Candidatus Phytoplasma Meliae’

bioRxiv preprint doi: https://doi.org/10.1101/2020.06.01.128413; this version posted June 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

1 Title: Diversity analysis of amp gene sequences in the ‘Candidatus Phytoplasma meliae’

2 Authors: Franco D. Fernández1,2, and Luis R. Conci1,2*

3 1. Instituto Nacional de Tecnología Agropecuaria (INTA), Centro de Investigaciones Agropecuarias

4 (CIAP), Instituto de Patología Vegetal (IPAVE). Camino 60 cuadras km 5 ½ (X5020ICA), Córdoba.

5 Argentina

6 2. Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET). Unidad de Fitopatología y

7 Modelización Agrícola (UFYMA). Camino 60 cuadras km 5 ½ (X5020ICA), Córdoba. Argentina

8 * Corresponding author: Luis R Conci, e-mail: [email protected]

10 Keywords: Phytoplasma, antigenic membrane protein, selection pressure, chinaberry, MPV

25 bioRxiv preprint doi: https://doi.org/10.1101/2020.06.01.128413; this version posted June 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

26 Abstract

27 Phytoplasmas are plant pathogenic bacteria transmitted by insects. As endosymbiotic bacteria that lack a 28 cell wall, their membrane proteins are in direct contact with host cytoplasm. In phytoplasmas the 29 immunodominant membrane proteins (IDPs), are the most abundant proteins of the cell membrane. The 30 antigenic membrane protein (Amp), one of the three types of IDPs, is characterized by a positive selection 31 pressure acting in their extracellular domain. In South America, the ‘Candidatus Phytoplasma meliae’ has 32 been associated to chinaberry yellows disease. In the present work, we describe for the first time the 33 structure, phylogeny and selection pressure of amp gene in sixteen ‘Candidatus Phytoplasma meliae’ 34 isolates. Our results indicate that amp gene sequences preserve the structure, large extracellular domain 35 flanked by to hydrophobic domains in the N- (signal peptide) and C-termini (transmembrane), previously 36 described in its orthologues and high divergence in the amino acids residues from extracellular domain. 37 Moreover, a positive selection pressure was detected predominantly in this region confirming previous 38 reports.

55 bioRxiv preprint doi: https://doi.org/10.1101/2020.06.01.128413; this version posted June 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

56 Introduction

57 Phytoplasmas are cell wall-less bacteria that inhabit sieve cells in the phloem tissue of infected plants and 58 are transmitted from plant-to-plant by phloem-feeding insect vectors, principally leafhoppers (Zhao et al. 59 2015). These pathogens are associated with plant diseases in several hundred plant species, including many 60 important food, vegetable and fruit crops, ornamental plants, timber and shade trees (Bertaccini and Lee, 61 2019). In South America, China berry trees (Melia azedarach L) are affected by two different 62 phytoplasmas, ‘Candidatus Phytoplasma meliae’ (group 16SrXIII, subgroups –C and –G) (Fernández et al. 63 2016) (Figure 1A) and ‘Candidatus Phytoplasma pruni’ (group 16SrIII, subgroup B) (Galdeano et al. 2004). 64 In Argentina, ‘Ca. P. meliae’ is restricted to North-East region while ‘Ca. P. pruni’ has a wider distribution 65 covering different regions of the country (Arneodo et al. 2007; Fernandez 2015). The differential 66 distribution of these two phytoplasmas could be linked to the distribution of its insect vector, considering 67 that each species of phytoplasmas establishes a unique relationship with the insect that has the ability to 68 transmit it. Nevertheless, in this case this hypothesis has not been confirmed yet. In this context, the study 69 of membrane proteins is a reliable approach to understand the molecular dialogue between insect vectors 70 and phytoplasmas. This group of pathogens lacks a cell wall, thus their membrane proteins are in direct 71 contact with the host cytoplasm (Konnerth et al. 2016). The immunodominant membrane proteins (IDPs) 72 are a group of proteins that comprises a major portion of total cellular membrane proteins in phytoplasmas 73 (Kakizawa et al. 2004). To date, three non-orthologous IDPs types have been described: Imp 74 (immunodominant membrane protein), Amp (antigenic membrane protein) and IdpA (immunodominant 75 membrane protein A) (Kakizawa et al. 2006a). The Amp protein is constituted by a large extracellular 76 domain flanked by two hydrophobic domains in the N- (signal peptide) and C-termini (transmembrane) 77 (Arashida et al. 2008; Barbara et al. 2002; Kakizawa et al. 2006a). Previous studies have shown great 78 variability in the extracellular domain accompanied by high selection positive pressure (Fabre et al. 2011; 79 Kakizawa, et al. 2006b). This selection pressure is suggested to be associated with the key role that it plays 80 in the interaction of phytoplasmas with insect vectors (Suzuki et al. 2006). So far, studies carried out with 81 the Amp protein have been only described in aster yellows group phytoplasmas (16SrI, ‘Ca. Phytoplasma 82 asteris’) and Stolbur (16SrXII, ‘Ca. Phytoplasma solani’). In South America, there are no reports about the 83 Amp protein in ‘Ca. Phytoplasma meliae’ and related phytoplasmas of the 16SrXIII group (Mexican 84 periwinkle virescence). In this scenario, the goal of this work was to describe the main features of Amp in 85 diverse geographical isolates of 'Ca. Phytoplasma meliae' present in Argentina to study its variability and 86 selection pressure processes.

87 Materials and methods

88 Sample source

89 Total DNA from sixteen (n=16) chinaberry tree naturally infected with ‘Candidatus Phytoplasma meliae’ 90 were used in molecular analyzes. This DNA collection was obtained from different geographical locations 91 situated in the northeast of Argentina (Table 1, Figure 1A). For DNA extraction CTAB protocol (Doyle 92 and Doyle 1990) was used. Detection and identification of ‘Candidatus Phytoplasma meliae’ was accessed 93 by PCR and PCR-RFLP as described previously (Fernández et al. 2016). Briefly, PCR detection was bioRxiv preprint doi: https://doi.org/10.1101/2020.06.01.128413; this version posted June 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

94 conducted using universal primers P1/P7 (Deng and Hiruki 1991) and R16F2n/R16R2 (Lee et al. 1994) in 95 direct and nested reactions. Nested PCR amplicons (1.2kb) were subjected to digestion using MseI, HpaII, 96 RsaI and HaeIII (NEB, USA) endonucleases and RFLP profiles were compared to reference patterns of 97 subgroups 16SXIII-G and 16SrIII-B.

98 Amplification and sequencing of groEL-amp-nadE region

99 DNA from ‘Ca. Phytoplasma meliae’ (isolate ChTYXIII-Mo3) was used as reference DNA for sequencing 100 genomic fragment containing groEL (partial)-amp (complete)-nadE (partial) genes. Firstly, a degenerate 101 primer pair (groEL-Fw1/nadE-Rv2) (Table 2) was designed manually based in the sequences of groEL 102 (cpn60) and nadE genes from related ‘Ca. Phytoplasma species’ available in GenBank. Amplification of 103 3.2 kb was obtained and directly sequenced from both ends using the same primers. Based on these 104 sequences new specific primers pair (groEL-ChTYFw1/nadE-ChTYRv1), which amplified a putative 105 fragment of 2.0 kb, were designed using Primer3 implemented in Geneious R.10 (Biomatters, USA). PCR 106 amplifications were conducted in a final volume of 50 µl, containing 1.5U of Dream® Taq polimerase 107 (Fermentas, Lituania), 0.4 µM of each primer, 100 µM of dNTPs and 1X buffer Dream Taq (2 mM MgCl2). 108 For 2.0 kb amplification PCR conditions used were, 3 minutes 94ºC for initial denaturation and 35 cycles 109 of 94ºC/1minute, 58ºC/1 minute and 72ºC/3 minutes, with final extension of 72ºC for 10 minutes. The PCR 110 product (2.0 kb) was purified using S-400 HR columns (GE, UK) and cloned in pGEM T-Easy system 111 (Promega, USA) according to the manufacturer instructions. The complete sequence of 2.0 kb amplicon 112 was obtained by primer walking strategy in three different clones (Macrogen, Korea).

113 Structural analysis

114 Open reading frames were estimated using ORF Finder in Geneious R.10 software. Annotation of amino 115 acidic deduced sequences was performed using BLASTp (nr, BLOSUM62, word size 6). For Amp-ORF 116 signal peptide sequence and the cleavage site were predicted with the program SignalIP v5.0 117 (http://www.cbs.dtu.dk/services/SignalP/) as well as the presence of the transmembrane domains with 118 TMHMM v2.0 program (http://www.cbs.dtu.dk/services/TMHMM/). Also, the conserve domains were 119 analyzed by CD-Search online tool (https://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi).

120 Phylogeny

121 For phylogeny reconstruction multiple alignments of amino acid sequences were conducted using MAFFT 122 (L-INS-i, 200PAM/K=2, gap open penalty=1.53, offset value=0.123) (Katoh and Toh 2008), from Amp 123 sequences obtained in this work and from related phytoplasmas groups (16SrI and 16SrXII) available from 124 GenBank. The evolutionary history was inferred by using the Maximum Likelihood method based on the 125 Le Gascuel model. Multiple alignments of 16S rDNA gene sequences were performed using MUSCLE 126 (window size=5, gap open score= -1) and evolutionary history was inferred using the Maximum Likelihood 127 method based on the General Time Reversible model. In both cases, bootstrap (1,000 repetitions) was 128 performed for statistical support. Initial tree(s) for the heuristic search were obtained automatically by 129 applying Neighbor-Join and BioNJ algorithms to a matrix of pairwise distances estimated using a JTT bioRxiv preprint doi: https://doi.org/10.1101/2020.06.01.128413; this version posted June 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

130 model, and then selecting the topology with superior log likelihood value. All evolutionary analysis were 131 conducted in MEGA7 (Kumar et al. 2016).

132 Selection pressure on amp gene

133 In order to elucidate the selection pressure acting in the amp gene, fifteen new ‘Ca. Phytoplasma meliae’ 134 isolates were sequenced (Table 1). A new set of primers, ampFw1-ampRv1 were designed based on groEL- 135 amp-nadE (2.0 kb) sequence previously described (ChTYXIII-Mo3). These primers amplified a putative 136 fragment of ~0.7 kb containing the entire sequence of the amp gene. Cloning and sequencing were 137 conducted as previously described. For each ‘Ca. Phytoplasma meliae’ isolate 3 different clones were 138 bidirectionally sequenced and consensus sequences (3X minimum coverage) were obtained using Geneious 139 R10 and deposited in GenBank. For the target gene (amp) the synonymous (dS) and non-synonymous (dN) 140 nucleotide substitution rates were calculated. The dN/dS ratios and the null hypothesis of no selection (H0: 141 dN=dS) versus the positive selection hypothesis (H1: dN>dS) were calculated using Nei–Gojobori method 142 in a codon-based Z selection test implemented in MEGA7 software (Kumar et al. 2016). The variance of 143 the difference was computed using the bootstrap method (1,000 replicates). In case of positive selection 144 dN/dS ratio must be >1 and p-value for the Z-test < 0.05 (Masatoshi and Sudhir 2000). Maximum 145 Likelihood computations of dN and dS were also conducted using HyPhy software package (Pond et al., 146 2005). The statistic test dN - dS is used to detect codons that have undergone positive selection, where dS 147 is the number of synonymous substitutions per site (s/S) and dN is the number of nonsynonymous 148 substitutions per site (n/N). A positive value for the statistic test indicates an overabundance of 149 nonsynonymous substitutions. Normalized dN - dS for the statistic test is obtained using the total number 150 of substitutions in the tree (measured in expected substitutions per site) which were also calculated in order 151 to compare different data sets. Tajima’s test of neutrality (Tajima 1989) was also conducted using MEGA7. 152 Three set of data were used in this work, ‘Ca. Phytoplasma meliae’ amp sequences data set (n=16) (this 153 paper); ‘Ca. Phytoplasma solani’ STAMP sequences data set (n=15) (Fabre et al. 2011) and ‘Ca. 154 Phytoplasma asteris’ amp sequences data set (n=13) (Kakizawa et al. 2006a).

155 Results

156 Amplification and sequencing of groEL-amp-nadE fragment

157 Using the primer pair groEL-Fw1/nadE-Rv2 a ~2 kb PCR fragment was amplified in all ‘Ca. Phytoplasma 158 meliae’ samples (16/16). No amplification product was obtained from healthy chinaberry samples (data not 159 show). PCR amplification of ‘Ca. Phytoplasma meliae’ isolate ChTYXIII-Mo3 (reference strain) 160 (Fernández et al. 2016) was selected for sequencing. A final consensus sequence of 1,975 bp was obtained 161 and deposited in GenBank under accession MG905024. ORF estimation revealed that the sequenced

162 fragment contains two incomplete ORFs (ORF-11-630 and ORF-31694-1975) and one complete (ORF-2750-1226) 163 (Figure 2.A). BLASTp analysis showed that ORF-1 encodes a protein homologue to Chaperonine GroEL 164 (groEL) (86.89% identity, E=1e-125, accession: CBL82429.1) and the ORF-3 encodes a NAD synthetase 165 (nadE) (76.09% identity, E=2e-45, accession: BAG16386.1). The protein encoded by ORF-2 (474bp- 166 158aa) showed an identity of 41% (E=2e-24) with Amp of ‘Candidatus Phytoplasma japonicum’

167 (BAG16385). In the intergenic region 1 (IG1631-749) putative transcription signals (-35: TTTATG; -10: bioRxiv preprint doi: https://doi.org/10.1101/2020.06.01.128413; this version posted June 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

168 TAATAGGTT) were found while in the intergenic region 2 (IG21227-1693) a putative transcription terminator 169 (TGTTTTTAAAAAGCTAGCTTTAAAACCTAGCTTTTTTTCTTTATTC) was also found. Comparison 170 of groEL-amp-nadE genomic fragment showed a high conservation in ORFs corresponding to groEL and 171 nadE proteins, while for amp gene, lower identity values were observed mainly in the central region (Figure 172 2.A). These results confirmed the synthetic organization of the genes flanking amp in the order 5’-groEL- 173 amp-nadE-3’ as previously reported in others ‘Ca. Phytoplasmas species’ (Arashida et al. 2008; Fabre et 174 al. 2011; Kakizawa et al. 2006b) or STOLBUR phytoplasmas (Fabre et al., 2011).

175 Structural analysis of amp protein

176 The deduced amino acid sequence for the Amp was 158 aa, with an estimated molecular weight of 17.07 177 kDa. Regarding its composition, the Amp is rich in alanine residues (12%), serine (12%), valine (9.13%) 178 and lysine (14.6%). Based on SignalP-5.0 analysis, residues corresponding to the signal peptide (1-35) 179 (Signal peptide (Sec/SPI), Likelihood = 0.9587), and a cleavage site of the putative protein between residues 180 35-36 (VFA-VS/Probability = 0.8813) (Figure 2.B) were identified. Two transmembrane regions, at the N- 181 termini (signal peptide) (residues 13-35) and C-termini region (residues 131-152) (Figure 2.B), and an 182 extracellular domain (residues 36-130) were also identified. pSORTb prediction located Amp as 183 cytoplasmic membrane protein (score = 9.87). Phyto-Amp conserved domain (Cdd: pfam15438) was also 184 recorded in the interval 1-103 (E= 0.02) supporting that this protein is an orthologous of previously 185 described antigenic membrane protein (Amp). Despite the conserved structural organization of Amp 186 domains (TM-extracellular-TM) among orthologues described in different 'Ca. Phytoplasma species', we 187 observed that some ‘Ca. Phytoplasma asteris’ isolates presented a somewhat larger extracellular region 188 (positions 77-116 and 132-172) (Figure 3.B).

189 Phylogeny

190 Phylogenetic analyses were performed from both Amp and 16S rDNA sequences. For Amp, ML tree shows 191 that ‘Ca. Phytoplasma meliae’ grouped in the same clade with ‘Ca. Phytoplasma solani’ and ‘Ca. 192 Phytoplasma japonicum’ (Figure 3.A). Meanwhile, the general topology of 16S rDNA ML-tree does not 193 consistently correspond to that described for Amp, since the groupings generated do not share the same- 194 clustered taxonomic groups (Figure 3.B), and ‘Ca. Phytoplasma meliae’ was grouped more closely with 195 different species of ‘Ca. Phytoplasma asteris’.

196 Selection pressure on amp gene

197 Sixteen (n=16) ‘Candidatus Phytoplasma meliae’ amp gene sequences were used in selection pressure 198 analysis. Multiple alignments of 474 positions (158 codons) were evaluated and dN-dS calculated for each 199 codon (Supplementary material, Table S1). Fourteen codons showed values of dN-dS > 0, which would 200 indicate that they are under a positive selection pressure (overall dN-dS=2.884, p=0.005), of them, nine 201 were found to encode amino acids in the extracellular region (Table 3, Figure S1). The same analysis was 202 also performed with two sets of data from population studies conducted with Amp in other phytoplasmas 203 species. The first data set (consisting of 15 sequences) corresponded to the immunodominant protein 204 STAMP (Fabre et al. 2011) characterized in various European isolates of the STOLBUR phytoplasmas. bioRxiv preprint doi: https://doi.org/10.1101/2020.06.01.128413; this version posted June 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

205 The other data set (consisting of 13 sequences) corresponded to the Amp characterized in various isolates 206 of ‘Ca. asteris’ related phytoplasmas (Kakizawa et al. 2006a). In both cases, the dN-dS values were 207 calculated, and their position within the sequence (Transmembrane domains, Extracellular domains). For 208 STAMP protein, out of 154 codons analyzed, 19 had values of dN-dS > 0 (overall= 2.226, p=0.028). Sixteen 209 out these nineteen codons were located in the extracellular region (Table 3). On the other hand, the Amp- 210 asteris protein, presented 62 codons, over a total of 225, with dN-dS values > 0 (overall=4.764, p< 0.001). 211 Within these 62 codons, 57 were associated to extracellular domain (Table 3).The results of these analyses 212 determined that the highest number of codons with dN-dS values > 0 occurred in the extracellular region 213 (Figure 4), which would indicate a positive selection pressure acting on this domain.

214 Discussion

215 In this work we described and characterized for the first time amp gene in sixteen isolates from ‘Ca. 216 Phytoplasma meliae’ derived from different geographical regions in Argentina. Previous studies have 217 shown the high conservation in groEL-amp-nadE operon from diverse ‘Ca. Phytoplasma species’ 218 (Andersen et al. 2013; Arashida et al. 2008; Barbara et al. 2002; Coetzee et al. 2019; Fabre et al. 2011; 219 Kakizawa et al. 2006b; Sparks et al. 2018). Our analysis showed that this 5’-groEL-amp-nadE-3’ locus 220 organization is also conserved in ‘Ca. Phytoplasma meliae’. The general structure of Amp consisted in a 221 large extracellular hydrophilic domain flanked by two hydrophobic domains in the N- and C-termini. While 222 the C-terminal domain contained a transmembrane region, which could serve as an anchor to phytoplasma 223 cellular membrane, the N-terminal domain included a signal peptide which is probably cleaved during 224 protein maturation (Arashida et al. 2008). Amp described in the present work consisted in 160-158 aa, with 225 a molecular weight of ~17 kDa, two hydrophobic domains located in the N-terminal (signal peptide) and 226 C-terminal ends (transmembrane), and a signal peptide cleavage (VFA-VS) within residues 33-37. A 227 central hydrophilic region was also inferred as the mayor portion of Amp-meliae protein. These features 228 indicated that the characterized protein is an orthologous of Amp described in other phytoplasmas species. 229 Comparative analysis with others “C. Phytoplasma” showed that Amp of 'Candidatus Phytoplasma meliae' 230 had a low aa homology (23.33%-37.74% identity), with the central hydrophilic region being the most 231 variable. This is consistent with what has been previously described in the aster group phytoplasma 232 (Kakizawa et al. 2006a) and the Stolbur group (Fabre et al. 2011). It has also been reported that the Amp 233 protein is also divergent in size (Arashida et al. 2008) and its extracellular region may vary between ~175 234 aa (Ca. asteris strains MBS, DeVilla and OY-M) to ~100 aa (Ca. solani, Ca. australiense and Ca. asteris 235 strains AYWB and NYAY). In the case of Amp from Ca. meliae, the extracellular region is composed of 236 94 aa, which is more closely linked to those phytoplasmas that have the smallest size in that domain. 237 Likewise, reconstruction of the phylogeny of Ca. meliae Amp protein has also linked it more closely with 238 the phytoplasmas Ca. solani and Ca. japonicum than Ca. australiense and Ca. asteris species. This 239 association was not consistent with those obtained for the highly conserved 16S rDNA gene, indicating the 240 presence of selective pressure acting on the Amp. The impact of positive selection on the rate of protein 241 evolution is evident in only a small fraction of proteins, mainly those subjected to recurrent positive 242 selection that is typically associated to host–pathogen interactions (Zhang et al. 2015). Several studies 243 strongly suggest that positive selection is acting on IDPs (Amp, Imp and idpA) (revised in Konnerth et al. bioRxiv preprint doi: https://doi.org/10.1101/2020.06.01.128413; this version posted June 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

244 2016). In Amp, most of amino acids subjected to positive selection pressure are located in the extracellular 245 domain (Fabre et al. 2011; Kakizawa et al. 2006a). The results obtained in this work have allowed us to 246 confirm this pattern, since Amp in ‘Ca. Phytoplasma meliae’ appears to be subjected to a positive selection 247 pressure (overall dN-dS> 0) resulting in a diversifying positive selection exerting in this portion on the 248 gene. The strong selection pressure and high divergence described for Amp and other IDPs proteins, suggest 249 that they might be playing a key role in the phytoplasma-host molecular interaction (Kakizawa et al. 2009; 250 Kakizawa et al. 2006a). In fact, it has been shown that the Amp in OY-M phytoplasma forms a complex 251 with actin microfilaments in leafhoppers which determine insect-vector specificity (Suzuki et al. 2006). It 252 has also been shown that Amp of CYP phytoplasma specifically binds to α and β subunits of ATP synthases 253 of insect vectors (Galetto et al. 2011). The role of this protein was also evaluated with pre-feeding assays 254 of two CYP vector with specific Amp-antibody which resulted in significant decrease in the acquisition 255 efficiency (Rashidi et al. 2015). Moreover, the Amp is somehow involved in the specific crossing of the 256 gut epithelium, as well as salivary gland colonization, during the early phases of vector infection with CYP 257 (Pacifico et al. 2015). Blocking IDPs protein using a specific scFv (Le Gall et al. 1998) or antibody (Pacifico 258 et al. 2015) in plants or an insect vector was highly effective in reducing phytoplasma infection in both 259 hosts. Recently a RNAi strategy was implemented via microinjection of muscle actin and ATP synthase β 260 dsRNAs in adult insects of E. variegatus which caused an exponential reduction in the expression of both 261 genes and also a significant decrease in survival rates (Abbà et al. 2019). Considering the aforementioned 262 characteristics, the Amp protein constitutes an interesting target not only for the development of resistance 263 strategies but also for increase fundamental knowledge in the pathogenesis of phytoplasmas.

264 In Argentina, and other countries from South America, ‘Candidatus Phytoplasma meliae’ (16SrXIII-G, 265 16SrXIII-C) (Fernández et al. 2016) and ‘Candidatus Phytoplasma pruni’ (16SrIII-B) (Galdeano et al. 266 2004) are the causative agents of chinaberry decline and chinaberry yellows diseases, respectively. Despite 267 the wide distribution that presents the host plant Melia azedarach L. along the Argentine territory, the 268 distribution of ‘Ca. Phytoplasma meliae’ is restricted to North East while ‘Ca. pruni’ is widely represented 269 throughout territory (Arneodo et al. 2007; Fernandez 2015). One of the factors that we believe would be 270 modulating this pattern is the distribution of their vectors. Identifying and characterizing the Amp protein 271 in these phytoplasmas constitutes the first step to achieve a more precise detection of potential vectors. The 272 production of a specific Amp antisera which could be used as a diagnostic tool to survey potential vectors 273 and also to evaluate the role of Amp in the transmission processes.

274

275 Acknowledgments

276 This work was founded by INTA, MinCyT (Foncyt 2010-0810 and 2016-0862). We gratefully 277 acknowledge Humberto Debat (IPAVE-CIAP-INTA) for valuable discussion and critical review of the 278 manuscript.

279 Compliance with ethical standards

280 The authors bear all the ethical responsibilities for this manuscript. bioRxiv preprint doi: https://doi.org/10.1101/2020.06.01.128413; this version posted June 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

281 Conflict of interest

282 The authors declare that the research was conducted in the absence of any commercial or financial 283 relationships that could be construed as a potential conflict of interest.

284 Human and animal rights

285 The authors declare that the presented research does not include any animal and/or human trials.

286 Informed consent

287 All authors consent to this submission.

288 References

289 Abbà, S., Galetto, L., Ripamonti, M., Rossi, M., & Marzachì, C. (2019). RNA interference of muscle 290 actin and ATP synthase beta increases mortality of the phytoplasma vector Euscelidius variegatus. 291 Pest Management Science, 75:1425–1434.

292 Andersen, M. T., Liefting, L. W., Havukkala, I., & Beever, R. E. (2013). Comparison of the complete 293 genome sequence of two closely related isolates of “Candidatus Phytoplasma australiense” reveals 294 genome plasticity. BMC Genomics, 14:529.

295 Arashida, R., Kakizawa, S., Ishii, Y., Hoshi, A., Jung, H.-Y., Kagiwada, S., et al. (2008). Cloning and 296 Characterization of the Antigenic Membrane Protein (Amp) Gene and In Situ Detection of Amp 297 from Malformed Flowers Infected with Japanese Hydrangea Phyllody Phytoplasma. 298 Phytopathology, 98:769–775

299 Arneodo, J. D., Marini, D. C., Galdeano, E., Meneguzzi, N., Bacci, M., Domecq, C., et al. (2007). 300 Diversity and geographical distribution of phytoplasmas infecting China-tree in Argentina. Journal 301 of Phytopathology, 155:70–75.

302 Barbara, D. J., Morton, A., Clark, M. F., & Davies, D. L. (2002). Immunodominant membrane proteins 303 from two phytoplasmas in the aster yellows clade (chlorante aster yellows and clover phyllody) are 304 highly divergent in the major hydrophilic region. Microbiology, 148:157-167.

305 Coetzee B, Douglas-Smit N, Maree H, Burger J, Krüger K, G. P. (2019). Draft Genome Sequence of a 306 “Candidatus Phytoplasma asteris”-Related Strain (Aster Yellows, Subgroup 16SrI-B) from South 307 Africa. Microbiology Resource Announcements, 8 (17): e00148-19.

308 Bertaccini, A., & Lee, I.M. (2018). Phytoplasmas: An Update. Chapter 1 in Phytoplasmas: Plant 309 Pathogenic Bacteria – I Characterization and Epidemiology of Phytoplasma - Associated Diseases. 310 pg 347. Ed. Springer. ISBN 978-981-13-0118-6 .

311 Doyle, J. J., & Doyle, J. L. (1990). A rapid total DNA preparation procedure for fresh plant 312 tissue. Focus, 12, 13-15. bioRxiv preprint doi: https://doi.org/10.1101/2020.06.01.128413; this version posted June 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

313 Deng S, & Hiruki C (1991) Amplification of 16S rRNA genes from culturable and non-culturable 314 mollicutes. Journal of Microbiological Methods, 14:53–61.

315 Fabre, A., Danet, J. L., & Foissac, X. (2011). The stolbur phytoplasma antigenic membrane protein gene 316 stamp is submitted to diversifying positive selection. Gene, 472:37–41.

317 Fernández, F. (2015). Caracterización molecular y epidemiología de fitoplasmas pertenecientes al grupo 318 16Sr XIII (Mexican periwinkle virescence group ; MPV ) presentes en la Argentina. Doctoral 319 Thesis, UNC. https://rdu.unc.edu.ar/handle/11086/12857 acceded 06-01-2020

320 Fernández, F. D., Galdeano, E., Kornowski, M. V., Arneodo, J. D., & Conci, L. R. (2016). Description of 321 ‘Candidatus Phytoplasma meliae’, a phytoplasma associated with Chinaberry (Melia azedarach L.) 322 yellowing in South America. International Journal of Systematic and Evolutionary Microbiology, 323 66:5244–5251.

324 Galdeano, E., Torres, L. E., Meneguzzi, N., Guzmán, F., Gomez, G. G., Docampo, D. M., & Conci, L. R. 325 (2004). Molecular characterization of 16S ribosomal DNA and phylogenetic analysis of two X- 326 disease group phytoplasmas affecting China-tree (Melia azedarach L.) and garlic (Allium sativum 327 L.) in Argentina. Journal of Phytopathology, 152:174–181.

328 Galetto, L., Bosco, D., Balestrini, R., Genre, A., Fletcher, J., & Marzachì, C. (2011). The major antigenic 329 membrane protein of “Candidatus Phytoplasma asteris” selectively interacts with ATP synthase and 330 actin of leafhopper vectors. PLoS ONE, 6(7).

331 Kakizawa, S., Oshima, K., Ishii, Y., Hoshi, A., Maejima, K., Jung, H. Y., et al. (2009). Cloning of 332 immunodominant membrane protein genes of phytoplasmas and their in planta expression: 333 RESEARCH LETTER. FEMS Microbiology Letters, 293:92–101.

334 Kakizawa, S., Oshima, K., Jung, H. Y., Suzuki, S., Nishigawa, H., Arashida, R., et al. (2006a). Positive 335 selection acting on a surface membrane protein of the plant-pathogenic phytoplasmas. Journal of 336 Bacteriology, 188:3424–3428.

337 Kakizawa, S., Oshima, K., & Namba, S. (2006b). Diversity and functional importance of phytoplasma 338 membrane proteins. Trends in Microbiology, 14:254–256.

339 Kakizawa, S., Oshima, K., Nishigawa, H., Jung, H. Y., Wei, W., Suzuki, S., et al. (2004). Secretion of 340 immunodominant membrane protein from onion yellows phytoplasma through the Sec protein- 341 translocation system in Escherichia coli. Microbiology, 150:135–142.

342 Katoh, K., & Toh, H. (2008). Recent developments in the MAFFT multiple sequence alignment program. 343 Briefings in Bioinformatics, 9:286–298.

344 Konnerth, A., Krczal, G., & Boonrod, K. (2016). Immunodominant membrane proteins of phytoplasmas. 345 Microbiology, 162:1267–1273. bioRxiv preprint doi: https://doi.org/10.1101/2020.06.01.128413; this version posted June 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

346 Kumar, S., Stecher, G., & Tamura, K. (2016). MEGA7: Molecular Evolutionary Genetics Analysis 347 Version 7.0 for Bigger Datasets. Molecular biology and evolution, 33:1870–1874.

348 Le Gall, F., Bové, J. M., & Garnier, M. (1998). Engineering of a single-chain variable-fragment (scFv) 349 antibody specific for the stolbur phytoplasma (mollicute) and its expression in Escherichia coli and 350 tobacco plants. Applied and Environmental Microbiology, 64:4566–4572.

351 Lee IM, Gundersen-Rindal DE, Hammond RW, Davis RE (1994) Use of mycoplasma-like organism 352 (MLO) group-specific oligonucleotide primers for nested PCR assay to detect MLO infections in a 353 single host plant. Phytopathology 84:559–566

354 Masatoshi, N., & Sudhir, K. (2000). Molecular Evolution and Phylogenetics. OXFORD University Press. 355 doi:10.1111/j.1471-0528.1976.tb00728.x

356 Pacifico, D., Galetto, L., Rashidi, M., Abbà, S., Palmano, S., Firrao, G., et al. (2015). Decreasing global 357 transcript levels over time suggest that phytoplasma cells enter stationary phase during plant and 358 insect colonization. Applied and Environmental Microbiology, 81:2591–2602.

359 Rashidi, M., Galetto, L., Bosco, D., Bulgarelli, A., Vallino, M., Veratti, F., & Marzachi, C. (2015). Role 360 of the major antigenic membrane protein in phytoplasma transmission by two insect vector species. 361 BMC Microbiology, 15:193.

362 Pond, S.L., Frost S.D, & Muse S.V. (2005). HyPhy: hypothesis testing using phylogenies. Bioinformatics. 363 21:676‐679.

364 Sparks, M. E., Bottner-Parker, K. D., Gundersen-Rindal, D. E., & Lee, I. M. (2018). Draft genome 365 sequence of the New Jersey aster yellows strain of ‘Candidatus Phytoplasma asteris.’ PLoS ONE, 366 13:1–16.

367 Suzuki, S., Oshima, K., Kakizawa, S., Arashida, R., Jung, H.-Y., Yamaji, Y., et al. (2006). Interaction 368 between the membrane protein of a pathogen and insect microfilament complex determines insect- 369 vector specificity. Proceedings of the National Academy of Sciences, 103:4252–4257.

370 Tajima, F. (1989). Statistical Method for Testing the Neutral Mutation Hypothesis by DNA 371 Polymorphism Fumio. Genetics, 585–595123:.

372 Zhang, Y., Jalan, N., Zhou, X., Goss, E., Jones, J. B., Setubal, J. C., et al. (2015). Positive selection is the 373 main driving force for evolution of citrus canker-causing Xanthomonas. ISME Journal, 9: 2128– 374 2138.

375 Zhao, Y., Davis, R. E., Wei, W., & Lee, I. M. (2015). Should ‘Candidatus Phytoplasma’ be retained 376 within the order Acholeplasmatales? International Journal of Systematic and Evolutionary 377 Microbiology, 65:1075–1082.

378 bioRxiv preprint doi: https://doi.org/10.1101/2020.06.01.128413; this version posted June 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

Table 1: ‘Ca. Phytoplasma meliae’ samples used in this work. * Latitude/Longitude (decimal)

Ca. meliae isolate Location Province Coordinates* #accesion ChTY-25.1 Campo Grande (CG) Misiones -27.207945°, -54.979693° MG905031.1 ChTY-Ce3 Cerro Azul (Ce) Misiones -27.633535°, -55.497152° MG905032.1 ChTY-27.1 El Soberbio (ES) Misiones -27.29549°, -54.196343° MG905019.1 ChTY-27.6 El Soberbio (ES) Misiones -27.29549°, -54.196343° MG905020.1 ChTY-27.9 El Soberbio (ES) Misiones -27.29549°, -54.196343° MG905030.1 ChTY-Mo3R Monte Carlo (Mo) Misiones -26.566667°, -54.783333° MG905024.1 ChTY-Mo2 Monte Carlo (Mo) Misiones -26.566667°, -54.783333° MG905026.1 ChTY-Mo6 Monte Carlo (Mo) Misiones -26.566667°, -54.783333° MG905021.1 ChTY-30.1 Panambí (Pan) Misiones -27.7223°, -54.914895° MG905029.1 ChTY-IT26 Itatí (It) Corrientes -27.266667°, -58.25° MG905022.1 ChTY-IT27 Itatí (It) Corrientes -27.266667°, -58.25° MG905027.1 ChTY-IT25 Itatí (It) Corrientes -27.266667°, -58.25° MN699857.1 ChTY-Ya4 Yapeyú (Ya) Corrientes -29.469611°, -56.817444° MN699858.1 ChTY-RS3 Roque Saenz Peña (RSP) Chaco -26.783333°, -60.45° MG905023.1 ChTY-RS12 Roque Saenz Peña (RSP) Chaco -26.783333°, -60.45° MG905025.1 ChTY-RS13 Roque Saenz Peña (RSP) Chaco -26.783333°, -60.45° MG905028.1

Table 2: Table 2: List of primer used in this work. a target gene, b PCR fragment size

Primer Sequence (5'-3') TM %GC genea sizeb groEl-Fw1 GCRATWGAYKYAGGRGCHAATCC 57.7 ºC 51.0 groEL ~3200bp nadE-Rv2 ATGAGCGCCATTTAAAGCCAT 55.5 ºC 42.9 nadE groEL-ChTYFw1 GTAGGAGCTGCTATGACAGAAG 54.7 ºC 50.0 groEL ~2000bp nadE-ChTYRv1 CCTCTTGTAAAGCCAAAGGCA 55.6 ºC 47.6 nadE amp-Fw1 GATTACTACTGAAGCTGCTGT 51.0 ºC 42.0 amp 731bp amp-Rv1 AGCTAGGTTTTAAAGCTAGCTTTTTA 57.4 ºC 30.8 amp bioRxiv preprint doi: https://doi.org/10.1101/2020.06.01.128413; this version posted June 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

Table 3: Selection pressure analysis in AMP proteins from three different ‘Ca. Phytoplasma specie’ data sets.

Normalized dN-dS >0 Dataset Nº S p dN-dS p-value C TM E #codons % Reference Ca. Phytoplasma meliae 16 17 0,00909 2,844 0,005 1 4 9 158 8,861 This paper Ca. Phytoplasma asteris 13 112 0,0433 4,764 < 0,001 1 4 57 225 27,556 Kakisawa et al., 2006 Ca. Phytoplasma solani 15 19 0,02295 2,226 0,028 1 2 16 154 12,338 Fabré et al., 2011

Nº: number of sequences, S: segregating sites, p: nucleotic diversity, dN-dS: statistic test, dS and dN are the numbers of synonymous and nonsynonymous substitutions per site, respectively, p-value:The probability of rejecting the null hypothesis of strict-neutrality (dN = dS), C, TM or E: number of codons with normalized dN-dS value >0 in Citoplasmic, Transmembrane or Extracellular domain, %: proportion of normalized codons with dN-dS>0/ total codons, #codons: total numbers of codon. bioRxiv preprint doi: https://doi.org/10.1101/2020.06.01.128413; this version posted June 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

Figure 1. ‘Candidatus Phytoplasma meliae’ affecting China berry trees in Argentina. A: Partial map of Argentina showing the sampling points (red), Campo Grande (CG), El Soberbio (ES), Montecarlo (Mo) and Panambí (Pan) from Misiones province, Itatí (It) and Yapeyú (Ya) from Corrientes province, and Roque Saenz Peña (RSP) from Chaco province; B: China berry tree showing typical symptoms of yellowing.

Figure 2. Genetic context of Ca. Phytoplasma meliae’Amp of ‘. A: multiple alignments of groEL-amp-nadE loci in related ‘Ca. Phytoplasma species’. Identity values are showed. B: structure of putative Amp protein, cytoplasmic domains (grey), transmembrane domains (black), extracellular domain (white), putative cleavage motif (amino acid residues VFA-VS) (black line).

Figure 3. Comparative analysis of Amp. A-B: Phylogenetic relationships inferred from analysis of Amp and 16Sr RNA gene sequence, respectively, using the Maximum Likelihood method implemented in MEGA 7. The bootstrap consensus tree inferred from 1,000 replicates is taken to represent the evolutionary history of the taxa analyzed. Sequences obtained in this work are in bold. The scale bar represents the number of nucleotide substitutions per site. Bootstrap values > 70% are shown in the nodes. ‘Ca. Phytoplasma species’ are written in different colors. C: Multiple alignment of Amp protein sequence from diverse ‘Ca. Phytoplasma species’, different domains in each sequence are illustrated with yellow (extracellular and cytoplasmic-C) or blue (transmembrane) colors. D: amino acids identity values expressed as % and heatmap.

Figure 4. Selection pressure acting on Amp protein. The results are displayed for three data sets, amp-ChTY (16 sequences), STamp-STOLBUR (9 sequences) and amp-asteris (14 sequences). In each data set the position of the codon is plotted on the X axis, and on the Y axis the standardized dN-dS value corresponding to each one of those codons. Domains of Amp protein are also illustrated at scale in the X axis.

Figure S1. Multiple alignments of Amp amino acid residues in all ‘Ca. Phytoplasma meliae’ isolates obtained in this work. The TM domains are marked in black dotted lines while extracellular domain is marked in purple dotted lines, grey triangle shows the putative cleavage site