DOCSLIB.ORG

Prevalence of Genes Encoding Exfoliatin Toxin a and Panton-Valentine Leukocidin Among Methicillin Resistant Staphylococcus Aureus in Baghdad

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Prevalence of Genes Encoding Exfoliatin Toxin a and Panton-Valentine Leukocidin Among Methicillin Resistant Staphylococcus Aureus in Baghdad Int.J.Curr.Microbiol.App.Sci (2014) 3(6) 595-600 ISSN: 2319-7706 Volume 3 Number 6 (2014) pp. 595-600 http://www.ijcmas.com Original Research Article Prevalence of genes encoding Exfoliatin toxin A and Panton-Valentine Leukocidin among Methicillin resistant Staphylococcus aureus in Baghdad Raghad A. Abdulrazaq, Mohammed F. AL-Marjani* and Sussan H. Othman Department of Biology, College of Science Al- Mustansiriya University, Baghdad, Iraq *Corresponding author A B S T R A C T The aim of this study was to determine the distribution of pvl and eta genes in K e y w o r d s Methicillin-resistant Staphylococcus aureus (MRSA) isolates are leading causes of hospital-acquired infections in Baghdad . A total of (100) MRSA isolates were PVL toxin, recovered from hospitalized patients. From the screening profile of 100 MRSA Exfoliative isolates enrolled in this study, the percent of PVL-Positive and ETA-Positive S. toxin, aureus were represented by 27% and 13% of isolates respectively. The resistance patterns of MRSA isolates were determined, All isolates were resistant to Staphylococcus cloxacillin , followed by cefoxitin ( 86 %) and cephalexin (51%) , 26% to aureus, lincomycin ,23% to trimethoprim and 22% to rifampicin. Results of Nitrogen PCR bases sequencing for PCR product of 16 samples in this study revealed consistency reaching up to 99 % as compared nitrogen bases sequence of the pvl gene present in the Staphylococcus aureus strain in NCBI Introduction Staphylococcus aureus is an important capsular polysaccharide and protein A), human pathogen capable of causing including those recognizing adhesive diseases in the hospital and community matrix molecules (e.g., clumping factor settings . The increased incidence of and fibronectin binding protein), and to multidrug-resistant S. aureus strains extracellular proteins (e.g., coagulase, among nosocomial (or hospital-acquired hemolysins, enterotoxins, toxic-shock [HA]) infections has added a challenging syndrome [TSS] toxin, exfoliatins, and dimension to the S. aureus problem (Saïd- Panton-Valentine leukocidin [PVL] Salim et al., 2005; McCarthy and (Archer, 1998). Lindasy, 2012). Panton-Valentine leukocidin (PVL) is a bi- The pathogenicity of Staphylococcus component, pore-forming exotoxin aureus infections is related to various produced by some strains of bacterial surface components (e.g., Staphylococcus aureus. Also termed a 595 Int.J.Curr.Microbiol.App.Sci (2014) 3(6) 595-600 synergohymenotropic toxin (i.e. acts on 2013.These isolates were identified by membranes through the synergistic conventional biochemical reactions activity of 2 non-associated secretory according to the criteria established by proteins, component S and component F) (Forbes et al., 2007). (Lina et al., 1999).The epidemiological association of PVL-producing S. aureus The isolates were inoculated a CHROM strains from patients with necrotizing agar MRSA plate. The results were read pneumonia suggested PVL was a major after 24 and 48 h of incubation at 35°C. virulence factor (Gillet et al., 2002). The growth of colonies showing any pink or mauve coloration was considered to be Exfoliative toxins (also known as positive (indicating MRSA). epidermolytic toxins) are particularly interesting virulence factors of S. aureus. Antimicrobial susceptibility test These extremely specific serine proteases recognize and cleave desmosomal Antimicrobial susceptibility of the isolates cadherins only in the superficial layers of were tested by using Kirby-Bauer disk the skin, which is directly responsible for diffusion method following CLSI the clinical manifestation. of guidelines (CLSI,2009) , using com- staphylococcal scalded skin syndrome mercially available 6mm discs (Bioanalyse (SSSS) (Bukowski et al., 2010). /Turkey) The susceptibility of the isolates was determined against 12 antibacterial There are two serological forms of agents, They include: Clindamycin, staphylococcal ETs(ETA and ETB) which rifampicin, tecoplanine, trimethoprime, are responsible for human SSSS.The gene cloxacillin, gentamicin, cephalexine, encoding ETA is situated in the bacterial cefoxitine lincomycin, levofloxacin, chromosome, but the gene encoding ETB Azithromycin and vancomycin, on is located on the plasmid. ETA and ETB Mueller Hinton agar Plate (Lab M Limited are composed of 242 and 246 amino acids, Topley House,United Kingdom), using respectively and they have overnight culture at a 0.5 McFarland approximately40% amino acid similarity standard followed by incubation at 35oC (Ladhani et al., 1999). The aim of this for 16 to 18 h. study was to determine the frequency of pvl and eta genes in MRSA in cutaneous DNA Preparation and PCR infections,and also to determine the nitrogen bases sequence of the pvl gene A PCR reactions with specific primers present in the Staphylococcus aureus in were performed to identify pvl and eta Baghdad. genes of each MRSA isolates (Table 1).DNA template was prepared as Materials and Methods described by (Olsvik and Strockbin, 1993) (25 l) of PCR amplification mixture Bacterial isolates contained deionized sterile water,(12.5) l Green Go Taq Master Mix pH (8) A total of 100 MRSA isolates were (Promega,USA) . collected from cutaneous samples (abscess and wound) from patients who were The thermocycling were as follows: Initial admitted to Baghdad hospitals in denaturation at 94°C for 10 min and 35 596 Int.J.Curr.Microbiol.App.Sci (2014) 3(6) 595-600 cycles of denaturation at 94°C for 1 min, vancomycin was reported from Japan, annealing at 55°C for 1min and extension after that ,two more cases were reported at 72 C for 45 Sec. and a final extension from united state . In 2002 ,the first was performed at 72°C for 10 minutes . clinical isolate of vancomycin resistant All PCR products were analyzed by Staphylococcus aureus was reported by electrophoresis through 1% agarose gels. workers from Brazil and Jordan (Ng et al.,2011). DNA sequence analysis A total of 100 isolates of MRSA were The DNA fragments for sequencing were tested for the presence of the pvl and eta obtained by PCR amplification, the genes by PCR, 27% and 13 % were fragments of each PCR products were positive respectively (Fig 1) (Fig 2). sequenced with the set of primers by Narita et al (2001) showed that the Macrogen , USA). The program (BioEdit temperate phage SLT infected only 3% Pro.version: 7.0.0) was used for of clinical PVL-negative S. aureus strains, bioinformatic analysis of nucleotide leading to PVL production. Cabrera et al sequences. (2010) showed that 83% of S. aureus isolates carrying pvl genes. When isolates Results and Discussion were categorized according to type of staphylococcal infection, the PVL genes In this research 100 Methicillin resistant S. were strongly associated with skin and soft aureus isolates were collected from tissue infections, such as abscesses, skin hospitalized patients in Baghdad . The lesions, and boils (furuncles). By contrast, resistance patterns of MRSA isolates to no statistically significant association was 12 antimicrobial agents are shown in observed with impetigo, blisters, or SSS Table 2. (Holmes et al., 2005). PVL has been linked to specific human S. aureus All isolates were resistant to cloxacillin , infections such as primary skin and soft followed by cefoxitin (86%) and tissue disease and severe necrotizing cephalexin (51 %), 26% to lincomycin, pneumonia, where the mortality rate is 23% to trimethoprim and 22% to about 75% (Gillet et al.,2002). rifampicin .First recognized in 1960, methicillin-resistant Staphylococcus A higher occurrence of exfoliative toxins aureus (MRSA) was considered to be a is associated with SSSS diagnosis, where medical oddity. Now, MRSA is the most eta is present at higher rates , but the common nosocomial bacterial pathogen prevalence shows geographical differences isolated in many parts of the world (in Japan, etb is more frequent) (Sauer et (Grundmann et al., 2006). Other resistance al., 2008 ) . rates were: 18 % gentamicin, 17% vancomycin, while the minimum Results of Nitrogen bases sequencing for resistance were seen with teicoplanin PCR product of 16 samples in this study (4%). revealed consistency reaching up to 99 % as compared Nitrogen bases sequence of In 1997, first strain of Staphylococcus the pvl gene present in the Staphylococcus aureus reduced susceptibility to aureus strain in NCBI . 597 Int.J.Curr.Microbiol.App.Sci (2014) 3(6) 595-600 Table.1 Sequence of forward and reverse primers used for detecting pvl and eta genes among MRSA isolates. Primer type Primer sequence 5----3 Product reference size Forward primer pvl 'ATCATTAGGTAAAATGTCTGCACATGATCCA Jarraud et 433bp al.,2002 Reverse primer pvl GCATCAASTGTATTGGATAGCCAAAAGC Forward primer eta ACTGTAGGAGCTAGTGCATTTGT Jarraud et 190 bp al.,2002 Reverse primer eta TGGATACTTTTGTCTATCTTTTTCATCAAC Table.2 Susceptibility of the 100 isolates of methicillin-resistant S.aureus to 12 Antibiotics. Antibiotic Resistant (%) Rifampicin RA 22 Clindamycin DA 13 Lincomycin L 26 Levofloxacin LEV 13 Trimethoprime TEM 23 Cloxacillin CX 100 Azithromycin AZM 16 Cefoxitine CX 86 Gentamicin CN 18 Cephalexine CL 51 Tecoplanine TEC 4 Vancomycin VA 17 598 Int.J.Curr.Microbiol.App.Sci (2014) 3(6) 595-600 Figure.1 Gel electrophoresis (1% agarose, 7 v/cm ) of pvl ( 433 bp) . Figure.2 Gel electrophoresis (1% agarose, 7 v/cm ) of eta ( 190 bp) References leukocidin gene. Philippine Science Letters , 3(1) .4-12. Archer, G., 1998. Staphylococcus aureus: a Clinical and Laboratory Standards Institute well-armed pathogen. Clin Infect Dis (CLSI) .2009.
Load more

Recommended publications
  • Introduction to Bacteriology and Bacterial Structure/Function
    INTRODUCTION TO BACTERIOLOGY AND BACTERIAL STRUCTURE/FUNCTION LEARNING OBJECTIVES To describe historical landmarks of medical microbiology To describe Koch’s Postulates To describe the characteristic structures and chemical nature of cellular constituents that distinguish eukaryotic and prokaryotic cells To describe chemical, structural, and functional components of the bacterial cytoplasmic and outer membranes, cell wall and surface appendages To name the general structures, and polymers that make up bacterial cell walls To explain the differences between gram negative and gram positive cells To describe the chemical composition, function and serological classification as H antigen of bacterial flagella and how they differ from flagella of eucaryotic cells To describe the chemical composition and function of pili To explain the unique chemical composition of bacterial spores To list medically relevant bacteria that form spores To explain the function of spores in terms of chemical and heat resistance To describe characteristics of different types of membrane transport To describe the exact cellular location and serological classification as O antigen of Lipopolysaccharide (LPS) To explain how the structure of LPS confers antigenic specificity and toxicity To describe the exact cellular location of Lipid A To explain the term endotoxin in terms of its chemical composition and location in bacterial cells INTRODUCTION TO BACTERIOLOGY 1. Two main threads in the history of bacteriology: 1) the natural history of bacteria and 2) the contagious nature of infectious diseases, were united in the latter half of the 19th century. During that period many of the bacteria that cause human disease were identified and characterized. 2. Individual bacteria were first observed microscopically by Antony van Leeuwenhoek at the end of the 17th century.
    [Show full text]
  • Staphylococcus Aureus Exfoliative Toxins: How They Cause Disease
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE To cite this article: JID 122:1070–1077, 2004 provided by Elsevier - Publisher Connector Published by the ology Progress in Dermatology Editor: Alan N. Moshell, M.D. Staphylococcus aureus exfoliative toxins: How they cause disease. Lisa R.W. Plano, M.D., Ph.D. Departments of Pediatrics and Microbiology & Immunology University of Miami School of Medicine, Miami, Florida Abbreviations: cell surface molecules associated with adhesion and BI- bullous impetigo multiple antibiotic resistances including methicillin and ET- exfoliative toxins vancomycin resistance (Centers for Disease Control and EDIN- epidermal cell differentiation inhibitor Prevention, 1997; 2000a; 2000b), all contributing to the ETA- exfoliative toxin A (epidermolysisn A, exfoliatin A) pathogenicity of these organisms. A minimum of 34 ETB- exfoliative toxin B (epidermolysisn B, exfoliatin B) different extracellular proteins are produced by S. ETD- exfoliative toxin D (epidermolysisn D, exfoliatin D) aureus, and many of these have defined roles in the PF- pemphigus foliaceus pathogenesis of their associated diseases (Iandolo, SSSS- Staphylococcal scalded skin syndrome, (pemphi- 1989). Infectious conditions caused by these organisms gus neonatorum, dermatitis exfoliativa neonatorum, can be divided into three major categories; (i) superficial Ritter’s disease) skin infections, skin abcesses and wound infections TEN- toxic epidermal necrolysis including bullous impetigo (BI) and furuncles, (ii) systemic or infections of deep seeded tissues including osteomyelitis, endocarditis, pneumonia and sepsis, and Introduction (iii) conditions caused by intoxication with one of the General Microbiology: Staphylococci are hardy excreted toxins. Among the conditions caused by intoxi- Gram-positive cocci found as bacterial pathogens or cation with an exotoxin are toxic shock syndrome caused commensal organisms in both humans and animals.
    [Show full text]
  • Serine Proteases with Altered Sensitivity to Activity-Modulating
    (19) & (11) EP 2 045 321 A2 (12) EUROPEAN PATENT APPLICATION (43) Date of publication: (51) Int Cl.: 08.04.2009 Bulletin 2009/15 C12N 9/00 (2006.01) C12N 15/00 (2006.01) C12Q 1/37 (2006.01) (21) Application number: 09150549.5 (22) Date of filing: 26.05.2006 (84) Designated Contracting States: • Haupts, Ulrich AT BE BG CH CY CZ DE DK EE ES FI FR GB GR 51519 Odenthal (DE) HU IE IS IT LI LT LU LV MC NL PL PT RO SE SI • Coco, Wayne SK TR 50737 Köln (DE) •Tebbe, Jan (30) Priority: 27.05.2005 EP 05104543 50733 Köln (DE) • Votsmeier, Christian (62) Document number(s) of the earlier application(s) in 50259 Pulheim (DE) accordance with Art. 76 EPC: • Scheidig, Andreas 06763303.2 / 1 883 696 50823 Köln (DE) (71) Applicant: Direvo Biotech AG (74) Representative: von Kreisler Selting Werner 50829 Köln (DE) Patentanwälte P.O. Box 10 22 41 (72) Inventors: 50462 Köln (DE) • Koltermann, André 82057 Icking (DE) Remarks: • Kettling, Ulrich This application was filed on 14-01-2009 as a 81477 München (DE) divisional application to the application mentioned under INID code 62. (54) Serine proteases with altered sensitivity to activity-modulating substances (57) The present invention provides variants of ser- screening of the library in the presence of one or several ine proteases of the S1 class with altered sensitivity to activity-modulating substances, selection of variants with one or more activity-modulating substances. A method altered sensitivity to one or several activity-modulating for the generation of such proteases is disclosed, com- substances and isolation of those polynucleotide se- prising the provision of a protease library encoding poly- quences that encode for the selected variants.
    [Show full text]
  • Targeting Staphylococcus Aureus Toxins: a Potential Form of Anti-Virulence Therapy
    toxins Review Targeting Staphylococcus aureus Toxins: A Potential form of Anti-Virulence Therapy Cin Kong 1, Hui-min Neoh 2 and Sheila Nathan 1,* 1 School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor Darul Ehsan, Malaysia; [email protected] 2 UKM Medical Molecular Biology Institute (UMBI), Universiti Kebangsaan Malaysia, 56000 Cheras, Kuala Lumpur, Malaysia; [email protected] * Correspondence: [email protected]; Tel.: +60-3-8921-3862 Academic Editor: Yinduo Ji Received: 18 February 2016; Accepted: 10 March 2016; Published: 15 March 2016 Abstract: Staphylococcus aureus is an opportunistic pathogen and the leading cause of a wide range of severe clinical infections. The range of diseases reflects the diversity of virulence factors produced by this pathogen. To establish an infection in the host, S. aureus expresses an inclusive set of virulence factors such as toxins, enzymes, adhesins, and other surface proteins that allow the pathogen to survive under extreme conditions and are essential for the bacteria’s ability to spread through tissues. Expression and secretion of this array of toxins and enzymes are tightly controlled by a number of regulatory systems. S. aureus is also notorious for its ability to resist the arsenal of currently available antibiotics and dissemination of various multidrug-resistant S. aureus clones limits therapeutic options for a S. aureus infection. Recently, the development of anti-virulence therapeutics that neutralize S. aureus toxins or block the pathways that regulate toxin production has shown potential in thwarting the bacteria’s acquisition of antibiotic resistance. In this review, we provide insights into the regulation of S.
    [Show full text]
  • Wednesday Slide Conference 2008-2009
    PROCEEDINGS DEPARTMENT OF VETERINARY PATHOLOGY WEDNESDAY SLIDE CONFERENCE 2008-2009 ARMED FORCES INSTITUTE OF PATHOLOGY WASHINGTON, D.C. 20306-6000 2009 ML2009 Armed Forces Institute of Pathology Department of Veterinary Pathology WEDNESDAY SLIDE CONFERENCE 2008-2009 100 Cases 100 Histopathology Slides 249 Images PROCEEDINGS PREPARED BY: Todd Bell, DVM Chief Editor: Todd O. Johnson, DVM, Diplomate ACVP Copy Editor: Sean Hahn Layout and Copy Editor: Fran Card WSC Online Management and Design Scott Shaffer ARMED FORCES INSTITUTE OF PATHOLOGY Washington, D.C. 20306-6000 2009 ML2009 i PREFACE The Armed Forces Institute of Pathology, Department of Veterinary Pathology has conducted a weekly slide conference during the resident training year since 12 November 1953. This ever- changing educational endeavor has evolved into the annual Wednesday Slide Conference program in which cases are presented on 25 Wednesdays throughout the academic year and distributed to 135 contributing military and civilian institutions from around the world. Many of these institutions provide structured veterinary pathology resident training programs. During the course of the training year, histopathology slides, digital images, and histories from selected cases are distributed to the participating institutions and to the Department of Veterinary Pathology at the AFIP. Following the conferences, the case diagnoses, comments, and reference listings are posted online to all participants. This study set has been assembled in an effort to make Wednesday Slide Conference materials available to a wider circle of interested pathologists and scientists, and to further the education of veterinary pathologists and residents-in-training. The number of histopathology slides that can be reproduced from smaller lesions requires us to limit the number of participating institutions.
    [Show full text]
  • High Nasal Carriage Rate of Staphylococcus Aureus Containing Panton-Valentine Leukocidin- and EDIN-Encoding Genes in Community A
    High Nasal Carriage Rate of Staphylococcus aureus Containing Panton-Valentine leukocidin- and EDIN-Encoding Genes in Community and Hospital Settings in Burkina Faso Abdoul-Salam Ouedraogo, Catherine Dunyach-Remy, Aimée Kissou, Soufiane Sanou, Armel Poda, Carole Kyelem, Jérôme Solassol, Anne-Laure Bañuls, Philippe van de Perre, Rasmata Ouédraogo, et al. To cite this version: Abdoul-Salam Ouedraogo, Catherine Dunyach-Remy, Aimée Kissou, Soufiane Sanou, Armel Poda, et al.. High Nasal Carriage Rate of Staphylococcus aureus Containing Panton-Valentine leukocidin- and EDIN-Encoding Genes in Community and Hospital Settings in Burkina Faso. Frontiers in Microbiol- ogy, Frontiers Media, 2016, 7, pp.1406. 10.3389/fmicb.2016.01406. hal-01818967 HAL Id: hal-01818967 https://hal.archives-ouvertes.fr/hal-01818967 Submitted on 21 Sep 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Distributed under a Creative Commons Attribution| 4.0 International License ORIGINAL RESEARCH published: 13 September 2016 doi: 10.3389/fmicb.2016.01406 High Nasal Carriage Rate of Staphylococcus aureus Containing Panton-Valentine leukocidin- and EDIN-Encoding Genes in Community and Hospital Settings in Burkina Faso Abdoul-Salam Ouedraogo 1, 2, 3, 4*, Catherine Dunyach-Remy 5, 6, Aimée Kissou 1, Soufiane Sanou 1, Armel Poda 1, Carole G.
    [Show full text]
  • Exfoliative Toxin Mediated Staphylococcal Scalded Skin Syndrome: a Review
    International Journal of Current Research and Review Review Article DOI: http://dx.doi.org/10.31782/IJCRR.2020.122212 Exfoliative Toxin Mediated Staphylococcal Scalded Skin Syndrome: A Review IJCRR 1 2 3 Section: Healthcare Gayathri Sunil , Meghana Vinod , Roshni PR Sci. Journal Impact Factor: 6.1 (2018) 1 ICV: 90.90 (2018) Student, Pharm D PB, Department of Pharmacy Practice, Amrita School of Pharmacy, Amrita Vishwa Vidyapeetham, Kochi-682041, Kerala, India; 2Student, Pharm D PB, Department of Pharmacy Practice, Amrita School of Pharmacy, Amrita Vishwa Vidyapeetham, Kochi-682041, Kerala, India; 3Assistant Professor Department of Pharmacy Practice, Amrita School of Pharmacy, Amrita Vishwa Vidyap- Copyright@IJCRR eetham, Kochi-682041, Kerala, India. ABSTRACT . Staphylococcal scalded skin syndrome (SSSS) is a rare dermatological condition associated with extensive desquamation by toxicogenic strains of staphylococcus aureus. The two known serotypes of exfoliative toxin namely A and B are responsible for this disease entity. Haematogenous dissemination of toxin cause extensive epidermal damage at sites distant to the infectious site. When considering all age ranges, SSSS is more prevalent in infants and children below 5 years but can occur at any age. Initially, symptoms include fever, malaise, dehydration followed by the tenderness of the skin with erythematous rash, flaccid blis- ters and bullae which may rupture on pressure, leaving superficial crusts. Despite a well-known clinical aspect, several cutane- ous diseases may be mistaken for SSSS. Therefore, rapid and definitive histopathological evaluation of the biopsy is essential to confirm the diagnosis. The prognosis is improved by adequate therapy, that is, aggressive fluid replacement, nutritional support and optimal antibacterial policy.
    [Show full text]
  • Action Et Contrôle Des Leucotoxines De Staphylococcus Aureus Sur Les Cellules Cibles Mira Tawk
    Action et contrôle des leucotoxines de Staphylococcus aureus sur les cellules cibles Mira Tawk To cite this version: Mira Tawk. Action et contrôle des leucotoxines de Staphylococcus aureus sur les cellules cibles. Bactériologie. Université de Strasbourg, 2014. Français. NNT : 2014STRAJ111. tel-01234206 HAL Id: tel-01234206 https://tel.archives-ouvertes.fr/tel-01234206 Submitted on 26 Nov 2015 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. UNIVERSITÉ DE STRASBOURG ÉCOLE DOCTORALE DES SCIENCES DE LA VIE ET DE LA SANTE EA-7290 Virulence bactérienne précoce : fonctions cellulaires et contrôle de l'infection aiguë et subaiguë THÈSE présentée par : Mira TAWK soutenue le : 07 juillet 2014 pour obtenir le grade de : !"#$%&'($')R%+,-$&.,# '($'0#&1.2!%&3 Discipline/ Spécialité : V'# #2 S,2M A1.#!21 M-*M!3*'0#1 #2 C#**3*'0#1 "# * B'-*-%'# Action et contrôle des leucotoxines de Staphylococcus aureus sur les cellules cibles THÈSE dirigée par : Dr. PRÉVOST Gilles MCU-PH, Université de Strasbourg Pr. BOURCIER Tristan Professeur, Université de Strasbourg RAPPORTEURS : Pr. FREY Joachim PR-PUPH, Université de Berne Dr. LADANT Daniel DR, Institut Pasteur-Paris AUTRES MEMBRES DU JURY : Dr.
    [Show full text]
  • Bacterial Quorum Sensing: Its Role in Virulence and Possibilities for Its Control
    Downloaded from http://perspectivesinmedicine.cshlp.org/ on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press Bacterial Quorum Sensing: Its Role in Virulence and Possibilities for Its Control Steven T. Rutherford1 and Bonnie L. Bassler1,2 1Department of Molecular Biology, Princeton University, Princeton, New Jersey 08544 2Howard Hughes Medical Institute, Chevy Chase, Maryland 20815 Correspondence: [email protected] Quorum sensing is a process of cell–cell communication that allows bacteria to share information about cell density and adjust gene expression accordingly. This process enables bacteria to express energetically expensive processes as a collective only when the impact of those processes on the environment or on a host will be maximized. Among the many traits controlled by quorum sensing is the expression of virulence factors by path- ogenic bacteria. Here we review the quorum-sensing circuits of Staphylococcus aureus, Bacillus cereus, Pseudomonas aeruginosa, and Vibrio cholerae. We outline these canonical quorum-sensing mechanisms and how each uniquely controls virulence factor production. Additionally,we examine recent efforts to inhibit quorum sensing in these pathogens with the goal of designing novel antimicrobial therapeutics. uorum sensing (QS) is a bacterial cell–cell Despite differences in regulatory compo- Qcommunication process that involves the nents and molecular mechanisms, all known production, detection, and response to extra- QS systems depend on three basic principles. cellular signaling molecules called autoinducers First, the members of the community produce (AIs). AIs accumulate in the environment as the AIs, which are the signaling molecules. At low bacterial population density increases, and bac- cell density (LCD), AIs diffuse away, and, there- teria monitor this information to track changes fore, are present at concentrations below the in their cell numbers and collectively alter gene threshold required for detection.
    [Show full text]
  • Infection and Immunity
    INFECTION AND IMMUNITY Volume 13 Contents for March Number3 Bacterial and Mycotic Infections Analysis ofthe Cell Wall ofFive Strains ofMycobacterium tuberculosis BCG and of an Attenuated Human Strain, W 115. P. H. PHIET, JUANA WIETZERBIN, ELISE ZISSMAN, J. F. PETIT,* AND E. LEDERER ...... ..................... 677 Subcutaneous Multiplication of Exfoliatin-Producing Staphylococci. FRANK A. KAPRAL .............................................................. 682 Virulent Treponemapallidum: Aerobe or Anaerobe. JOEL B. BASEMAN,* JEAN C. NICHOLS, AND NANCY S. HAYES ......................................... 704 Bacterial Interference. III. Effects of Oral Antibiotics on the Normal Throat Flora and Its Ability to Interfere with Group A Streptococcus. CHRISTINE C. SANDERS,* W. EUGENE SANDERS, JR., AND DAVID J. HARROWE .... ......... 808 Relationship of Cellular Potential Hemolysin in Group A Streptococci to Extra- cellular Streptolysin S. G. B. CALANDRA, R. S. WHITT, AND R. M. COLE* .. 813 Germination of Candida albicans Induced by Proline. NINA DABROWA, SHARON S. S. TAXER, AND DEXTER H. HOWARD* ................................. 830 Pathological Features of Experimental Gonococcal Infection in Mice and Guinea Pigs. FRANCIS W. CHANDLER,* STEPHEN J. KRAUS, AND JOHN C. WATTS . 909 Growth and Effects of Ureaplasmas (T Mycoplasmas) in Bovine Oviductal Organ Cultures. 0. H. V. STALHEIM,* S. J. PROCTOR, AND J. E. GALLAGHER ..... 915 Unbalanced Growth and Macromolecular Synthesis in Streptococcus mutans FA-1. S. J. MATTINGLY, J. R. DIPERSIO, M. L. HIGGINS, AND G. D. SHOCKMAN* ... 941 Attachment of Mycoplasma pneumoniae to Respiratory Epithelium. DWIGHT A. POWELL, * PING C. Hu, MARION WILSON, ALBERT M. COLLIER, AND JOEL B. BASEMAN ........................................................... 959 Purification of Staphylococcal Alpha-Toxin by Adsorption Chromatography on Glass. PAUL CASSIDY AND SIDNEY HARSHMAN* ...... .................... 982 T Antigen of Streptococcus pyogenes: Isolation and Purification.
    [Show full text]
  • Distribution of Toxinogenic Methicillin-Resistant and Methicillin-Susceptible Staphylococcus Aureus from Different Ecological Ni
    toxins Article Distribution of Toxinogenic Methicillin-Resistant and Methicillin-Susceptible Staphylococcus aureus from Different Ecological Niches in Algeria Assia Mairi 1,2 , Abdelaziz Touati 1, Alix Pantel 3, Karima Zenati 1, Alex Yahiaoui Martinez 3, Catherine Dunyach-Remy 3, Albert Sotto 4 and Jean-Philippe Lavigne 3,* 1 Laboratoire d’Ecologie Microbienne, FSNV, Université de Bejaia, Bejaia 06000, Algeria 2 National Institute of Health and Medical Research INSERM U1047, University of Montpellier, 30900 Montpellier, France 3 Department of Microbiology, CHU Nîmes, University of Montpellier, 30900 Montpellier, France 4 Department of Infectious Diseases, CHU Nîmes, University of Montpellier, 30900 Montpellier, France * Correspondence: [email protected] Received: 31 July 2019; Accepted: 21 August 2019; Published: 28 August 2019 Abstract: The diffusion of Panton–Valentine leukocidin (PVL)–positive methicillin-resistant S. aureus (MRSA) is a health problem in Algeria. The objectives of the study were to investigate the global distribution of methicillin-susceptible S. aureus (MSSA) and MRSA isolates in different ecological niches in this country. In total, 2246 samples were collected from humans, livestock, wild animals, pets, food products and the aquatic environment, from 12 Algerian provinces. A total of 312 S. aureus were detected from 2446 samples (12.7%) in the screened niches. We observed the emergence of toxinogenic S. aureus representing 41% of the isolates. Among them, we noted the diffusion of ST80-IV CA-MRSA PVL + strains isolated in human, animals, and food and genetic diversity of MSSA PVL + isolates. This study suggests an alarming dissemination of MRSA-ST80 PVL + in both human and extra-human sources in Algeria.
    [Show full text]
  • Botulinum Toxin
    Botulinum toxin From Wikipedia, the free encyclopedia Jump to: navigation, search Botulinum toxin Clinical data Pregnancy ? cat. Legal status Rx-Only (US) Routes IM (approved),SC, intradermal, into glands Identifiers CAS number 93384-43-1 = ATC code M03AX01 PubChem CID 5485225 DrugBank DB00042 Chemical data Formula C6760H10447N1743O2010S32 Mol. mass 149.322,3223 kDa (what is this?) (verify) Bontoxilysin Identifiers EC number 3.4.24.69 Databases IntEnz IntEnz view BRENDA BRENDA entry ExPASy NiceZyme view KEGG KEGG entry MetaCyc metabolic pathway PRIAM profile PDB structures RCSB PDB PDBe PDBsum Gene Ontology AmiGO / EGO [show]Search Botulinum toxin is a protein and neurotoxin produced by the bacterium Clostridium botulinum. Botulinum toxin can cause botulism, a serious and life-threatening illness in humans and animals.[1][2] When introduced intravenously in monkeys, type A (Botox Cosmetic) of the toxin [citation exhibits an LD50 of 40–56 ng, type C1 around 32 ng, type D 3200 ng, and type E 88 ng needed]; these are some of the most potent neurotoxins known.[3] Popularly known by one of its trade names, Botox, it is used for various cosmetic and medical procedures. Botulinum can be absorbed from eyes, mucous membranes, respiratory tract or non-intact skin.[4] Contents [show] [edit] History Justinus Kerner described botulinum toxin as a "sausage poison" and "fatty poison",[5] because the bacterium that produces the toxin often caused poisoning by growing in improperly handled or prepared meat products. It was Kerner, a physician, who first conceived a possible therapeutic use of botulinum toxin and coined the name botulism (from Latin botulus meaning "sausage").
    [Show full text]