Genomic Insights of the Archaea Inhabiting an Australian
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Sorgodb: Superoxide Reductase Gene Ontology Curated Database
Lucchetti-Miganeh et al. BMC Microbiology 2011, 11:105 http://www.biomedcentral.com/1471-2180/11/105 DATABASE Open Access SORGOdb: Superoxide Reductase Gene Ontology curated DataBase Céline Lucchetti-Miganeh1*, David Goudenège1, David Thybert1,2, Gilles Salbert1 and Frédérique Barloy-Hubler1 Abstract Background: Superoxide reductases (SOR) catalyse the reduction of superoxide anions to hydrogen peroxide and are involved in the oxidative stress defences of anaerobic and facultative anaerobic organisms. Genes encoding SOR were discovered recently and suffer from annotation problems. These genes, named sor, are short and the transfer of annotations from previously characterized neelaredoxin, desulfoferrodoxin, superoxide reductase and rubredoxin oxidase has been heterogeneous. Consequently, many sor remain anonymous or mis-annotated. Description: SORGOdb is an exhaustive database of SOR that proposes a new classification based on domain architecture. SORGOdb supplies a simple user-friendly web-based database for retrieving and exploring relevant information about the proposed SOR families. The database can be queried using an organism name, a locus tag or phylogenetic criteria, and also offers sequence similarity searches using BlastP. Genes encoding SOR have been re-annotated in all available genome sequences (prokaryotic and eukaryotic (complete and in draft) genomes, updated in May 2010). Conclusions: SORGOdb contains 325 non-redundant and curated SOR, from 274 organisms. It proposes a new classification of SOR into seven different classes and allows biologists to explore and analyze sor in order to establish correlations between the class of SOR and organism phenotypes. SORGOdb is freely available at http://sorgo.genouest.org/index.php. Background (called reactive oxygen species or ROS), particularly Two and a half billion years ago, the intense photosyn- hydroxyl radicals (•OH), hydrogen peroxide (H2O2)and thetic activity of cyanobacteria caused the largest envir- superoxide anion radicals (O2-). -
ABSTRACT JI, MIKYOUNG LEE. Superoxide Reductase from The
ABSTRACT JI, MIKYOUNG LEE. Superoxide Reductase from the Hyperthermophilic Archaeon Pyrococcus furiosus: its Function, Regulation, and Biotechnological Applications. (Under the direction of Amy M. Grunden.) The anaerobic hyperthermophilic archaeon, Pyrococcus furious, possesses a system for the detoxification of reactive oxygen species, which is different from the classical defense mechanisms present in aerobes. P. furiosus employs a novel enzyme system centered on the enzyme superoxide reductase (SOR), which reduces superoxide molecules to hydrogen peroxide without producing oxygen. Surprisingly, P. furiosus SOR, unlike many P. furiosus enzymes, was shown to function at low temperature (<25o C). A model for superoxide reduction by SOR was proposed where the electrons used by SOR to reduce superoxide are supplied by a small iron containing protein, rubredoxin (Rd), and Rd is reduced by the oxidoreductase, NAD(P)H-rubredoxin oxidoreductase (NROR). The first objective of this study was to evaluate the validity of the proposed superoxide reduction pathway by using the recombinant SOR, Rd and NROR enzymes in an in vitro assay as well as to demonstrate in vivo function via complementation studies in superoxide detoxification deficient Escherichia coli strains. The second objective was to investigate the transcriptional expression levels of genes that are involved in the SOR- centered superoxide reduction pathway in order to determine how these genes are expressed and regulated in response to various oxidative stresses. The third objective was to evaluate the efficacy of the biotechnological application of this superoxide detoxification system by expressing SOR in plant cells, which enhanced their survival at high temperature and from drought indicating that it functions successfully in vivo. -
Role of Superoxide Reductase FA796 in Oxidative Stress Resistance in Filifactor Alocis Arunima Mishra✉, Ezinne Aja & Hansel M Fletcher
www.nature.com/scientificreports OPEN Role of Superoxide Reductase FA796 in Oxidative Stress Resistance in Filifactor alocis Arunima Mishra✉, Ezinne Aja & Hansel M Fletcher Filifactor alocis, a Gram-positive anaerobic bacterium, is now a proposed diagnostic indicator of periodontal disease. Because the stress response of this bacterium to the oxidative environment of the periodontal pocket may impact its pathogenicity, an understanding of its oxidative stress resistance strategy is vital. Interrogation of the F. alocis genome identifed the HMPREF0389_00796 gene that encodes for a putative superoxide reductase (SOR) enzyme. SORs are non-heme, iron-containing enzymes that can catalyze the reduction of superoxide radicals to hydrogen peroxide and are important in the protection against oxidative stress. In this study, we have functionally characterized the putative SOR (FA796) from F. alocis ATCC 35896. The recombinant FA796 protein, which is predicted to be a homotetramer of the 1Fe-SOR class, can reduce superoxide radicals. F. alocis FLL141 (∆FA796::ermF) was signifcantly more sensitive to oxygen/air exposure compared to the parent strain. Sensitivity correlated with the level of intracellular superoxide radicals. Additionally, the FA796-defective mutant had increased sensitivity to hydrogen peroxide-induced stress, was inhibited in its ability to form bioflm and had reduced survival in epithelial cells. Collectively, these results suggest that the F. alocis SOR protein is a key enzymatic scavenger of superoxide radicals and protects the bacterium from oxidative stress conditions. All living cells in an oxygen-rich environment encounter oxidative stress due to the generation of reactive oxygen 1,2 species (ROS), including superoxide radicals, hydroxyl radicals and hydrogen peroxide (H2O2) . -
Redox Proteomics in Selected Neurodegenerative Disorders: from Its Infancy to Future Applications Allan Butterfield University of Kentucky
Eastern Kentucky University Encompass Chemistry Faculty and Staff choS larship Chemistry 2012 Redox Proteomics in Selected Neurodegenerative Disorders: From Its Infancy to Future Applications Allan Butterfield University of Kentucky Marzia Perluigi Sapienza University of Rome Tanea Reed Eastern Kentucky University Tasneem Muharib University of Kentucky Christopher P. Hughes University of Kentucky See next page for additional authors Follow this and additional works at: http://encompass.eku.edu/che_fsresearch Part of the Chemistry Commons Recommended Citation Butterfield, D. A., Perluigi, M., Reed, T., Muharib, T., Hughes, C. P., Robinson, R. A., & Sultana, R. (2012). Redox Proteomics in Selected Neurodegenerative Disorders: From Its Infancy to Future Applications. Antioxidants & Redox Signaling, 17(11), 1610-1655. doi:10.1089/ars.2011.4109 This Article is brought to you for free and open access by the Chemistry at Encompass. It has been accepted for inclusion in Chemistry Faculty and Staff Scholarship by an authorized administrator of Encompass. For more information, please contact [email protected]. Authors Allan Butterfield, Marzia Perluigi, Tanea Reed, Tasneem Muharib, Christopher P. Hughes, Rena A.S. Robinson, and Rukhsana Sultana This article is available at Encompass: http://encompass.eku.edu/che_fsresearch/3 See discussions, stats, and author profiles for this publication at: https://www.researchgate.net/publication/51828850 Redox Proteomics in Selected Neurodegenerative Disorders: From Its Infancy to Future Applications Article -
Adaptive Laboratory Evolution Enhances Methanol Tolerance and Conversion in Engineered Corynebacterium Glutamicum
ARTICLE https://doi.org/10.1038/s42003-020-0954-9 OPEN Adaptive laboratory evolution enhances methanol tolerance and conversion in engineered Corynebacterium glutamicum Yu Wang 1, Liwen Fan1,2, Philibert Tuyishime1, Jiao Liu1, Kun Zhang1,3, Ning Gao1,3, Zhihui Zhang1,3, ✉ ✉ 1234567890():,; Xiaomeng Ni1, Jinhui Feng1, Qianqian Yuan1, Hongwu Ma1, Ping Zheng1,2,3 , Jibin Sun1,3 & Yanhe Ma1 Synthetic methylotrophy has recently been intensively studied to achieve methanol-based biomanufacturing of fuels and chemicals. However, attempts to engineer platform micro- organisms to utilize methanol mainly focus on enzyme and pathway engineering. Herein, we enhanced methanol bioconversion of synthetic methylotrophs by improving cellular tolerance to methanol. A previously engineered methanol-dependent Corynebacterium glutamicum is subjected to adaptive laboratory evolution with elevated methanol content. Unexpectedly, the evolved strain not only tolerates higher concentrations of methanol but also shows improved growth and methanol utilization. Transcriptome analysis suggests increased methanol con- centrations rebalance methylotrophic metabolism by down-regulating glycolysis and up- regulating amino acid biosynthesis, oxidative phosphorylation, ribosome biosynthesis, and parts of TCA cycle. Mutations in the O-acetyl-L-homoserine sulfhydrylase Cgl0653 catalyzing formation of L-methionine analog from methanol and methanol-induced membrane-bound transporter Cgl0833 are proven crucial for methanol tolerance. This study demonstrates the importance of -
Yeast Genome Gazetteer P35-65
gazetteer Metabolism 35 tRNA modification mitochondrial transport amino-acid metabolism other tRNA-transcription activities vesicular transport (Golgi network, etc.) nitrogen and sulphur metabolism mRNA synthesis peroxisomal transport nucleotide metabolism mRNA processing (splicing) vacuolar transport phosphate metabolism mRNA processing (5’-end, 3’-end processing extracellular transport carbohydrate metabolism and mRNA degradation) cellular import lipid, fatty-acid and sterol metabolism other mRNA-transcription activities other intracellular-transport activities biosynthesis of vitamins, cofactors and RNA transport prosthetic groups other transcription activities Cellular organization and biogenesis 54 ionic homeostasis organization and biogenesis of cell wall and Protein synthesis 48 plasma membrane Energy 40 ribosomal proteins organization and biogenesis of glycolysis translation (initiation,elongation and cytoskeleton gluconeogenesis termination) organization and biogenesis of endoplasmic pentose-phosphate pathway translational control reticulum and Golgi tricarboxylic-acid pathway tRNA synthetases organization and biogenesis of chromosome respiration other protein-synthesis activities structure fermentation mitochondrial organization and biogenesis metabolism of energy reserves (glycogen Protein destination 49 peroxisomal organization and biogenesis and trehalose) protein folding and stabilization endosomal organization and biogenesis other energy-generation activities protein targeting, sorting and translocation vacuolar and lysosomal -
Endogenous Superoxide Is a Key Effector of the Oxygen Sensitivity of A
Endogenous superoxide is a key effector of the oxygen PNAS PLUS sensitivity of a model obligate anaerobe Zheng Lua,1, Ramakrishnan Sethua,1, and James A. Imlaya,2 aDepartment of Microbiology, University of Illinois, Urbana, IL 61801 Edited by Irwin Fridovich, Duke University Medical Center, Durham, NC, and approved March 1, 2018 (received for review January 3, 2018) It has been unclear whether superoxide and/or hydrogen peroxide fects (3, 4). Thus, these phenotypes confirmed the potential tox- play important roles in the phenomenon of obligate anaerobiosis. icity of reactive oxygen species (ROS), and they broadly supported This question was explored using Bacteroides thetaiotaomicron,a the idea that anaerobes might be poisoned by endogenous major fermentative bacterium in the human gastrointestinal tract. oxidants. Aeration inactivated two enzyme families—[4Fe-4S] dehydratases The metabolic defects of the mutant E. coli strains were sub- and nonredox mononuclear iron enzymes—whose homologs, in sequently traced to damage to two types of enzymes: dehy- contrast, remain active in aerobic Escherichia coli. Inactivation- dratases that depend upon iron-sulfur clusters and nonredox rate measurements of one such enzyme, B. thetaiotaomicron fu- enzymes that employ a single atom of ferrous iron (5–9). In both marase, showed that it is no more intrinsically sensitive to oxi- enzyme families, the metal centers are solvent exposed so that dants than is an E. coli fumarase. Indeed, when the E. coli they can directly bind and activate their substrates. Superoxide B. thetaiotaomicron enzymes were expressed in , they no longer and H2O2 are tiny molecules that cannot easily be excluded from could tolerate aeration; conversely, the B. -
Table S1. List of Oligonucleotide Primers Used
Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG -
Alkyl Hydroperoxide Reductase Dependent on Thioredoxin-Like Protein from Pyrococcus Horikoshii
Rapid Communication J. Biochem. 134, 25-29 (2003) D O I: 10.1093/j b/mvg l09 Alkyl Hydroperoxide Reductase Dependent on Thioredoxin-Like Protein from Pyrococcus horikoshii Yasuhiro Kashima and Kazuhiko Ishikawa* Special Division of Human Life Technology, National Institute of Advanced Industrial Science and Technology (AIST Kansai)1-8-31 Midorigaoka, Ikeda, Osaka 563-8577 Received February 25, 2003; accepted May 14, 2003 Pyrococcus horikoshii is an obligate anaerobic hyperthermophilic archaeon. In P. horikoshii cells, a hydroperoxide reductase homologue ORF (PH1217) was found to be induced by oxygen. The recombinant protein, which was expressed in E. coli under aerobic conditions, exhibited no activity. However, the recombinant protein prepared under semi-anaerobic conditions exhibited alkyl hydroperoxide reductase activity. Furthermore, it was clarified that it was coupled with the thioredoxin-like system in P. horikoshii. Western blot analysis revealed that the protein was induced by oxygen and hydrogen peroxide. This protein seems to be sensitive to oxygen but forms a thioredoxin-dependent system to eliminate reactive oxygen species in P. horikoshii. Key words: alkyl hydroperoxide reductase, hyperthermophilic archaea, oxidative stress, Pyrococcus horikoshii, thioredoxin system. Organisms have developed various mechanisms that AhpC-like enzyme plays a critical role in the elimination have the ability to eliminate many forms of physiological of hydrogen peroxide that is produced through reduction and chemical stress from their environments, such as of the superoxide anion by SOR. However, an enzyme for reactive oxygen species (ROS), temperature, pH, and the elimination of peroxide has not been reported in osmotic pressure. In particular, oxidative stress caused hyperthermophilic archaea. -
Structures, Functions, and Mechanisms of Filament Forming Enzymes: a Renaissance of Enzyme Filamentation
Structures, Functions, and Mechanisms of Filament Forming Enzymes: A Renaissance of Enzyme Filamentation A Review By Chad K. Park & Nancy C. Horton Department of Molecular and Cellular Biology University of Arizona Tucson, AZ 85721 N. C. Horton ([email protected], ORCID: 0000-0003-2710-8284) C. K. Park ([email protected], ORCID: 0000-0003-1089-9091) Keywords: Enzyme, Regulation, DNA binding, Nuclease, Run-On Oligomerization, self-association 1 Abstract Filament formation by non-cytoskeletal enzymes has been known for decades, yet only relatively recently has its wide-spread role in enzyme regulation and biology come to be appreciated. This comprehensive review summarizes what is known for each enzyme confirmed to form filamentous structures in vitro, and for the many that are known only to form large self-assemblies within cells. For some enzymes, studies describing both the in vitro filamentous structures and cellular self-assembly formation are also known and described. Special attention is paid to the detailed structures of each type of enzyme filament, as well as the roles the structures play in enzyme regulation and in biology. Where it is known or hypothesized, the advantages conferred by enzyme filamentation are reviewed. Finally, the similarities, differences, and comparison to the SgrAI system are also highlighted. 2 Contents INTRODUCTION…………………………………………………………..4 STRUCTURALLY CHARACTERIZED ENZYME FILAMENTS…….5 Acetyl CoA Carboxylase (ACC)……………………………………………………………………5 Phosphofructokinase (PFK)……………………………………………………………………….6 -
The Role of the Salvage Pathway in Nucleotide Sugar Biosynthesis
THE ROLE OF THE SALVAGE PATHWAY IN NUCLEOTIDE SUGAR BIOSYNTHESIS: IDENTIFICATION OF SUGAR KINASES AND NDP-SUGAR PYROPHOSPHORYLASES by TING YANG (Under the Direction of Maor Bar-Peled) ABSTRACT The synthesis of polysaccharides, glycoproteins, glycolipids, glycosylated secondary metabolites and hormones requires a large number of glycosyltransferases and a constant supply of nucleotide sugars. In plants, photosynthesis and the NDP-sugar inter-conversion pathway are the major entry points to form NDP-sugars. In addition to these pathways is the salvage pathway, a less understood metabolism that provides the flux of NDP-sugars. This latter pathway involves the hydrolysis of glycans to free sugars, sugar transport, sugar phosphorylation and nucleotidylation. The balance between glycan synthesis and recycling as well as its regulation at various plant developmental stages remains elusive as many of the molecular components are unknown. To understand how the salvage pathway contributes to the sugar flux and cell wall biosynthesis, my research focused on the functional identification of salvage pathway sugar kinases and NDP-sugar pyrophosphorylases. This research led to the first identification and enzymatic characterization of galacturonic acid kinase (GalA kinase), galactokinase (GalK), a broad UDP-sugar pyrophosphorylase (sloppy), two promiscuous UDP-GlcNAc pyrophosphorylases (GlcNAc-1-P uridylyltransferases), as well as UDP-sugar pyrophosphorylase paralogs from Trypanosoma cruzi and Leishmania major. To evaluate the salvage pathway in plant biology, we further investigated a sugar kinase mutant: galacturonic acid kinase mutant (galak) and determined if and how galak KO mutant affects the synthesis of glycans in Arabidopsis. Feeding galacturonic acid to the seedlings exhibited a 40-fold accumulation of free GalA in galak mutant, while the wild type (WT) plant readily metabolizes the fed-sugar. -
Letters to Nature
letters to nature Received 7 July; accepted 21 September 1998. 26. Tronrud, D. E. Conjugate-direction minimization: an improved method for the re®nement of macromolecules. Acta Crystallogr. A 48, 912±916 (1992). 1. Dalbey, R. E., Lively, M. O., Bron, S. & van Dijl, J. M. The chemistry and enzymology of the type 1 27. Wolfe, P. B., Wickner, W. & Goodman, J. M. Sequence of the leader peptidase gene of Escherichia coli signal peptidases. Protein Sci. 6, 1129±1138 (1997). and the orientation of leader peptidase in the bacterial envelope. J. Biol. Chem. 258, 12073±12080 2. Kuo, D. W. et al. Escherichia coli leader peptidase: production of an active form lacking a requirement (1983). for detergent and development of peptide substrates. Arch. Biochem. Biophys. 303, 274±280 (1993). 28. Kraulis, P.G. Molscript: a program to produce both detailed and schematic plots of protein structures. 3. Tschantz, W. R. et al. Characterization of a soluble, catalytically active form of Escherichia coli leader J. Appl. Crystallogr. 24, 946±950 (1991). peptidase: requirement of detergent or phospholipid for optimal activity. Biochemistry 34, 3935±3941 29. Nicholls, A., Sharp, K. A. & Honig, B. Protein folding and association: insights from the interfacial and (1995). the thermodynamic properties of hydrocarbons. Proteins Struct. Funct. Genet. 11, 281±296 (1991). 4. Allsop, A. E. et al.inAnti-Infectives, Recent Advances in Chemistry and Structure-Activity Relationships 30. Meritt, E. A. & Bacon, D. J. Raster3D: photorealistic molecular graphics. Methods Enzymol. 277, 505± (eds Bently, P. H. & O'Hanlon, P. J.) 61±72 (R. Soc. Chem., Cambridge, 1997).