Author Manuscript Faculty of Biology and Medicine Publication

Serveur Académique Lausannois SERVAL serval.unil.ch Author Manuscript Faculty of Biology and Medicine Publication

This paper has been peer-reviewed but dos not include the final publisher proof-corrections or journal pagination. Published in final edited form as:

Title: B-cell receptor-driven MALT1 activity regulates MYC signaling in mantle cell lymphoma. Authors: Dai B, Grau M, Juilland M, Klener P, Höring E, Molinsky J, Schimmack G, Aukema SM, Hoster E, Vogt N, Staiger AM, Erdmann T, Xu W, Erdmann K, Dzyuba N, Madle H, Berdel WE, Trneny M, Dreyling M, Jöhrens K, Lenz P, Rosenwald A, Siebert R, Tzankov A, Klapper W, Anagnostopoulos I, Krappmann D, Ott G, Thome M, Lenz G Journal: Blood Year: 2017 Jan 19 Volume: 129 Issue: 3 Pages: 333-346 DOI: 10.1182/blood-2016-05-718775

In the absence of a copyright statement, users should assume that standard copyright protection applies, unless the article contains an explicit statement to the contrary. In case of doubt, contact the journal publisher to verify the copyright status of an article.

B-cell receptor driven MALT1 activity regulates MYC signaling in mantle cell lymphoma

Beiying Dai,1-3 Michael Grau,1,2 Mélanie Juilland,4 Pavel Klener,5,6 Elisabeth Höring,7 Jan Molinsky,5,6 Gisela Schimmack,8 Sietse M. Aukema,9 Eva Hoster,10,11 Niklas Vogt,1,12 Annette M. Staiger,13 Tabea Erdmann,1,2 Wendan Xu,1,2 Kristian Erdmann,1,2 Nicole Dzyuba,1,2 Hannelore Madle,1,2 Wolfgang E. Berdel,2,14 Marek Trneny,6 Martin Dreyling,10 Korinna Jöhrens,15 Peter Lenz,16 Andreas Rosenwald,17 Reiner Siebert,9,18 Alexandar Tzankov,19 Wolfram Klapper,12 Ioannis Anagnostopoulos,15 Daniel Krappmann,8 German Ott,13 Margot Thome,4 Georg Lenz1,2,14

1Translational Oncology, Albert-Schweitzer-Campus 1, University Hospital Münster, 48149 Münster, Germany; 2Cluster of Excellence EXC 1003, Cells in Motion, 48149 Münster, Germany; 3Fachbereich Chemie und Pharmazie, University of Münster, 48149 Münster, Germany; 4Department of Biochemistry, University of Lausanne, CH-1066 Epalinges, Switzerland; 5Institute of Pathological Physiology, First Faculty of Medicine, Charles University Prague, Prague, Czech Republic; 6Department of Hematology, Charles University General Hospital Prague, Prague, Czech Republic; 7 Department of Hematology and Oncology, Robert-Bosch-Hospital and Dr. Margarete Fischer-Bosch Institute of Clinical Pharmacology, 70376 Stuttgart, and University of Tuebingen, Germany; 8Research Unit Cellular Signal Integration, Institute of Molecular Toxicology and Pharmacology, Helmholtz Zentrum München - German Research Center for Environmental Health, 85764 Neuherberg, Germany; 9Institute of Human Genetics, Christian-Albrechts-University Kiel, 24105 Kiel, Germany; 10Department of Internal Medicine III, Ludwig-Maximilians-University Hospital Munich, Munich, Germany; 11Institute of Medical Informatics, Biometry, and Epidemiology, Ludwig-Maximilians- University of Munich, Munich, Germany; 12Department of Pathology, Hematopathology Section and Lymph Node Registry, University Hospital Schleswig-Holstein, Campus Kiel, 24105 Kiel, Germany; 13Department of Clinical Pathology, Robert-Bosch-Hospital and Dr. Margarete Fischer-Bosch Institute of Clinical Pharmacology, 70376 Stuttgart, and University of Tuebingen, Germany; 14Department of Medicine A, Hematology, Oncology and Pneumology, University Hospital Münster, 48149 Münster, Germany; 15Institute of Pathology, Charité - Universitätsmedizin Berlin, Charitéplatz 1, 10117 Berlin, Germany; 16Department of Physics, Philipps-University, 35032 Marburg, Germany; 17Department of Pathology, University of Würzburg, Josef-Schneider-Strasse 2, 97080 Würzburg, Germany; 18Institute of Human Genetics, University Hospital Ulm, 89081 Ulm, Germany; and 19Institute of Pathology, University Hospital, Schoenbeinstrasse 40, 4031 Basel, Switzerland

Short title: MALT1 and MYC signaling in MCL

Scientific category: LYMPHOID NEOPLASIA Word count manuscript: 3990 Abstract word count: 183 Number of figures: 7 Number of references: 44

Corresponding author: Georg Lenz, M.D. University Hospital Münster, Translational Oncology Albert-Schweitzer-Campus 1 48149 Münster, Germany Phone: +49 251 83 52995 Fax: +49 251 83 52673 Email: [email protected]

Key points

• MALT1 protease activity stabilizes MYC

• The MALT1-MYC network might represent a therapeutic target for MCL patients

Abstract

Mantle cell lymphoma (MCL) is a mature B-cell lymphoma characterized by poor clinical outcome. Recent studies revealed the importance of B-cell receptor (BCR) signaling in maintaining MCL survival. However, it remains unclear which role

MALT1, an essential component of the CARD11-BCL10-MALT1 (CBM) complex that links BCR signaling to the nuclear factor kappa-B (NF-κB) pathway, plays in the biology of MCL. Here we show that a subset of MCLs is addicted to MALT1, as its inhibition by either RNA or pharmacologic interference induced cytotoxicity both in vitro and in vivo. Gene expression profiling following MALT1 inhibition demonstrated that MALT1 controls a MYC-driven gene expression network predominantly through increasing MYC protein stability. Thus, our analyses identify a previously unappreciated regulatory mechanism of MYC expression. Investigating primary mouse splenocytes, we could demonstrate that MALT1-induced MYC regulation is not restricted to MCL, but represents a common mechanism. MYC itself is pivotal for

MCL survival as its downregulation and pharmacologic inhibition induced cytotoxicity in all MCL models. Collectively, these results provide a strong mechanistic rationale to investigate the therapeutic efficacy of targeting the MALT1-MYC axis in MCL patients. 3

Introduction

Mantle cell lymphoma (MCL) is characterized by an aggressive clinical course and short overall survival.1 Different cytomorphological variants can be distinguished and especially, blastic variants are associated with poor overall survival.2-4 Besides clinical factors summarized in the mantle cell lymphoma international prognostic index (MIPI), high cell proliferation has been identified as a major prognostic factor associated with adverse outcome.5-7

Pathogenetically MCL is characterized by cyclin D1 overexpression due to the chromosomal translocation t(11;14)(q13;q32).8 In addition, various secondary genetic aberrations activating different pathways have been elucidated.9,10 Recently, constitutive activation of B-cell receptor (BCR) signaling and downstream activation of the nuclear factor kappa-B (NF-κB) pathway have been identified to be critical for survival of MCL subsets.11,12 Upon BCR stimulation MALT1 and BCL10 are recruited to CARD11 resulting in the formation of the CARD11-BCL10-MALT1 (CBM) complex and NF-κB activation.13,14 Additionally, the protease activity of MALT1 is enhanced leading to cleavage of NF-κB inhibitors such as A20 and RelB.15,16 Other known

MALT1 substrates include BCL10, CYLD, Regnase-1, Roquin-1, Roquin-2, and

HOIL1.17-25

Preliminary data suggested that MALT1 is constitutively activated in subsets of

MCL.11 However, its precise role in the pathogenesis of MCL remains unknown.

Thus, we investigated the role of MALT1 in the biology of MCL in the current study. 4

Methods

Patient samples, immunohistochemistry and fluorescence in situ hybridization

(FISH)

CD20+ MCL cells were separated from peripheral blood mononuclear cells (PBMCs; patient samples #1 and #2) or cell suspensions from lymph nodes (patient samples

#3-5) of MCL patients by CD20 magnetic-activated cell sorting (Miltenyi Biotec,

Bergisch Gladbach, Germany).

The immunohistochemical protocols are summarized in the Supplemental

Material and Methods. FISH was performed as described.26,27

Cell culture, retroviral constructs and transductions

The experiments were performed as described.28-30 Protocols are available in the

Supplemental Material and Methods. The sequences of the utilized small hairpin

RNAs (shRNAs) are summarized in Supplemental Table 1.

Viability assay, analysis of cell cycle, apoptosis and proliferation

The experiments were performed as described.29,31,32 Protocols are available in the

Supplemental Material and Methods.

Isolation and stimulation of mouse splenocytes

Protocols are available in the Supplemental Material and Methods.

In vivo xenograft mouse studies

The in vivo xenograft mouse studies were done as described.33 Protocols are available in the Supplemental Material and Methods. 5

Gene expression profiling

Gene expression profiling was performed 24, 30, 36, 42, 48, and 54 hours following treatment with z-VRPR-fmk or DMSO in Mino and Rec-1 cells and analyzed as described in Supplemental Material and Methods.32,34,35 The gene expression data has been deposited in the GEO database (http://www.ncbi.nlm.nih.gov/geo; accession number GSE81552).

Quantitative PCR

Quantitative PCR was performed as described using predesigned assays (Applied

Biosystems, Carlsbad, CA, USA).29

Western blotting and analysis of MYC stability

Protocols are available in the Supplemental Material and Methods.

Results

MALT1 is expressed and activated in MCL

To assess if MALT1 is expressed in MCL, we determined its expression in 60 primary samples by immunohistochemistry. To establish the immunohistochemical assay, we stained five reactive lymph node and tonsil specimens. MALT1 was expressed in both B- and T-cell areas of the lymph node, albeit to varying degrees. The germinal center (GC) B-cells were strongly positive and staining was accentuated in the dark zone of the GC (Supplemental Figure 1). 56/60 (93%) of MCL cases stained positive for MALT1 and showed a diffuse cytoplasmic expression that was detectable in virtually all MCL cells (Figure 1A-B). We compared this expression pattern to other aggressive lymphomas by staining 81 primary DLBCL samples. We determined the 6 molecular DLBCL subtype by applying the Hans algorithm36 and identified 34 GCB and 47 non-GCB DLBCLs. All 34 GCB as well as 46 out of the 47 (98%) non-GCB

DLBCLs expressed MALT1 suggesting that different B-cell lymphoma subtypes express MALT1.

MALT1 functions as a protease and therefore its proteolytic activity is determining its biologic function. Thus, to determine MALT1 activity in primary MCL samples, we prepared cell lysates from CD20+ MCL cells that were isolated from either PBMCs or cell suspensions from affected lymph nodes. MALT1 expression was found in all five primary MCL samples, whereas CYLD cleavage as a direct marker of MALT1 proteolytic activity22 was detectable in four out of five samples

(Figure 1C).

To investigate MALT1 activity in additional MCLs, we analyzed ten established cell lines. MALT1 was expressed in all lines assessed by Western blotting (Figure

1D). Five cell lines (Mino, Jeko-1, Rec-1, SP49, and SP53) had detectable levels of cleaved forms of CYLD, RelB, A20, and BCL10 indicating constitutive MALT1 activity.

In contrast, the other cell lines did not show cleavage of MALT1 targets suggesting absent MALT1 proteolytic activity (Figure 1E). Collectively, these data implicate that

MALT1 is constitutively active in a substantial number of MCLs and that MCLs can be divided into two distinct subgroups based on their MALT1 activation status.

Activation of MALT1 in MCL is caused by constitutive BCR signaling

Next, we investigated the mechanisms leading to MALT1 activation in MCL. As BCR signaling is an activator of MALT1, we knocked down CD79A and CARD11 as central components of the BCR cascade to investigate the effects on MALT1 activity.

Cleavage of the MALT1 targets CYLD, RelB, and BCL10 was significantly decreased in two MALT1-activated cell lines (Jeko-1 and Rec-1), but unaffected in two MALT1- 7 inactive MCL cell lines (Maver-1 and Z-138) after CD79A and CARD11 knockdown using specific shRNAs, respectively (Figure 2A). These results suggest that MALT1 is activated through constitutive BCR signaling in MCL. Interestingly, shRNA- mediated knockdown of CD79A, CARD11 or the CBM complex component BCL10 induced toxicity in Jeko-1 and Rec-1 cells, but not in Maver-1 and Z-138 cells, indicating dependency on BCR signaling only in MALT1-activated MCLs (Figure 2B and Supplemental Figure 2A-B). These results were further confirmed by experiments showing that all MALT1-activated MCL cell lines were sensitive to the

Bruton’s tyrosine kinase (BTK) inhibitor ibrutinib, whereas all MALT1-inactive models did not respond (Figure 2C).

Downregulation of MALT1 is toxic to MALT1-activated MCLs in vitro and in vivo

To elucidate the functional significance of MALT1 in MCL, we knocked down its expression using different MALT1-specific shRNAs. Both shRNAs significantly decreased MALT1 mRNA and protein levels after 48 hours (Figure 3A-B).

Transduction of MALT1 shRNAs induced cytotoxicity in MALT1-activated MCLs while it did not affect survival of any of the MALT1-inactive models (Figure 3C). To demonstrate that MALT1 shRNA-mediated toxicity was specifically caused by MALT1 knockdown, we performed a rescue experiment by transducing Jeko-1 and Rec-1 cells with a vector carrying the MALT1 cDNA that is not targetable by both MALT1 shRNAs. Indeed, exogenous MALT1 expression restored growth of both MALT1- activated MCL models, indicating the specificity of our approach (Figure 3D).

We next determined if MALT1 dependency in MALT1-activated MCLs translates into an in vivo setting. To this end, we created MCL xenograft mouse models using Jeko-1 cells transduced with vectors encoding either MALT1 shRNA #2 or a negative control shRNA. shRNA-mediated MALT1 knockdown was detectable by 8

Western blotting in different samples from sacrificed mice (Figure 3E). MALT1 knockdown significantly inhibited tumor growth over 12 days (P = 1.9×10−5 for MALT1 shRNA vs. control shRNA on day 12; one-tailed two-sample t-test; Figure 3F), suggesting that MALT1 promotes lymphoma growth in MALT1-activated MCLs.

Next, we asked if signaling through MALT1 can be utilized therapeutically in

MCL. Thus, we treated our MCL lines with the specific MALT1 inhibitor z-VRPR- fmk.23 To confirm that z-VRPR-fmk indeed exerts its effect through inhibiting

MALT1´s proteolytic activity, expression of the MALT1 targets CYLD, RelB, A20, and

BCL10 were studied 48 hours after incubation with z-VRPR-fmk by immunoblotting.

We detected a significant downregulation of their cleaved forms in MALT1-activated

MCLs (Mino and SP53). In contrast, no changes in their expression levels were observed in the MALT1-inactive MCLs (Maver-1 and Z-138) (Figure 3G). These results confirm that z-VRPR-fmk inhibits the proteolytic function of MALT1.

Subsequently, we determined cell viability seven days after z-VRPR-fmk treatment.

In line with our MALT1 knockdown data, pharmacologic inhibition of MALT1 significantly reduced cell viability of MALT1-activated MCLs, whereas survival of

MALT1-inactive MCLs was not affected (Figure 3H).

To obtain insights into the nature of the growth inhibitory effects of MALT1 inhibition through z-VRPR-fmk, we measured cell proliferation, the rate of apoptosis, and performed cell cycle analyses. We treated MALT1-activated (Mino) and MALT1- inactive (Z-138) MCLs with z-VRPR-fmk or DMSO. To assess proliferation, cellular divisions were determined by measuring CFSE dilutions in viable cells by flow cytometry. z-VRPR-fmk significantly downregulated proliferation of Mino cells (P <

10−15 on day 6) , while Z-138 cells were not affected (P = .4 on day 6; Figure 3I). In addition, we quantified the number of cell divisions following treatment with z-VRPR- fmk. These analyses revealed that Mino cells divided 1.8 ± 0.17 or 0.9 ± 0.1 ×/d after 9

DMSO or z-VRPR-fmk treatment, respectively, whereas Z-138 cells divided 2.6 ±

0.03 x/d after DMSO treatment and 2.5 ± 0.04 ×/d following MALT1 inhibition. In contrast, neither changes in apoptosis (data not shown) nor cell cycle (Supplemental

Figure 3) were detectable following MALT1 inhibition, indicating that z-VRPR-fmk exerts its growth inhibitory effect in MALT1-activated MCLs predominantly through reduction of cell proliferation (Figure 3I).

Inhibition of MALT1 overcomes ibrutinib resistance

The BTK inhibitor ibrutinib is effective in the treatment of relapsed/refractory MCL patients.37 A recent study identified that the BTKC481S mutation confers resistance to ibrutinib in MCL.38 To investigate whether inhibition of MALT1 is able to overcome

BTKC481S-induced ibrutinib resistance, we expressed a BTKC481S cDNA or an empty vector in all five MALT1-activated and two MALT1-inactive MCL lines (Figure 3J and

Supplemental Figure 4A,C,E,G,I,K) and subsequently treated these cells with ibrutinib or z-VRPR-fmk. Introduction of the BTKC481S mutation rescued all MALT1- activated lines from the toxic effect of ibrutinib (Figure 3K and Supplemental Figure

4B,D,F,H). In contrast, in MALT1-inactive MCLs transduction of the BTKC481S mutant or an empty vector did not alter sensitivity to ibrutinib or z-VRPR-fmk (Figure 2C and

3H; Supplemental Figure 4J,L). These data indicate that inhibition of MALT1 might be effective in ibrutinib resistant MCLs.

MALT1 regulates MYC expression in MCL

To understand which biologic processes are regulated by MALT1 in MCL, we profiled gene expression changes after 24, 30, 36, 42, 48, and 54 hours of z-VRPR-fmk treatment in Mino cells. We identified 93 genes that were significantly downregulated

(P ≤ 1×10−5; paired t-tests over all time points) and 126 genes significantly 10 upregulated (P ≤ 1×10−5) following pharmacologic MALT1 inhibition (Figure 4A;

Supplemental Figure 5A; Supplemental Table 2).

To analyze the gene expression data in an unbiased manner, we performed a gene set enrichment analysis using a previously described gene expression signatures database consisting of 13,593 signatures (Supplemental Table 3). Our analysis revealed that the second most enriched downregulated signature was a previously described MYC target gene set (enrichment score = 0.841; P ≤ .001;

Figure 4B; Supplemental Figure 5B; Supplemental Table 3). In addition, various other independent MYC signatures were significantly enriched with downregulated genes and among the top downregulated signatures, suggesting that MYC expression and its gene expression network is regulated by MALT1 (Supplemental Table 3-4).

To confirm that MYC deregulation by MALT1 is a general mechanism in MCL, we further performed gene expression profiling in Rec-1 cells (Supplemental Figure 6

A-B; Supplemental Table 5). These analyses confirmed that various previously identified MYC target sets were downregulated following z-VRPR-fmk treatment

(Supplemental Figure 6C-D; Supplemental Table 6-7). Additionally, the identified

Mino target gene signature was significantly downregulated in Rec-1 following

MALT1 inhibition (Supplemental Figure 6E) suggesting that very similar target genes are affected by MALT1 inhibition in Mino and Rec-1 cells. Finally, to confirm that the detected Mino target gene signature is also downregulated in other MCL models, we performed real-time PCR for eleven selected genes following MALT1 inhibition in both MALT1-activated and MALT1-inactive cell lines. Real-time PCR confirmed downregulation of ten out of eleven target genes in all MALT1-activated but not

MALT-inactive models (Figure 4C and Supplemental Figure 7). These results suggest that the MYC target gene network seems to be controlled by MALT1 in 11

MCL. In contrast, previously identified NF-κB target gene signatures were not affected by MALT1 inhibition in both Mino and Rec-1 cells.

Due to the strong impact of MALT1 inhibition on the MYC expression profile, we asked whether MYC itself is regulated by MALT1. MYC mRNA expression was moderately suppressed by MALT1 inhibition (log2(ratio) = −.33 in Mino and log2(ratio)

= −.23 in Rec-1). This result was confirmed by shRNA-mediated MALT1 knockdown that did not substantially alter MYC mRNA levels measured by quantitative PCR

(Figure 4D). To elucidate if MYC is regulated posttranscriptionally by MALT1, we evaluated MYC protein expression after z-VRPR-fmk treatment. Immunoblotting revealed that MYC levels were reduced in MALT1-activated but not in MALT1- inactive MCLs following MALT1 inhibition (Figure 4E).

To corroborate these findings, we next investigated MYC expression levels following shRNA-mediated MALT1 knockdown in MALT1-activated and -inactive cells by Western blotting. MALT1 silencing induced a substantial decrease in MYC protein levels in MALT1-activated but not MALT1-inactive MCLs (Figure 4F). As MALT1 is activated by BCR signaling in MCL, we investigated whether inhibition of BCR signaling by ibrutinib alters MYC expression levels. To this end we treated MALT1- activated (Mino and Rec-1) and MALT1-inactive (Maver-1 and Z-138) cell lines with 5 and 10 nM ibrutinib for 12, 24, 36, and 48 hours. Ibrutinib treatment significantly decreased MYC expression in Mino and Rec-1 cells, whereas MYC levels in Maver-1 and Z-138 were unaffected (Supplemental Figure 8). Collectively, these data indicate that BCR-driven MALT1 activity regulates MYC expression.

MALT1 regulates MYC expression in primary mouse splenocytes

To elucidate if MALT1-induced regulation of MYC protein expression is relevant in other settings than MCL, we isolated primary mouse splenocytes expressing either 12 wild-type MALT1 (+/+) or a catalytically inactive MALT1C472A mutant (ki/ki)39 and subsequently stimulated the splenocytes with PMA and ionomycin for 30, 60, and

120 minutes (Figure 5A). Stimulation of MALT1 (+/+) and MALT1 (ki/ki) splenocytes was equally strong, as determined by monitoring the induction of ERK phosphorylation (Figure 5A). In contrast, CYLD cleavage, which served as a marker of MALT1 activity, was only detectable in MALT1 (+/+) splenocytes. Likewise, the stimulation-induced expression of MYC was considerably stronger in MALT1 (+/+) compared to MALT1 (ki/ki) splenocytes. Collectively, these findings suggest that

MALT1 activity promotes MYC expression in activated primary lymphocytes (Figure

5A).

MALT1 stabilizes MYC expression

Next, we investigated whether MALT1 promotes MYC expression by controlling MYC protein stability. We treated Rec-1 and Mino cells with 50 μM z-VRPR-fmk or DMSO for 24 hours, followed by incubation with 10 μg/mL of the protein synthesis inhibitor cycloheximide. Immunoblotting revealed that MYC levels in Rec-1 cells declined faster following z-VRPR-fmk treatment (half-life 31.5 minutes) compared to DMSO

(69.31 minutes). This was confirmed in Mino cells, in which the half-life of MYC decreased from 46.21 minutes in DMSO treated cells compared to 34.65 minutes in

MALT1-inhibited cells (Figure 5B and Supplemental Figure 9A).

Next, to decipher if MALT1 affected proteasomal degradation of MYC, we assessed MYC levels in Mino, Rec-1, and SP53 cells that were incubated with z-

VRPR-fmk or DMSO for 12 hours and 24 hours, respectively, followed by treatment with the proteasome inhibitor MG132 for two hours. Under these conditions, we detected a marked increase of MYC expression in z-VRPR-fmk and MG132 treated cells (Figure 5C and Supplemental Figure 9B). To confirm our MALT1 inhibitor data, 13 we transduced MALT1-activated (Rec-1 and SP53) and MALT1-inactive (Maver-1 and Z-138) MCLs with our two MALT1 shRNAs and treated these cells with either

DMSO or MG132. MG132 treatment significantly increased MYC expression levels following shRNA-mediated MALT1 knockdown in MALT1-activated MCLs (Figure

5D). Collectively, these results indicate that MALT1 increases MYC stability posttranslationally by preventing its proteasomal degradation.

MCLs depend on MYC signaling

Our analyses implicated that MALT1 regulates MYC expression. To validate these findings, we determined MYC expression in our cell lines and in MCL patient samples. All MCL cell lines expressed MYC protein by Western blotting irrespective of their MALT1 activation status (Figure 6A and Supplemental Figure 10), whereas the four MALT1-activated primary MCLs showed higher MYC expression levels compared to the MALT1-inactive specimen (Figure 1C).

Next, we determined MYC expression in 234 primary MCL samples. 104

(44.4%) samples did not show MYC expression. In contrast, 75 (32.1%) samples displayed an intermediate and 55 (23.5%) samples a high MYC positivity (Figure 6B-

C). To compare the MYC staining pattern in MCL to other lymphomas, we stained 93 primary DLBCLs (10 MYC rearranged) and 7 BLs (all MYC rearranged). In BLs nuclear positivity was strong in >90% of cells. Eight out of ten MYC rearranged

DLBCLs expressed MYC, while 52 out of 83 primary non-rearranged DLBCLs were

MYC positive. In general, primary DLBCLs and MCLs were similar with respect to their staining intensity and more variable compared to the BL cases (Supplemental

Figure 11).

To investigate if MYC expression correlates with the cytological subtype, we compared MYC expression in classical (n = 154), pleomorphic (n = 34), and blastoid 14

(n = 40) MCLs (Figure 6D). For six samples the cytological subtype was not available. MYC expression was significantly higher in pleomorphic (P = 9.9×10−4) and blastoid variants (P = 2.6×10−5) compared to classical MCLs. There was no difference in MYC expression between pleomorphic and blastoid MCLs (P = .4;

Figure 6D).

To rule out that genetic aberrations involving the MYC locus are causative for increased MYC expression, we performed FISH in 80 MCLs with available MYC expression data. 55 (69%) of these cases were classical, 6 (8%) pleomorphic, and 13

(16%) blastoid MCLs (for six cases the cytological subtype was not available). 40

(50%) cases did not express MYC, 28 (35%) had intermediate MYC expression, whereas 12 (15%) samples had high MYC expression. Of the 80 cases, only one

(1.3%) harbored a MYC translocation, whereas none of the cases showed a high- level MYC amplification, indicating that these genetic aberrations are extremely rare in MCL.

To elucidate the functional role of MYC expression in MCL, we transduced

MCL cell lines with specific MYC shRNAs, which induced MYC downregulation 48 hours after induction (Supplemental Figure 12A). MYC knockdown was lethal to all

MCL models (Figure 7A). To confirm the specificity of our approach, an exogenous

MYC cDNA (which is not targeted by MYC shRNA #2) was introduced in Jeko-1,

Rec-1, and SP53 cells prior to transduction with the MYC shRNA. Indeed, exogenous

MYC expression rescued all MCL cells from shRNA-mediated toxicity (Figure 7B).

To evaluate the degree to which MYC downregulation contributes to the impaired viability of MALT1-silenced cells, we performed a rescue experiment introducing a MYC cDNA or an empty vector into MALT1 shRNA-transduced Jeko-1,

Rec-1, and SP53 cells. We detected a partial MYC-induced rescue in all three cell lines suggesting that MYC knockdown, at least partially, contributes to the lethal 15 effect of MALT1 silencing in these cells (Figure 7C; Supplemental Figure 12B). To confirm these results, we treated Jeko-1, Rec-1, SP53, and Mino cells that expressed either MYC cDNA or an empty vector with z-VRPR-fmk. In all cell lines we could detect a substantial MYC-induced rescue confirming that MYC downregulation is at least partially causative for the toxic effects of MALT1 inhibition in MALT1-activated

MCLs (Figure 7D). To investigate whether this rescue effect is specific to z-VRPR- fmk, we determined cell viability of these exogenous MYC harboring cells after doxorubicin treatment. No resistance against doxorubicin was conferred by MYC cDNA expression, indicating the specificity of our findings (Supplemental Figure

12C).

To obtain insights into the nature of the growth inhibitory effects of MYC knockdown, we analyzed whether cell proliferation was negatively affected by MYC silencing. To this end, SNARF-1 staining was performed in Rec-1 and SP53 cells expressing MYC shRNA #1/#2. Cell divisions were compared after two days between cells with and without MYC knockdown. In both cell lines, the proliferation rate decreased substantially after MYC silencing (Figure 7E) indicating that MYC controls

MCL proliferation.

To validate our in vitro findings, we stained our cohort of primary MCL samples for Ki-67 to assess proliferation. Indeed, overall Ki-67 and MYC expression correlated

(r = .63; P = 5×10−27; Supplemental Figure 12D). Furthermore, samples with intermediate MYC expression had higher Ki-67 levels compared to MYC negative

MCLs (P = 1.1×10−6; Figure 7F) whereas MYC positive MCLs had the highest Ki-67 levels (P = 4.6×10−24 vs. MYC negative MCLs and P = 1.4×10−12 vs. MYC intermediate MCLs; Figure 7F). This suggests that MYC regulates MCL proliferation in vivo. 16

Finally, we investigated if inhibiting MYC signaling can be exploited therapeutically. Cell viability was measured three days after treating MCL lines with the small molecule inhibitor 10058-F4 that inhibits MYC-MAX heterodimerization.

U266 cells that do not express MYC were used as a negative control. Irrespective of

MALT1 activity, three cell lines (Mino, Rec-1, and Z-138) were highly sensitive to

10058-F4. In contrast, U266 cells were virtually unaffected, whereas Maver-1 cells showed an intermediate sensitivity (Figure 7G). Taken together, these data suggest that MYC represents a promising target for future therapies of MCL patients.

Discussion

We detected a novel role of MALT1 in the biology of MCL. A substantial fraction of

MCLs exhibit constitutive MALT1 activity and these MCLs are addicted to MALT1 function. In contrast, some MCLs do not show constitutive MALT1 proteolytic activity and these lymphomas do not depend on MALT1. Thus, our results indicate that

MCLs can be divided into two distinct subgroups based on their MALT1 activation status.

MALT1 activity seems to be caused by constitutive BCR signaling. Recent work showed that activity of BCR signaling is correlated with increased MCL proliferation.12 It seems conceivable that this could be caused by MALT1-induced upregulation of the oncogenic transcription factor MYC. MYC is crucial for the regulation of cell proliferation.40 In line, pharmacologic MALT1 inhibition or shRNA- mediated MYC knockdown significantly decreased MCL proliferation. Moreover, Ki-

67 expression as a marker for cell proliferation was significantly higher in primary

MCL samples with MYC expression. MYC expression was detectable in more than

55% of primary MCLs indicating that MYC is frequently expressed in MCL. In our series of primary samples common genetic aberrations such as MYC locus 17 translocations or high-level amplifications that can cause upregulation of MYC were extremely rare, confirming results of previous studies.41,42 However, given that MYC expression and MALT1 activation status did not correlate in all cell lines, additional molecular mechanisms regulate MYC expression in MCL besides MALT1 activity.

Recent work in chronic lymphocytic leukemia (CLL) has linked BCR signaling to upregulation of MYC expression, as anti-IgM-induced BCR signaling increased translation of MYC mRNA in primary CLL cells.43 However, the exact molecular mechanisms how BCR signaling and MYC expression are linked were not elucidated.

Our data using primary splenocytes suggest that MALT1-driven MYC expression is not restricted to MCL, but seems to be a common mechanism of MYC regulation.

MALT1 seems to regulate MYC expression through different mechanisms. We detected a very moderate MYC downregulation on mRNA level following MALT1 knockdown or pharmacologic inhibition of MALT1. However, the predominant mechanism of MYC regulation involves control of MYC stability.

Interestingly, our gene expression data following MALT1 inhibition failed to show downregulation of previously identified NF-κB gene sets including signatures defined in MCL.12 This finding is surprising given the role of MALT1 in activating NF-

κB signaling. The protease activity of MALT1 is dispensable for initial NF-κB activation and instead promotes NF-κB signaling through cleavage of the negative

NF-κB regulators RelB and A20.15,16,44 The mechanisms why downregulation of NF-

κB was not detectable by our transcriptome analyses are unclear and should be addressed in future studies.

Finally, our work revealed that the MALT1-MYC network could be exploited therapeutically in MCL patients. Despite improvements in therapy, MCL remains an incurable disease.1 MALT1 inhibition was highly effective in all MALT1-activated models. These data warrant future clinical trials with MALT1 inhibitors in MCL 18 patients with constitutive MALT1 activity. Moreover, MALT1 inhibition was able to overcome BTKC481S-induced ibrutinib resistance and might represent a novel therapeutic option for patients failing ibrutinib therapy. Similarly, MYC inhibition was lethal to MYC expressing models. These data suggest that MYC inhibition offers a promising target and a novel therapeutic strategy to overcome therapy resistance in

MCL patients.

Acknowledgements

We thank André Weilemann for technical support. This work was supported by research grants to G.L. from the Deutsche Forschungsgemeinschaft (DFG), the Else

Kröner-Fresenius-Stiftung, the Brigitte und Dr. Konstanze Wegener-Stiftung, the

Deutsche Krebshilfe and the Swiss National Science Foundation (Sinergia grant). In addition, this work was also supported by the DFG EXC 1003 Cells in Motion -

Cluster of Excellence, Münster, Germany. P.K. was supported by the Ministry of

Health of the Czech Republic grant AZV 15-27757A. R.S. and W.K. were supported by the e:BIO project MMML-MYC-Sys, by the German Ministry for Education and

Research, funding number 0316166B and 0316166I. A.S., E.H. and G.O. were supported by the Robert-Bosch-Foundation, Stuttgart, Germany. D.K. was supported by the Wilhelm Sander-Stiftung (2012.075.2).

Authorship

Contribution: B.D. designed research, performed experiments, analyzed data, and wrote the manuscript; M.G. performed bioinformatic and biophysical analyses; M.J.,

P.K., E.H., J.M., G.S., S.M.A., E.H., N.V., A.M.S., T.E., W.X., K.E., N.D., and H.M. performed and analyzed experiments; W.E.B., M.T., M.D., K.J., P.L., A.R., R.S., A.T., 19

W.K., I.A., D.K., G.O., M.T. analyzed data; G.L. designed research, analyzed data, and wrote the manuscript.

Conflict-of-interest disclosure: The authors declare no conflict of interest.

Correspondence: Georg Lenz, Translational Oncology, University Hospital Münster,

Albert-Schweitzer-Campus 1, 48149 Münster, Germany; e-mail: [email protected]. 20

References

1. Campo E, Rule S. Mantle cell lymphoma: evolving management strategies. Blood. 2015;125(1):48-55. 2. Bernard M, Gressin R, Lefrere F, et al. Blastic variant of mantle cell lymphoma: a rare but highly aggressive subtype. Leukemia. 2001;15(11):1785-1791. 3. Jares P, Colomer D, Campo E. Genetic and molecular pathogenesis of mantle cell lymphoma: perspectives for new targeted therapeutics. Nat Rev Cancer. 2007;7(10):750-762. 4. Perez-Galan P, Dreyling M, Wiestner A. Mantle cell lymphoma: biology, pathogenesis, and the molecular basis of treatment in the genomic era. Blood. 2011;117(1):26-38. 5. Hoster E, Dreyling M, Klapper W, et al. A new prognostic index (MIPI) for patients with advanced-stage mantle cell lymphoma. Blood. 2008;111(2):558- 565. 6. Rosenwald A, Wright G, Wiestner A, et al. The proliferation gene expression signature is a quantitative integrator of oncogenic events that predicts survival in mantle cell lymphoma. Cancer Cell. 2003;3(2):185-197. 7. Hoster E, Rosenwald A, Berger F, et al. Prognostic Value of Ki-67 Index, Cytology, and Growth Pattern in Mantle-Cell Lymphoma: Results From Randomized Trials of the European Mantle Cell Lymphoma Network. J Clin Oncol. 2016;34(12):1386-1394. 8. Nogai H, Dorken B, Lenz G. Pathogenesis of Non-Hodgkin's Lymphoma. J Clin Oncol. 2011;29(14):1803-1811. 9. Bea S, Valdes-Mas R, Navarro A, et al. Landscape of somatic mutations and clonal evolution in mantle cell lymphoma. Proc Natl Acad Sci U S A. 2013;110(45):18250-18255. 10. Zhang J, Jima D, Moffitt AB, et al. The genomic landscape of mantle cell lymphoma is related to the epigenetically determined chromatin state of normal B cells. Blood. 2014;123(19):2988-2996. 11. Rahal R, Frick M, Romero R, et al. Pharmacological and genomic profiling identifies NF-kappaB-targeted treatment strategies for mantle cell lymphoma. Nat Med. 2014;20(1):87-92. 12. Saba NS, Liu D, Herman SE, et al. Pathogenic role of B-cell receptor signaling and canonical NF-kappaB activation in mantle cell lymphoma. Blood. 2016. 13. Gaide O, Favier B, Legler DF, et al. CARMA1 is a critical lipid raft-associated regulator of TCR-induced NF-kappa B activation. Nat Immunol. 2002;3(9):836- 843. 14. Che T, You Y, Wang D, Tanner MJ, Dixit VM, Lin X. MALT1/paracaspase is a signaling component downstream of CARMA1 and mediates T cell receptor- induced NF-kappaB activation. J Biol Chem. 2004;279(16):15870-15876. 15. Coornaert B, Baens M, Heyninck K, et al. T cell antigen receptor stimulation induces MALT1 paracaspase-mediated cleavage of the NF-kappaB inhibitor A20. Nat Immunol. 2008;9(3):263-271. 16. Hailfinger S, Nogai H, Pelzer C, et al. Malt1-dependent RelB cleavage promotes canonical NF-kappaB activation in lymphocytes and lymphoma cell lines. Proc Natl Acad Sci U S A. 2011;108(35):14596-14601. 17. Hailfinger S, Schmitt A, Schulze-Osthoff K. The paracaspase MALT1 dampens NF-kappaB signalling by cleaving the LUBAC subunit HOIL-1. FEBS J. 2016;283(3):400-402. 18. Elton L, Carpentier I, Staal J, Driege Y, Haegman M, Beyaert R. MALT1 21

cleaves the E3 ubiquitin ligase HOIL-1 in activated T cells, generating a dominant negative inhibitor of LUBAC-induced NF-kappaB signaling. FEBS J. 2016;283(3):403-412. 19. Klein T, Fung SY, Renner F, et al. The paracaspase MALT1 cleaves HOIL1 reducing linear ubiquitination by LUBAC to dampen lymphocyte NF-kappaB signalling. Nat Commun. 2015;6:8777. 20. Douanne T, Gavard J, Bidere N. The paracaspase MALT1 cleaves the LUBAC subunit HOIL1 during antigen receptor signaling. J Cell Sci. 2016;129(9):1775- 1780. 21. Gewies A, Gorka O, Bergmann H, et al. Uncoupling Malt1 threshold function from paracaspase activity results in destructive autoimmune inflammation. Cell Rep. 2014;9(4):1292-1305. 22. Staal J, Driege Y, Bekaert T, et al. T-cell receptor-induced JNK activation requires proteolytic inactivation of CYLD by MALT1. EMBO J. 2011;30(9):1742-1752. 23. Rebeaud F, Hailfinger S, Posevitz-Fejfar A, et al. The proteolytic activity of the paracaspase MALT1 is key in T cell activation. Nat Immunol. 2008;9(3):272- 281. 24. Uehata T, Iwasaki H, Vandenbon A, et al. Malt1-induced cleavage of regnase- 1 in CD4(+) helper T cells regulates immune activation. Cell. 2013;153(5):1036-1049. 25. Jeltsch KM, Hu D, Brenner S, et al. Cleavage of roquin and regnase-1 by the paracaspase MALT1 releases their cooperatively repressed targets to promote T(H)17 differentiation. Nat Immunol. 2014;15(11):1079-1089. 26. Hummel M, Bentink S, Berger H, et al. A biologic definition of Burkitt's lymphoma from transcriptional and genomic profiling. N Engl J Med. 2006;354(23):2419-2430. 27. Ventura RA, Martin-Subero JI, Jones M, et al. FISH analysis for the detection of lymphoma-associated chromosomal abnormalities in routine paraffin- embedded tissue. J Mol Diagn. 2006;8(2):141-151. 28. Ngo VN, Davis RE, Lamy L, et al. A loss-of-function RNA interference screen for molecular targets in cancer. Nature. 2006;441(7089):106-110. 29. Wenzel SS, Grau M, Mavis C, et al. MCL1 is deregulated in subgroups of diffuse large B-cell lymphoma. Leukemia. 2013;27(6):1381-1390. 30. Pelzer C, Cabalzar K, Wolf A, Gonzalez M, Lenz G, Thome M. The protease activity of the paracaspase MALT1 is controlled by monoubiquitination. Nat Immunol. 2013;14(4):337-345. 31. Pfeifer M, Zheng B, Erdmann T, et al. Anti-CD22 and anti-CD79B antibody drug conjugates are active in different molecular diffuse large B-cell lymphoma subtypes. Leukemia. 2015;29(7):1578-1586. 32. Pfeifer M, Grau M, Lenze D, et al. PTEN loss defines a PI3K/AKT pathway- dependent germinal center subtype of diffuse large B-cell lymphoma. Proc Natl Acad Sci U S A. 2013;110(30):12420-12425. 33. Weilemann A, Grau M, Erdmann T, et al. Essential role of IRF4 and MYC signaling for survival of anaplastic large cell lymphoma. Blood. 2015;125(1):124-132. 34. Heinig K, Gatjen M, Grau M, et al. Access to follicular dendritic cells is a pivotal step in murine chronic lymphocytic leukemia B-cell activation and proliferation. Cancer Discov. 2014;4(12):1448-1465. 35. Nogai H, Wenzel SS, Hailfinger S, et al. IkappaB-zeta controls the constitutive NF-kappaB target gene network and survival of ABC DLBCL. Blood. 22

2013;122(13):2242-2250. 36. Hans CP, Weisenburger DD, Greiner TC, et al. Confirmation of the molecular classification of diffuse large B-cell lymphoma by immunohistochemistry using a tissue microarray. Blood. 2004;103(1):275-282. 37. Wang ML, Rule S, Martin P, et al. Targeting BTK with ibrutinib in relapsed or refractory mantle-cell lymphoma. N Engl J Med. 2013;369(6):507-516. 38. Chiron D, Di Liberto M, Martin P, et al. Cell-cycle reprogramming for PI3K inhibition overrides a relapse-specific C481S BTK mutation revealed by longitudinal functional genomics in mantle cell lymphoma. Cancer Discov. 2014;4(9):1022-1035. 39. Jaworski M, Marsland BJ, Gehrig J, et al. Malt1 protease inactivation efficiently dampens immune responses but causes spontaneous autoimmunity. EMBO J. 2014;33(23):2765-2781. 40. Eilers M, Eisenman RN. Myc's broad reach. Genes Dev. 2008;22(20):2755- 2766. 41. Oberley MJ, Rajguru SA, Zhang C, et al. Immunohistochemical evaluation of MYC expression in mantle cell lymphoma. Histopathology. 2013;63(4):499-508. 42. Choe JY, Yun JY, Na HY, et al. MYC overexpression correlates with MYC amplification or translocation, and is associated with poor prognosis in mantle cell lymphoma. Histopathology. 2016;68(3):442-449. 43. Yeomans A, Thirdborough SM, Valle-Argos B, et al. Engagement of the B-cell receptor of chronic lymphocytic leukemia cells drives global and MYC-specific mRNA translation. Blood. 2016;127(4):449-457. 44. Duwel M, Welteke V, Oeckinghaus A, et al. A20 negatively regulates T cell receptor signaling to NF-kappaB by cleaving Malt1 ubiquitin chains. J Immunol. 2009;182(12):7718-7728. 23

Figure Legends

Figure 1. MALT1 expression and activity in MCL. (A) Immunohistochemical

MALT1 staining of a MALT1 positive MCL case (left picture; original magnification

×200) and a MALT1 negative MCL case (right picture; original magnification ×100).

Images were captured using a Leitz DMRB microscope (Leica Microsystems, Wetzlar,

Germany) equipped with Fluotar objective lenses (10×/0.30 NA, 20×/0.50 NA) and a

KY-F75U digital camera (Victor, Yokohama, Japan) and were processed with the

Diskus Program 4.20 (Hilgers Technical, Königswinter, Germany) that converts and exports images in jpeg file format. (B) MALT1 expression in MCLs determined by immunohistochemistry. (C) Western blot analysis of MALT1, full-length and cleaved forms of CYLD and MYC. MALT1 was highly expressed in CD20+ cells isolated from either PBMCs (patient samples #1 and #2) or lymph nodes (patient samples #3, #4, and #5) of five primary MCL patient samples. Cleaved CYLD indicating MALT1 proteolytic activity was detectable in four of five patient samples. MYC expression was higher in these four samples with activated MALT1. The MCL cell line Z-138 was used as a positive control for MALT1 expression and as a negative control for CYLD cleavage. Asterisk indicates non-specific band, which was not observed in any

MALT1-activated MCL cell lines (Figure 1E). (D) Western blot analysis of MALT1 expression in MCL cell lines. MALT1 protein expression was detectable in all MCL cell lines. (E) Western blot analysis of different MALT1 targets. Cleaved forms of

CYLD, RelB, A20, and BCL10 were detectable in Mino, Jeko-1, Rec-1, SP49, and

SP53 cells. Asterisk indicates non-specific band.

Figure 2. Activation of MALT1 is caused by constitutive BCR signaling in MCL.

(A) Western blot analysis of CD79A, CARD11, CYLD, RelB, and BCL10 following 24 shRNA-mediated knockdown of CD79A and CARD11, respectively. Cleavage of

CYLD, RelB, and BCL10 was significantly downregulated following CD79A or

CARD11 knockdown, respectively, in MALT1-activated cell lines (Jeko-1 and Rec-1), whereas none of these cleaved forms was detectable in MALT1-inactive cell lines

(Maver-1 and Z-138) and the expression levels of the corresponding full-length forms were not affected. (B) shRNA-mediated knockdown of CD79A and CARD11 was toxic to the MALT1-activated cell lines Jeko-1 and Rec-1. In contrast, the MALT1- inactive cell lines Maver-1 and Z-138 were unaffected by CD79A and CARD11 knockdown. A previously described non-toxic shRNA against MSMO1 did not induce toxicity in any cell line. Data are shown as means ± standard deviation of at least three independent experiments. (C) Cell viability of MCL cell lines after incubation with the BTK inhibitor ibrutinib. Representative results from at least three independent replicates are shown. Error bars indicate the standard deviation.

Figure 3. Subsets of MCLs are addicted to MALT1. (A) Effect of MALT1 shRNA #1 and #2 on MALT1 mRNA level in MALT1-activated (Jeko-1 and Rec-1) and MALT1- inactive (Maver-1 and Z-138) MCLs 48 hours after shRNA induction measured by quantitative PCR. MALT1 mRNA levels were normalized to expression of GAPDH.

Error bars indicate the standard deviation. (B) Effect of MALT1 shRNA #1 and #2 on

MALT1 protein in MALT1-activated (Jeko-1 and Rec-1) and MALT1-inactive (Maver-1 and Z-138) MCLs 48 hours after shRNA induction measured by Western blotting. (C)

Effect of MALT1 knockdown by two independent shRNAs on viability of MCL cell lines. A previously described non-toxic shRNA against MSMO1 did not induce toxicity in any cell line. Data are shown as means ± standard deviation of at least three independent experiments. (D) Rescue of Jeko-1 and Rec-1 cells from MALT1 shRNA-induced toxicity by exogenous expression of a MALT1 cDNA. Data are 25 shown as means ± standard deviation of at least three independent experiments. (E)

Western blot analysis of MALT1 knockdown in Jeko-1 mouse xenograft tumor biopsies from cells transduced with MALT1 shRNA #2 compared to control shRNA transduced cells (shRNA against MSMO1). (F) Tumor growth curve of Jeko-1 xenograft mouse models that inducibly express MALT1 shRNA #2 (blue) or a control shRNA against MSMO1 (red). MALT1 knockdown significantly reduced in vivo tumor growth (P = 1.9×10−5, MALT1 shRNA vs. control shRNA on day 12; one-tailed two- sample t-test). Error bars indicate the standard deviation. (G) Western blot analysis of

MCL cell lines, treated with z-VRPR-fmk for 48 hours, for cleavage of CYLD, RelB,

A20, and BCL10 in MALT1-activated MCL cell lines (Mino and SP53) vs. MALT1- inactive MCLs (Maver-1 and Z-138). (H) Cell viability of MCL cell lines after incubation with the MALT1 inhibitor z-VRPR-fmk. Representative results from at least three independent replicates are shown. Error bars indicate the standard deviation.

(I) CFSE staining after treatment with z-VRPR-fmk or DMSO was measured on day zero and after two, four, and six days. In Z-138 cells, no difference in cell proliferation was detectable (P = .4 on day 6). In contrast, Mino cells showed reduced proliferation after treatment with z-VRPR-fmk (P < 10−15 on day 6). Representative results from at least three independent replicates are shown. (J) Western blotting for FLAG and BTK following transduction of Mino cells with either a BTKC481S cDNA or an empty vector.

(K) Determination of cell viability of Mino cells expressing either an empty vector (red) or a BTKC481S cDNA (blue) following treatment with ibrutinib or z-VRPR-fmk.

Representative results from at least three independent replicates are shown. Error bars indicate the standard deviation.

* P < .05, ** P < .01, *** P < .001. 26

Figure 4. MALT1 regulates the gene expression network of MYC in MCL. (A)

Gene expression profiling following pharmacologic inhibition of the proteolytic MALT1 activity using z-VRPR-fmk vs. DMSO in Mino cells. Changes of gene expression were profiled at the indicated time points following treatment with z-VRPR-fmk. Each time point depicted the mean of log2-transformed expression ratios for two replicates.

Gene expression changes were depicted according to the color scale shown. Genes that are involved in critical biological processes are highlighted. (B) Gene set enrichment analysis of a previously described MYC gene expression signature. The

MYC signature was significantly enriched with genes that are downregulated following pharmacologic MALT1 inhibition using z-VRPR-fmk in Mino cells. (C)

Expression levels of MALT1 target genes in MALT1-activated and -inactive MCL cell lines determined by quantitative PCR. mRNA levels of PFKM, CARD9, and MLKL were normalized to expression of GAPDH. Error bars indicate the standard deviation.

(D) MYC mRNA levels in Rec-1 and SP53 cells following shRNA-mediated knockdown of MALT1 as measured by quantitative PCR. MYC mRNA levels were normalized to expression of GAPDH. Error bars indicate the standard deviation. (E)

Treatment with z-VRPR-fmk downregulated MYC protein in the MALT1-activated

MCL cell lines Mino and Rec-1. In contrast, in the MALT1-inactive cell lines Maver-1 and Z-138 MYC was not affected by inhibition of MALT1 activity. Accumulation of full- length BCL10 in MALT1-activated MCL models after treatment with z-VRPR-fmk was used as a surrogate marker of MALT1 inhibition. (F) MALT1 shRNA #1 and #2 downregulated MYC protein in MALT1-activated MCLs (Rec-1 and SP53), but not in

MALT1-inactive MCLs (Maver-1 and Z-138) at the indicated time points after shRNA induction as measured by Western blotting.

N.D., not detectable, N.S., not significant, * P < .05, ** P < .01, *** P < .001. 27

Figure 5. MYC is stabilized by MALT1 function. (A) Primary mouse splenocytes expressing either wild-type MALT1 (+/+) or a catalytically inactive MALT1 mutant

(ki/ki) were stimulated with PMA and ionomycin for the indicated time points.

Stimulation efficiency and MALT1 activation were assessed by Western blotting using anti-p-ERK and anti-CYLD antibodies, respectively. (B) Rec-1 and Mino cells were first treated with z-VRPR-fmk or DMSO for 24 hours and subsequently with cycloheximide (CHX). MYC protein expression was assessed by Western blot using samples collected at the indicated time points. In both cell lines, MALT1 inhibition resulted in a reduced half-life of MYC protein. (C) Mino, Rec-1 and SP53 cells were treated with z-VRPR-fmk or DMSO and subsequently with MG132 or DMSO. MYC protein levels were increased by MG132 treatment as evaluated by Western blotting.

(D) In Rec-1, SP53, Maver-1 and Z-138 cells either a control shRNA against MSMO1 or one of the two MALT1 shRNAs were induced with doxycycline for 24 hours.

Subsequently cells were treated with MG132 or DMSO. MYC protein levels were increased by MG132 treatment in MALT1-activated MCLs (Rec-1 and SP53), but not in MALT1-inactive MCLs (Maver-1 and Z-138) as evaluated by Western blotting.

Figure 6. MYC expression in MCL. (A) Western blot analysis of MYC expression in ten MCL cell lines and in the MM cell line U266. All MCL cell lines had detectable

MYC expression compared to the negative control U266. (B) Immunohistochemical

MYC staining of a MYC positive MCL case (left picture; original magnification ×400) and a MYC negative MCL case (right picture; original magnification ×400). Images were captured using an Olympus BX51 microscope (Olympus, Tokio, Japan) equipped with an Olympus DP73 camera (Olympus) and were processed with

Olympus cellSens software (Olympus). (C) Frequency of MYC expression in MCL.

(D) Mean MYC expression in cytological MCL variants. MYC expression was 28 significantly higher in pleomorphic and blastoid variants compared to classical MCLs.

Error bars indicate the standard errors of the mean.

Figure 7. MCLs depend on MYC signaling. (A) shRNA-mediated MYC knockdown induced cytotoxicity in MCL cell lines. A previously described non-toxic shRNA against MSMO1 did not induce toxicity in any cell line. Data are shown as means ± standard deviation of at least three independent experiments. (B) Expression of a

MYC cDNA rescued Jeko-1, Rec-1, and SP53 cells transduced with MYC shRNA #2

(targeting the 3’UTR of MYC) from toxicity. Data are shown as means ± standard deviation of at least two independent experiments. (C) Expression of a MYC cDNA partially rescued Jeko-1, Rec-1, and SP53 cells transduced with MALT1 shRNA #1 from toxicity. Data are shown as means ± standard deviation of at least two independent experiments. (D) Expression of a MYC cDNA partially rescued Jeko-1,

Rec-1, SP53, and Mino cells treated with z-VRPR-fmk from toxicity. Data are shown as means ± standard deviation of at least two independent experiments. (E) shRNA- mediated knockdown of MYC significantly downregulated cell proliferation. Data are shown as means ± standard deviation of at least two independent experiments. (F)

Correlation of Ki-67 and MYC expression determined by immunohistochemistry. Error bars indicate the standard errors of the mean. (G) Viability of MCL cell lines following

MYC inhibition using the small molecule inhibitor 10058-F4 that inhibits MYC-MAX heterodimerization. Baseline MYC expression was assessed by Western blotting

(Figure 6A). Representative results from at least three independent replicates are shown. Error bars indicate the standard deviation.

* P < .05, ** P < .01, *** P < .001. From www.bloodjournal.org by guest on December 8, 2016. For personal use only. Dai et al. Figure 1

A B 100 90 80 70 MCL 60 samples 50 (% of total) 40 30 20 10 0 MALT1 MALT1 positive negative C MCLs MCLs MALT1 (n = 56) (n = 4) -inactive MCL Primary MCL patient samples Z-138 #1 #2 #3 #4 #5

MALT1

Full-length CYLD

* Cleaved CYLD

MYC

Tubulin

D MALT1-activated MALT1-inactive

JVM-2 JVM-13 Mino Jeko-1 Rec-1 SP49 SP53 Z-138 Maver-1 Granta- 519

MALT1

Tubulin

E MALT1-activated MALT1-inactive

VM-2

J JVM-13 Mino Jeko-1 Rec-1 SP49 SP53 Z-138 Maver-1 Granta- 519

Full-length CYLD

Cleaved CYLD

Full-length RelB Cleaved RelB

Full-length A20 Cleaved A20

* Full-length BCL10

Cleaved BCL10

Tubulin From www.bloodjournal.org by guest on December 8, 2016. For personal use only.

Dai et al. Figure 2 A Jeko-1 Rec-1 Jeko-1 Rec-1

shRNA: Control CD79A CD79A Control CD79A CD79A shRNA: Control CARD11 CARD11 Control CARD11 CARD11 #1 #2 #1 #2 #1 #2 #1 #2 CD79A CARD11

Full-length CYLD Full-length CYLD

Cleaved CYLD Cleaved CYLD

Full-length RelB Full-length RelB Cleaved RelB Cleaved RelB

Full-length BCL10 Full-length BCL10

Cleaved BCL10 Cleaved BCL10

Tubulin Tubulin

Maver-1 Z-138 Maver-1 Z-138

shRNA: Control CD79A CD79A Control CD79A CD79A shRNA: Control CARD11 CARD11 Control CARD11 CARD11 #1 #2 #1 #2 #1 #2 #1 #2 CD79A CARD11

Full-length CYLD Full-length CYLD

Cleaved CYLD Cleaved CYLD

Full-length RelB Full-length RelB

Full-length BCL10 Full-length BCL10

Cleaved BCL10 Cleaved BCL10

Tubulin Tubulin

B CD79A shRNA CARD11 shRNA Negative control shRNA 120 120 120 Cell MALT1 100 100 100 Live shRNA- line activity transduced 80 80 80 cells 60 60 60 Jeko-1 Activated Rec-1 Activated (% of day 2 40 40 40 Maver-1 Inactive fraction) 20 20 20 Z-138 Inactive 0 0 0 24681012 24681012 24681012 Days after shRNA transduction Days after shRNA transduction Days after shRNA transduction

C 120

100 Cell MALT1 Cell MALT1 line activity line activity Cell 80 viability Jeko-1 Activated Maver-1 Inactive (% of 60 Rec-1 Activated Z-138 Inactive control) SP53 Activated Granta-519 Inactive 40 SP49 Activated JVM-2 Inactive Mino-1 Activated JVM-13 Inactive 20

0 0 3.125 6.25 12.5 25 50 100 Ibrutinib [nM] Dai et al. Figure 3 A Jeko-1 Rec-1 Maver-1 Z-138

Relative ** ** ** ** ** * * *** MALT1 100 100 100 100 mRNA 80 80 80 80 expression 60 60 60 60 (% of control 40 40 40 40 shRNA) 20 20 20 20 0000 shRNA: ControlMALT1 MALT1 ControlMALT1 MALT1 ControlMALT1 MALT1 ControlMALT1 MALT1 #1 #2 #1 #2 #1 #2 #1 #2 B Jeko-1 Rec-1 Maver-1 Z-138 shRNA: Control MALT1 MALT1 Control MALT1 MALT1 Control MALT1 MALT1 Control MALT1 MALT1 #1 #2 #1 #2 #1 #2 #1 #2 MALT1 Tubulin C MALT1 shRNA #1 MALT1 shRNA #2 Negative control shRNA 140 140 140 Cell MALT1 Cell MALT1 Live shRNA- 120 120 120 line activity line activity 100 100 100 transduced Jeko-1 Activated Maver-1 Inactive cells 80 80 80 60 Rec-1 Activated Z-138 Inactive (% of day 2 60 60 40 40 40 SP53 Activated Granta-519 Inactive fraction) 20 20 20 SP49 Activated JVM-2 Inactive 0 0 0 24681012 24681012 2 4 6 8 10 12 JVM-13 Inactive Days after shRNA transduction Days after shRNA transduction Days after shRNA transduction D Jeko-1 Rec-1 Jeko-1 Rec-1 300 250 300 250 250 Cell 250 200 MALT1 shRNA #1 200 MALT1 shRNA #2 200 200 growth 150 + MALT1 cDNA 150 + MALT1 cDNA 150 MALT1 shRNA #1 150 MALT1 shRNA #2 (%) 100 100 100 + empty vector 100 + empty vector 50 50 50 50 2 4 6 8 10 12 2 4 6 8 10 12 2 4 6 8 10 12 2 4 6 8 10 12 Days after Days after Days after Days after cDNA transduction cDNA transduction cDNA transduction cDNA transduction

E Jeko-1 F 4 3.5 Sample: #1#2 #3 #4 3 Tumor 2.5 *** Jeko-1 + MALT1 shRNA #2 shRNA: Control MALT1 Control MALT1 volume 2 *** Jeko-1 + control shRNA [cm³] 1.5 MALT1 1 ** *** ** 0.5 Tubulin 0 1 3 5 8 10 12 Days after tumor development

G Mino SP53 Maver-1 Z-138 H 120 100 z-VRPR-fmk [50 μM]: -+ -+ -+ -+ Cell 80 Full-length CYLD viability 60 Cleaved CYLD (% of control) 40 Full-length RelB Cleaved RelB 20 Full-length A20 0 Cleaved A20 0 12.5 25 50 Full-length BCL10 z-VRPR-fmk [μM] Cell MALT1 Cell MALT1 Cleaved BCL10 line activity line activity Tubulin Jeko-1 Activated Maver-1 Inactive Rec-1 Activated Z-138 Inactive SP53 Activated Granta-519 Inactive SP49 Activated JVM-2 Inactive Mino-1 Activated JVM-13 Inactive

I d0 d2 d4 d6 J Mino K Mino Empty C481S 120 120 Mino cDNA: BTK vector Cell 100 100 80 80 % of viability FLAG-Tag 60 60 max (% of 40 40 Z-138 BTK control) 20 20 0 0 Tubulin 0 3 6 12 25 50 100 0 12.5 25 50 CFSE Ibrutinib [nM] z-VRPR-fmk [μM] z-VRPR-fmk C481S DMSO BTK Empty vector Dai et al. Figure 4 A B z-VRPR-fmk MYC target gene signature [50 μM] 24h 30h 36h 42h 48h 54h (COLLER_MYC_TARGETS_UP signature) ALKBH2 0.8 CARD9 0.7 CXCR7 0.6 Relative ETS2 Enrichment 0.5 gene score 0.4 expression ITPKA KLHL14 0.3 2x MAPK13 MLKL 0.2 NAMPT 0.1 1x PDE7B PFKM 0 PRMT1 Signature 0.5x PVT1 RAB40B genes

Genes 0.5 sorting 0 SULF2 metric −0.5 2444 up with p<0.05

TNFRSF4 2561 down with p<0.05 WNT10A 1 5000 10000 15000 20000 24000 C PFKM CARD9 MLKL

N.S. N.S. N.S. N.D. N.S. N.S. 140 ** * ** ** 140 ** ** ** *** 140 ** ** ** ** Relative 120 120 120 mRNA 100 100 100 DMSO expression 80 80 80 z-VRPR-fmk (% of 60 60 60 control) 40 40 40 20 20 20 0 0 0 Mino Mino Mino SP53 SP49 SP53 SP49 SP53 SP49 Z-138 Z-138 Z-138 Rec-1 Rec-1 Rec-1 D Maver-1 Maver-1 Maver-1 Rec-1 SP53

N.S. N.S. N.S. N.S. N.S. N.S. N.S. N.S. Relative N.S. N.S. N.S. N.S. N.S. N.S. N.S. N.S. MYC 140 140 120 120 Control shRNA mRNA 100 100 MALT1 shRNA #1 expression 80 80 MALT1 shRNA #2 (% of control 60 60 40 40 shRNA) 20 20 0 0 Time point: 12h 24h 36h 48h 12h 24h 36h 48h E Mino Maver-1 Time point: 12h 24h 36h 48h Time point: 12h 24h 36h 48h z-VRPR-fmk [50 μM]: +- - + - + - + z-VRPR-fmk [50 μM]: +- - + - + - + Full-length BCL10 Full-length BCL10 MYC MYC Tubulin Tubulin Rec-1 Z-138 Time point: 12h 24h 36h 48h Time point: 12h 24h 36h 48h z-VRPR-fmk [50 μM]: +- - + - + - + z-VRPR-fmk [50 μM]: --++++ - - Full-length BCL10 Full-length BCL10 MYC MYC Tubulin Tubulin F Rec-1 Maver-1 Time point: 12h 24h 36h 48h Time point: 12h 24h 36h 48h Control shRNA: + - - + - - + - - + - - Control shRNA: + - - + - - + - - + - - MALT1 shRNA: - #1 #2 - #1 #2 - #1 #2 - #1 #2 MALT1 shRNA: - #1 #2 - #1 #2 - #1 #2 - #1 #2 MALT1 MALT1 MYC MYC Tubulin Tubulin SP53 Z-138 Time point: 12h 24h 36h 48h Time point: 12h 24h 36h 48h Control shRNA: + - - + - - + - - + - - Control shRNA: + - - + - - + - - + - - MALT1 shRNA: - #1 #2 - #1 #2 - #1 #2 - #1 #2 MALT1 shRNA: - #1 #2 - #1 #2 - #1 #2 - #1 #2 MALT1 MALT1 MYC MYC Tubulin Tubulin From www.bloodjournal.org by guest on December 8, 2016. For personal use only. From www.bloodjournal.org by guest on December 8, 2016. For personal use only.

Dai et al. Figure 6 A B MCL MM MALT1-activated MALT1-inactive

VM-13

JVM-2 J U266 Jeko-1 Rec-1 SP49 SP53 Z-138 Maver-1 Granta- 519 Mino MYC

Tubulin

C D 100 100 90 80 80 70 P = 2.6×10−5 MCL 60 MYC negative MCLs (n = 104) Mean 60 Classical MCLs (n = 154) samples 50 MYC intermediate positive MCLs (n = 75) MYC P = 9.9×10−4 P = .404 Pleomorphic MCLs (n = 34) (% of total) 40 MYC positive MCLs (n = 55) expression 40 Blastoid MCLs (n = 40) 30 20 10 20 0 0 From www.bloodjournal.org by guest on December 8, 2016. For personal use only.

Dai et al. Figure 7 A MYC shRNA #1 MYC shRNA #2 Negative control shRNA Cell MALT1 Cell MALT1 120 120 120 line activity line activity Live shRNA- 100 100 100 transduced 80 80 80 Jeko-1 Activated Maver-1 Inactive cells 60 60 60 Rec-1 Activated Z-138 Inactive 40 40 40 (% of day 2 SP53 Activated Granta-519 Inactive fraction) 20 20 20 0 0 0 SP49 Activated JVM-2 Inactive 24681012 2 4 6 8 10 12 24681012 JVM-13 Inactive Days after Days after Days after shRNA transduction shRNA transduction shRNA transduction

B Jeko-1 Rec-1 SP53 120 120 120 Live shRNA- 100 100 100 MYC cDNA transduced 80 80 80 + MYC shRNA #2 cells 60 60 60 Empty vector (% of day 2 40 40 40 + MYC shRNA #2 fraction) 20 20 20 0 0 0 2 4 6 8 10 12 2 4 6 8 10 12 24681012 Days after Days after Days after shRNA transduction shRNA transduction shRNA transduction

C Jeko-1 Rec-1 SP53 120 120 120 Live shRNA- 100 100 100 MYC cDNA transduced 80 80 80 + MALT1 shRNA #1 cells 60 60 60 Empty vector (% of day 2 40 40 40 + MALT1 shRNA #1 fraction) 20 20 20 0 0 0 24681012 24681012 24681012 Days after Days after Days after shRNA transduction shRNA transduction shRNA transduction D Jeko-1 Rec-1 SP53 Mino 120 120 120 120 100 100 100 100 Cell 80 80 80 80 viability MYC cDNA 60 60 60 60 (% of Empty vector 40 40 40 40 control) 20 20 20 20 0 0 0 0 0 12.5 25 50 0 12.5 25 50 0 12.5 25 50 0 12.5 25 50 z-VRPR-fmk [μM] z-VRPR-fmk [μM] z-VRPR-fmk [μM] z-VRPR-fmk [μM]

E F Rec-1 SP53 100 P = 4.6×10−24

P = 1.4×10−12 *** ** 120 *** 120 ** 80 100 100 Proliferation Mean 60 MYC negative MCLs (n = 104) 80 80 (% of control Ki-67 P = 1.1×10−6 MYC intermediate positive MCLs (n = 75) 60 60 shRNA) expression 40 MYC positive MCLs (n = 55) 40 40 20 20 20 0 0 shRNA: Control MYC MYC Control MYC MYC 0 #1 #2 #1 #2

G 120

100 Cell Lymphoma MYC line subtype status Cell 80 viability Maver-1 MCL + 60 (% of Z-138 MCL + control) 40 Rec-1 MCL + Mino MCL + 20 U266 MM -

0 0.40 0.80 10058-F4 [μM] 1

B-cell receptor driven MALT1 activity regulates MYC signaling in mantle cell lymphoma

Supplemental Material and Methods

Immunohistochemistry

Five reactive lymph node and tonsil specimens, 234 formalin-fixed, paraffin- embedded (FFPE) mantle cell lymphoma (MCL) samples, 93 diffuse large B-cell lymphoma (DLBCL) samples and seven Burkitt lymphoma (BL) samples were analyzed by immunohistochemistry. MYC staining was performed as described.1 A cut-off level of ≥30% tumor cells with distinct nuclear staining was applied to define

MYC positivity.1,2 Samples with <10% positive cells were defined as MYC negative.

Samples with ≥10% and <30% positive cells were determined as MYC intermediate positive. Ki-67 staining was done as described.3 MALT1 immunohistochemistry was performed using the anti-human MALT1 antibody clone 50 (AbD Serotec, Puchheim,

Germany) or the anti-human MALT1 antibody MT1/410 (Abcam, Cambridge, UK).

Cell culture, retroviral constructs and transductions

The human MCL cell lines Mino, Jeko-1, Rec-1, SP49, SP53, Z-138, Maver-1, and

Granta-519 were cultured in RPMI 1640 with 10% or 20% fetal calf serum. Two MCL cell lines JVM-2 and JVM-13 as well as the multiple myeloma (MM) cell line U266 were cultured in Iscove´s modified Dulbecco´s medium supplemented with 20% human plasma. All cell lines were maintained at 37°C with 5% CO2.

For efficient retroviral transductions, all cell lines were engineered to express the murine ecotropic receptor as previously described.4,5 Additionally, these cell lines were engineered to express the bacterial tetracycline repressor allowing doxycycline- 2 inducible small hairpin RNA (shRNA) or complementary DNA (cDNA) expression.4,5

The shRNA-mediated RNA interference and cytotoxicity assays were performed as described.4,5 In brief, to assess toxicity of the shRNA, retroviruses that co-express green fluorescent protein (GFP) were used. Flow cytometry was performed two days after shRNA transduction to determine the initial GFP-positive proportion of live cells for each shRNA. Subsequently, cells were cultured with doxycycline (20 ng/mL) to induce shRNA expression and sampled over time. The GFP-positive proportion at each time point was normalized to that of the day two fraction. The targeting sequence of the utilized shRNAs directed against BCL10, CARD11, CD79A, MALT1 and MYC are summarized in Supplemental Table 1. As a negative control shRNA, we used a previously described shRNA against MSMO1 (Supplemental Table 1).5

Each shRNA experiment was performed at least three times for each cell line. For the

MALT1 and MYC rescue experiments a MALT1 cDNA (NM_006785.3) and a MYC cDNA (NM_002467.2) were created and the experiment was performed as described.5,6 The MALT1 rescue experiment was performed at least three times and the MYC rescue experiment at least two times. Expression of the BTKC481S cDNA in

Mino, Jeko-1, Rec-1, SP49, SP53, Z-138 and Maver-1 cells was performed as described.7

Isolation and stimulation of mouse splenocytes

Primary mouse splenocytes were isolated from C57/BL6 littermates expressing either wild-type MALT1 (+/+) or a catalytically inactive C472A mutant of MALT1 (ki/ki) as described.8 Splenocyte stimulation was initiated by addition of phorbol myristate acetate (PMA; 80 ng/mL; Alexis, Enzo Life Sciences, Lausen, Switzerland) and ionomycin (1 μM; Calbiochem, Merck, Darmstadt, Germany) and cells were incubated for the indicated times at 37°C. 3

In vivo xenograft mouse studies

For in vivo testing of the Jeko-1 xenograft mouse models, six to eight week old female NOD.Cg-Prkdc severe combined immunodeficiency Il2rgtm1Wjl/SzJ (NSG;

Jackson Laboratory, Bar Harbor, ME, USA) mice were used. To induce either MALT1 shRNA #2 or the non-toxic shRNA against MSMO1, mice received drinking water supplemented with 1 mg/mL doxycycline (Genaxxon, Ulm, Germany) and 5% sucrose immediately after they developed macroscopic signs of s.c. tumors. Tumor size was measured three times weekly in two dimensions for each mouse using caliper. Tumor volume was calculated according to the following formula: 1/2 ×

(length × width2). All animal experiments were approved by the institutional Animal

Care and Use Committee, as well as by the Research and Higher Education section of the Ministry of Education, Youth and Sports of the Czech Republic under the number 592/15 (MSMT-11255/2015-4).

Viability assay, analysis of cell cycle, apoptosis, proliferation

MCL cell lines were incubated with different concentrations of z-VRPR-fmk (Bachem,

Bubendorf, Switzerland), 10058-F4 (Sigma-Aldrich, Schnelldorf, Germany), ibrutinib

(Selleckchem, Houston, TX, USA), and doxorubicin (Sigma-Aldrich). Cell viability was measured after three days (doxorubicin and 10058-F4), five days (ibrutinib) or seven days (z-VRPR-fmk) of incubation using the Cell Titer Glo Assay (Promega,

Dübendorf, Switzerland) as previously described.5,9 Each experiment was reproduced at least two times for each cell line.

The number of cell divisions following treatment with z-VRPR-fmk or DMSO was quantified by using the following equation and stated as mean ± standard deviation of at least three independent experiments for each cell line. 4

tf Nt=N02

Variables:

Nt Numbers of cells at time t N0 Numbers of cells initially t Time (days) f Frequency of cell division per day

Gene expression profiling

Gene expression profiling was performed 24, 30, 36, 42, 48, and 54 hours following treatment with z-VRPR-fmk or DMSO in cell lines Mino and Rec-1 as previously described.10 Total RNA was isolated using the NucleoSpin RNA II Kit (Macherey &

Nagel, Oensingen, Switzerland) according to the manufacturer's protocol. RNA was amplified and labeled with the TotalPrep RNA Amplification Kit (Illumina, Thermo

Fisher Scientific, Waltham, MA, USA). Samples were subsequently hybridized on

HumanHT-12 v4 Expression Bead Chips (Illumina) following the manufacturer's protocol as previously described.10,11 Gene expression changes were measured in two independent biological replicates for each time point in Mino cells and in one experiment in Rec-1 cells. Gene expression changes in Mino and Rec-1 cells treated with z-VRPR-fmk were compared to cells treated with DMSO. The independent measurements were preprocessed and normalized in the following manner. Data were imported on raw bead level and subsequently a bead level spot filter was applied to each microarray experiment based on the fitted density mode for the background intensities. Afterwards, bead intensities of all measured microarrays were quantile-normalized and beads were grouped by measured sequence to form beadsets. Beadsets with more than 50% of their beads excluded by the spot filter were also excluded. Further analyses were performed on gene level using median aggregation and manufacturer’s annotations. 5

Differentially expressed genes were identified in the following manner. A one- tailed paired t-test was used to calculate P-values for each gene based on all the microarray pairs. Additionally, we used the Benjamini & Hochberg method to calculate a false discovery rate (FDR) for every significance threshold. In Rec-1 cells, we identified 113 genes that were significantly downregulated (P ≤ .0025; FDR = .09) and 223 genes that were significantly upregulated (P ≤ .0025; FDR = .05) across all time points following inhibition of MALT1 (paired t-tests over all time points of on one experiment; Supplemental Table 5). In Mino cells, we identified 93 genes that were significantly downregulated (P ≤ 1×10−5; FDR = .0002) and 126 genes that were significantly upregulated (P ≤ 1×10−5; FDR = .0001) across all time points following inhibition of MALT1 (paired t-tests over all time points of two independent replicates;

Supplemental Table 2).

The gene set enrichment analysis (GSEA) was performed as previously described against an integrated database with 13,593 gene signatures, comprised of signatures from the Molecular Signatures Database v4, the GeneSigDB v4, HGCN gene families and the Staudt laboratory library.12-16 Signatures with less than eight measured genes were excluded. GSEA P-values were computed by permutation tests and FDRs were computed relative to respective signature families. Top enriched signatures with an absolute enrichment score ≥ .7 in cell lines Mino and

Rec-1 after treatment with z-VRPR-fmk are presented in Supplemental Table 3 and

6, respectively.

Western blotting and analysis of MYC stability

Western blotting was performed as described.5 Image acquisition was performed using Amersham Imager 600 (GE Healthcare Life Sciences, Chicago, IL, USA). Band quantification was performed using the ImageQuant TL software (GE Healthcare Life 6

Sciences). All antibodies used in this study were obtained from Cell Signaling

(Danvers, MA, USA) except of antibodies detecting A20, full-length BCL10, MYC

(Abcam, Cambridge, UK), and α-Tubulin (Sigma-Aldrich). Antibodies directed against cleaved BCL10 and MALT1 have been previously described.17,18 Full-length and cleaved isoforms of RelB, A20 and CYLD were detected with the same antibody, whereas full-length and cleaved forms of BCL10 were detected with different antibodies as stated above.

Non-transduced cells treated with z-VRPR-fmk (50 μM) or DMSO for the indicated time points or cells transduced with inducible MALT1 shRNAs and treated with doxocycline for 24 hours were incubated with 5 μM MG132 (Selleckchem,

Houston, TX, USA) or 10 μg/mL cycloheximide (Santa Cruz Biotechnology,

Heidelberg, Germany) at 37°C, harvested, and subjected to immunoblotting.

References

1. Weilemann A, Grau M, Erdmann T, et al. Essential role of IRF4 and MYC signaling for survival of anaplastic large cell lymphoma. Blood. 2015;125(1):124-132. 2. Gupta M, Maurer MJ, Wellik LE, et al. Expression of Myc, but not pSTAT3, is an adverse prognostic factor for diffuse large B-cell lymphoma treated with epratuzumab/R-CHOP. Blood. 2012;120(22):4400-4406. 3. Ott G, Kalla J, Ott MM, et al. Blastoid variants of mantle cell lymphoma: frequent bcl-1 rearrangements at the major translocation cluster region and tetraploid chromosome clones. Blood. 1997;89(4):1421-1429. 4. Ngo VN, Davis RE, Lamy L, et al. A loss-of-function RNA interference screen for molecular targets in cancer. Nature. 2006;441(7089):106-110. 5. Wenzel SS, Grau M, Mavis C, et al. MCL1 is deregulated in subgroups of diffuse large B-cell lymphoma. Leukemia. 2013;27(6):1381-1390. 6. Pelzer C, Cabalzar K, Wolf A, Gonzalez M, Lenz G, Thome M. The protease activity of the paracaspase MALT1 is controlled by monoubiquitination. Nat Immunol. 2013;14(4):337-345. 7. Rahal R, Frick M, Romero R, et al. Pharmacological and genomic profiling identifies NF-kappaB-targeted treatment strategies for mantle cell lymphoma. Nat Med. 2014;20(1):87-92. 8. Jaworski M, Marsland BJ, Gehrig J, et al. Malt1 protease inactivation efficiently dampens immune responses but causes spontaneous autoimmunity. EMBO J. 2014;33(23):2765-2781. 9. Pfeifer M, Zheng B, Erdmann T, et al. Anti-CD22 and anti-CD79B antibody drug conjugates are active in different molecular diffuse large B-cell lymphoma subtypes. Leukemia. 2015;29(7):1578-1586. 10. Pfeifer M, Grau M, Lenze D, et al. PTEN loss defines a PI3K/AKT pathway- dependent germinal center subtype of diffuse large B-cell lymphoma. Proc Natl Acad Sci U S A. 2013;110(30):12420-12425. 11. Nogai H, Wenzel SS, Hailfinger S, et al. IkappaB-zeta controls the constitutive NF-kappaB target gene network and survival of ABC DLBCL. Blood. 2013;122(13):2242-2250. 12. Subramanian A, Tamayo P, Mootha VK, et al. Gene set enrichment analysis: A knowledge-based approach for interpreting genome-wide expression profiles. Proc Natl Acad Sci U S A. 2005;102(43):15545-15550. 13. Liberzon A, Subramanian A, Pinchback R, Thorvaldsdottir H, Tamayo P, Mesirov JP. Molecular signatures database (MSigDB) 3.0. Bioinformatics. 2011;27(12):1739-1740. 14. Culhane AC, Schroder MS, Sultana R, et al. GeneSigDB: a manually curated database and resource for analysis of gene expression signatures. Nucleic Acids Res. 2012;40(Database issue):D1060-1066. 15. Gray KA, Daugherty LC, Gordon SM, Seal RL, Wright MW, Bruford EA. Genenames.org: the HGNC resources in 2013. Nucleic Acids Res. 2013;41(Database issue):D545-552. 16. Shaffer AL, Wright G, Yang L, et al. A library of gene expression signatures to illuminate normal and pathological lymphoid biology. Immunol Rev. 2006;210:67-85. 17. Rebeaud F, Hailfinger S, Posevitz-Fejfar A, et al. The proteolytic activity of the paracaspase MALT1 is key in T cell activation. Nat Immunol. 2008;9(3):272- 281. 8

18. Hailfinger S, Lenz G, Ngo V, et al. Essential role of MALT1 protease activity in activated B cell-like diffuse large B-cell lymphoma. Proc Natl Acad Sci U S A. 2009;106(47):19946-19951.

Supplemental Figures

Supplemental Figure 1. MALT1 expression in normal reactive tissue.

Immunohistochemical MALT1 staining of a reactive tonsil specimen (original magnification ×200). Image was captured using an Olympus BX51 microscope

(Olympus, Tokio, Japan) equipped with an Olympus DP73 camera (Olympus) and was processed with Olympus cellSens software (Olympus).

Supplemental Figure 2. Toxicity of shRNA-mediated knockdown of BCL10 in

MCL cell lines. (A) A BCL10 shRNA downregulates BCL10 protein in MALT1- activated (Jeko-1 and Rec-1) and MALT1-inactive (Maver-1 and Z-138) MCLs 48 hours after shRNA induction measured by Western blotting. (B) BCL10 knockdown induced toxicity in MALT1-activated MCLs (Jeko-1 and Rec-1), whereas it did not affect MALT1-inactive MCLs (Maver-1 and Z-138). A previously described non-toxic shRNA against MSMO1 did not induce toxicity in any cell line. Data are shown as means ± standard deviation of at least three independent experiments.

Supplemental Figure 3. Cell cycle analysis following pharmacologic MALT1 inhibition. Cell cycle distribution of Mino and Z-138 cells after treatment with z-

VRPR-fmk or DMSO alone was measured on day zero and after two, four, and six days. In both Mino and Z-138 cells no difference in cell cycle distribution was detectable. Data are expressed as means ± standard deviation of at least two independent experiments.

Supplemental Figure 4. Inhibition of MALT1 overcomes BTKC481S-induced ibrutinib resistance in MALT1-activated MCLs. Western blotting for FLAG and 10

BTK following transduction of MCL cells with either a BTKC481S cDNA or an empty vector (A. Jeko-1; C. Rec-1; E. SP53; G. SP49; I. Maver-1; K. Z-138). Determination of cell viability of MCL cells expressing either an empty vector (red) or a BTKC481S cDNA (blue) following treatment with ibrutinib or z-VRPR-fmk (B. Jeko-1; D. Rec-1; F.

SP53; H. SP49; J. Maver-1; L. Z-138). Representative results from at least two independent replicates are shown. Error bars indicate the standard deviation.

Supplemental Figure 5. Inhibition of MALT1 suppresses the gene expression network of MYC in Mino cells. (A) Gene expression profiling following MALT1 inhibition in Mino cells. Changes of gene expression were profiled at the indicated time points following treatment with z-VRPR-fmk relative to treatment with DMSO only. Each time point depicted the mean of log2-transformed expression ratios for two replicates according to the color scale shown. (B) Inhibition of MALT1 significantly downregulated the previously identified MYC target gene signature

“COLLER_MYC_TARGETS_UP”. Changes of gene expression were profiled at the indicated time points following inhibition of MALT1. Each time point depicted the mean of log2-transformed expression ratios for two replicates. Gene expression changes were depicted according to the color scale shown.

Supplemental Figure 6. Inhibition of MALT1 suppresses the gene expression network of MYC in Rec-1 cells. (A) Gene expression profiling following pharmacologic inhibition of the proteolytic MALT1 activity using z-VRPR-fmk vs.

DMSO in Rec-1 cells. Changes of gene expression were profiled at the indicated time points following treatment with z-VRPR-fmk. Gene expression changes are depicted according to the color scale shown. Genes that are involved in critical biological processes are highlighted. (B) Gene expression profiling following MALT1 inhibition 11 in Rec-1 cells. Changes of gene expression were profiled at the indicated time points following treatment with z-VRPR-fmk relative to treatment with DMSO only. Gene expression changes are depicted according to the color scale shown. A fraction of genes that were also upregulated in Mino cells following MALT1 inhibition are highlighted. (C) Gene set enrichment analysis of a previously described MYC gene expression signature. The MYC signature was significantly enriched with genes that are downregulated following pharmacologic MALT1 inhibition using z-VRPR-fmk in

Rec-1 cells. (D) Inhibition of MALT1 significantly downregulated the previously identified MYC target gene signature “COLLER_MYC_TARGETS_UP” in Rec-1 cells.

Changes of gene expression were profiled at the indicated time points following inhibition of MALT1. Gene expression changes were depicted according to the color scale shown. (E) Downregulation of the Mino target gene signature (Figure 4A) in

Rec-1 cells. Changes of gene expression were profiled at the indicated time points following treatment with z-VRPR-fmk relative to treatment with DMSO only. Gene expression changes are depicted according to the color scale shown. Genes that are highlighted in Figure 4A are also highlighted here.

Supplemental Figure 7. Expression levels of MALT1 target genes in MALT1- activated and -inactive MCL cell lines following MALT1 inhibition. mRNA levels of ITPKA, MAPK13, PVT1, ETS2, NAMPT, KIF26B, C10orf10, and ALKBH2 in the indicated MCL cell lines following MALT1 inhibition were normalized to expression of

GAPDH. Error bars indicate the standard deviation.

N.D., not detectable, N.S., not significant, * P < .05, ** P < .01, *** P < .001.

Supplemental Figure 8. Downregulation of MYC protein expression in MALT1- activated MCLs following ibrutinib treatment. MYC expression on protein level 12 was downregulated in MALT1-activated MCLs (Mino and Rec-1), but not in MALT1- inactive MCLs (Maver-1 and Z-138) following Bruton’s tyrosine kinase (BTK) inhibition using the small molecule inhibitor ibrutinib.

Supplemental Figure 9. Protein quantification of Western blot data depicted in

Figure 5B and 5C. (A) Protein quantification of Western blot of Figure 5B. The MYC measurements of cells incubated with cycloheximide (CHX) were normalized to matched tubulin measurements and then depicted as a ratio of the normalized values of cells without CHX incubation. (B) Protein quantification of Western blot of Figure

5C. At indicated time points, the MYC measurements of cells treated with z-VRPR- fmk were normalized to matched tubulin measurements and then shown as a ratio of the normalized values of cells treated with DMSO.

Supplemental Figure 10. Protein quantification of Western blot data depicted in

Figure 6A. For all cell lines MYC measurements were normalized to matched tubulin measurements and then depicted as fold change compared to the normalized values of U266 cells.

Supplemental Figure 11. MYC expression in MYC positive lymphomas.

Immunohistochemical MYC staining of a BL case (left picture; original magnification

×400) and a DLBCL case (right picture; original magnification ×400). Images were captured using an Olympus BX51 microscope (Olympus) equipped with an Olympus

DP73 camera (Olympus) and were processed with Olympus cellSens software

(Olympus).

Supplemental Figure 12. Functional role of MYC in MCL. (A) MYC shRNA #1 and

#2 significantly downregulated MYC protein measured by Western blotting in Rec-1 and SP53 cells. (B) Expression of a MYC cDNA partially rescued Jeko-1, Rec-1, and

SP53 cells transduced with MALT1 shRNA #2 from toxicity. Data are shown as means ± standard deviation of at least two independent experiments. (C) Expression of a MYC cDNA did not rescue Jeko-1, Rec-1, SP53, and Mino cells treated with doxorubicin for 72 hours from toxicity. Representative results from two independent replicates are shown. Error bars indicate the standard deviation. (D) Correlation of

MYC and Ki-67 expression in MCL (r = .63; P = 5×10−27).

Dai et al. Supplemental Figure 1 Dai et al. Supplemental Figure 2 A Jeko-1 Rec-1 Maver-1 Z-138

shRNA: Control BCL10 shRNA: Control BCL10 shRNA: Control BCL10 shRNA: Control BCL10 BCL10 BCL10 BCL10 BCL10

Tubulin Tubulin Tubulin Tubulin

B BCL10 shRNA Negative control shRNA 120 120 Cell MALT1 100 100 Live shRNA- line activity transduced 80 80 cells 60 60 Jeko-1 Activated Rec-1 Activated (% of day 2 40 40 Maver-1 Inactive fraction) 20 20 Z-138 Inactive 0 0 2 4 6 8 10 12 2 4 6 8 10 12 Days after shRNA transduction Days after shRNA transduction Dai et al. Supplemental Figure 3

Mino Z-138

d0 d2 d4 d6 d0 d2 d4 d6 100 100 SubG1 80 80 G0/G1 Cell cycle Cell cycle 60 60 S distribution distribution (%) 40 (%) 40 G2/M 20 20 0 0 z-VRPR-fmk [50 μM]: - + - + - + - + z-VRPR-fmk [50 μM]: - + - + - + - + Dai et al. Supplemental Figure 4 A B Jeko-1 Jeko-1 Empty C481S 120 120 cDNA: BTK vector Cell 100 100 viability 80 80 BTKC481S FLAG-Tag 60 60 (% of 40 40 Empty vector BTK control) 20 20 0 0 Tubulin 0 3 6 12 25 50 100 0 12.5 25 50 Ibrutinib [nM] z-VRPR-fmk [μM]

C Rec-1 D Rec-1 Empty C481S 120 120 cDNA: BTK vector Cell 100 100 viability 80 80 BTKC481S FLAG-Tag 60 60 (% of 40 40 Empty vector BTK control) 20 20 0 0 Tubulin 0 3 6 12 25 50 100 0 12.5 25 50 Ibrutinib [nM] z-VRPR-fmk [μM] E SP53 F SP53 Empty C481S 120 120 cDNA: BTK vector Cell 100 100 viability 80 80 BTKC481S FLAG-Tag 60 60 (% of 40 40 Empty vector BTK control) 20 20 0 0 Tubulin 0 3 6 12 25 50 100 0 12.5 25 50 Ibrutinib [nM] z-VRPR-fmk [μM]

G SP49 H SP49 Empty C481S 120 120 cDNA: BTK vector Cell 100 100 viability 80 80 BTKC481S FLAG-Tag 60 60 (% of 40 40 Empty vector BTK control) 20 20 0 0 Tubulin 0 3 6 12 25 50 100 0 12.5 25 50 Ibrutinib [nM] z-VRPR-fmk [μM]

I Maver-1 J Maver-1 Empty C481S 120 120 cDNA: BTK vector Cell 100 100 viability 80 80 BTKC481S FLAG-Tag 60 60 (% of 40 40 Empty vector BTK control) 20 20 0 0 Tubulin 0 3 6 12 25 50 100 0 12.5 25 50 Ibrutinib [nM] z-VRPR-fmk [μM] K Z-138 L Z-138 Empty C481S 120 120 cDNA: BTK vector Cell 100 100 viability 80 80 BTKC481S FLAG-Tag 60 60 (% of 40 40 Empty vector BTK control) 20 20 0 0 Tubulin 0 3 6 12 25 50 100 0 12.5 25 50 Ibrutinib [nM] z-VRPR-fmk [μM] Dai et al. Supplemental Figure 5 A B z-VRPR-fmk z-VRPR-fmk [50 μM] 24h 30h 36h 42h 48h 54h [50 μM] 24h 30h 36h 42h 48h 54h

ABCA1 AHCY ABHD8 AK4 ADARB1 ASS1 ALDH5A1 Relative APOC2 gene C1QBP APOD CCND2 ARSD expression CEBPZ BACH2 CKS2 BEST3 EIF5A BHLHE40 1.5x FABP5 C12orf57 FBL C16orf93 FKBP4 CAND2 G0S2 CASZ1 CBLB 1x GPI CCNG2 GRPEL1 CD24 HDGF HSPD1 CD72 CD81 IARS CDKN2D NAMPT CIITA 0.67x NCL CNR1 ODC1 COQ10A POLR2H CXCL16 PPIF CXCR4 CYFIP2 SLC16A1 DDX54 TFRC DENND2A TRAP1 DENND2D DFNA5 DOK3 EBF1 EMP3 EPSTI1 ETV5 FBXO32 FCGRT FLJ42627 GBE1 GLRX GLRXP3 GM2A GNG7 GPR160 GPR18 HBEGF HCP5 HES6 HLA−DPA1 HLA−DPB1 HLA−DRA Relative IRF1 IRF9 gene KIAA1683 KLF2 expression KLHL22 KLHL24 KLHL6 2x LAMP5 LGALS1 LILRB4 LINC00426 LOC728743 1x LRMP LY86 LYL1 MDK MFGE8 MIS18BP1 0.5x MYB NINJ2 NPAS1 NPC2 NUB1 NUCB2 OAS1 OAS2 OAS3 P2RY8 PARP15 PARP9 PARVG PELI2 PPP1R16B PRKCE PRR5 RARRES3 RASGRP2 RGS19 RHBDF1 RHOBTB2 RNF144A RNH1 RRAGD SAMD9 SAMD9L SASH3 SETDB2 SIT1 SLC26A11 SLC29A4 SMAD3 SNX29P2 SOCS1 SOX11 SOX18 SOX4 SSBP2 ST3GAL5 STK38 STMN1 STS TAX1BP3 TMEM136 TNFRSF14 TOP2B TP53INP1 TPP1 TTYH3 VPREB3 WIPI2 WNT3 YPEL5 ZEB2 ZHX2 ZSCAN16 Dai et al. Supplemental Figure 6 A C z-VRPR-fmk MYC target gene signature [50 μM] 24h 30h 36h 42h 48h 54h (COLLER_MYC_TARGETS_UP signature) 0.8 ASS1P11 C9orf173 0.7 0.6 CXCR7 0.5 ETS2 FAM81A Enrichment Relative 0.4 score gene HEY2 0.3 expression KLHL14 0.2 1.5x LMO3 0.1

MSRB1 0 1x NPW Signature PDE7B genes POLR1C 0.67x PPAN

0.5 RPS7 Genes sorting 0 SLC16A9 metric −0.5

SNAPC4 1715 up with p<0.05

SNORD96A 1681 down with p<0.05 TIGIT 1 5000 10000 15000 20000 24000

D z-VRPR-fmk [50 24h 30h 36h 42h 48h 54h B μM] z-VRPR-fmk AHCY Relative AK4 [50 μM] 24h 30h 36h 42h 48h 54h ASS1 ABCA1 gene C1QBP CCND2 ADARB1 expression CEBPZ CKS2 ALDH5A1 1.5x EIF5A APOC2 FABP5 APOD FBL BEST3 FKBP4 BHLHE40 G0S2 GPI C12orf57 1x GRPEL1 HDGF HSPD1 CIITA IARS CXCL16 NAMPT DDX54 DENND2D 0.67x NCL DFNA5 ODC1 EMP3 POLR2H PPIF FBXO32 FCGRT SLC16A1 FLJ42627 TFRC TRAP1 GLRX GNG7 GPR160 HCP5 E z-VRPR-fmk Relative HLA-DPB1 [50 24h 30h 36h 42h 48h 54h HLA-DRA μM] gene ALKBH2 expression IRF1 KLF2 1.5x KLHL24 CARD9 KLHL6 LILRB4 CXCR7 ETS2 LOC728743 Relative 1x LRMP MDK gene MFGE8 expression ITPKA MIS18BP1 KLHL14 0.67x 1.5x NPC2 MAPK13 NUCB2 MLKL OAS2 P2RY8 NAMPT PARP9 PARVG 1x PDE7B PFKM PRR5 PRMT1 RHBDF1 0.67x PVT1 RNF144A RAB40B RRAGD SAMD9 SAMD9L SLC26A11 SLC29A4 SOX11 SSBP2 ST3GAL5

TNFRSF14 SULF2 TOP2B TP53INP1 TPP1 TNFRSF4

P < 10 P < 10 P < 10 P < 10 P < 10 P < 10 WNT10A P - value WIPI2 WNT3 YPEL5

ZHX2 −14 −14 −17 −18 −18 −13 ZSCAN16 Dai et al. Supplemental Figure 7

ITPKA MAPK13 PVT1 ETS2

N.D. N.D. * * * * * * * * N.S. N.D. * * * * * *** N.S. N.S. N.S. N.S. 140 * * * * * * *** 140 140 140 * * * * Relative 120 120 120 120 mRNA 100 100 100 100 DMSO expression 80 80 80 80 z-VRPR-fmk (% of 60 60 60 60 control) 40 40 40 40 20 20 20 20 0 0 0 0 Mino Mino Mino Mino SP53 SP49 SP53 SP49 SP53 SP49 SP53 SP49 Z-138 Z-138 Z-138 Z-138 Rec-1 Rec-1 Rec-1 Rec-1 Maver-1 Maver-1 Maver-1 Maver-1

NAMPT KIF26B C10orf10 ALKBH2

* * * * N.S. N.S. * * N.D. N.D. N.S. * * N.S. N.S. * * N.S. N.S. 140 140 * * * 140 * * *** * * * * * 140 Relative 120 120 120 120 mRNA 100 100 100 100 DMSO expression 80 80 80 80 z-VRPR-fmk (% of 60 60 60 60 control) 40 40 40 40 20 20 20 20 0 0 0 0 Mino Mino Mino Mino SP53 SP49 SP53 SP49 SP53 SP49 SP53 SP49 Z-138 Z-138 Z-138 Z-138 Rec-1 Rec-1 Rec-1 Rec-1 Maver-1 Maver-1 Maver-1 Maver-1 Dai et al. Supplemental Figure 8

Mino 12h 24h 36h 48h Ibrutinib [nM]: 0 5 10 0 5 10 0 5 10 0 5 10 MYC

Tubulin

Rec-1 12h 24h 36h 48h Ibrutinib [nM]: 0 5 10 0 5 10 0 5 10 0 5 10 MYC

Tubulin

Maver-1 12h 24h 36h 48h Ibrutinib [nM]: 0 5 10 0 5 10 0 5 10 0 5 10 MYC

Tubulin

Z-138 12h 24h 36h 48h Ibrutinib [nM]: 0 5 10 0 5 10 0 5 10 0 5 10 MYC

Tubulin Dai et al. Supplemental Figure 9 A 1.4

1.2

1.0 MYC/Tubulin 0.8 (relative Rec-1 expression) 0.6 0.4

0.2

0 DMSO CHX [10 μg/mL] (min): 0 10 20 30 40 50 60 90 z-VRPR-fmk 1.4

1.2

1.0 MYC/Tubulin 0.8 (relative Mino expression) 0.6 0.4

0.2

0 CHX [10 μg/mL] (min): 0 10 20 30 40 50 60 90

B Mino Rec-1 SP53

12h 24h 12h 24h 12h 24h 1.4 1.4 1.4 1.2 1.2 1.2 MYC/Tubulin 1.0 1.0 1.0 DMSO (relative 0.8 0.8 0.8 z-VRPR-fmk expression) 0.6 0.6 0.6 0.4 0.4 0.4 0.2 0.2 0.2 0 0 0 MG132 [5 μM]: - + - + - + - + - + - + Dai et al. Supplemental Figure 10

1200

1000

800 MYC/Tubulin (relative 600 expression) 400

200

0 Mino U266 SP49 SP53 Z-138 Rec-1 JVM-2 Jeko-1 JVM-13 Maver-1 Granta-519 Dai et al. Supplemental Figure 11 A B Dai et al. Supplemental Figure 12 A Rec-1 SP53 shRNA: Control MYC MYC Control MYC MYC #1 #2 #1 #2 MYC Tubulin

B Jeko-1 Rec-1 SP53 140 140 140 Live shRNA- 120 120 120 MYC cDNA transduced 100 100 100 80 80 80 + MALT1 shRNA #2 cells 60 60 60 Empty vector (% of day 2 40 40 40 + MALT1 shRNA #2 fraction) 20 20 20 0 0 0 2 4 6 8 10 12 2 4 6 8 10 12 2 4 6 8 10 12 Days after Days after Days after shRNA transduction shRNA transduction shRNA transduction

C 120 Cell line 100 Jeko-1 + empty vector 80 Jeko-1 + MYC cDNA Cell Rec-1 + empty vector viability 60 Rec-1 + MYC cDNA (% of 40 SP53 + empty vector control) SP53 + MYC cDNA

20 Mino + empty vector Mino + MYC cDNA

0 0 6.25 12.5 25 50 100 200 Doxorubicin [nM]

D 100

70 = One sample 60 Ki-67 = Two samples expression 50 = Three samples = Four samples 40 = Six samples 30

0 10 20 30 40 50 60 70 80 90 100 MYC expression Supplemental Table 1. Sequences of utilized shRNAs.

Target gene shRNA sequence BCL10 shRNA #1: GATGAAGTGCTGAAACTTAGA CARD11 shRNA #1: GGGGTGTGTACCAGGCTATGA CARD11 shRNA #2: GGACGACAACTACAACTTAGC CD79A shRNA #1: GGGGCTTCCTTAGTCATATTC CD79A shRNA #2: CAGCGGGTAATGAGCCCTTAA MALT1 shRNA #1: GGCAGCTACTTGGTATCAAAG MALT1 shRNA #2: GTCACAGAATTGAGTGATTTC MSMO1 shRNA #1: GGATAATGGTGATTGAGATGG MYC shRNA #1: CGATTCCTTCTAACAGAAATG MYC shRNA #2: CCTATGAACTTGTTTCAAATG Supplemental Table 2. Downregulated and upregulated genes following z-VRPR-fmk treatment in Mino cells.

Signature name Gene symbol Gene ID Gene description Downregulated genes (alpha=1e-05) ADAP2 55803 ArfGAP with dual PH domains 2 Downregulated genes (alpha=1e-05) ADM 133 adrenomedullin Downregulated genes (alpha=1e-05) ADTRP 84830 androgen-dependent TFPI-regulating protein Downregulated genes (alpha=1e-05) AK2 204 adenylate kinase 2 Downregulated genes (alpha=1e-05) ALKBH2 121642 alkB, alkylation repair homolog 2 (E. coli) Downregulated genes (alpha=1e-05) ASS1P11 340274 argininosuccinate synthetase 1 pseudogene 11 Downregulated genes (alpha=1e-05) BSPRY 54836 B-box and SPRY domain containing Downregulated genes (alpha=1e-05) C10orf10 11067 chromosome 10 open reading frame 10 Downregulated genes (alpha=1e-05) C1orf186 440712 chromosome 1 open reading frame 186 Downregulated genes (alpha=1e-05) C9orf173 441476 chromosome 9 open reading frame 173 Downregulated genes (alpha=1e-05) CAMP 820 cathelicidin antimicrobial peptide Downregulated genes (alpha=1e-05) CARD9 64170 caspase recruitment domain family, member 9 Downregulated genes (alpha=1e-05) CD247 919 CD247 molecule Downregulated genes (alpha=1e-05) CHCHD10 400916 coiled-coil-helix-coiled-coil-helix domain containing 10 Downregulated genes (alpha=1e-05) CHCHD6 84303 coiled-coil-helix-coiled-coil-helix domain containing 6 Downregulated genes (alpha=1e-05) CHDH 55349 choline dehydrogenase Downregulated genes (alpha=1e-05) CHST7 56548 carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 7 Downregulated genes (alpha=1e-05) COL9A2 1298 collagen, type IX, alpha 2 Downregulated genes (alpha=1e-05) CXCR7 57007 chemokine (C-X-C motif) receptor 7 Downregulated genes (alpha=1e-05) DNASE1L3 1776 deoxyribonuclease I-like 3 Downregulated genes (alpha=1e-05) ETS2 2114 v-ets erythroblastosis virus E26 oncogene homolog 2 (avian) Downregulated genes (alpha=1e-05) FAM46C 54855 family with sequence similarity 46, member C Downregulated genes (alpha=1e-05) FAM81A 145773 family with sequence similarity 81, member A Downregulated genes (alpha=1e-05) FKBP11 51303 FK506 binding protein 11, 19 kDa Downregulated genes (alpha=1e-05) GCSH 2653 glycine cleavage system protein H (aminomethyl carrier) Downregulated genes (alpha=1e-05) GLT25D2 23127 glycosyltransferase 25 domain containing 2 Downregulated genes (alpha=1e-05) HEY2 23493 hairy/enhancer-of-split related with YRPW motif 2 Downregulated genes (alpha=1e-05) IL17RB 55540 interleukin 17 receptor B Downregulated genes (alpha=1e-05) ITPKA 3706 inositol-trisphosphate 3-kinase A Downregulated genes (alpha=1e-05) KIF26B 55083 kinesin family member 26B Downregulated genes (alpha=1e-05) KISS1R 84634 KISS1 receptor Downregulated genes (alpha=1e-05) KLHL14 57565 kelch-like 14 (Drosophila) Downregulated genes (alpha=1e-05) LMO3 55885 LIM domain only 3 (rhombotin-like 2) Downregulated genes (alpha=1e-05) LMO7 4008 LIM domain 7 Downregulated genes (alpha=1e-05) LOC100132439100132439 protein FAM27E3-like Downregulated genes (alpha=1e-05) LOC284837 284837 uncharacterized LOC284837 Downregulated genes (alpha=1e-05) LOC642661 642661 translocase of outer mitochondrial membrane 40 homolog (yeast) pseudogene Downregulated genes (alpha=1e-05) LOC645638 645638 WDNM1-like pseudogene Downregulated genes (alpha=1e-05) MAPK13 5603 mitogen-activated protein kinase 13 Downregulated genes (alpha=1e-05) MLKL 197259 mixed lineage kinase domain-like Downregulated genes (alpha=1e-05) MS4A6A 64231 membrane-spanning 4-domains, subfamily A, member 6A Downregulated genes (alpha=1e-05) MSRB1 51734 methionine sulfoxide reductase B1 Downregulated genes (alpha=1e-05) NAMPT 10135 nicotinamide phosphoribosyltransferase Downregulated genes (alpha=1e-05) NOD2 64127 nucleotide-binding oligomerization domain containing 2 Downregulated genes (alpha=1e-05) NPM3 10360 nucleophosmin/nucleoplasmin 3 Downregulated genes (alpha=1e-05) NPW 283869 neuropeptide W Downregulated genes (alpha=1e-05) NRARP 441478 NOTCH-regulated ankyrin repeat protein Downregulated genes (alpha=1e-05) NRG4 145957 neuregulin 4 Downregulated genes (alpha=1e-05) PDCD2L 84306 programmed cell death 2-like Downregulated genes (alpha=1e-05) PDE7B 27115 phosphodiesterase 7B Downregulated genes (alpha=1e-05) PFKM 5213 phosphofructokinase, muscle Downregulated genes (alpha=1e-05) PIEZO1 9780 piezo-type mechanosensitive ion channel component 1 Downregulated genes (alpha=1e-05) PNMA3 29944 paraneoplastic Ma antigen 3 Downregulated genes (alpha=1e-05) PNP 4860 purine nucleoside phosphorylase Downregulated genes (alpha=1e-05) POLR1C 9533 polymerase (RNA) I polypeptide C, 30kDa Downregulated genes (alpha=1e-05) POLR3G 10622 polymerase (RNA) III (DNA directed) polypeptide G (32kD) Downregulated genes (alpha=1e-05) PPAN 56342 peter pan homolog (Drosophila) Downregulated genes (alpha=1e-05) PPAN-P2RY11 692312 PPAN-P2RY11 readthrough Downregulated genes (alpha=1e-05) PRMT1 3276 protein arginine methyltransferase 1 Downregulated genes (alpha=1e-05) PVT1 5820 Pvt1 oncogene (non-protein coding) Downregulated genes (alpha=1e-05) RAB40B 10966 RAB40B, member RAS oncogene family Downregulated genes (alpha=1e-05) RGS16 6004 regulator of G-protein signaling 16 Downregulated genes (alpha=1e-05) RPF2P1 729608 ribosome production factor 2 homolog (S. cerevisiae) pseudogene 1 Downregulated genes (alpha=1e-05) RPL29 6159 ribosomal protein L29 Downregulated genes (alpha=1e-05) RPS7 6201 ribosomal protein S7 Downregulated genes (alpha=1e-05) RSPH1 89765 radial spoke head 1 homolog (Chlamydomonas) Downregulated genes (alpha=1e-05) RXRA 6256 retinoid X receptor, alpha Downregulated genes (alpha=1e-05) SEPT3 55964 septin 3 Downregulated genes (alpha=1e-05) SEPW1 6415 selenoprotein W, 1 Downregulated genes (alpha=1e-05) SH3TC1 54436 SH3 domain and tetratricopeptide repeats 1 Downregulated genes (alpha=1e-05) SLC16A9 220963 solute carrier family 16, member 9 (monocarboxylic acid transporter 9) Downregulated genes (alpha=1e-05) SLC25A12 8604 solute carrier family 25 (aspartate/glutamate carrier), member 12 Downregulated genes (alpha=1e-05) SLC27A5 10998 solute carrier family 27 (fatty acid transporter), member 5 Downregulated genes (alpha=1e-05) SLC2A5 6518 solute carrier family 2 (facilitated glucose/fructose transporter), member 5 Downregulated genes (alpha=1e-05) SNAPC4 6621 small nuclear RNA activating complex, polypeptide 4, 190kDa Downregulated genes (alpha=1e-05) SNORA24 677809 small nucleolar RNA, H/ACA box 24 Downregulated genes (alpha=1e-05) SNORA56 677835 small nucleolar RNA, H/ACA box 56 Downregulated genes (alpha=1e-05) SNORA64 26784 small nucleolar RNA, H/ACA box 64 Downregulated genes (alpha=1e-05) SNORD16 595097 small nucleolar RNA, C/D box 16 Downregulated genes (alpha=1e-05) SNORD65 692106 small nucleolar RNA, C/D box 65 Downregulated genes (alpha=1e-05) SNORD80 26774 small nucleolar RNA, C/D box 80 Downregulated genes (alpha=1e-05) SNORD83B 116938 small nucleolar RNA, C/D box 83B Downregulated genes (alpha=1e-05) SNORD96A 619571 small nucleolar RNA, C/D box 96A Downregulated genes (alpha=1e-05) SPINK2 6691 serine peptidase inhibitor, Kazal type 2 (acrosin-trypsin inhibitor) Downregulated genes (alpha=1e-05) SULF2 55959 sulfatase 2 Downregulated genes (alpha=1e-05) SUSD2 56241 sushi domain containing 2 Downregulated genes (alpha=1e-05) SYTL3 94120 synaptotagmin-like 3 Downregulated genes (alpha=1e-05) TIGIT 201633 T cell immunoreceptor with Ig and ITIM domains Downregulated genes (alpha=1e-05) TLCD1 116238 TLC domain containing 1 Downregulated genes (alpha=1e-05) TM2D3 80213 TM2 domain containing 3 Downregulated genes (alpha=1e-05) TNFRSF13B 23495 tumor necrosis factor receptor superfamily, member 13B Downregulated genes (alpha=1e-05) TNFRSF4 7293 tumor necrosis factor receptor superfamily, member 4 Downregulated genes (alpha=1e-05) WNT10A 80326 wingless-type MMTV integration site family, member 10A

Upregulated genes (alpha=1e-05) ABCA1 19 ATP-binding cassette, sub-family A (ABC1), member 1 Upregulated genes (alpha=1e-05) ABHD8 79575 abhydrolase domain containing 8 Upregulated genes (alpha=1e-05) ADARB1 104 adenosine deaminase, RNA-specific, B1 Upregulated genes (alpha=1e-05) ALDH5A1 7915 aldehyde dehydrogenase 5 family, member A1 Upregulated genes (alpha=1e-05) APOC2 344 apolipoprotein C-II Upregulated genes (alpha=1e-05) APOD 347 apolipoprotein D Upregulated genes (alpha=1e-05) ARSD 414 arylsulfatase D Upregulated genes (alpha=1e-05) BACH2 60468 BTB and CNC homology 1, basic leucine zipper transcription factor 2 Upregulated genes (alpha=1e-05) BEST3 144453 bestrophin 3 Upregulated genes (alpha=1e-05) BHLHE40 8553 basic helix-loop-helix family, member e40 Upregulated genes (alpha=1e-05) C12orf57 113246 chromosome 12 open reading frame 57 Upregulated genes (alpha=1e-05) C16orf93 90835 chromosome 16 open reading frame 93 Upregulated genes (alpha=1e-05) CAND2 23066 cullin-associated and neddylation-dissociated 2 (putative) Upregulated genes (alpha=1e-05) CASZ1 54897 castor zinc finger 1 Upregulated genes (alpha=1e-05) CBLB 868 Cbl proto-oncogene, E3 ubiquitin protein ligase B Upregulated genes (alpha=1e-05) CCNG2 901 cyclin G2 Upregulated genes (alpha=1e-05) CD24 100133941 CD24 molecule Upregulated genes (alpha=1e-05) CD72 971 CD72 molecule Upregulated genes (alpha=1e-05) CD81 975 CD81 molecule Upregulated genes (alpha=1e-05) CDKN2D 1032 cyclin-dependent kinase inhibitor 2D (p19, inhibits CDK4) Upregulated genes (alpha=1e-05) CIITA 4261 class II, major histocompatibility complex, transactivator Upregulated genes (alpha=1e-05) CNR1 1268 cannabinoid receptor 1 (brain) Upregulated genes (alpha=1e-05) COQ10A 93058 coenzyme Q10 homolog A (S. cerevisiae) Upregulated genes (alpha=1e-05) CXCL16 58191 chemokine (C-X-C motif) ligand 16 Upregulated genes (alpha=1e-05) CXCR4 7852 chemokine (C-X-C motif) receptor 4 Upregulated genes (alpha=1e-05) CYFIP2 26999 cytoplasmic FMR1 interacting protein 2 Upregulated genes (alpha=1e-05) DDX54 79039 DEAD (Asp-Glu-Ala-Asp) box polypeptide 54 Upregulated genes (alpha=1e-05) DENND2A 27147 DENN/MADD domain containing 2A Upregulated genes (alpha=1e-05) DENND2D 79961 DENN/MADD domain containing 2D Upregulated genes (alpha=1e-05) DFNA5 1687 deafness, autosomal dominant 5 Upregulated genes (alpha=1e-05) DOK3 79930 docking protein 3 Upregulated genes (alpha=1e-05) EBF1 1879 early B-cell factor 1 Upregulated genes (alpha=1e-05) EMP3 2014 epithelial membrane protein 3 Upregulated genes (alpha=1e-05) EPSTI1 94240 epithelial stromal interaction 1 (breast) Upregulated genes (alpha=1e-05) ETV5 2119 ets variant 5 Upregulated genes (alpha=1e-05) FBXO32 114907 F-box protein 32 Upregulated genes (alpha=1e-05) FCGRT 2217 Fc fragment of IgG, receptor, transporter, alpha Upregulated genes (alpha=1e-05) FLJ42627 645644 uncharacterized LOC645644 Upregulated genes (alpha=1e-05) GBE1 2632 glucan (1,4-alpha-), branching enzyme 1 Upregulated genes (alpha=1e-05) GLRX 2745 glutaredoxin (thioltransferase) Upregulated genes (alpha=1e-05) GLRXP3 100132510 glutaredoxin (thioltransferase) pseudogene 3 Upregulated genes (alpha=1e-05) GM2A 2760 GM2 ganglioside activator Upregulated genes (alpha=1e-05) GNG7 2788 guanine nucleotide binding protein (G protein), gamma 7 Upregulated genes (alpha=1e-05) GPR160 26996 G protein-coupled receptor 160 Upregulated genes (alpha=1e-05) GPR18 2841 G protein-coupled receptor 18 Upregulated genes (alpha=1e-05) HBEGF 1839 heparin-binding EGF-like growth factor Upregulated genes (alpha=1e-05) HCP5 10866 HLA complex P5 (non-protein coding) Upregulated genes (alpha=1e-05) HES6 55502 hairy and enhancer of split 6 (Drosophila) Upregulated genes (alpha=1e-05) HLA-DPA1 3113 major histocompatibility complex, class II, DP alpha 1 Upregulated genes (alpha=1e-05) HLA-DPB1 3115 major histocompatibility complex, class II, DP beta 1 Upregulated genes (alpha=1e-05) HLA-DRA 3122 major histocompatibility complex, class II, DR alpha Upregulated genes (alpha=1e-05) IRF1 3659 interferon regulatory factor 1 Upregulated genes (alpha=1e-05) IRF9 10379 interferon regulatory factor 9 Upregulated genes (alpha=1e-05) KIAA1683 80726 KIAA1683 Upregulated genes (alpha=1e-05) KLF2 10365 Kruppel-like factor 2 (lung) Upregulated genes (alpha=1e-05) KLHL22 84861 kelch-like 22 (Drosophila) Upregulated genes (alpha=1e-05) KLHL24 54800 kelch-like 24 (Drosophila) Upregulated genes (alpha=1e-05) KLHL6 89857 kelch-like 6 (Drosophila) Upregulated genes (alpha=1e-05) LAMP5 24141 lysosomal-associated membrane protein family, member 5 Upregulated genes (alpha=1e-05) LGALS1 3956 lectin, galactoside-binding, soluble, 1 Upregulated genes (alpha=1e-05) LILRB4 11006 leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 4 Upregulated genes (alpha=1e-05) LINC00426 100188949 long intergenic non-protein coding RNA 426 Upregulated genes (alpha=1e-05) LOC728743 728743 zinc finger protein pseudogene Upregulated genes (alpha=1e-05) LRMP 4033 lymphoid-restricted membrane protein Upregulated genes (alpha=1e-05) LY86 9450 lymphocyte antigen 86 Upregulated genes (alpha=1e-05) LYL1 4066 lymphoblastic leukemia derived sequence 1 Upregulated genes (alpha=1e-05) MDK 4192 midkine (neurite growth-promoting factor 2) Upregulated genes (alpha=1e-05) MFGE8 4240 milk fat globule-EGF factor 8 protein Upregulated genes (alpha=1e-05) MIS18BP1 55320 MIS18 binding protein 1 Upregulated genes (alpha=1e-05) MYB 4602 v-myb myeloblastosis viral oncogene homolog (avian) Upregulated genes (alpha=1e-05) NINJ2 4815 ninjurin 2 Upregulated genes (alpha=1e-05) NPAS1 4861 neuronal PAS domain protein 1 Upregulated genes (alpha=1e-05) NPC2 10577 Niemann-Pick disease, type C2 Upregulated genes (alpha=1e-05) NUB1 51667 negative regulator of ubiquitin-like proteins 1 Upregulated genes (alpha=1e-05) NUCB2 4925 nucleobindin 2 Upregulated genes (alpha=1e-05) OAS1 4938 2'-5'-oligoadenylate synthetase 1, 40/46kDa Upregulated genes (alpha=1e-05) OAS2 4939 2'-5'-oligoadenylate synthetase 2, 69/71kDa Upregulated genes (alpha=1e-05) OAS3 4940 2'-5'-oligoadenylate synthetase 3, 100kDa Upregulated genes (alpha=1e-05) P2RY8 286530 purinergic receptor P2Y, G-protein coupled, 8 Upregulated genes (alpha=1e-05) PARP15 165631 poly (ADP-ribose) polymerase family, member 15 Upregulated genes (alpha=1e-05) PARP9 83666 poly (ADP-ribose) polymerase family, member 9 Upregulated genes (alpha=1e-05) PARVG 64098 parvin, gamma Upregulated genes (alpha=1e-05) PELI2 57161 pellino E3 ubiquitin protein ligase family member 2 Upregulated genes (alpha=1e-05) PPP1R16B 26051 protein phosphatase 1, regulatory subunit 16B Upregulated genes (alpha=1e-05) PRKCE 5581 protein kinase C, epsilon Upregulated genes (alpha=1e-05) PRR5 55615 proline rich 5 (renal) Upregulated genes (alpha=1e-05) RARRES3 5920 retinoic acid receptor responder (tazarotene induced) 3 Upregulated genes (alpha=1e-05) RASGRP2 10235 RAS guanyl releasing protein 2 (calcium and DAG-regulated) Upregulated genes (alpha=1e-05) RGS19 10287 regulator of G-protein signaling 19 Upregulated genes (alpha=1e-05) RHBDF1 64285 rhomboid 5 homolog 1 (Drosophila) Upregulated genes (alpha=1e-05) RHOBTB2 23221 Rho-related BTB domain containing 2 Upregulated genes (alpha=1e-05) RNF144A 9781 ring finger protein 144A Upregulated genes (alpha=1e-05) RNH1 6050 ribonuclease/angiogenin inhibitor 1 Upregulated genes (alpha=1e-05) RRAGD 58528 Ras-related GTP binding D Upregulated genes (alpha=1e-05) SAMD9 54809 sterile alpha motif domain containing 9 Upregulated genes (alpha=1e-05) SAMD9L 219285 sterile alpha motif domain containing 9-like Upregulated genes (alpha=1e-05) SASH3 54440 SAM and SH3 domain containing 3 Upregulated genes (alpha=1e-05) SETDB2 83852 SET domain, bifurcated 2 Upregulated genes (alpha=1e-05) SIT1 27240 signaling threshold regulating transmembrane adaptor 1 Upregulated genes (alpha=1e-05) SLC26A11 284129 solute carrier family 26, member 11 Upregulated genes (alpha=1e-05) SLC29A4 222962 solute carrier family 29 (nucleoside transporters), member 4 Upregulated genes (alpha=1e-05) SMAD3 4088 SMAD family member 3 Upregulated genes (alpha=1e-05) SNX29P2 440352 sorting nexin 29 pseudogene 2 Upregulated genes (alpha=1e-05) SOCS1 8651 suppressor of cytokine signaling 1 Upregulated genes (alpha=1e-05) SOX11 6664 SRY (sex determining region Y)-box 11 Upregulated genes (alpha=1e-05) SOX18 54345 SRY (sex determining region Y)-box 18 Upregulated genes (alpha=1e-05) SOX4 6659 SRY (sex determining region Y)-box 4 Upregulated genes (alpha=1e-05) SSBP2 23635 single-stranded DNA binding protein 2 Upregulated genes (alpha=1e-05) ST3GAL5 8869 ST3 beta-galactoside alpha-2,3-sialyltransferase 5 Upregulated genes (alpha=1e-05) STK38 11329 serine/threonine kinase 38 Upregulated genes (alpha=1e-05) STMN1 3925 stathmin 1 Upregulated genes (alpha=1e-05) STS 412 steroid sulfatase (microsomal), isozyme S Upregulated genes (alpha=1e-05) TAX1BP3 30851 Tax1 (human T-cell leukemia virus type I) binding protein 3 Upregulated genes (alpha=1e-05) TMEM136 219902 transmembrane protein 136 Upregulated genes (alpha=1e-05) TNFRSF14 8764 tumor necrosis factor receptor superfamily, member 14 Upregulated genes (alpha=1e-05) TOP2B 7155 topoisomerase (DNA) II beta 180kDa Upregulated genes (alpha=1e-05) TP53INP1 94241 tumor protein p53 inducible nuclear protein 1 Upregulated genes (alpha=1e-05) TPP1 1200 tripeptidyl peptidase I Upregulated genes (alpha=1e-05) TTYH3 80727 tweety homolog 3 (Drosophila) Upregulated genes (alpha=1e-05) VPREB3 29802 pre-B lymphocyte 3 Upregulated genes (alpha=1e-05) WIPI2 26100 WD repeat domain, phosphoinositide interacting 2 Upregulated genes (alpha=1e-05) WNT3 7473 wingless-type MMTV integration site family, member 3 Upregulated genes (alpha=1e-05) YPEL5 51646 yippee-like 5 (Drosophila) Upregulated genes (alpha=1e-05) ZEB2 9839 zinc finger E-box binding homeobox 2 Upregulated genes (alpha=1e-05) ZHX2 22882 zinc fingers and homeoboxes 2 Upregulated genes (alpha=1e-05) ZSCAN16 80345 zinc finger and SCAN domain containing 16 Supplemental Table 3. Signatures that are significantly enriched with top regulated genes following z-VRPR-fmk treatment in Mino cells.

Downregulated signatures: Defined P [GSEA] Signatures DB Category Sub Category Signature name Signature links members Enrichment score (by permutation test) FDR [GSEA] MolSigDBv4_0_dMay2014 c2: curated gene sets canonical pathways / Reactome REACTOME_FORMATION_OF_ATP_BY_CHEMIOSMOTIC_COUPLINGhttp://www.broadinstitute.org/gsea/msigdb/cards/REACTOME_FORMATION_OF_ATP_BY_CHEMIOSMOTIC_COUPLING13 0.8416 0.0010 0.0010 MolSigDBv4_0_dMay2014 c2: curated gene sets chemical and genetic perturbationsCOLLER_MYC_TARGETS_UP http://www.broadinstitute.org/gsea/msigdb/cards/COLLER_MYC_TARGETS_UP 25 0.8405 0.0010 0.0010 HGNCSigDB_dMay2014 gene families Mitochondrial ribosomal proteins Mitochondrial ribosomal proteins / small subunits http://www.genenames.org/genefamilies/MRP#MRPS 31 0.8392 0.0010 0.0010 MolSigDBv4_0_dMay2014 c2: curated gene sets chemical and genetic perturbationsFUNG_IL2_SIGNALING_1 http://www.broadinstitute.org/gsea/msigdb/cards/FUNG_IL2_SIGNALING_1 11 0.8324 0.0010 0.0010 HGNCSigDB_dMay2014 gene families Mitochondrial respiratory chain complexMitochondrial respiratory chain complex / Complex V http://www.genenames.org/genefamilies/mitocomplex#FATP 16 0.8277 0.0010 0.0010 HGNCSigDB_dMay2014 gene families ATPases ATPases / F-type http://www.genenames.org/genefamilies/ATP#F1ATP 15 0.8254 0.0019 0.0010 MolSigDBv4_0_dMay2014 c5: gene ontology (GO) gene sets cellular components ORGANELLAR_SMALL_RIBOSOMAL_SUBUNIT http://www.broadinstitute.org/gsea/msigdb/cards/ORGANELLAR_SMALL_RIBOSOMAL_SUBUNIT 11 0.8100 0.0010 0.0010 MolSigDBv4_0_dMay2014 c5: gene ontology (GO) gene sets cellular components MITOCHONDRIAL_SMALL_RIBOSOMAL_SUBUNIT http://www.broadinstitute.org/gsea/msigdb/cards/MITOCHONDRIAL_SMALL_RIBOSOMAL_SUBUNIT11 0.8100 0.0010 0.0010 MolSigDBv4_0_dMay2014 c5: gene ontology (GO) gene sets cellular components SMALL_RIBOSOMAL_SUBUNIT http://www.broadinstitute.org/gsea/msigdb/cards/SMALL_RIBOSOMAL_SUBUNIT 11 0.8100 0.0010 0.0010 HGNCSigDB_dMay2014 gene families Mitochondrial respiratory chain complexMitochondrial respiratory chain complex / Complex III http://www.genenames.org/genefamilies/mitocomplex#comIII 9 0.7990 0.0019 0.0093 MolSigDBv4_0_dMay2014 c4: computational gene sets cancer modules MODULE_103 http://www.broadinstitute.org/gsea/msigdb/cards/MODULE_103 12 0.7924 0.0010 0.0039 MolSigDBv4_0_dMay2014 c5: gene ontology (GO) gene sets biological processes COENZYME_BIOSYNTHETIC_PROCESS http://www.broadinstitute.org/gsea/msigdb/cards/COENZYME_BIOSYNTHETIC_PROCESS 10 0.7862 0.0103 0.0354 HGNCSigDB_dMay2014 gene families General transcription factor IIH complexGeneral subunits transcription factor IIH complex subunits http://www.genenames.org/genefamilies/TFIIH 10 0.7861 0.0049 0.0086 MolSigDBv4_0_dMay2014 c2: curated gene sets chemical and genetic perturbationsSCHLOSSER_MYC_AND_SERUM_RESPONSE_SYNERGYhttp://www.broadinstitute.org/gsea/msigdb/cards/SCHLOSSER_MYC_AND_SERUM_RESPONSE_SYNERGY32 0.7853 0.0010 0.0010 MolSigDBv4_0_dMay2014 c5: gene ontology (GO) gene sets biological processes PROTEIN_TARGETING_TO_MITOCHONDRION http://www.broadinstitute.org/gsea/msigdb/cards/PROTEIN_TARGETING_TO_MITOCHONDRION 11 0.7803 0.0023 0.0212 MolSigDBv4_0_dMay2014 c2: curated gene sets chemical and genetic perturbationsXU_RESPONSE_TO_TRETINOIN_AND_NSC682994_DNhttp://www.broadinstitute.org/gsea/msigdb/cards/XU_RESPONSE_TO_TRETINOIN_AND_NSC682994_DN15 0.7791 0.0010 0.0010 StaudtSigDB_dNov2012 Signaling pathway T cell cytokine signallng Tcell_cytokine_induced_prolif http://lymphochip.nih.gov/cgi-bin/signaturedb/signatureDB_DisplayGenes.cgi?signatureID=77 27 0.7749 0.0010 0.0010 GeneSigDB_v4_Sept2011 Mouse Lung homolog(Lung_Rangasamy09_10genes_DownRegulatedPhaseIIGenes,http://www.genesigdb.org/genesigdb/signaturedetail.jsp?signatureId=19286929-SuppTable2b from Mus musculus, to Homo sapiens, 9 of 10 genes) 9 0.7742 0.0071 0.0602 GeneSigDB_v4_Sept2011 Mouse StemCell homolog(StemCell_Parker05_27genes, from Mus musculus,http://www.genesigdb.org/genesigdb/signaturedetail.jsp?signatureId=15992799-table2 to Homo sapiens, 15 of 15 genes) 15 0.7702 0.0010 0.0052 MolSigDBv4_0_dMay2014 c5: gene ontology (GO) gene sets biological processes RRNA_PROCESSING http://www.broadinstitute.org/gsea/msigdb/cards/RRNA_PROCESSING 15 0.7674 0.0012 0.0083 GeneSigDB_v4_Sept2011 Human Viral Viral_Zafrakas07_14genes http://www.genesigdb.org/genesigdb/signaturedetail.jsp?signatureId=18288381-Table1 8 0.7664 0.0218 0.0370 MolSigDBv4_0_dMay2014 c4: computational gene sets cancer modules MODULE_50 http://www.broadinstitute.org/gsea/msigdb/cards/MODULE_50 13 0.7641 0.0011 0.0049 MolSigDBv4_0_dMay2014 c5: gene ontology (GO) gene sets biological processes RRNA_METABOLIC_PROCESS http://www.broadinstitute.org/gsea/msigdb/cards/RRNA_METABOLIC_PROCESS 16 0.7630 0.0012 0.0059 MolSigDBv4_0_dMay2014 c4: computational gene sets cancer modules MODULE_471 http://www.broadinstitute.org/gsea/msigdb/cards/MODULE_471 10 0.7594 0.0094 0.0147 StaudtSigDB_dNov2012 Signaling pathway MYC Myc_overexpression_1.5x_up http://lymphochip.nih.gov/cgi-bin/signaturedb/signatureDB_DisplayGenes.cgi?signatureID=167 86 0.7573 0.0010 0.0010 MolSigDBv4_0_dMay2014 c5: gene ontology (GO) gene sets cellular components NUCLEOLAR_PART http://www.broadinstitute.org/gsea/msigdb/cards/NUCLEOLAR_PART 18 0.7532 0.0010 0.0010 MolSigDBv4_0_dMay2014 c2: curated gene sets canonical pathways / Reactome REACTOME_MRNA_DECAY_BY_3_TO_5_EXORIBONUCLEASEhttp://www.broadinstitute.org/gsea/msigdb/cards/REACTOME_MRNA_DECAY_BY_3_TO_5_EXORIBONUCLEASE11 0.7517 0.0058 0.0101 MolSigDBv4_0_dMay2014 c5: gene ontology (GO) gene sets biological processes AMINO_ACID_DERIVATIVE_BIOSYNTHETIC_PROCESShttp://www.broadinstitute.org/gsea/msigdb/cards/AMINO_ACID_DERIVATIVE_BIOSYNTHETIC_PROCESS10 0.7482 0.0108 0.0336 MolSigDBv4_0_dMay2014 c2: curated gene sets canonical pathways / KEGG KEGG_VALINE_LEUCINE_AND_ISOLEUCINE_BIOSYNTHESIShttp://www.broadinstitute.org/gsea/msigdb/cards/KEGG_VALINE_LEUCINE_AND_ISOLEUCINE_BIOSYNTHESIS11 0.7471 0.0040 0.0014 MolSigDBv4_0_dMay2014 c5: gene ontology (GO) gene sets biological processes RIBOSOME_BIOGENESIS_AND_ASSEMBLY http://www.broadinstitute.org/gsea/msigdb/cards/RIBOSOME_BIOGENESIS_AND_ASSEMBLY 18 0.7467 0.0012 0.0032 MolSigDBv4_0_dMay2014 c2: curated gene sets chemical and genetic perturbationsSCHUHMACHER_MYC_TARGETS_UP http://www.broadinstitute.org/gsea/msigdb/cards/SCHUHMACHER_MYC_TARGETS_UP 80 0.7466 0.0010 0.0010 MolSigDBv4_0_dMay2014 c4: computational gene sets cancer modules MODULE_77 http://www.broadinstitute.org/gsea/msigdb/cards/MODULE_77 28 0.7441 0.0010 0.0010 MolSigDBv4_0_dMay2014 c5: gene ontology (GO) gene sets cellular components OLIGOSACCHARYL_TRANSFERASE_COMPLEX http://www.broadinstitute.org/gsea/msigdb/cards/OLIGOSACCHARYL_TRANSFERASE_COMPLEX10 0.7370 0.0092 0.0056 MolSigDBv4_0_dMay2014 c4: computational gene sets cancer modules MODULE_25 http://www.broadinstitute.org/gsea/msigdb/cards/MODULE_25 13 0.7368 0.0027 0.0125 MolSigDBv4_0_dMay2014 c5: gene ontology (GO) gene sets cellular components ORGANELLAR_RIBOSOME http://www.broadinstitute.org/gsea/msigdb/cards/ORGANELLAR_RIBOSOME 22 0.7360 0.0010 0.0010 MolSigDBv4_0_dMay2014 c5: gene ontology (GO) gene sets cellular components MITOCHONDRIAL_RIBOSOME http://www.broadinstitute.org/gsea/msigdb/cards/MITOCHONDRIAL_RIBOSOME 22 0.7360 0.0010 0.0010 GeneSigDB_v4_Sept2011 Human Lymphoma Lymphoma_Cassinelli09_59genes http://www.genesigdb.org/genesigdb/signaturedetail.jsp?signatureId=19555670-Table3b 49 0.7356 0.0010 0.0010 MolSigDBv4_0_dMay2014 c5: gene ontology (GO) gene sets biological processes TRNA_PROCESSING http://www.broadinstitute.org/gsea/msigdb/cards/TRNA_PROCESSING 10 0.7343 0.0129 0.0470 StaudtSigDB_dNov2012 Signaling pathway Notch Notch_T-ALL_up_Palomero http://lymphochip.nih.gov/cgi-bin/signaturedb/signatureDB_DisplayGenes.cgi?signatureID=235 47 0.7300 0.0011 0.0010 MolSigDBv4_0_dMay2014 c2: curated gene sets canonical pathways / Reactome REACTOME_RNA_POL_I_TRANSCRIPTION_TERMINATIONhttp://www.broadinstitute.org/gsea/msigdb/cards/REACTOME_RNA_POL_I_TRANSCRIPTION_TERMINATION21 0.7294 0.0010 0.0020 HGNCSigDB_dMay2014 gene families N(alpha)-acetyltransferase subunitsN(alpha)-acetyltransferase subunits http://www.genenames.org/genefamilies/NAA 12 0.7290 0.0155 0.0111 MolSigDBv4_0_dMay2014 c2: curated gene sets canonical pathways / KEGG KEGG_TERPENOID_BACKBONE_BIOSYNTHESIS http://www.broadinstitute.org/gsea/msigdb/cards/KEGG_TERPENOID_BACKBONE_BIOSYNTHESIS15 0.7268 0.0010 0.0021 HGNCSigDB_dMay2014 gene families Mitochondrial respiratory chain complexMitochondrial respiratory chain complex / Complex IV http://www.genenames.org/genefamilies/mitocomplex#comIV 16 0.7265 0.0010 0.0010 MolSigDBv4_0_dMay2014 c4: computational gene sets cancer modules MODULE_528 http://www.broadinstitute.org/gsea/msigdb/cards/MODULE_528 11 0.7254 0.0136 0.0139 GeneSigDB_v4_Sept2011 Human Breast Breast_Larsson07_76genes http://www.genesigdb.org/genesigdb/signaturedetail.jsp?signatureId=17638893-SuppTable7 45 0.7200 0.0010 0.0010 MolSigDBv4_0_dMay2014 c4: computational gene sets cancer gene neighborhoods GNF2_NS http://www.broadinstitute.org/gsea/msigdb/cards/GNF2_NS 40 0.7162 0.0010 0.0010 MolSigDBv4_0_dMay2014 c2: curated gene sets canonical pathways / Reactome REACTOME_BRANCHED_CHAIN_AMINO_ACID_CATABOLISMhttp://www.broadinstitute.org/gsea/msigdb/cards/REACTOME_BRANCHED_CHAIN_AMINO_ACID_CATABOLISM17 0.7158 0.0014 0.0070 GeneSigDB_v4_Sept2011 Mouse Bone homolog(Bone_Kalajzic05_12genes, from Mus musculus,http://www.genesigdb.org/genesigdb/signaturedetail.jsp?signatureId=15834136-Table3 to Homo sapiens, 10 of 11 genes) 10 0.7141 0.0340 0.0481 HGNCSigDB_dMay2014 gene families Mitochondrial ribosomal proteins Mitochondrial ribosomal proteins / large subunits http://www.genenames.org/genefamilies/MRP#MRPL 49 0.7141 0.0010 0.0010 MolSigDBv4_0_dMay2014 c2: curated gene sets chemical and genetic perturbationsSCHLOSSER_MYC_TARGETS_AND_SERUM_RESPONSE_DNhttp://www.broadinstitute.org/gsea/msigdb/cards/SCHLOSSER_MYC_TARGETS_AND_SERUM_RESPONSE_DN47 0.7138 0.0010 0.0010 MolSigDBv4_0_dMay2014 c2: curated gene sets chemical and genetic perturbationsSCHLOSSER_MYC_TARGETS_AND_SERUM_RESPONSE_UPhttp://www.broadinstitute.org/gsea/msigdb/cards/SCHLOSSER_MYC_TARGETS_AND_SERUM_RESPONSE_UP47 0.7127 0.0010 0.0010 GeneSigDB_v4_Sept2011 Human Breast Breast_Lee10_23genes http://www.genesigdb.org/genesigdb/signaturedetail.jsp?signatureId=20068086-ST1-3 23 0.7110 0.0010 0.0013 MolSigDBv4_0_dMay2014 c2: curated gene sets canonical pathways / Reactome REACTOME_MITOCHONDRIAL_TRNA_AMINOACYLATIONhttp://www.broadinstitute.org/gsea/msigdb/cards/REACTOME_MITOCHONDRIAL_TRNA_AMINOACYLATION21 0.7101 0.0015 0.0017 StaudtSigDB_dNov2012 Transcription factor target PGC-1 alpha PGC-1alpha_overepxression_up http://lymphochip.nih.gov/cgi-bin/signaturedb/signatureDB_DisplayGenes.cgi?signatureID=210 27 0.7084 0.0010 0.0010 HGNCSigDB_dMay2014 gene families Aminoacyl tRNA synthetases Aminoacyl tRNA synthetases / Class I http://www.genenames.org/genefamilies/AARS#AARS1 19 0.7048 0.0010 0.0014 MolSigDBv4_0_dMay2014 c2: curated gene sets canonical pathways / Reactome REACTOME_MITOCHONDRIAL_PROTEIN_IMPORT http://www.broadinstitute.org/gsea/msigdb/cards/REACTOME_MITOCHONDRIAL_PROTEIN_IMPORT52 0.7030 0.0010 0.0010 HGNCSigDB_dMay2014 gene families Short chain dehydrogenase Short chain dehydrogenase/reductase superfamily / Classicalhttp://www.genenames.org/genefamilies/SDR#SDRC1 SDR fold cluster 1 20 0.7024 0.0010 0.0011 MolSigDBv4_0_dMay2014 c5: gene ontology (GO) gene sets molecular functions RIBONUCLEOPROTEIN_BINDING http://www.broadinstitute.org/gsea/msigdb/cards/RIBONUCLEOPROTEIN_BINDING 12 0.7018 0.0208 0.3597

Upregulated signatures: Defined P [GSEA] Signatures DB Category Sub Category Signature name Signature links members Enrichment score (by permutation test) FDR [GSEA] MolSigDBv4_0_dMay2014 c4: computational gene sets cancer modules MODULE_293 http://www.broadinstitute.org/gsea/msigdb/cards/MODULE_293 12 -0.8842 0.0010 0.0018 MolSigDBv4_0_dMay2014 c2: curated gene sets canonical pathways / Reactome REACTOME_ENDOSOMAL_VACUOLAR_PATHWAY http://www.broadinstitute.org/gsea/msigdb/cards/REACTOME_ENDOSOMAL_VACUOLAR_PATHWAY8 -0.8811 0.0027 0.0086 HGNCSigDB_dMay2014 gene families Histocompatibility complex Histocompatibility complex http://www.genenames.org/genefamilies/HLA 24 -0.8802 0.0010 0.0010 MolSigDBv4_0_dMay2014 c2: curated gene sets chemical and genetic perturbationsHOLLEMAN_ASPARAGINASE_RESISTANCE_B_ALL_DNhttp://www.broadinstitute.org/gsea/msigdb/cards/HOLLEMAN_ASPARAGINASE_RESISTANCE_B_ALL_DN14 -0.8772 0.0010 0.0009 MolSigDBv4_0_dMay2014 c4: computational gene sets cancer modules MODULE_143 http://www.broadinstitute.org/gsea/msigdb/cards/MODULE_143 14 -0.8556 0.0010 0.0036 MolSigDBv4_0_dMay2014 c2: curated gene sets chemical and genetic perturbationsHOLLEMAN_DAUNORUBICIN_B_ALL_DN http://www.broadinstitute.org/gsea/msigdb/cards/HOLLEMAN_DAUNORUBICIN_B_ALL_DN 12 -0.8443 0.0010 0.0009 GeneSigDB_v4_Sept2011 Mouse Prostate homolog(Prostate_Glinsky05_11genes, from Mus musculus,http://www.genesigdb.org/genesigdb/signaturedetail.jsp?signatureId=15931389-table3 to Homo sapiens, 8 of 10 genes) 8 -0.8367 0.0060 0.0111 MolSigDBv4_0_dMay2014 c2: curated gene sets chemical and genetic perturbationsSCHMAHL_PDGF_SIGNALING http://www.broadinstitute.org/gsea/msigdb/cards/SCHMAHL_PDGF_SIGNALING 9 -0.8335 0.0011 0.0073 GeneSigDB_v4_Sept2011 Human Lymphoma Lymphoma_Fernandez10_13genes http://www.genesigdb.org/genesigdb/signaturedetail.jsp?signatureId=20124476-SuppTable3 12 -0.8277 0.0010 0.0075 MolSigDBv4_0_dMay2014 c5: gene ontology (GO) gene sets biological processes G_PROTEIN_SIGNALING_ADENYLATE_CYCLASE_INHIBITING_PATHWAYhttp://www.broadinstitute.org/gsea/msigdb/cards/G_PROTEIN_SIGNALING_ADENYLATE_CYCLASE_INHIBITING_PATHWAY10 -0.8155 0.0011 0.0310 GeneSigDB_v4_Sept2011 Human Lung Lung_Nam10_10genes http://www.genesigdb.org/genesigdb/signaturedetail.jsp?signatureId=20369051-Table1 9 -0.8094 0.0050 0.0122 MolSigDBv4_0_dMay2014 c2: curated gene sets chemical and genetic perturbationsMAINA_VHL_TARGETS_UP http://www.broadinstitute.org/gsea/msigdb/cards/MAINA_VHL_TARGETS_UP 10 -0.7897 0.0022 0.0098 GeneSigDB_v4_Sept2011 Human Colon Colon_Protiva09_31genes http://www.genesigdb.org/genesigdb/signaturedetail.jsp?signatureId=19139017-Table3 23 -0.7806 0.0010 0.0009 GeneSigDB_v4_Sept2011 Human Immune Immune_Ristich05_13genes http://www.genesigdb.org/genesigdb/signaturedetail.jsp?signatureId=15770701-Table1 12 -0.7697 0.0033 0.0102 MolSigDBv4_0_dMay2014 c5: gene ontology (GO) gene sets molecular functions SMALL_CONJUGATING_PROTEIN_BINDING http://www.broadinstitute.org/gsea/msigdb/cards/SMALL_CONJUGATING_PROTEIN_BINDING 12 -0.7694 0.0010 0.0163 MolSigDBv4_0_dMay2014 c5: gene ontology (GO) gene sets biological processes INTERLEUKIN_2_PRODUCTION http://www.broadinstitute.org/gsea/msigdb/cards/INTERLEUKIN_2_PRODUCTION 11 -0.7680 0.0033 0.0251 MolSigDBv4_0_dMay2014 c5: gene ontology (GO) gene sets molecular functions UBIQUITIN_BINDING http://www.broadinstitute.org/gsea/msigdb/cards/UBIQUITIN_BINDING 11 -0.7668 0.0036 0.0173 GeneSigDB_v4_Sept2011 Human Liver Liver_Liu03_11genes http://www.genesigdb.org/genesigdb/signaturedetail.jsp?signatureId=14728809-Table3b 9 -0.7659 0.0034 0.0176 MolSigDBv4_0_dMay2014 c2: curated gene sets canonical pathways / Reactome REACTOME_UNWINDING_OF_DNA http://www.broadinstitute.org/gsea/msigdb/cards/REACTOME_UNWINDING_OF_DNA 11 -0.7625 0.0052 0.0171 MolSigDBv4_0_dMay2014 c2: curated gene sets chemical and genetic perturbationsBOWIE_RESPONSE_TO_EXTRACELLULAR_MATRIXhttp://www.broadinstitute.org/gsea/msigdb/cards/BOWIE_RESPONSE_TO_EXTRACELLULAR_MATRIX17 -0.7620 0.0010 0.0022 MolSigDBv4_0_dMay2014 c5: gene ontology (GO) gene sets biological processes ACTIN_FILAMENT_BASED_MOVEMENT http://www.broadinstitute.org/gsea/msigdb/cards/ACTIN_FILAMENT_BASED_MOVEMENT 10 -0.7578 0.0109 0.0342 GeneSigDB_v4_Sept2011 Human Viral Viral_Stoff-Khalili06_9genes http://www.genesigdb.org/genesigdb/signaturedetail.jsp?signatureId=16410819-Table5 9 -0.7553 0.0152 0.0222 MolSigDBv4_0_dMay2014 c2: curated gene sets chemical and genetic perturbationsVISALA_AGING_LYMPHOCYTE_UP http://www.broadinstitute.org/gsea/msigdb/cards/VISALA_AGING_LYMPHOCYTE_UP 10 -0.7542 0.0105 0.0134 GeneSigDB_v4_Sept2011 Human StemCell StemCell_Novakova10_22genes http://www.genesigdb.org/genesigdb/signaturedetail.jsp?signatureId=19802007-Table1 14 -0.7514 0.0020 0.0109 GeneSigDB_v4_Sept2011 Human StemCell StemCell_Lambert09_12genes http://www.genesigdb.org/genesigdb/signaturedetail.jsp?signatureId=19946333-Table1 12 -0.7498 0.0010 0.0105 MolSigDBv4_0_dMay2014 c2: curated gene sets chemical and genetic perturbationsEGUCHI_CELL_CYCLE_RB1_TARGETS http://www.broadinstitute.org/gsea/msigdb/cards/EGUCHI_CELL_CYCLE_RB1_TARGETS 23 -0.7483 0.0010 0.0009 GeneSigDB_v4_Sept2011 Human Viral Viral_Guo05_21genes http://www.genesigdb.org/genesigdb/signaturedetail.jsp?signatureId=16254373-Table3 18 -0.7471 0.0016 0.0067 GeneSigDB_v4_Sept2011 Human Leukemia Leukemia_Wilson06_15genes http://www.genesigdb.org/genesigdb/signaturedetail.jsp?signatureId=16597596-TableS6-2 14 -0.7461 0.0017 0.0075 GeneSigDB_v4_Sept2011 Human Leukemia Leukemia_Sanchez-Guijo08_14genes http://www.genesigdb.org/genesigdb/signaturedetail.jsp?signatureId=18722011-SuppTable2a 13 -0.7453 0.0084 0.0112 MolSigDBv4_0_dMay2014 c2: curated gene sets chemical and genetic perturbationsGUTIERREZ_WALDENSTROEMS_MACROGLOBULINEMIA_2http://www.broadinstitute.org/gsea/msigdb/cards/GUTIERREZ_WALDENSTROEMS_MACROGLOBULINEMIA_213 -0.7433 0.0043 0.0080 GeneSigDB_v4_Sept2011 Human Lymphoma Lymphoma_Mahadevan05_11genes http://www.genesigdb.org/genesigdb/signaturedetail.jsp?signatureId=16373702-Table3 9 -0.7371 0.0217 0.0213 GeneSigDB_v4_Sept2011 Human Breast Breast_Li09_24genes http://www.genesigdb.org/genesigdb/signaturedetail.jsp?signatureId=18278552-Genes 13 -0.7366 0.0051 0.0103 HGNCSigDB_dMay2014 gene families POTE ankyrin domain containing POTE ankyrin domain containing http://www.genenames.org/genefamilies/POTE 11 -0.7363 0.0091 0.0308 MolSigDBv4_0_dMay2014 c2: curated gene sets canonical pathways / BioCarta BIOCARTA_RANKL_PATHWAY http://www.broadinstitute.org/gsea/msigdb/cards/BIOCARTA_RANKL_PATHWAY 14 -0.7359 0.0040 0.0392 MolSigDBv4_0_dMay2014 c2: curated gene sets chemical and genetic perturbationsUROSEVIC_RESPONSE_TO_IMIQUIMOD http://www.broadinstitute.org/gsea/msigdb/cards/UROSEVIC_RESPONSE_TO_IMIQUIMOD 23 -0.7350 0.0010 0.0009 MolSigDBv4_0_dMay2014 c2: curated gene sets chemical and genetic perturbationsSEMBA_FHIT_TARGETS_DN http://www.broadinstitute.org/gsea/msigdb/cards/SEMBA_FHIT_TARGETS_DN 10 -0.7344 0.0183 0.0239 MolSigDBv4_0_dMay2014 c2: curated gene sets chemical and genetic perturbationsBANDRES_RESPONSE_TO_CARMUSTIN_MGMT_24HR_UPhttp://www.broadinstitute.org/gsea/msigdb/cards/BANDRES_RESPONSE_TO_CARMUSTIN_MGMT_24HR_UP9 -0.7342 0.0171 0.0218 MolSigDBv4_0_dMay2014 c2: curated gene sets chemical and genetic perturbationsGRANDVAUX_IFN_RESPONSE_NOT_VIA_IRF3 http://www.broadinstitute.org/gsea/msigdb/cards/GRANDVAUX_IFN_RESPONSE_NOT_VIA_IRF3 14 -0.7340 0.0034 0.0082 HGNCSigDB_dMay2014 gene families Chromatin-modifying enzymes Chromatin-modifying enzymes / K-demethylases http://www.genenames.org/genefamilies/KDM-KAT-KMT#KDM 20 -0.7338 0.0010 0.0010 MolSigDBv4_0_dMay2014 c2: curated gene sets chemical and genetic perturbationsMYLLYKANGAS_AMPLIFICATION_HOT_SPOT_12 http://www.broadinstitute.org/gsea/msigdb/cards/MYLLYKANGAS_AMPLIFICATION_HOT_SPOT_1211 -0.7336 0.0085 0.0187 MolSigDBv4_0_dMay2014 c2: curated gene sets chemical and genetic perturbationsCASORELLI_APL_SECONDARY_VS_DE_NOVO_DN http://www.broadinstitute.org/gsea/msigdb/cards/CASORELLI_APL_SECONDARY_VS_DE_NOVO_DN9 -0.7335 0.0159 0.0245 MolSigDBv4_0_dMay2014 c5: gene ontology (GO) gene sets molecular functions CATION_TRANSPORTING_ATPASE_ACTIVITY http://www.broadinstitute.org/gsea/msigdb/cards/CATION_TRANSPORTING_ATPASE_ACTIVITY 11 -0.7333 0.0125 0.0407 GeneSigDB_v4_Sept2011 Human Breast Breast_Feng07_21genesUpRegulated http://www.genesigdb.org/genesigdb/signaturedetail.jsp?signatureId=17123152-Table3b 20 -0.7315 0.0010 0.0073 GeneSigDB_v4_Sept2011 Human Lymphoma Lymphoma_Blenk08_16genes http://www.genesigdb.org/genesigdb/signaturedetail.jsp?signatureId=18416826-Table2 11 -0.7299 0.0143 0.0187 MolSigDBv4_0_dMay2014 c4: computational gene sets cancer modules MODULE_402 http://www.broadinstitute.org/gsea/msigdb/cards/MODULE_402 12 -0.7293 0.0040 0.0047 MolSigDBv4_0_dMay2014 c2: curated gene sets chemical and genetic perturbationsBOWIE_RESPONSE_TO_TAMOXIFEN http://www.broadinstitute.org/gsea/msigdb/cards/BOWIE_RESPONSE_TO_TAMOXIFEN 18 -0.7271 0.0011 0.0050 MolSigDBv4_0_dMay2014 c4: computational gene sets cancer gene neighborhoods GNF2_VAV1 http://www.broadinstitute.org/gsea/msigdb/cards/GNF2_VAV1 36 -0.7267 0.0010 0.0010 GeneSigDB_v4_Sept2011 Human StemCell StemCell_Roth05_11genes http://www.genesigdb.org/genesigdb/signaturedetail.jsp?signatureId=15741219-Table2 9 -0.7266 0.0308 0.0253 MolSigDBv4_0_dMay2014 c2: curated gene sets canonical pathways / KEGG KEGG_ASTHMA http://www.broadinstitute.org/gsea/msigdb/cards/KEGG_ASTHMA 30 -0.7264 0.0010 0.0009 MolSigDBv4_0_dMay2014 c2: curated gene sets chemical and genetic perturbationsGOLUB_ALL_VS_AML_UP http://www.broadinstitute.org/gsea/msigdb/cards/GOLUB_ALL_VS_AML_UP 24 -0.7261 0.0010 0.0009 MolSigDBv4_0_dMay2014 c2: curated gene sets canonical pathways / Reactome REACTOME_G1_S_SPECIFIC_TRANSCRIPTION http://www.broadinstitute.org/gsea/msigdb/cards/REACTOME_G1_S_SPECIFIC_TRANSCRIPTION18 -0.7201 0.0030 0.0084 MolSigDBv4_0_dMay2014 c5: gene ontology (GO) gene sets molecular functions THYROID_HORMONE_RECEPTOR_BINDING http://www.broadinstitute.org/gsea/msigdb/cards/THYROID_HORMONE_RECEPTOR_BINDING 17 -0.7197 0.0012 0.0144 MolSigDBv4_0_dMay2014 c5: gene ontology (GO) gene sets cellular components NUCLEAR_SPECK http://www.broadinstitute.org/gsea/msigdb/cards/NUCLEAR_SPECK 11 -0.7159 0.0138 0.0253 GeneSigDB_v4_Sept2011 Human Breast Breast_Sgroi99_16genes http://www.genesigdb.org/genesigdb/signaturedetail.jsp?signatureId=10582678-Table1 11 -0.7149 0.0152 0.0174 MolSigDBv4_0_dMay2014 c2: curated gene sets canonical pathways / KEGG KEGG_OTHER_GLYCAN_DEGRADATION http://www.broadinstitute.org/gsea/msigdb/cards/KEGG_OTHER_GLYCAN_DEGRADATION 16 -0.7145 0.0040 0.0015 MolSigDBv4_0_dMay2014 c5: gene ontology (GO) gene sets biological processes ESTABLISHMENT_OF_ORGANELLE_LOCALIZATIONhttp://www.broadinstitute.org/gsea/msigdb/cards/ESTABLISHMENT_OF_ORGANELLE_LOCALIZATION18 -0.7100 0.0011 0.0207 MolSigDBv4_0_dMay2014 c5: gene ontology (GO) gene sets molecular functions INSULIN_LIKE_GROWTH_FACTOR_RECEPTOR_BINDINGhttp://www.broadinstitute.org/gsea/msigdb/cards/INSULIN_LIKE_GROWTH_FACTOR_RECEPTOR_BINDING10 -0.7095 0.0252 0.0573 GeneSigDB_v4_Sept2011 Human Skin Skin_Zimmerer08_23genes_InVitrovsInVivo http://www.genesigdb.org/genesigdb/signaturedetail.jsp?signatureId=18794103-Table3 20 -0.7046 0.0017 0.0070 StaudtSigDB_dNov2012 Transcription factor target NFkB NFkB_Up_OCILy3_only http://lymphochip.nih.gov/cgi-bin/signaturedb/signatureDB_DisplayGenes.cgi?signatureID=87 10 -0.7041 0.0245 0.0152 MolSigDBv4_0_dMay2014 c5: gene ontology (GO) gene sets cellular components VACUOLAR_MEMBRANE http://www.broadinstitute.org/gsea/msigdb/cards/VACUOLAR_MEMBRANE 11 -0.7034 0.0203 0.0246 MolSigDBv4_0_dMay2014 c4: computational gene sets cancer gene neighborhoods GNF2_INPP5D http://www.broadinstitute.org/gsea/msigdb/cards/GNF2_INPP5D 43 -0.7032 0.0010 0.0010 MolSigDBv4_0_dMay2014 c5: gene ontology (GO) gene sets molecular functions BETA_TUBULIN_BINDING http://www.broadinstitute.org/gsea/msigdb/cards/BETA_TUBULIN_BINDING 10 -0.7019 0.0375 0.0477 Supplemental Table 4. MYC signatures enriched with top regulated genes following z-VRPR-fmk treatment in Mino cells.

Downregulated signatures: Enrichment P [GSEA] Signature name Signature links Defined members score (by permutation test) COLLER_MYC_TARGETS_UP http://www.broadinstitute.org/gsea/msigdb/cards/COLLER_MYC_TARGETS_UP 25 0.8405 0.0010 SCHLOSSER_MYC_AND_SERUM_RESPONSE_SYNERGY http://www.broadinstitute.org/gsea/msigdb/cards/SCHLOSSER_MYC_AND_SERUM_RESPONSE_SYNERGY 32 0.7853 0.0010 Myc_overexpression_1.5x_up http://lymphochip.nih.gov/cgi-bin/signaturedb/signatureDB_DisplayGenes.cgi?signatureID=167 88 0.7573 0.0010 SCHUHMACHER_MYC_TARGETS_UP http://www.broadinstitute.org/gsea/msigdb/cards/SCHUHMACHER_MYC_TARGETS_UP 80 0.7466 0.0010 SCHLOSSER_MYC_TARGETS_AND_SERUM_RESPONSE_DN http://www.broadinstitute.org/gsea/msigdb/cards/SCHLOSSER_MYC_TARGETS_AND_SERUM_RESPONSE_DN 47 0.7138 0.0010 SCHLOSSER_MYC_TARGETS_AND_SERUM_RESPONSE_UP http://www.broadinstitute.org/gsea/msigdb/cards/SCHLOSSER_MYC_TARGETS_AND_SERUM_RESPONSE_UP 47 0.7127 0.0010 MENSSEN_MYC_TARGETS http://www.broadinstitute.org/gsea/msigdb/cards/MENSSEN_MYC_TARGETS 53 0.6902 0.0010 Myc_overexpression_2x_up http://lymphochip.nih.gov/cgi-bin/signaturedb/signatureDB_DisplayGenes.cgi?signatureID=168 36 0.6781 0.0010 CAIRO_PML_TARGETS_BOUND_BY_MYC_DN http://www.broadinstitute.org/gsea/msigdb/cards/CAIRO_PML_TARGETS_BOUND_BY_MYC_DN 14 0.6580 0.0066 Supplemental Table 5. Downregulated and upregulated genes following z-VRPR-fmk treatment in Rec-1 cells.

Signature name Gene symbol Gene ID Gene description Downregulated genes (alpha=0.0025)ANKRD27 84079 ankyrin repeat domain 27 Downregulated genes (alpha=0.0025)AQP3 360 aquaporin 3 (Gill blood group) Downregulated genes (alpha=0.0025)ASH1L-AS1 645676 ASH1L antisense RNA 1 Downregulated genes (alpha=0.0025)ASS1 445 argininosuccinate synthase 1 Downregulated genes (alpha=0.0025)ASS1P11 340274 argininosuccinate synthetase 1 pseudogene 11 Downregulated genes (alpha=0.0025)ATP5C1 509 ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1 Downregulated genes (alpha=0.0025)BCS1L 617 BCS1 homolog, ubiquinol-cytochrome c reductase complex chaperone Downregulated genes (alpha=0.0025)C20orf27 54976 chromosome 20 open reading frame 27 Downregulated genes (alpha=0.0025)C9orf173 441476 sperm-tail PG-rich repeat containing 3 Downregulated genes (alpha=0.0025)CBX6 23466 chromobox 6 Downregulated genes (alpha=0.0025)CCNY 219771 cyclin Y Downregulated genes (alpha=0.0025)CD3EAP 10849 CD3e molecule associated protein Downregulated genes (alpha=0.0025)CHCHD4 131474 coiled-coil-helix-coiled-coil-helix domain containing 4 Downregulated genes (alpha=0.0025)CHEK2 11200 checkpoint kinase 2 Downregulated genes (alpha=0.0025)CIZ1 25792 CDKN1A interacting zinc finger protein 1 Downregulated genes (alpha=0.0025)CUX2 23316 cut like homeobox 2 Downregulated genes (alpha=0.0025)CXCR7 57007 atypical chemokine receptor 3 Downregulated genes (alpha=0.0025)CYSLTR1 10800 cysteinyl leukotriene receptor 1 Downregulated genes (alpha=0.0025)DANCR 57291 differentiation antagonizing non-protein coding RNA Downregulated genes (alpha=0.0025)DEXI 28955 Dexi homolog Downregulated genes (alpha=0.0025)ERCC8 1161 ERCC excision repair 8, CSA ubiquitin ligase complex subunit Downregulated genes (alpha=0.0025)ERI3 79033 ERI1 exoribonuclease family member 3 Downregulated genes (alpha=0.0025)ETS2 2114 ETS proto-oncogene 2, transcription factor Downregulated genes (alpha=0.0025)FAM203B 728071 Downregulated genes (alpha=0.0025)FAM81A 145773 family with sequence similarity 81 member A Downregulated genes (alpha=0.0025)FDXACB1 91893 ferredoxin-fold anticodon binding domain containing 1 Downregulated genes (alpha=0.0025)FKBP4 2288 FK506 binding protein 4 Downregulated genes (alpha=0.0025)FLJ39739 388685 long intergenic non-protein coding RNA 1138 Downregulated genes (alpha=0.0025)GFM1 85476 G elongation factor mitochondrial 1 Downregulated genes (alpha=0.0025)GMDS 2762 GDP-mannose 4,6-dehydratase Downregulated genes (alpha=0.0025)GRB14 2888 growth factor receptor bound protein 14 Downregulated genes (alpha=0.0025)HEY2 23493 hes related family bHLH transcription factor with YRPW motif 2 Downregulated genes (alpha=0.0025)HNRNPA1 3178 heterogeneous nuclear ribonucleoprotein A1 Downregulated genes (alpha=0.0025)IARS 3376 isoleucyl-tRNA synthetase Downregulated genes (alpha=0.0025)IDH3A 3419 isocitrate dehydrogenase 3 (NAD(+)) alpha Downregulated genes (alpha=0.0025)IL2RB 3560 interleukin 2 receptor subunit beta Downregulated genes (alpha=0.0025)ITPK1 3705 inositol-tetrakisphosphate 1-kinase Downregulated genes (alpha=0.0025)KLHL14 57565 kelch like family member 14 Downregulated genes (alpha=0.0025)KREMEN2 79412 kringle containing transmembrane protein 2 Downregulated genes (alpha=0.0025)LDHA 3939 lactate dehydrogenase A Downregulated genes (alpha=0.0025)LFNG 3955 LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase Downregulated genes (alpha=0.0025)LMO3 55885 LIM domain only 3 Downregulated genes (alpha=0.0025)LOC146880 146880 Rho GTPase activating protein 27 pseudogene Downregulated genes (alpha=0.0025)LOC642909 642909 C-terminal binding protein 2 pseudogene 4 Downregulated genes (alpha=0.0025)LOC644684 644684 BMS1, ribosome biogenesis factor pseudogene 12 Downregulated genes (alpha=0.0025)LOC653557 653557 BMS1, ribosome biogenesis factor pseudogene 8 Downregulated genes (alpha=0.0025)MARS2 92935 methionyl-tRNA synthetase 2, mitochondrial Downregulated genes (alpha=0.0025)MESP1 55897 mesoderm posterior bHLH transcription factor 1 Downregulated genes (alpha=0.0025)MINA 84864 MYC induced nuclear antigen Downregulated genes (alpha=0.0025)MRPS23 51649 mitochondrial ribosomal protein S23 Downregulated genes (alpha=0.0025)MSRB1 51734 methionine sulfoxide reductase B1 Downregulated genes (alpha=0.0025)MYCBP 26292 MYC binding protein Downregulated genes (alpha=0.0025)NAA10 8260 N(alpha)-acetyltransferase 10, NatA catalytic subunit Downregulated genes (alpha=0.0025)NCLN 56926 nicalin Downregulated genes (alpha=0.0025)NDUFB8 4714 NADH:ubiquinone oxidoreductase subunit B8 Downregulated genes (alpha=0.0025)NOP16 51491 NOP16 nucleolar protein Downregulated genes (alpha=0.0025)NPW 283869 neuropeptide W Downregulated genes (alpha=0.0025)NT5DC3 51559 5'-nucleotidase domain containing 3 Downregulated genes (alpha=0.0025)NUFIP1 26747 NUFIP1, FMR1 interacting protein 1 Downregulated genes (alpha=0.0025)NUP35 129401 nucleoporin 35 Downregulated genes (alpha=0.0025)PDCL3 79031 phosducin like 3 Downregulated genes (alpha=0.0025)PDE7B 27115 phosphodiesterase 7B Downregulated genes (alpha=0.0025)PDIA2 64714 protein disulfide isomerase family A member 2 Downregulated genes (alpha=0.0025)PDIA5 10954 protein disulfide isomerase family A member 5 Downregulated genes (alpha=0.0025)PHBP11 644214 prohibitin pseudogene 11 Downregulated genes (alpha=0.0025)PNPO 55163 pyridoxamine 5'-phosphate oxidase Downregulated genes (alpha=0.0025)POLDIP2 26073 DNA polymerase delta interacting protein 2 Downregulated genes (alpha=0.0025)POLR1C 9533 RNA polymerase I subunit C Downregulated genes (alpha=0.0025)POLR2F 5435 RNA polymerase II subunit F Downregulated genes (alpha=0.0025)PPAN 56342 peter pan homolog (Drosophila) Downregulated genes (alpha=0.0025)PSMG1 8624 proteasome assembly chaperone 1 Downregulated genes (alpha=0.0025)PTCD2 79810 pentatricopeptide repeat domain 2 Downregulated genes (alpha=0.0025)PTGES3P3 441050 prostaglandin E synthase 3 pseudogene 3 Downregulated genes (alpha=0.0025)RASA4 10156 RAS p21 protein activator 4 Downregulated genes (alpha=0.0025)RCBTB2 1102 RCC1 and BTB domain containing protein 2 Downregulated genes (alpha=0.0025)RDH10 157506 retinol dehydrogenase 10 (all-trans) Downregulated genes (alpha=0.0025)RFESD 317671 Rieske Fe-S domain containing Downregulated genes (alpha=0.0025)RPL26P30 653147 ribosomal protein L26 pseudogene 30 Downregulated genes (alpha=0.0025)RPL31P4 729646 ribosomal protein L31 pseudogene 4 Downregulated genes (alpha=0.0025)RPS7 6201 ribosomal protein S7 Downregulated genes (alpha=0.0025)RRP12 23223 ribosomal RNA processing 12 homolog Downregulated genes (alpha=0.0025)RRP15 51018 ribosomal RNA processing 15 homolog Downregulated genes (alpha=0.0025)RSAD1 55316 radical S-adenosyl methionine domain containing 1 Downregulated genes (alpha=0.0025)RUVBL1 8607 RuvB like AAA ATPase 1 Downregulated genes (alpha=0.0025)SART3 9733 squamous cell carcinoma antigen recognized by T-cells 3 Downregulated genes (alpha=0.0025)SBDSP1 155370 Shwachman-Bodian-Diamond syndrome pseudogene 1 Downregulated genes (alpha=0.0025)SCARNA13 677768 small Cajal body-specific RNA 13 Downregulated genes (alpha=0.0025)SDC3 9672 syndecan 3 Downregulated genes (alpha=0.0025)SLC16A9 220963 solute carrier family 16 member 9 Downregulated genes (alpha=0.0025)SLC19A1 6573 solute carrier family 19 member 1 Downregulated genes (alpha=0.0025)SLC25A19 60386 solute carrier family 25 member 19 Downregulated genes (alpha=0.0025)SLC25A39 51629 solute carrier family 25 member 39 Downregulated genes (alpha=0.0025)SNAPC4 6621 small nuclear RNA activating complex polypeptide 4 Downregulated genes (alpha=0.0025)SNORD96A 619571 small nucleolar RNA, C/D box 96A Downregulated genes (alpha=0.0025)SPATA13 221178 spermatogenesis associated 13 Downregulated genes (alpha=0.0025)SREK1IP1 285672 SREK1 interacting protein 1 Downregulated genes (alpha=0.0025)STUB1 10273 STIP1 homology and U-box containing protein 1 Downregulated genes (alpha=0.0025)TAF4B 6875 TATA-box binding protein associated factor 4b Downregulated genes (alpha=0.0025)TFRC 7037 transferrin receptor Downregulated genes (alpha=0.0025)TIGIT 201633 T-cell immunoreceptor with Ig and ITIM domains Downregulated genes (alpha=0.0025)TLE1P1 645381 transducin like enhancer of split 1 pseudogene 1 Downregulated genes (alpha=0.0025)TSFM 10102 Ts translation elongation factor, mitochondrial Downregulated genes (alpha=0.0025)TUBA4A 7277 tubulin alpha 4a Downregulated genes (alpha=0.0025)TUT1 64852 terminal uridylyl transferase 1, U6 snRNA-specific Downregulated genes (alpha=0.0025)TYW3 127253 tRNA-yW synthesizing protein 3 homolog Downregulated genes (alpha=0.0025)UNC93B3 285296 unc-93 homolog B3 pseudogene (C. elegans) Downregulated genes (alpha=0.0025)UNC93B6 255620 unc-93 homolog B6 pseudogene (C. elegans) Downregulated genes (alpha=0.0025)VMA21 203547 VMA21 vacuolar H+-ATPase homolog (S. cerevisiae) Downregulated genes (alpha=0.0025)WDR4 10785 WD repeat domain 4 Downregulated genes (alpha=0.0025)YIF1A 10897 Yip1 interacting factor homolog A, membrane trafficking protein Downregulated genes (alpha=0.0025)ZNF317 57693 zinc finger protein 317 Downregulated genes (alpha=0.0025)ZNF589 51385 zinc finger protein 589 Downregulated genes (alpha=0.0025)ZNRF3 84133 zinc and ring finger 3

Upregulated genes (alpha=0.0025) AACS 65985 acetoacetyl-CoA synthetase Upregulated genes (alpha=0.0025) ABCA1 19 ATP binding cassette subfamily A member 1 Upregulated genes (alpha=0.0025) ABCG1 9619 ATP binding cassette subfamily G member 1 Upregulated genes (alpha=0.0025) ABI1 10006 abl interactor 1 Upregulated genes (alpha=0.0025) ACSF2 80221 acyl-CoA synthetase family member 2 Upregulated genes (alpha=0.0025) ACTA2 59 actin, alpha 2, smooth muscle, aorta Upregulated genes (alpha=0.0025) ADA 100 adenosine deaminase Upregulated genes (alpha=0.0025) ADARB1 104 adenosine deaminase, RNA specific B1 Upregulated genes (alpha=0.0025) ADSSL1 122622 adenylosuccinate synthase like 1 Upregulated genes (alpha=0.0025) AIM1 202 absent in melanoma 1 Upregulated genes (alpha=0.0025) AKAP8L 26993 A-kinase anchoring protein 8 like Upregulated genes (alpha=0.0025) ALDH5A1 7915 aldehyde dehydrogenase 5 family member A1 Upregulated genes (alpha=0.0025) ALPK1 80216 alpha kinase 1 Upregulated genes (alpha=0.0025) AMY1B 277 amylase, alpha 1B (salivary) Upregulated genes (alpha=0.0025) ANKRD12 23253 ankyrin repeat domain 12 Upregulated genes (alpha=0.0025) AP1G2 8906 adaptor related protein complex 1 gamma 2 subunit Upregulated genes (alpha=0.0025) APOC2 344 apolipoprotein C2 Upregulated genes (alpha=0.0025) APOD 347 apolipoprotein D Upregulated genes (alpha=0.0025) ARID5B 84159 AT-rich interaction domain 5B Upregulated genes (alpha=0.0025) ARRB2 409 arrestin beta 2 Upregulated genes (alpha=0.0025) BAZ2B 29994 bromodomain adjacent to zinc finger domain 2B Upregulated genes (alpha=0.0025) BCRP5 648980 breakpoint cluster region pseudogene 5 Upregulated genes (alpha=0.0025) BEST3 144453 bestrophin 3 Upregulated genes (alpha=0.0025) BHLHE40 8553 basic helix-loop-helix family member e40 Upregulated genes (alpha=0.0025) BIRC7 79444 baculoviral IAP repeat containing 7 Upregulated genes (alpha=0.0025) BRI3 25798 brain protein I3 Upregulated genes (alpha=0.0025) BRI3P1 730010 brain protein I3 pseudogene 1 Upregulated genes (alpha=0.0025) BTN2A2 10385 butyrophilin subfamily 2 member A2 Upregulated genes (alpha=0.0025) C12orf57 113246 chromosome 12 open reading frame 57 Upregulated genes (alpha=0.0025) C18orf8 29919 chromosome 18 open reading frame 8 Upregulated genes (alpha=0.0025) C1orf85 112770 glycosylated lysosomal membrane protein Upregulated genes (alpha=0.0025) CAPN3 825 calpain 3 Upregulated genes (alpha=0.0025) CARHSP1 23589 calcium regulated heat stable protein 1 Upregulated genes (alpha=0.0025) CCDC109B 55013 mitochondrial calcium uniporter dominant negative beta subunit Upregulated genes (alpha=0.0025) CCDC42B 387885 cilia and flagella associated protein 73 Upregulated genes (alpha=0.0025) CD52 1043 CD52 molecule Upregulated genes (alpha=0.0025) CECR1 51816 cat eye syndrome chromosome region, candidate 1 Upregulated genes (alpha=0.0025) CIITA 4261 class II major histocompatibility complex transactivator Upregulated genes (alpha=0.0025) CLEC9A 283420 C-type lectin domain family 9 member A Upregulated genes (alpha=0.0025) CREBRF 153222 CREB3 regulatory factor Upregulated genes (alpha=0.0025) CRIP1 1396 cysteine rich protein 1 Upregulated genes (alpha=0.0025) CXCL16 58191 C-X-C motif chemokine ligand 16 Upregulated genes (alpha=0.0025) DCAF5 8816 DDB1 and CUL4 associated factor 5 Upregulated genes (alpha=0.0025) DDAH2 23564 dimethylarginine dimethylaminohydrolase 2 Upregulated genes (alpha=0.0025) DDX54 79039 DEAD-box helicase 54 Upregulated genes (alpha=0.0025) DENND2D 79961 DENN domain containing 2D Upregulated genes (alpha=0.0025) DFNA5 1687 DFNA5, deafness associated tumor suppressor Upregulated genes (alpha=0.0025) DIP2C 22982 disco interacting protein 2 homolog C Upregulated genes (alpha=0.0025) DPYSL2 1808 dihydropyrimidinase like 2 Upregulated genes (alpha=0.0025) DTX3L 151636 deltex E3 ubiquitin ligase 3L Upregulated genes (alpha=0.0025) DYRK1B 9149 dual specificity tyrosine phosphorylation regulated kinase 1B Upregulated genes (alpha=0.0025) EMP3 2014 epithelial membrane protein 3 Upregulated genes (alpha=0.0025) FAIM3 9214 Fc fragment of IgM receptor Upregulated genes (alpha=0.0025) FAM60A 58516 family with sequence similarity 60 member A Upregulated genes (alpha=0.0025) FBLN2 2199 fibulin 2 Upregulated genes (alpha=0.0025) FBXO15 201456 F-box protein 15 Upregulated genes (alpha=0.0025) FBXO32 114907 F-box protein 32 Upregulated genes (alpha=0.0025) FCGRT 2217 Fc fragment of IgG receptor and transporter Upregulated genes (alpha=0.0025) FLJ42627 645644 uncharacterized LOC645644 Upregulated genes (alpha=0.0025) FOXN3 1112 forkhead box N3 Upregulated genes (alpha=0.0025) GABARAPL2 11345 GABA type A receptor associated protein like 2 Upregulated genes (alpha=0.0025) GATS 352954 GATS, stromal antigen 3 opposite strand Upregulated genes (alpha=0.0025) GFI1 2672 growth factor independent 1 transcriptional repressor Upregulated genes (alpha=0.0025) GIMAP8 155038 GTPase, IMAP family member 8 Upregulated genes (alpha=0.0025) GLRX 2745 glutaredoxin Upregulated genes (alpha=0.0025) GM2A 2760 GM2 ganglioside activator Upregulated genes (alpha=0.0025) GNG7 2788 G protein subunit gamma 7 Upregulated genes (alpha=0.0025) GPR137C 283554 G protein-coupled receptor 137C Upregulated genes (alpha=0.0025) GPR160 26996 G protein-coupled receptor 160 Upregulated genes (alpha=0.0025) GYPC 2995 glycophorin C (Gerbich blood group) Upregulated genes (alpha=0.0025) H1FX 8971 H1 histone family member X Upregulated genes (alpha=0.0025) HAVCR2 84868 hepatitis A virus cellular receptor 2 Upregulated genes (alpha=0.0025) HBA2 3040 hemoglobin subunit alpha 2 Upregulated genes (alpha=0.0025) HCP5 10866 HLA complex P5 (non-protein coding) Upregulated genes (alpha=0.0025) HELQ 113510 helicase, POLQ-like Upregulated genes (alpha=0.0025) HILPDA 29923 hypoxia inducible lipid droplet associated Upregulated genes (alpha=0.0025) HIP1 3092 huntingtin interacting protein 1 Upregulated genes (alpha=0.0025) HLA-DMA 3108 major histocompatibility complex, class II, DM alpha Upregulated genes (alpha=0.0025) HLA-DMB 3109 major histocompatibility complex, class II, DM beta Upregulated genes (alpha=0.0025) HLA-DOA 3111 major histocompatibility complex, class II, DO alpha Upregulated genes (alpha=0.0025) HLA-DOB 3112 major histocompatibility complex, class II, DO beta Upregulated genes (alpha=0.0025) HLA-DPB1 3115 major histocompatibility complex, class II, DP beta 1 Upregulated genes (alpha=0.0025) HLA-DQA1 3117 major histocompatibility complex, class II, DQ alpha 1 Upregulated genes (alpha=0.0025) HLA-DRA 3122 major histocompatibility complex, class II, DR alpha Upregulated genes (alpha=0.0025) HLA-DRB1 3123 major histocompatibility complex, class II, DR beta 1 Upregulated genes (alpha=0.0025) HLA-DRB3 3125 major histocompatibility complex, class II, DR beta 3 Upregulated genes (alpha=0.0025) HLA-DRB4 3126 major histocompatibility complex, class II, DR beta 4 Upregulated genes (alpha=0.0025) HLA-E 3133 major histocompatibility complex, class I, E Upregulated genes (alpha=0.0025) HSPB1P1 653553 heat shock protein family B (small) member 1 pseudogene 1 Upregulated genes (alpha=0.0025) IFIH1 64135 interferon induced with helicase C domain 1 Upregulated genes (alpha=0.0025) IFIT2 3433 interferon induced protein with tetratricopeptide repeats 2 Upregulated genes (alpha=0.0025) IL10RB 3588 interleukin 10 receptor subunit beta Upregulated genes (alpha=0.0025) IL4R 3566 interleukin 4 receptor Upregulated genes (alpha=0.0025) IRF1 3659 interferon regulatory factor 1 Upregulated genes (alpha=0.0025) IRF2BPL 64207 interferon regulatory factor 2 binding protein like Upregulated genes (alpha=0.0025) IRS2 8660 insulin receptor substrate 2 Upregulated genes (alpha=0.0025) KANSL1L 151050 KAT8 regulatory NSL complex subunit 1 like Upregulated genes (alpha=0.0025) KLF2 10365 Kruppel like factor 2 Upregulated genes (alpha=0.0025) KLHDC8B 200942 kelch domain containing 8B Upregulated genes (alpha=0.0025) KLHL22 84861 kelch like family member 22 Upregulated genes (alpha=0.0025) KLHL24 54800 kelch like family member 24 Upregulated genes (alpha=0.0025) KLHL6 89857 kelch like family member 6 Upregulated genes (alpha=0.0025) LGALS1 3956 galectin 1 Upregulated genes (alpha=0.0025) LILRB4 11006 leukocyte immunoglobulin like receptor B4 Upregulated genes (alpha=0.0025) LINC00426 100188949 long intergenic non-protein coding RNA 426 Upregulated genes (alpha=0.0025) LITAF 9516 lipopolysaccharide induced TNF factor Upregulated genes (alpha=0.0025) LMOD3 56203 leiomodin 3 Upregulated genes (alpha=0.0025) LOC100129550100129550 uncharacterized LOC100129550 Upregulated genes (alpha=0.0025) LOC100130276100130276 uncharacterized LOC100130276 Upregulated genes (alpha=0.0025) LOC440864 440864 uncharacterized LOC440864 Upregulated genes (alpha=0.0025) LOC644173 644173 uncharacterized LOC644173 Upregulated genes (alpha=0.0025) LOC644634 644634 family with sequence similarity 231 member D Upregulated genes (alpha=0.0025) LOC728743 728743 zinc finger protein pseudogene Upregulated genes (alpha=0.0025) LPIN1 23175 lipin 1 Upregulated genes (alpha=0.0025) LRMP 4033 lymphoid restricted membrane protein Upregulated genes (alpha=0.0025) LY9 4063 lymphocyte antigen 9 Upregulated genes (alpha=0.0025) LY96 23643 lymphocyte antigen 96 Upregulated genes (alpha=0.0025) MACF1 23499 microtubule-actin crosslinking factor 1 Upregulated genes (alpha=0.0025) MDK 4192 midkine (neurite growth-promoting factor 2) Upregulated genes (alpha=0.0025) MEF2D 4209 myocyte enhancer factor 2D Upregulated genes (alpha=0.0025) MFGE8 4240 milk fat globule-EGF factor 8 protein Upregulated genes (alpha=0.0025) MGC72080 389538 MGC72080 pseudogene Upregulated genes (alpha=0.0025) MICAL1 64780 microtubule associated monooxygenase, calponin and LIM domain containing 1 Upregulated genes (alpha=0.0025) MIS18BP1 55320 MIS18 binding protein 1 Upregulated genes (alpha=0.0025) MMP11 4320 matrix metallopeptidase 11 Upregulated genes (alpha=0.0025) MVP 9961 major vault protein Upregulated genes (alpha=0.0025) MXD3 83463 MAX dimerization protein 3 Upregulated genes (alpha=0.0025) MYB 4602 MYB proto-oncogene, transcription factor Upregulated genes (alpha=0.0025) MYO1G 64005 myosin IG Upregulated genes (alpha=0.0025) NEU1 4758 neuraminidase 1 Upregulated genes (alpha=0.0025) NFATC2IP 84901 nuclear factor of activated T-cells 2 interacting protein Upregulated genes (alpha=0.0025) NPC2 10577 NPC intracellular cholesterol transporter 2 Upregulated genes (alpha=0.0025) NPIPL3 23117 nuclear pore complex interacting protein family member B3 Upregulated genes (alpha=0.0025) NREP 9315 neuronal regeneration related protein Upregulated genes (alpha=0.0025) NUAK2 81788 NUAK family kinase 2 Upregulated genes (alpha=0.0025) NUCB2 4925 nucleobindin 2 Upregulated genes (alpha=0.0025) OAS1 4938 2'-5'-oligoadenylate synthetase 1 Upregulated genes (alpha=0.0025) OAS2 4939 2'-5'-oligoadenylate synthetase 2 Upregulated genes (alpha=0.0025) OAS3 4940 2'-5'-oligoadenylate synthetase 3 Upregulated genes (alpha=0.0025) P2RX4 5025 purinergic receptor P2X 4 Upregulated genes (alpha=0.0025) P2RY8 286530 purinergic receptor P2Y8 Upregulated genes (alpha=0.0025) PARP15 165631 poly(ADP-ribose) polymerase family member 15 Upregulated genes (alpha=0.0025) PARP9 83666 poly(ADP-ribose) polymerase family member 9 Upregulated genes (alpha=0.0025) PARVG 64098 parvin gamma Upregulated genes (alpha=0.0025) PATL2 197135 PAT1 homolog 2 Upregulated genes (alpha=0.0025) PCNX 22990 pecanex homolog 1 (Drosophila) Upregulated genes (alpha=0.0025) PHEX 5251 phosphate regulating endopeptidase homolog, X-linked Upregulated genes (alpha=0.0025) PIK3C2B 5287 phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta Upregulated genes (alpha=0.0025) PIK3IP1 113791 phosphoinositide-3-kinase interacting protein 1 Upregulated genes (alpha=0.0025) PINK1 65018 PTEN induced putative kinase 1 Upregulated genes (alpha=0.0025) PLA2G2C 391013 phospholipase A2 group IIC Upregulated genes (alpha=0.0025) PLAU 5328 plasminogen activator, urokinase Upregulated genes (alpha=0.0025) PLXNB1 5364 plexin B1 Upregulated genes (alpha=0.0025) PPP1R15A 23645 protein phosphatase 1 regulatory subunit 15A Upregulated genes (alpha=0.0025) PRR5 55615 proline rich 5 Upregulated genes (alpha=0.0025) PYCARD 29108 PYD and CARD domain containing Upregulated genes (alpha=0.0025) PYROXD2 84795 pyridine nucleotide-disulphide oxidoreductase domain 2 Upregulated genes (alpha=0.0025) RAB11FIP1 80223 RAB11 family interacting protein 1 Upregulated genes (alpha=0.0025) RAB37 326624 RAB37, member RAS oncogene family Upregulated genes (alpha=0.0025) RARRES2 5919 retinoic acid receptor responder 2 Upregulated genes (alpha=0.0025) RENBP 5973 renin binding protein Upregulated genes (alpha=0.0025) RHBDF1 64285 rhomboid 5 homolog 1 Upregulated genes (alpha=0.0025) RHOBTB2 23221 Rho related BTB domain containing 2 Upregulated genes (alpha=0.0025) RHOQ 23433 ras homolog family member Q Upregulated genes (alpha=0.0025) RNF144A 9781 ring finger protein 144A Upregulated genes (alpha=0.0025) RNF44 22838 ring finger protein 44 Upregulated genes (alpha=0.0025) RRAGD 58528 Ras related GTP binding D Upregulated genes (alpha=0.0025) RRN3P2 653390 RRN3 homolog, RNA polymerase I transcription factor pseudogene 2 Upregulated genes (alpha=0.0025) S1PR4 8698 sphingosine-1-phosphate receptor 4 Upregulated genes (alpha=0.0025) SAMD9 54809 sterile alpha motif domain containing 9 Upregulated genes (alpha=0.0025) SAMD9L 219285 sterile alpha motif domain containing 9 like Upregulated genes (alpha=0.0025) SBK1 388228 SH3 domain binding kinase 1 Upregulated genes (alpha=0.0025) SERPINB9 5272 serpin family B member 9 Upregulated genes (alpha=0.0025) SGSH 6448 N-sulfoglucosamine sulfohydrolase Upregulated genes (alpha=0.0025) SLC15A4 121260 solute carrier family 15 member 4 Upregulated genes (alpha=0.0025) SLC26A11 284129 solute carrier family 26 member 11 Upregulated genes (alpha=0.0025) SLC29A4 222962 solute carrier family 29 member 4 Upregulated genes (alpha=0.0025) SLC29A4P1 402509 solute carrier family 29 member 4 pseudogene 1 Upregulated genes (alpha=0.0025) SMG1 23049 SMG1, nonsense mediated mRNA decay associated PI3K related kinase Upregulated genes (alpha=0.0025) SNORA72 26775 small nucleolar RNA, H/ACA box 72 Upregulated genes (alpha=0.0025) SNX30 401548 sorting nexin family member 30 Upregulated genes (alpha=0.0025) SOX11 6664 SRY-box 11 Upregulated genes (alpha=0.0025) SOX8 30812 SRY-box 8 Upregulated genes (alpha=0.0025) SSBP2 23635 single stranded DNA binding protein 2 Upregulated genes (alpha=0.0025) ST3GAL5 8869 ST3 beta-galactoside alpha-2,3-sialyltransferase 5 Upregulated genes (alpha=0.0025) STAT2 6773 signal transducer and activator of transcription 2 Upregulated genes (alpha=0.0025) SUN2 25777 Sad1 and UNC84 domain containing 2 Upregulated genes (alpha=0.0025) SYS1 90196 SYS1, golgi trafficking protein Upregulated genes (alpha=0.0025) TCL1B 9623 T-cell leukemia/lymphoma 1B Upregulated genes (alpha=0.0025) TIAF1 9220 TGFB1-induced anti-apoptotic factor 1 Upregulated genes (alpha=0.0025) TM2D1 83941 TM2 domain containing 1 Upregulated genes (alpha=0.0025) TMEM91 641649 transmembrane protein 91 Upregulated genes (alpha=0.0025) TMX4 56255 thioredoxin related transmembrane protein 4 Upregulated genes (alpha=0.0025) TNFRSF14 8764 TNF receptor superfamily member 14 Upregulated genes (alpha=0.0025) TNFRSF17 608 TNF receptor superfamily member 17 Upregulated genes (alpha=0.0025) TOP2B 7155 topoisomerase (DNA) II beta Upregulated genes (alpha=0.0025) TOX2 84969 TOX high mobility group box family member 2 Upregulated genes (alpha=0.0025) TP53INP1 94241 tumor protein p53 inducible nuclear protein 1 Upregulated genes (alpha=0.0025) TPP1 1200 tripeptidyl peptidase 1 Upregulated genes (alpha=0.0025) TRIB1 10221 tribbles pseudokinase 1 Upregulated genes (alpha=0.0025) TRIM13 10206 tripartite motif containing 13 Upregulated genes (alpha=0.0025) TRIM22 10346 tripartite motif containing 22 Upregulated genes (alpha=0.0025) TSC22D1 8848 TSC22 domain family member 1 Upregulated genes (alpha=0.0025) TSC22D3 1831 TSC22 domain family member 3 Upregulated genes (alpha=0.0025) TSPAN32 10077 tetraspanin 32 Upregulated genes (alpha=0.0025) TUG1 55000 taurine up-regulated 1 (non-protein coding) Upregulated genes (alpha=0.0025) TYROBP 7305 TYRO protein tyrosine kinase binding protein Upregulated genes (alpha=0.0025) UAP1L1 91373 UDP-N-acetylglucosamine pyrophosphorylase 1 like 1 Upregulated genes (alpha=0.0025) UBE2L6 9246 ubiquitin conjugating enzyme E2 L6 Upregulated genes (alpha=0.0025) VANGL2 57216 VANGL planar cell polarity protein 2 Upregulated genes (alpha=0.0025) WIPI2 26100 WD repeat domain, phosphoinositide interacting 2 Upregulated genes (alpha=0.0025) WNT3 7473 Wnt family member 3 Upregulated genes (alpha=0.0025) YPEL1 29799 yippee like 1 Upregulated genes (alpha=0.0025) YPEL2 388403 yippee like 2 Upregulated genes (alpha=0.0025) YPEL3 83719 yippee like 3 Upregulated genes (alpha=0.0025) YPEL5 51646 yippee like 5 Upregulated genes (alpha=0.0025) ZC3H12B 340554 zinc finger CCCH-type containing 12B Upregulated genes (alpha=0.0025) ZHX2 22882 zinc fingers and homeoboxes 2 Upregulated genes (alpha=0.0025) ZNF219 51222 zinc finger protein 219 Upregulated genes (alpha=0.0025) ZNF260 339324 zinc finger protein 260 Upregulated genes (alpha=0.0025) ZNF608 57507 zinc finger protein 608 Upregulated genes (alpha=0.0025) ZSCAN16 80345 zinc finger and SCAN domain containing 16 Upregulated genes (alpha=0.0025) ZSCAN2 54993 zinc finger and SCAN domain containing 2 Supplemental Table 6. Signatures that are significantly enriched with top regulated genes following z-VRPR-fmk treatment in Rec-1 cells.

Downregulated signatures: Defined P [GSEA] Signatures DB Category Sub Category Signature name Signature links members Enrichment score (by permutation test) FDR [GSEA] HGNCSigDB_dMay2014 gene families Mitochondrial respiratory chain complexMitochondrial respiratory chain complex / Complex III http://www.genenames.org/genefamilies/mitocomplex#comIII 9 0.8030 0.0036 0.0064 MolSigDBv4_0_dMay2014 c5: gene ontology (GO) gene sets biological processes RESPONSE_TO_HEAT http://www.broadinstitute.org/gsea/msigdb/cards/RESPONSE_TO_HEAT 10 0.8013 0.0051 0.0202 MolSigDBv4_0_dMay2014 c5: gene ontology (GO) gene sets biological processes DNA_FRAGMENTATION_DURING_APOPTOSIS http://www.broadinstitute.org/gsea/msigdb/cards/DNA_FRAGMENTATION_DURING_APOPTOSIS 13 0.7959 0.0010 0.0146 MolSigDBv4_0_dMay2014 c2: curated gene sets chemical and genetic perturbationsCOLLER_MYC_TARGETS_UP http://www.broadinstitute.org/gsea/msigdb/cards/COLLER_MYC_TARGETS_UP 25 0.7935 0.0010 0.0010 MolSigDBv4_0_dMay2014 c2: curated gene sets canonical pathways / KEGG KEGG_VALINE_LEUCINE_AND_ISOLEUCINE_BIOSYNTHESIShttp://www.broadinstitute.org/gsea/msigdb/cards/KEGG_VALINE_LEUCINE_AND_ISOLEUCINE_BIOSYNTHESIS11 0.7877 0.0018 0.0019 MolSigDBv4_0_dMay2014 c2: curated gene sets chemical and genetic perturbationsMULLIGAN_NTF3_SIGNALING_VIA_INSR_AND_IGF1R_UPhttp://www.broadinstitute.org/gsea/msigdb/cards/MULLIGAN_NTF3_SIGNALING_VIA_INSR_AND_IGF1R_UP23 0.7860 0.0010 0.0010 GeneSigDB_v4_Sept2011 Human Viral Viral_Tsunedomi06_12genes http://www.genesigdb.org/genesigdb/signaturedetail.jsp?signatureId=17088983-Table2a 12 0.7793 0.0016 0.0084 MolSigDBv4_0_dMay2014 c4: computational gene sets cancer modules MODULE_50 http://www.broadinstitute.org/gsea/msigdb/cards/MODULE_50 13 0.7783 0.0010 0.0107 MolSigDBv4_0_dMay2014 c4: computational gene sets cancer modules MODULE_514 http://www.broadinstitute.org/gsea/msigdb/cards/MODULE_514 10 0.7761 0.0019 0.0125 MolSigDBv4_0_dMay2014 c2: curated gene sets canonical pathways / Reactome REACTOME_RNA_POL_III_CHAIN_ELONGATION http://www.broadinstitute.org/gsea/msigdb/cards/REACTOME_RNA_POL_III_CHAIN_ELONGATION17 0.7758 0.0010 0.0017 MolSigDBv4_0_dMay2014 c2: curated gene sets chemical and genetic perturbationsMYLLYKANGAS_AMPLIFICATION_HOT_SPOT_29 http://www.broadinstitute.org/gsea/msigdb/cards/MYLLYKANGAS_AMPLIFICATION_HOT_SPOT_298 0.7744 0.0049 0.0134 MolSigDBv4_0_dMay2014 c2: curated gene sets chemical and genetic perturbationsSCHUHMACHER_MYC_TARGETS_UP http://www.broadinstitute.org/gsea/msigdb/cards/SCHUHMACHER_MYC_TARGETS_UP 80 0.7722 0.0010 0.0010 MolSigDBv4_0_dMay2014 c5: gene ontology (GO) gene sets cellular components ORGANELLAR_SMALL_RIBOSOMAL_SUBUNIT http://www.broadinstitute.org/gsea/msigdb/cards/ORGANELLAR_SMALL_RIBOSOMAL_SUBUNIT 11 0.7618 0.0040 0.0029 MolSigDBv4_0_dMay2014 c5: gene ontology (GO) gene sets cellular components MITOCHONDRIAL_SMALL_RIBOSOMAL_SUBUNIT http://www.broadinstitute.org/gsea/msigdb/cards/MITOCHONDRIAL_SMALL_RIBOSOMAL_SUBUNIT11 0.7618 0.0040 0.0029 MolSigDBv4_0_dMay2014 c5: gene ontology (GO) gene sets cellular components SMALL_RIBOSOMAL_SUBUNIT http://www.broadinstitute.org/gsea/msigdb/cards/SMALL_RIBOSOMAL_SUBUNIT 11 0.7618 0.0040 0.0029 MolSigDBv4_0_dMay2014 c2: curated gene sets chemical and genetic perturbationsSCHLOSSER_MYC_TARGETS_AND_SERUM_RESPONSE_DNhttp://www.broadinstitute.org/gsea/msigdb/cards/SCHLOSSER_MYC_TARGETS_AND_SERUM_RESPONSE_DN47 0.7549 0.0010 0.0010 MolSigDBv4_0_dMay2014 c2: curated gene sets chemical and genetic perturbationsXU_RESPONSE_TO_TRETINOIN_AND_NSC682994_DNhttp://www.broadinstitute.org/gsea/msigdb/cards/XU_RESPONSE_TO_TRETINOIN_AND_NSC682994_DN15 0.7505 0.0010 0.0016 GeneSigDB_v4_Sept2011 Mouse StemCell homolog(StemCell_Parker05_27genes, from Mus musculus,http://www.genesigdb.org/genesigdb/signaturedetail.jsp?signatureId=15992799-table2 to Homo sapiens, 15 of 15 genes) 15 0.7483 0.0020 0.0088 StaudtSigDB_dNov2012 Signaling pathway T cell cytokine signallng Tcell_cytokine_induced_prolif http://lymphochip.nih.gov/cgi-bin/signaturedb/signatureDB_DisplayGenes.cgi?signatureID=77 27 0.7472 0.0010 0.0010 MolSigDBv4_0_dMay2014 c2: curated gene sets chemical and genetic perturbationsFU_INTERACT_WITH_ALKBH8 http://www.broadinstitute.org/gsea/msigdb/cards/FU_INTERACT_WITH_ALKBH8 13 0.7457 0.0040 0.0048 MolSigDBv4_0_dMay2014 c2: curated gene sets chemical and genetic perturbationsFUNG_IL2_SIGNALING_1 http://www.broadinstitute.org/gsea/msigdb/cards/FUNG_IL2_SIGNALING_1 11 0.7446 0.0051 0.0076 MolSigDBv4_0_dMay2014 c5: gene ontology (GO) gene sets biological processes PROTEIN_TARGETING_TO_MITOCHONDRION http://www.broadinstitute.org/gsea/msigdb/cards/PROTEIN_TARGETING_TO_MITOCHONDRION 11 0.7437 0.0017 0.0342 HGNCSigDB_dMay2014 gene families Mitochondrial ribosomal proteins Mitochondrial ribosomal proteins / large subunits http://www.genenames.org/genefamilies/MRP#MRPL 49 0.7426 0.0010 0.0010 MolSigDBv4_0_dMay2014 c5: gene ontology (GO) gene sets biological processes RRNA_METABOLIC_PROCESS http://www.broadinstitute.org/gsea/msigdb/cards/RRNA_METABOLIC_PROCESS 16 0.7409 0.0010 0.0064 StaudtSigDB_dNov2012 Signaling pathway Notch Notch_T-ALL_up_Palomero http://lymphochip.nih.gov/cgi-bin/signaturedb/signatureDB_DisplayGenes.cgi?signatureID=235 47 0.7353 0.0010 0.0010 MolSigDBv4_0_dMay2014 c2: curated gene sets chemical and genetic perturbationsSCHLOSSER_MYC_TARGETS_AND_SERUM_RESPONSE_UPhttp://www.broadinstitute.org/gsea/msigdb/cards/SCHLOSSER_MYC_TARGETS_AND_SERUM_RESPONSE_UP47 0.7346 0.0010 0.0010 MolSigDBv4_0_dMay2014 c2: curated gene sets canonical pathways / KEGG KEGG_CITRATE_CYCLE_TCA_CYCLE http://www.broadinstitute.org/gsea/msigdb/cards/KEGG_CITRATE_CYCLE_TCA_CYCLE 32 0.7341 0.0010 0.0010 HGNCSigDB_dMay2014 gene families RNA polymerase subunits RNA polymerase subunits http://www.genenames.org/genefamilies/POLR 29 0.7336 0.0010 0.0010 MolSigDBv4_0_dMay2014 c5: gene ontology (GO) gene sets cellular components RIBOSOMAL_SUBUNIT http://www.broadinstitute.org/gsea/msigdb/cards/RIBOSOMAL_SUBUNIT 20 0.7331 0.0010 0.0010 MolSigDBv4_0_dMay2014 c2: curated gene sets canonical pathways / Reactome REACTOME_RNA_POL_III_TRANSCRIPTION_TERMINATIONhttp://www.broadinstitute.org/gsea/msigdb/cards/REACTOME_RNA_POL_III_TRANSCRIPTION_TERMINATION19 0.7313 0.0010 0.0017 MolSigDBv4_0_dMay2014 c5: gene ontology (GO) gene sets biological processes RRNA_PROCESSING http://www.broadinstitute.org/gsea/msigdb/cards/RRNA_PROCESSING 15 0.7307 0.0010 0.0138 MolSigDBv4_0_dMay2014 c5: gene ontology (GO) gene sets biological processes CELLULAR_RESPONSE_TO_STIMULUS http://www.broadinstitute.org/gsea/msigdb/cards/CELLULAR_RESPONSE_TO_STIMULUS 19 0.7304 0.0010 0.0096 StaudtSigDB_dNov2012 Signaling pathway MYC Myc_overexpression_1.5x_up http://lymphochip.nih.gov/cgi-bin/signaturedb/signatureDB_DisplayGenes.cgi?signatureID=167 86 0.7271 0.0010 0.0010 MolSigDBv4_0_dMay2014 c2: curated gene sets chemical and genetic perturbationsRAHMAN_TP53_TARGETS_PHOSPHORYLATED http://www.broadinstitute.org/gsea/msigdb/cards/RAHMAN_TP53_TARGETS_PHOSPHORYLATED21 0.7218 0.0010 0.0010 MolSigDBv4_0_dMay2014 c4: computational gene sets cancer modules MODULE_25 http://www.broadinstitute.org/gsea/msigdb/cards/MODULE_25 13 0.7214 0.0059 0.0157 MolSigDBv4_0_dMay2014 c2: curated gene sets canonical pathways / Reactome REACTOME_PURINE_RIBONUCLEOSIDE_MONOPHOSPHATE_BIOSYNTHESIShttp://www.broadinstitute.org/gsea/msigdb/cards/REACTOME_PURINE_RIBONUCLEOSIDE_MONOPHOSPHATE_BIOSYNTHESIS11 0.7173 0.0182 0.0128 StaudtSigDB_dNov2012 Signaling pathway IL6 IL6_Ly10_Up_group2 http://lymphochip.nih.gov/cgi-bin/signaturedb/signatureDB_DisplayGenes.cgi?signatureID=255 9 0.7166 0.0416 0.0083 MolSigDBv4_0_dMay2014 c5: gene ontology (GO) gene sets cellular components ORGANELLAR_RIBOSOME http://www.broadinstitute.org/gsea/msigdb/cards/ORGANELLAR_RIBOSOME 22 0.7160 0.0010 0.0010 MolSigDBv4_0_dMay2014 c5: gene ontology (GO) gene sets cellular components MITOCHONDRIAL_RIBOSOME http://www.broadinstitute.org/gsea/msigdb/cards/MITOCHONDRIAL_RIBOSOME 22 0.7160 0.0010 0.0010 MolSigDBv4_0_dMay2014 c2: curated gene sets canonical pathways / Reactome REACTOME_VITAMIN_B5_PANTOTHENATE_METABOLISMhttp://www.broadinstitute.org/gsea/msigdb/cards/REACTOME_VITAMIN_B5_PANTOTHENATE_METABOLISM11 0.7156 0.0141 0.0139 MolSigDBv4_0_dMay2014 c4: computational gene sets cancer gene neighborhoods GNF2_MSH6 http://www.broadinstitute.org/gsea/msigdb/cards/GNF2_MSH6 31 0.7125 0.0010 0.0010 MolSigDBv4_0_dMay2014 c5: gene ontology (GO) gene sets cellular components NUCLEOLAR_PART http://www.broadinstitute.org/gsea/msigdb/cards/NUCLEOLAR_PART 18 0.7103 0.0010 0.0019 MolSigDBv4_0_dMay2014 c5: gene ontology (GO) gene sets molecular functions NEUTRAL_AMINO_ACID_TRANSMEMBRANE_TRANSPORTER_ACTIVITYhttp://www.broadinstitute.org/gsea/msigdb/cards/NEUTRAL_AMINO_ACID_TRANSMEMBRANE_TRANSPORTER_ACTIVITY12 0.7098 0.0197 0.0445 GeneSigDB_v4_Sept2011 Mouse Bone homolog(Bone_Kalajzic05_12genes, from Mus musculus,http://www.genesigdb.org/genesigdb/signaturedetail.jsp?signatureId=15834136-Table3 to Homo sapiens, 10 of 11 genes) 10 0.7085 0.0232 0.0533 MolSigDBv4_0_dMay2014 c5: gene ontology (GO) gene sets biological processes COFACTOR_TRANSPORT http://www.broadinstitute.org/gsea/msigdb/cards/COFACTOR_TRANSPORT 11 0.7071 0.0126 0.0709 HGNCSigDB_dMay2014 gene families Mitochondrial respiratory chain complexMitochondrial respiratory chain complex / Complex V http://www.genenames.org/genefamilies/mitocomplex#FATP 16 0.7046 0.0062 0.0057 MolSigDBv4_0_dMay2014 c5: gene ontology (GO) gene sets biological processes RNA_3END_PROCESSING http://www.broadinstitute.org/gsea/msigdb/cards/RNA_3END_PROCESSING 10 0.7036 0.0225 0.0767 MolSigDBv4_0_dMay2014 c4: computational gene sets cancer gene neighborhoods MORF_GSPT1 http://www.broadinstitute.org/gsea/msigdb/cards/MORF_GSPT1 49 0.7007 0.0010 0.0010