as the earlier study showed that the oil palm seedlings developed the disease symptoms after three months of exposure to G. boninense (Figure 33). Based on the qualitative results, physical appearance of M. sarawak and M. padawan treated seedlings showed differences from untreated seedlings. However, statistical analysis (Table 16) described differently, which showed no significant difference on the physical appearance between treated and untreated seedlings.

Table 16: Effect of G. boninense on the physical appearance of six-month-old treated and untreated oil palm seedlings

Height Leaflet Disease Treatment (Tip to bole) Production Symptoms (%) Viability (%) M. padawan- treated seedling + G. boninense 22.53 + 11.60a 2.33 ± 1.20a 66.67 ± 33.33a 66.67 ± 33.33a M. sarawak - treated seedling + G. boninense 18.83 ± 9.24a 2.33 ± 1.20a 66.67 ± 33.33a 66.67 ± 33.33a Untreated seedling + G. boninense 9.83 ± 9.83a 1.33 ± 1.33a 66.67 ± 33.33a 33.33± 33.33a

a b c

Figure 33: Survivability of treated seedlings upon exposure to G. boninense. (a) Out of three untreated seedling, one replicate survived and two replicates were dead after exposure to G. boninense. Muscodor sarawak -treated seedlings (b) M. padawan-treated seedlings (c) showed two replicates survived after treatment with G. boninense and the other one was dead

After the physical appearances examination, the seedling was separated into 3 parts; root, bole and leaves for endophytic isolation and DNA molecular. In endophytic fungi isolation, no occurrence of white fungus with slow growth was observed from the root, bole and leaves sample of treated and untreated seedlings. However, root parts were mostly colonized by bacteria and the upper parts (bole and leaves) were colonized by bacteria and fast growing fungus, suspected to be Pestalotiopsis spp. It was concluded that G. boninense failed to infect the oil palm seedlings. This result suggests that M. sarawak and M. padawan act externally by releasing anti-Ganoderma chemicals into the soil and the air, killing the G. boninense.

5.4 Conclusion

Muscodor padawan and Muscodor sarawak produced volatile and non-volatile anti- Ganoderma chemicals in the plate assay system. They could be considered as strong antagonistic fungi to G. boninense in vitro (double plate and dual culture assay) especially M. sarawak. However, in greenhouse studies (pot assay system) using oil palm seedlings especially one month old seedlings, M. padawan showed destructive impact towards the height, leaflet production and disease symptoms even though the rate of viability did not show significant differences as compared with M. sarawak and untreated seedlings. In contrast with M. sarawak, the seedlings were not significantly different from the untreated seedlings. Thus, M. sarawak is recommended over M. padawan, as a potential biological control agent in oil palm industry especially in the nursery stage. However, the endophytic isolation and DNA isolation results did not support M. padawan and M. sarawak as the endophytic fungi that supported the oil palm seedlings from G. boninense infection due to (1) no slow growing white mycelium was observed coming out from the sterilized tissue of seedlings that were treated with M. padawan, or M. sarawak (2) DNA sequence obtained from samples suspected to be M. padawan, or M. sarawak did not match or align with DNA sequences of M. padawan or M. sarawak. Ganoderma boninense that was mixed with the soil that had been treated or untreated with M. padawan or M. sarawak was also not detected in soil isolation. This suggests that the chemicals produced by M. padawan or M. sarawak into the soil caused the death of G. boninense and supressed the growth of Trichoderma sp. that was found to cover the soil surface of untreated seedlings. The presence of Trichoderma sp. after two weeks in control seedlings treated with G. boninense becomes questionable as this situation was not observed in other treated seedlings. It was thus concluded that M. padawan or M. sarawak was not successfully established inside the internal tissue of oil palm seedlings, but they acted externally to kill off G. boninense by secreting chemicals into the soil.

Chapter 6

General Summary and Recommendations

6.1 Aim of the thesis

The thesis presents data from our work to explore the biodiversity of Sarawak to isolate indigenous species of Muscodor, from the jungles of Sarawak, Malaysia. Studies by Prof. Dr. Strobel and other researchers have found that endophytic fungi from the newly described genus, Muscodor showed the ability to completely kill (100% inhibition) certain soil borne fungi including those from the group of Basidiomycete (Worapong et al., 2001; 2002; Ezra & Strobel, 2003; Daisy et al., 2002; Gonzalez et. al., 2009; Suwannarach et al., 2010; 2013; Mitchell et al., 2010; Zhang et al., 2010; Kudalkar et al., 2011; Meshram et al., 2012 and Saxena et al., 2014). This gave the inspiration to search for local isolates of Muscodor spp., from the jungles of Sarawak, Malaysia. Prior to this study, there were no records of Muscodor occurrence in Sarawak, this thesis is thus, a first report on the strategy to isolate Muscodor from Sarawak resources as well as the potential development of the isolates as BCA against G. boninense. This chapter summarises the findings of this thesis and offers recommendation for future work in this area.

6.2 Enrichment and Isolation

A screening and isolation method designed based on exposure to VOC produced by M. albus resulted in successful isolation of 10 fungi. It was concluded that, these 10 fungi were also producing volatile chemicals similar to M. albus. This also suggested that the method adapted in this study was successful in the screening for endophytic fungi that produces volatile chemicals. All 10 isolates were obtained from the host plant, Cinnamomum javanicum.

6.3 Taxonomy and Characterization

The identity of the Muscodor-like isolates was determined to belong to the Muscodor group with 96-99% sequence similarity to existing sequences of Muscodor spp. in the GenBank database. Two isolates, L3R3a and L5R1c, exhibited potential to be further developed as biological control agents (BCAs). Since the results collected from morphological structures and DNA sequence analysis suggested that these two isolates did not match with any member in the Muscodor group, we determined that the isolates are new species and proposed the names Muscodor padawan and Muscodor sarawak.

6.4 Volatile Chemicals Composition

Isolate M. padawan that was grown on barley grain produced a light sweet fruit odour. GC/MS-SPME analysis showed 3-Octanone was detected in all range of incubation period (day 1 to 18), either as a major compound or in the top three range of major compounds. M. sarawak produced a musty odour that was lighter than M. albus (Strobel et al., 2001). In the analysis of volatile chemical produced by M. sarawak, azulene was found to be the major compound at the early stage (incubation up to 6 days) and delta-Panasinsine at the late stages of incubation (7 to 18 days).

6.5 Key Factors that Affect Volatile Chemicals Production

In this study M. padawan and M. sarawak produces secondary metabolite (VOC) at the same time during the growth phase but the effect towards G. boninense was lesser or only inhibitory to growth.

Nutrient and environment factors (temperature and pH) influenced the effectiveness of M. padawan in producing anti-Ganoderma compound capable of killing G. boninense. The anti- Ganoderma compound produced by isolate M. padawan that was grown on media containing rich sucrose (OEA) and glucose (PDA) showed the capability to kill G. boninense. This was not the case when MEA and CMA were used. However, the productivity and volatile chemicals

produced by M. sarawak was not influenced by nutrient factors as they showed consistent bioactivity towards G. boninense when grown on different media.

Muscodor padawan produces volatile chemical that can kill G. boninense when grown at temperature 250C and at pH condition of 5 and 9. However, in M. sarawak the bioactivity was not influenced by pH condition but partially affected by temperature. Muscodor sarawak that was grown at different pH did not show any significant difference in their ability to kill, but were only able to inhibit the growth of G. boninense when grown at 350C.

Muscodor padawan was able to produce the VOC earlier, on day 5 as compared to M. Sarawak (on day 7), however, nutritional and environment conditions; pH and temperature greatly influenced the capability of M. padawan to produce these VOCs that could kill G. boninense.

6.6 Development of a Biocontrol Agent

This thesis proposes the use of biofumigant agent as a new approach in handling G. boninense infection in the oil palm industry. Data obtained from in vivo studies conducted on young oil palm seedlings concluded that the endophytes, M. padawan and M. sarawak were able to produce both volatiles and non-volatile organic compounds that can kill or inhibit the growth of G. boninense, thus preventing it from infecting the root systems of palms and causing BSR disease.

6.7 Future Directions and Recommendations

The findings from this thesis suggest that M. padawan and M. sarawak have the potential to be developed as biological control agent for G. boninense. Future work involving these two isolates may involve the production of resistant materials using manipulation of interaction between endophytic fungi and host plant. This is a promising alternative method to overcome G. boninense infection. By establishing M. padawan and M. sarawak inside the tissue of oil palm seedlings, these fungi will protect the oil palms from being invaded by G. boninense. The idea was to inoculate the calluses of oil palm with mycelium suspension of M. padawan and M.

100

sarawak. However as the time needed to prepare calluses took more than 3 months, the process to establish M. padawan and M. sarawak in the tissues was stopped due to time limitation to finish this project. Through this idea, oil palm seedlings containing M. padawan and M. sarawak might be able to resist G. boninense infection throughout their lifespan.

This approach has clear benefits to the oil palm industries as G. boninense is the major causal agent of BSR. Generating a clone of an oil palm harbouring an endophyte which is able to protect the palm from being infected by the fungi would substantially reduce cost and increase yield to the plantations.

The application of this newly discovered biofumigant agent could be expanded to other pre and post plant disease problems in the horticultural and agricultural industry. The isolated Muscodor strains described in this thesis may hold a lot of potential in the field of fungal biocontrol and this thesis can serve as a useful reference resource to the oil palm industries, researchers, and marketers.

101

Appendix 1: List of plants collected from Padawan and Bako National Park (BNP)

Sample Plant Name Plant Family Location GPS DBH Height (cm) (cm) L01 Cinnamomum Lauraceae Padawan N 01023.451 9 420 javanicum E 110019.273 L02 Cinnamomum Lauraceae Padawan N01023.433 10 510 javanicum E 110019.321 L03 Cinnamomum Lauraceae Padawan N 01023.466 5 150 javanicum E 110019.331 L04 Cinnamomum Lauraceae Padawan N01023.459 8 510 javanicum E 110019.352 L05 Cinnamomum Lauraceae Padawan N 01023.458 5.5 340 javanicum E 110019.362 L06 Actinodaphne Lauraceae BNP N 0143.258 4.5 10 sesquipedalis E 110026.842 L07 Myristica Myristicaceae BNP N 01043.283 8 160 fragrans E110026.852 L08 Cinnamomum Lauraceae BNP N 01043.333 2 150 zeylanicum. E110026.903 L09 Cinnamomum Lauraceae BNP N 01043.358 2 150 zeylanicum E110026.963 L10 Cinnamomum Lauraceae BNP N 01043.375 1 93 cassia E 110027.224 L11 Cinnamomum Lauraceae BNP N 01043.399 4.5 320 javanicum E 110027.233 L12 Horsfieldia Myristicaceae BNP N 01043.258 50 240 paucinervis E 110026.842 L13 Nephelium Sapindaceae BNP N 01043.453 13 300 lappaceum E 110027.409 L14 Cinnamomum Lauraceae BNP N 01043.512 2 80 javanicum E110027.418 L15 Cinnamomum Lauraceae BNP N 01043.651 3 120 javanicum E 110027.460 L16 Cinnamomum Lauraceae BNP N 01043.816 2.5 280 javanicum E 110027.120 L17 Cinnamomum Lauraceae BNP N 01042.895 2 80 javanicum E 110026.613 L18 Cinnamomum Lauraceae BNP N 01042.896 16 650 javanicum E 110026.613 L19 Myristica Myristicaceae BNP N 01042.850 7 320 fragrans E 110026.631 L20 Actinodaphne Lauraceae BNP N 01042.805 13 320 sesquipedalis E110026.648 L21 Myristica Myristicaceae BNP N 01042.691 27 800 cinnamomea E 110026.697

102 Sample Plant Name Plant Family Location GPS DBH Height (cm) (cm)

L22 Knema viridis Sapindaceae BNP N 01042.638 25 300 E 110026.602 L23 Nephelium Sapindaceae BNP N 01042.571 10.7 1200 lappaceum E 110026.686 L24 Myristica Myristicaceae BNP N 01042.671 3 80 fragrans E 110026.678 L25 Nephelium Sapindaceae BNP N 01042.789 4.5 320 lappaceum E 110026.662 L26 Cinnamomum Lauraceae BNP N 01042.497 2.5 200 javanicum E 110026.777 L27 Cinnamomum Lauraceae BNP N 01042.461 1 100 cassia E 110026.790 L28 Cinnamomum Lauraceae BNP N 01042.416 1 120 cassia E 110026.797 L29 Cinnamomum Lauraceae BNP N 01042.406 1 150 javanicum E 110026.801 L30 Cinnamomum Lauraceae BNP N 01042.379 1.5 120 javanicum E 110026.812 L31 Cinnamomum Lauraceae BNP N 01042.801 3 75 javanicum E 110026.812 L32 Actinodaphne Lauraceae BNP N 01042.347 3.5 230 sesquipedalis E 110026.846 L33 Cinnamomum Lauraceae BNP N 01042.358 1 120 javanicum E 110026.858 L34 Cinnamomum Lauraceae BNP N 01042.347 1 30 javanicum E 110026.884 L35 Cinnamomum Lauraceae BNP N 01042.338 3.5 320 javanicum E 110026.902 L36 Cinnamomum Lauraceae BNP N 01042.331 2.5 320 javanicum E 110026.935 L37 Cinnamomum Lauraceae BNP N 01042.505 1 245 cassia E 110027.237 L38 Cinnamomum Lauraceae BNP N 01042.739 3.5 100 javanicum E 110027.576 L39 Cinnamomum Lauraceae BNP N 01043.034 2 300 javanicum E 110027.270 L40 Myristica Myristicaceae BNP N 01044.489 34 1100 fragrans E 110030.092 L41 Myristica Myristicaceae BNP N 01044.489 23 350 fragrans E 110030.102 L42 Cinnamomum Lauraceae BNP N 01044.470 3.5 150 javanicum E 110030.107

103 Sample Plant Name Plant Family Location GPS DBH Height (cm) (cm)

L43 Nephelium Sapindaceae BNP N 01044.477 1 150 lappaceum E 110030.077 L44 Cinnamomum Lauraceae BNP N 01044.477 3 160 javanicum. E 110030.141 L45 Cinnamomum Lauraceae BNP N 01044.438 2 150 zeylanicum E 110030.158 L46 Knema viridis Myristicaceae BNP N 01044.423 15 100 E 110030.048 L47 Dimocarpus Sapindaceae BNP N 01044.438 2 150 longan E 110030.158 L48 Knema viridis Myristicaceae BNP N 01044.510 18 120 E 110030.078 L49 Nephelium Sapindaceae BNP N 01044.507 3 200 lappaceum E 110030.073 L50 Myristica Myristicaceae BNP N 01044.531 10 600 fragrans E 110030.043

104 References

Adaskaveg, J.E and Gilbertson, R.L. (1989). Cultural studies of four North American species in the Ganoderma lucidum complex with comparisons to G. lucidum and G. tsugae. Mycological Research, 92: 182-191.

Adema F, Leehouts P.W & Welzen P.C. V (1996). Sapindaceae. In Tree Flora of Sabah and Sarawak Vol. Two (Eds: Soepadmo, E., Wong, K.M. & Saw, L.G.). Ampang Press Sdn. Bhd. Kuala Lumpur, Malaysia.

Ahmad, F.B and Holdsworth, D.K. (1994). Medicinal plants of Sarawak, Malaysia, Part 1. The Kedayans. Pharmaceutical Biology, 32 (4): 384-387.

Akbar, M.H., Ahmed, O.H., Jamaluddin, A.S., Majid, N.M. N.A., Abdul-Hamid, H., Jusop, S., Hassan, A., Yusof, K.H. and Abdu, A. (2010). Differences in soil physical and chemical properties of rehabilitated and secondary forests. American Journal of Applied Sciences, 7 (9): 1200-1209.

Ariffin, D., Idris, A.S and Marzuki, A. (1996). Spread of Ganoderma boninense and vegetative compatibility studies of a single field palm isolates. In: Ariffin, D. et al., (eds) Proceedings of the 1996 PORIM International Palm Oil Congress (Agriculture), September 1996. Palm Oil Research Institute of Malaysia, Bangi, Selangor, Malaysia.pp:132-141.

Arnold, A.E., Maynard, Z., Gilbert, G.S., Coley, P.D. and Kursar, T.A. (2000). Are tropical endophytic fungi hyper diverse. Ecology Letter, 3: 267-274.

Arnold, A.E., Maynard, Z and Gilbert, G.S. (2001). Fungal endophytes in dicotyledonous neotropical trees: pattern of abundance and diversity. Mycological Research, 105: 1502-1507.

Arnold, A.E and Herre, E.A (2003). Canopy cover and leaf age affect colonization by tropical fungal endophytes: ecological pattern and process in Theobroma cacao (Malvaceae). Mycologia, 95: 388-398.

105

Arnold, A.E., Mejia, L.C., Kyllo, D., Rojas, E.I., Maynard, Z., Robbins, N and Herre, E.A (2003). Fungal endophytes limit pathogen damage in a tropical tree. PNAS, Vol. 100.p. 15649-15654.

Ariffin, D., Idris, A.S. and Singh, G. (2000). Status of Ganoderma in oil palm. In: Ganoderma Diseases of Perennial crops (Flood, J., Bridge, P.D. and Holderness, M., ed.), p. 49-68. United Kingdom, CABI Publishing.

Arif, M.S., Roslan, A. and Idris, A.S. (2011). Economics of oil palm pests and Ganoderma disease and yield losses. Proceedings of the third MPOB-IOPRI International Seminar: Integrated Oil Palm Pests and Diseases Management. Kuala Lumpur Convention Centre: 14 November 2011.

Atmosukarto, I., Castillo, U., Hess, W.M., Sears, J and Strobel, G.A. (2005). Isolation and characterization of Muscodor albus I-41.3s, a volatile antibiotic producing fungus. Plant Science, 169: 854-861.

Bacon, C.W and White, J.F. (2000). Microbial endophytes. New York: Marcel Dekker

Bai, Y., Aoust, F., Smith, D., Driscoll, B. (2002). Isolation of plant growth promoting Bacillus strains from soybean root nodules. Canadian Journal Microbiology, 48: 230-238.

Baldauf, S.L. (2003). Phylogeny for the paint of heart: a tutorial. TRENDS in Genetics, 19 (6): 345-351.

Bernicchia, A., Savino, E. and Gorjon, S.P. (2007). Aphyllophoraceous wood-inhibating fungi on Pinus spp. in Italy. Mycotaxon, 101: 5-8.

Boyle, C., Gotz, M., Dammann-Tugend, U and Schulz, B. (2001). Endophyte-host interactions III. Local vs. systemic colonization. Symbiosis, 31:259-281.

Cheong, Y.L., Burkart, K., Leitao, P.J. and Lakes, T. (2013). Assessing weather effects on dengue disease in Malaysia. International Journal of Environmental Research and Public Health, 10: 6319-6334.

106

Corner, E.J.H. (1932). The fruitbody of Polystictuc xanthopus Fr. Annals of Botany, 46:71-111.

Corner, E.J.H. (1983). Ad Polyporaceae I. Amauroderma and Ganoderma. Nova Hedwigia, 75: 1-182.

Daisy, B., Strobel, G.A., Castillo, U., Ezra, D., Sear, J., Weaver, D.K and Runyon, J.B. (2002). Naphtalene, an insect repellent, is produced by Muscodor vitigenus, a novel endophytic fungus. Microbiology, 148: 3737-3741.

Dix, N.J and Webster, J. (1995). Fungal Ecology. Chapman and Hall, London, pp. 1-60.

Dreyfuss, M.M and Chapela, I.H (1994). Potential of fungi in the discovery of novel, low- molecular weight pharmaceuticals. p. 49-80. In V.P. Gullo (ed.), the discovery of natural products with therapeutic potential. Butterworth- Heinemann. London.

Drenth, A and Sendall, B (2004). Economic Impact of Phytophthora Diseases in Southeast Asia. In: Diversity and Management of Phytophthora in Southeast Asia (Eds. Drenth, A. & Guest, D.I. (2004). ACIAR Monograph 114. BPA Print Group PTY Ltd, Melbourne, Australia.p.10-28.

Drenth, A and Guest, D.I. (2004). Phytophpthora in the Tropics. In: Diversity and Management of Phytophthora in Southeast Asia (Eds. Drenth, A. & Guest, D.I. (2004). ACIAR Monograph 114. BPA Print Group PTY Ltd, Melbourne, Australia.p.10-28.

Dompeipen, E. J., Srikandace, Y., Suharso, W. P., Cahyana, H. and Simanjuntak, P. (2011). Potential Endophytic Microbes Selection for Antidiabetic Bioactive Compounds Production. Asian Journal of Biochemistry, 6: 465-471.

Ezra, D and Strobel, G.A. (2003). Effect of substrate on the bioactivity of volatile antimicrobials produced by Muscodor albus. Plant Science, 165: 1229 -1238.

Ezra, D., Hess, W.M and Strobel, G.A. (2004). New endophytic isolates of Muscodor albus, a volatile-antibiotic-producing fungus. Microbiology, 150: 4023-4031.

107

Farid, M.A., Lee, S.S., Maziah, Z., Rosli, H and Norwati, M. (2005). Basal root rot, a new disease of Teak (Tectona grandis) in Malaysia caused by Phellinus noxius. Malaysian Journal of Microbiology, 1(2): 40-45.

Firakova, S., Sturdikova, M. and Muckova, M. (2007). Bioactive secondary metabolites produced by microorganisms associated with plants. Biologia, 62: 251-257.

Flood, J., Hasan, Y., Turner, P.D. and O’Grady, E.B. (2000). The spread of Ganoderma from infective sources in the field and its implications for management of the disease in oil palm. In: Ganoderma Diseases of Perennial crops (Flood, J., Bridge, P.D. and Holderness, M., ed.), p. 104- 112. United Kingdom, CABI Publishing.

Gilberston, R.L. and Adaskaveg, J. E. (1993). Studies on wood-rotting basidiomycetes of Hawaii. Mycotaxon, Vol XLIX: 369-397.

Hallman, J., Quadt-Hallmann, A., Mahaffee, W.F and Kloepper, J.W. (1997). Bacterial endophytes in agricultural crops. Canadian Journal Microbiology, 43: 895-914.

Hasan, Y and Turner, P.D. (1998). The comparative importance of different oil palm tissues as infection sources for basal stem rot in replantings. The Planter, 74: 119-135.

Hawksworth, D.L. and Rossman, A.Y (1997). Where are all the undescribed fungi? Phytopathology. Vol. 89. No.9.p. 888-891.

Hawksworth, D.L (2001). The magnitude of fungal diversity: the 1.5 million species estimate revisited. Mycological Research, 105: 1422-1432.

Ho, Y.W and Nawawi, A. (1985). Ganoderma boninense Pat. From basal stem rot of oil palm in Peninsular Malaysia. Pertanika, 8: 425-428.

Ingold, C.T. (2002). A love affair with giant polypores. Mycologist, 16: 162-164.

108

Forest Department Sarawak, 2013. Fact and Figures. (www. http://www.forestry.sarawak.gov.my/modules/web/pages.php.)

Freire, E.S., Pinho, R.S.C., Oliveira, D.F., Faria, M.R., Pohlit, A.M., Noberto, N.P., Rezende, E.L., Pfenning, L.H and Silva, J.V.C. (2012). Volatiles substances produced by Fusarium oxysporum from coffee rhizosphere and other microbe affect Meloidogyne incognita and Arthrobotrys conoides. The Journal of Nematology, 44 (4): 321-328.

Gabler, F.M., Fassel, R., Mercier, J and Smillanick, J.L. (2006). Influence of temperature, inoculation interval, and dosage on biofumigation with Muscodor albus to control postharvest Gray Mold on grapes. Plant disease, 90 (8): 1019-1025.

Griffin, M.A., Spakowicz, D.J., Gianoulis, T.A and Strobel, G.A. (2010). Volatile organic compound production by organisms in the genus Ascocoryne and a re-evaluation of myco- diesel production by NRRL 50072. Microbiology, 156: 3814-3829.

Gomori, G. (1955). Preparation of buffers for use in enzyme studies. In Methods of Enzymology (S.P. Colowick & Caplan, N.O., eds): 138-146. Academic Press, New York.

González, M. C., Anaya, A. L., Glenn, A. E., Macías-Rubalcava, M. L., Hernández-Bautista, B. E. and Hanlin, R. T (2009). Muscodor yucatanensis, a new endophytic ascomycete from Mexican chakah, Bursera simaruba. Mycotaxon, 110 (10): 363-372.

Hazalin, N.A.M.N., Ramasamy, K., Lim, S.M., Wahab, I.A., Cole, A. L.J., Abdul Majeed, A. B. (2009). Cytotoxic and antibacterial activities of endophytic fungi isolated from plants at the National Park, Pahang, Malaysia. BMC Complementary and Alternative Medicine 2009, 9:46

Hazalin, N.A.M.N., Ramasamy, K., Lim, S.M., (2012). Induction of apoptosis against cancer cell lines by four ascomycetes (endophytes) from Malaysian rainforest. Phytomedicine, 19 (7): 609- 617.

109

Idris, A.S., Ariffin, D., Swinburne, T.R and Watt, T.A. (2000). The identity of Ganoderma species responsible for BSR disease of oil palm in Malaysia- Morphological characteristics. MPOB Information series.

Idris, A.S., Ismail, S., Ariffin, D and Ahmad, H. (2002). Control of Ganoderma-infected palms- development of pressure injection and field application. MPOB Information series.

Idris, A.S., Ismail, S., Ariffin, D and Ahmad, H. (2004). Prolonging the productive life of Ganoderma-infected palms with hexaconazole. MPOB Information series.

Idris, A.S., Ismail, S and Ariffin, D. (2005). Reducing risk of Ganoderma in supply palms. MPOB Information series.

Idris, A.S., Kushairi, D., Ariffin, D and Basri, M.W. (2006). Technique for inoculation of oil palm geminated seeds with Ganoderma. MPOB Information series.

Idris, A.S and Arifurrahman, R. (2008). Determination of 50% effective concentration (EC50) of fungicides against pathogenic Ganoderma. MPOB Information series.

Idris, A.S., Zaiton, S and Noorhaida, S. (2008). In vitro methods for evaluation of antagonistic bacteria and actinomycetes against pathogenic Ganoderma. MPOB Information series.

Idris, A.S., Azahar, T., Wahid, O., Hasnol, O and Tarmizi, A.M. (2009). Spatial pattern and hotspot analyses of Ganoderma disease in oil palm plantations using the geographical information system. MPOB Information series.

Idris, A.S., Noor Haida, S and Nur Rashyeda, R. (2010). GanoEF1-A fungal biocontrol agent for Ganoderma in oil palm. MPOB Information series.

Idris, A.S and Maizatul, S.M. (2012). Stump treatment with dazomet for controlling Ganoderma disease in oil palm. MPOB Information series.

110

Idris, A.S., Nur Rashyeda, R., Maizatul, S.M., Madihah, A.Z., Tarmizi, A.M., Kushairi, D., Wan Azha, W.M and Tong Peng, S.H. (2012). Biofertiliser Hendersonia GanoEF as biological control of Ganoderma in oil palm. MPOB Information series.

Idris, A.S., Mior, M.H.A.Z., Rusli, M.H., Wahid, O and Zulkifli, H. (2013). Effects of Planting Density on Outbreak of Ganoderma Disease. Proceedings of the 5th MPOB-IOPRI International Seminar: Sustainable Management of Pests and Diseases in Oil Palm- The Way Forward. Kuala Lumpur Convention Centre, 22 November 2013.

Jeffrey, L.S.H., Son, R. and Tosiah, S. (2008). Preliminary screening of endophytic fungi isolated from medicinal plants at MARDI Sessang, Sarawak for their bioactivity. Journal Tropical Agriculture and Fundamental Science, 36 (1):121-126.

Jelani, A.R., Hitam, A., Khalid, R., Idris, A.S., Shuib, A.R., Aminulrashid and Ismail, F. (2004). Mechanical trunk injection for control of Ganoderma. MPOB Information series.

Jennings, D.H and Lysek, G. (1996). Fungal Biology: Understanding the fungal lifestyle. United Kingdom: Bios Scientific Publishers.pp. 1-143

Jones, A.C and Ostry, M.E. (1998). Estimating white trunk rot in Aspen stands. Northern Journal of Applied Forestry, 15: 33-36.

Khairil, M.M.R. and Hasmadi, M.I. (2010). Applying GIS for mapping agriculture roads network in Felda Trolak Utara for Oil Palm Plantation Management. Information Management and Business Review, 1 (1):11-15.

Khairuddin, H. (1993). Basal stem rot of oil palm caused by Ganoderma boninense. An update, PORIM, International Palm Oil Congress, Update and vision. PORIM, Kuala Lumpur. pp: 739- 749.

Khairuddin, H. (1995). Basal stem rot of oil palm caused by Ganoderma boninense. In: 1993 PORIM, International Palm Oil Congress, Kuala Lumpur, Malaysia.

111

Kobayashi, D.Y and Palumbo, J.D. (2000). Bacterial endophytes and their effects on plants and uses in agriculture. In: Bacon, C.W and White, J.F. (Eds) Microbial endophytes. Dekker, New York, pp: 199-236.

Kogure, T., Douglas Kinghorn, A., Yan, I., Bolon, B., Lucas, D.M., Grever, M.R and Patel, T. (2013). Therapeutic potential of the translation inhibitor silvestrol in Hepatocellular cancer. PLoS One, 8 (9).

Kudalkar, P., Strobel, G.A., Hasan, S.R.U., Geary, G and Sears, J. (2012). Muscodor sutura, a novel endophytic fungus with volatile antibiotic activities. Mycoscience, 53: 319-325.

Lacey, L.A., Horton, D.R., Jones, D.C., Headrick, H.L and Neven, L.G. (2009). Efficacy of the biofumigant fungus Muscodor albus (Ascomycota: Xylariales) for control of codling moth (Lepidoptera: Tortricidae) in simulated storage condition. Journal of Economic entomology, 102(1): 43-49.

Lee, S.S. (2003). Pathology of tropical hardwood plantations in South-Eastasia. New Zealand Journal of Forestry Science, 33 (3): 321-335.

Lee, B.S and Lum, K.Y (2004). Phytophthora Diseases in Malaysia. In: Diversity and Management of Phytophthora in Southeast Asia (Eds. Drenth, A. & Guest, D.I. (2004). ACIAR Monograph, 114. BPA Print Group PTY Ltd, Melbourne, Australia.p.60-69.

Liang, H., Xing, Y., Chen, J., Zhang, D., Guo, S. and Wang, C. (2012). Antimicrobial activities of endophytic fungi isolated from Ophiopogon japonicus (Liliaceae). BMC Complementary and Alternative Medicine, 12:238

Lim, K.H and Udin, W. (2010). Management of Ganoderma in peat soil in Indonesia. Paper presented in 2010 Second International Seminar Oil Palm Diseases: Advances in Ganoderma research and management. 31 May 2010, Sheraton Hotel- Yogyakarta, Indonesia.p. 11.

Loh, H.P. (1999). The essentials of oil palm replanting: United Plantations' experience. Planter (Malaysia), 75 (879), p. 289-303.

112

Lumyong, S., Lumyong, P., Mckenzie, E.H.C and Hyde, K. (2002). Enzymatic activity of endophytic fungi of six native seedlings of Pinus resinosa on iron tailings. Canadian Journal Botanical, 66:55-60.

Maizatul, S.M., Idris, A.S., Madihah, A.Z., Nasyaruddin, M.N.M and Kushairi, A. (2012). Burkholderia GanoEB2 powder as biological control of Ganoderma in oil palm. MPOB Information series.

Mathan, S., Vasuki, S and Nagamony, S (2013). Optimization and antimicrobial metabolite production from endophytic fungi Aspergillus terreus KC582297. European Journal of Experimental Biology, 3 (4): 138-144.

Mercier, J and Manker, D.C. (2005). Biocontrol of soil-borne diseases and plant growth enhancement in greenhouse soilless mix by the volatile-producing fungus Muscodor albus. Crop protect, 24: 355-362.

Malone, S.R and Ashworth, E.N. (1991). Freezing stress response in woody tissue observed using low-temperature scanning electron microscopy and freeze substitution techniques. Plant Physiology, 98: 871-881.

Meshram, V., Kapoor, N., and Saxena, S. (2012). Muscodor strobelli, new species from South India. Mycoscience.

Meshram, V., Kapoor, N., and Saxena, S. (2013). Muscodor kashayum sp.nov. a new volatile anti-microbial producing endophytic fungus. Mycology, 4 (4): 196 – 204.

Miller, R.N.G. (1995). The characterization of Ganoderma population in oil palm cropping systems. PhD thesis, University of Reading, UK.

Mitchell, A.M., Strobel, G.A., Moore, E., Robinson, R and Sears, J. (2010). Volatile antimicrobials from Muscodor crispans, a novel endophytic fungus. Microbiology, 156: 270- 277.

113

Mucciarelli, M., Scannerini, S., Bertea, C and Maffei, M. (2003). In vitro and in vivo peppermint (Mentha piperita) growth promotion by nonmycorrhizal fungal colonization. New Phytologist, 158: 579-591.

Muhamad, I., Zainol, M., Sahid, I and Abu Seman, I. (2012). Determination of hexaconazole in field samples of an oil palm plantation. Drug testing and analysis, 4 (1):112-117.

Muramatsu, H., Shahab, N., Tsurumi, Y., and Hino, M. (2003). A comparative Study of Malaysian and Japanese Actinomycetes Using a Simple Identification Method Based on Partial MPOB Information series.

Nurrashyeda, R., Idris, A.S., Madihah, A.Z., Ramle, M and Kushairi, A. (2011). Hendersonia GanoEF1 granules for the control of Ganoderma boninense in oil palm. MPOB Information series.

Nasyaruddin, M.N., Idris, A.S., Maizatul, S.M., Madihah, A.Z and Kushairi, A. (2011). Pseudomonas GanoEB3 powder for the control of Ganoderma boninense in oil palm. MPOB Information series.

Nelson, P.N., Rhebergen, T., Berthelsen, S., Webb, M.J., Banabas, M., Oberthur, T., Donough, C.R., Rahmadsyah, Indrasuara, K and Lubis, A. (2011). Soil acidification under oil palm: rates and effects on yield. Better Crops, 95 (4): 22-25.

Ommelna, B.G., Jennifer, A.N. and Chong, K.P. (2012). The potential of chitosan in suppressing Ganoderma boninense infection in oil-palm seedlings. Journal of Sustainability Science and Management, 7 (2).p: 186-192.

Ostrofsky, A., Jellison, J., Smith, K.T and Shortle, W.C. (1997). Changes in cation concentrations in red sprude wood decayed by brown rot and white rot fungi. Canadian Journal of Forest Research, 27: 567-571.

114

Othman, A.S., Samsiah, M.S., Ishak, Z. and Russman, N. (2008). Endophytic fungi in Theobroma cacao L. leaves (clones PBC123 and KKM22). Malaysian Cocoa Journal, 4: 6-12. Petrini, O. (1991). Fungal endophytes of tree leaves. In: Andrews, J., Hirano, S. (Eds) Microbial ecology of leaves. Springer, New York Berlin Heidelberg, pp: 179-197.

Pegler, D.N. (1997). The Larger Fungi of Borneo. Natural History Publications, Kota Kinabalu, Malaysia, pp. 2-20.

Petrini, O., Sieber, T., Toti, L and Viret, O (1992). Ecology, metabolite production, and substrate utilization in endophytic fungi. Natural Toxins, 1: 185-196.

Roy, A. and De, A.B. (1996). Taxonomy of Daedalea roseola comb. Nov. Mycotaxon, LVIIII: 413- 417.

Ramasamy, S. (1972). Cross-infectivity and decay ability of Ganoderma species parasitic to rubber, oil palm and tea. Bachelor Agriculture Science, Project Report, University Malaya.

Saikkonen, K., Faeth, S.H., Helander, M and Sullivan (1998). Fungal endophytes: A continuum of interactions with host plants. Annual Review Ecology System, 29: 319-343

Saikkonen, K., Helander, M and Faeth, S.H (2004). Fungal endophytes: hitch-hikers of the green world. Plant Microbiology.p. 81-100.

Saitou, N and Nei, M. (1987). The neighbor-joining method: A new method for reconstructing phylogenetic trees. Molecular Biology and Evolution, 4: 406-425.

Sanderson, F.R., Pilotti, C.A. and Bridge, P.D. (2000). Basidiospores: Their influence on our thinking regarding a control strategy for basal stem rot of oil palm. In: Ganoderma Diseases of Perennial crops (Flood, J., Bridge, P.D. and Holderness, M., ed.), p. 113-128. United Kingdom, CABI Publishing.

Sankaran, T and Syed, R.A. (1972). The natural enemies of bagworms on oil palms in Sabah, East Malaysia. Pasific Insects, 14 (1): 57-71.

115

Sapak, Z., Meon, S and Ahmad, Z.A.M (2008). Effect of endophytic bacteria on growth and suppression of Ganoderma Infection in oil palm. International Journal of Agriculture & Biology, 10: 127- 132.

Sarawak Planning Unit (2013). The Report Sarawak 2013. Oxford Business Group, Sarawak, Malaysia.

Sariah, M. and Zakaria H. (2000). The use of soil amendments for the control of basal stem rot of oil palm seedlings. In: Ganoderma Diseases of Perennial crops (Flood, J., Bridge, P.D. and Holderness, M., ed.), p. 89-99. United Kingdom, CABI Publishing.

Saxena, S., Meshram, V and Kappor, N (2014). Muscodor tigerii sp. Nov. volatile antibiotic producing endophytic fungus from the Northeastern Himalayas. Annual Microbiology.

Schnabel, G and Mercier, J. (2006). Use of Muscodor albus pad delivery system for the management of brown rot of peach in shipping cartons. Postharvest Biology and Technology, 42: 121-123.

Schulz, B and Boyle, D. (2005). The endophytic continuum. Mycological Research, 109: 661- 687.

Schulz, B., Rommert, A.K., Dammann, U., Aust, H.J and Strack, D. (1999). The endophyte-host interaction: a balanced antagonism. Mycological Research, 103: 1275-1283.

Schulz, B., Boyle, C., Draeger, S., Rommert, A.K and Krohn, K. (2002). Endophytic fungi: a source of biologically active secondary metabolite. Mycological Research, 106: 996-1004.

Shahid, A.A., Rao, A.Q., Bakhsh, A and Husnain, T. (2012). Entomopathogenic fungi as biological controllers: New insights into their virulence and pathogenicity. Arch. Biol. Sci., Belgrade, 64 (1): 21-24.

116

Shamala, S and Idris, A.S. (2009). Assessment of arbuscular mycorrhiza (AM) as a vegetative growth enhancer for oil palm. MPOB Information series.

Shariffah Muzaimah, S.A., Idris, A.S., Madihah, A.Z and Kushairi, A. (2012). Streptomyces GanoSA1 powder as biological control of Ganoderma in oil palm. MPOB Information series.

Sieber, T.N. (2002). Fungal root endophytes. In: Waisel, Y., Eshel, A and Kafkafi, U (Eds) The hidden half. Dekker, New York.pp: 887-917.

Singh, G. (1990). Ganoderma-scourage of oil palm in the coastal area. In: Proceedings of the Ganoderma workshop, 11 september , (Ariffin, D and Jalani, S. eds). Palm oil research Institute of Malaysia, Kuala Lumpur.pp: 7-35.

Singh, G. (1991). Ganoderma-the scourage of oil palms in the coastal areas. The Planter, 67: 421-444.

Stewart A, Brownbridge M, Hill RA & Jackson TA (2009). Utilizing soil microbes for biocontrol. In Dickson CR & Tilston E eds Soil microbiology and sustainable crop production. Springer, Dordtrecht (in press)

Stinson, A.M., Zidack, N.K., Strobel, G.A. and Jacobsen, B.J. (2003). Mycofumigation with Muscodor albus and Muscodor roseus for control of seedling of sugarbeet and Verticillium wilt of eggplant. Plant Disease, 87 (11): 1349-1354.

Stone, J.K., Bacon, C.W and White, J.F. (2000). An overview of endophytic microbes: endophytism defined. In: Bacon, C.W and White, J.F. (Eds) Microbial endophytes. Dekker, New York.pp: 3-30.

Strobel, G.A., Yang, X.S., Sears, J., Kramer, R., Sidhu, R.S., Hess, W.M. (1996) Taxol from Pestalotiopsis microspora, an endophytic fungus of Taxus wallachiana. Microbiology,142:435- 440.

117

Strobel, G.A., Hess, W.M., Li, J.Y., Ford, E., Sears, J., Sidhu, R.S and Summerell, B. (1997). Pestalotiopsis guepinii, a taxol producing endophytic of the Wollemi pine, Wollemia nobilis. Australian Botanical Journal, 45: 1073-1082.

Strobel, G.A., Dirkse, E., Sears, J and Markworth, C., (2001). Volatile antimicrobials from a novel endophytic fungus. Microbiology, 147: 2943 – 2950

Strobel, G.A., Ford, E., Worapong, J., Harper, J.K., Arif, A.M., Grant, D.M., Fung, P.C.W and Chan, K. (2002). Ispoestacin, an isobenzofuranone from Pestalotiopsis microspore, possessing antifungal and antioxidant activities. Phytochemistry, 60: 179- 183. Strobel G.A., Daisy B., Castillo U and Harper J. (2003). Natural Products from Endophytic Microorganisms.

Strobel, G.A and Daisy, B. (2003). Bioprospecting for microbial endophytes and their natural products. Microbiology and Molecular Biology Review, 67: 491-502.

Sturz, A.V and Nowak, J. (2000). Endophytic communities of rhizobacteria and the strategies required to create yield enhancing associations with crops. Applied Soil Ecology, 15:183–190.

Susanto, A., Sudharto, P.S and Purba, R.Y. (2005). Enhancing biological control of basal stem rot disease (Ganoderma boninense) in oil palm plantations. Mycopathologia, 159 (1): 153-157. Tamura, K., Nei, M and Kumar, S. (2004). Prospects for inferring very large phylogenies by using the neighbor-joining method. Proceedings of the National Academy of Sciences (USA), 101: 11030-11035.

Suwannarach, N., Bussaban, B., Hyde, K. D. and Lumyong, S. (2010). Muscodor cinnamomi, a new endophytic species from Cinnamomum bejolghota. Mycotaxon, 114: 15–23.

Suwannarach, N., Kumla, J., Bussaban, B., Hyde, K. D., Matsui, K and Lumyong, S. (2013). Molecular and morphological evidence support four new species in the genus Muscodor from northern Thailand. Annual Microbiology. doi:10.1007/s13213-012-0593-6.

118

Tudzynski, B and Sharon, A. (2002). Biosynthesis, biological role and application of fungal hormones. In: Osiewacz, H.D. (Ed) The mycota X industrial applications, Springer, Berlin Heidelberg New York. Pp: 183-211.

Turner, P.D. (1965). Infection of oil palms by Ganoderma. Phytopathology, 55: 937.

Turner, P.D. (1981). Oil palm diseases and disorders. Oxford University Press, Oxford.pp: 88- 110.

Wang, C.J.K. and Zabel, R.A. (1990). Identification manual for fungi from utility poles in the Eastern United Stated.

Wahid, M.B and Simeh, M.A. (2008). Issues related to production cost of palm oil in Malaysia. Oil Palm Industry Economic Journal, 9 (2):1 -12.

Watkinson, S.C., Boddy, L., Burton, K., Darrah, P.R., Eastwood, D., Fricker, M.D and Tlalka, M. (2005). New approaches to investigating the function of mycelial networks. Mycologist, 19 (1): 11-17.

Wheatley, R., Hackett, C and Bruce, A. K. (1997). Effect of substrate composition on the production of volatile organic compounds from Trichoderma spp. inhibitory to wood decay fungi. Internation Biodeterioration & Biodegradation, 39: 199-205.

White, T.J., Bruns, T and Taylor, J.W. (1990). Amplifications and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols: A guide to methods and applications. Edited by Innis, M.A., Gelfand, D.H., Sninsky, J.J., White, T.J. Academic Press, Inc.,California: 315-324.

Wilde W.J.J.O.D (2000). Myristicaceae. In Tree Flora of Sabah and Sarawak Vol. Three (Eds: Soepadmo, E. & Saw, L.G.). Ampang Press Sdn. Bhd. Kuala Lumpur, Malaysia.

Worapong, J, Strobel, G.A., Ford, E.J., Li, J.Y., Baird, G. and Hess, W.M (2001) Muscodor albus anam. Nov. an endophyte from Cinnamomum zeylanicum. Mycotaxon 79: 67-79

119

Worapong, J., Strobel, G., Daisy, B., Castillo, U. F., Baird, G. and Hess, W.M. (2002). Muscodor roseus anam. sp. nov., an endophyte from Grevillea pteridifolia. Mycotaxon, 81: 463-475.

Worapong, J. and Strobel, G.A (2009). Biocontrol of a root rot of kale by Muscodor albus strain MFC2. Biocontrol, 54:p.301-306

World Heritage, 2000. Natural Heritage, Properties inscribed on the world heritage list (Property: Gunung Mulu National Park) in Twenty-fourth session report, WHC- 2000/CONF.204/21. Convention concerning the protection of the world cultural and Natural Heritage. Pp: 36-37.

Xiao, C.L. and Sitton, J.W. (2004). Effects of culture media and environmental factors on mycelia growth and pycnidial production of Potebniamyces pyri. Mycological Research, 108 (8): 926-932.

Yates, I., Bacon, C.W and Hinton, D.M. (1997). Effects of endophytic infection by Fusarium moniliforme on corn growth and cellular morphology. Plant Disease, 81: 723-728.

Yusof, B and Chan, K.W. (2004). The oil palm and its sustainability. Journal of Oil Palm Research, 16 (1): 1-10.

Zhang, C. L., Wang, G. P., Mao, L. J., Komon-Zelazowska, M., Yuan, Z. L., Lin, F. C., Druzhinina, I. S., Kubicek, C. P. (2010). Muscodor fengyangensis sp. nov. from southeast China: morphology, physiology and production of volatile compounds. Fungal Biology, 114(10):797-808.

Zitter, T. A., D. L. Hopkins, and C. E. Thomas (Editors). (1996). Compendium of Cucurbit Diseases. American Phytopathological Society.

Zulkifli, H., Halimah, M., Chan, K.W., Choo, Y.M and Mohd Basri, W. (2010). Life cycle assessment for oil palm fresh fruit bunch production from continued land use for oil palm planted on mineral soil (part 2). Journal of Oil Palm Research, (22): 887-894.

120