Int.J.Curr.Microbiol.App.Sci (2014) 3(6) 595-600 ISSN: 2319-7706 Volume 3 Number 6 (2014) pp. 595-600 http://www.ijcmas.com Original Research Article Prevalence of genes encoding Exfoliatin toxin A and Panton-Valentine Leukocidin among Methicillin resistant Staphylococcus aureus in Baghdad Raghad A. Abdulrazaq, Mohammed F. AL-Marjani* and Sussan H. Othman Department of Biology, College of Science Al- Mustansiriya University, Baghdad, Iraq *Corresponding author A B S T R A C T The aim of this study was to determine the distribution of pvl and eta genes in K e y w o r d s Methicillin-resistant Staphylococcus aureus (MRSA) isolates are leading causes of hospital-acquired infections in Baghdad . A total of (100) MRSA isolates were PVL toxin, recovered from hospitalized patients. From the screening profile of 100 MRSA Exfoliative isolates enrolled in this study, the percent of PVL-Positive and ETA-Positive S. toxin, aureus were represented by 27% and 13% of isolates respectively. The resistance patterns of MRSA isolates were determined, All isolates were resistant to Staphylococcus cloxacillin , followed by cefoxitin ( 86 %) and cephalexin (51%) , 26% to aureus, lincomycin ,23% to trimethoprim and 22% to rifampicin. Results of Nitrogen PCR bases sequencing for PCR product of 16 samples in this study revealed consistency reaching up to 99 % as compared nitrogen bases sequence of the pvl gene present in the Staphylococcus aureus strain in NCBI Introduction Staphylococcus aureus is an important capsular polysaccharide and protein A), human pathogen capable of causing including those recognizing adhesive diseases in the hospital and community matrix molecules (e.g., clumping factor settings . The increased incidence of and fibronectin binding protein), and to multidrug-resistant S. aureus strains extracellular proteins (e.g., coagulase, among nosocomial (or hospital-acquired hemolysins, enterotoxins, toxic-shock [HA]) infections has added a challenging syndrome [TSS] toxin, exfoliatins, and dimension to the S. aureus problem (Saïd- Panton-Valentine leukocidin [PVL] Salim et al., 2005; McCarthy and (Archer, 1998). Lindasy, 2012). Panton-Valentine leukocidin (PVL) is a bi- The pathogenicity of Staphylococcus component, pore-forming exotoxin aureus infections is related to various produced by some strains of bacterial surface components (e.g., Staphylococcus aureus. Also termed a 595 Int.J.Curr.Microbiol.App.Sci (2014) 3(6) 595-600 synergohymenotropic toxin (i.e. acts on 2013.These isolates were identified by membranes through the synergistic conventional biochemical reactions activity of 2 non-associated secretory according to the criteria established by proteins, component S and component F) (Forbes et al., 2007). (Lina et al., 1999).The epidemiological association of PVL-producing S. aureus The isolates were inoculated a CHROM strains from patients with necrotizing agar MRSA plate. The results were read pneumonia suggested PVL was a major after 24 and 48 h of incubation at 35°C. virulence factor (Gillet et al., 2002). The growth of colonies showing any pink or mauve coloration was considered to be Exfoliative toxins (also known as positive (indicating MRSA). epidermolytic toxins) are particularly interesting virulence factors of S. aureus. Antimicrobial susceptibility test These extremely specific serine proteases recognize and cleave desmosomal Antimicrobial susceptibility of the isolates cadherins only in the superficial layers of were tested by using Kirby-Bauer disk the skin, which is directly responsible for diffusion method following CLSI the clinical manifestation. of guidelines (CLSI,2009) , using com- staphylococcal scalded skin syndrome mercially available 6mm discs (Bioanalyse (SSSS) (Bukowski et al., 2010). /Turkey) The susceptibility of the isolates was determined against 12 antibacterial There are two serological forms of agents, They include: Clindamycin, staphylococcal ETs(ETA and ETB) which rifampicin, tecoplanine, trimethoprime, are responsible for human SSSS.The gene cloxacillin, gentamicin, cephalexine, encoding ETA is situated in the bacterial cefoxitine lincomycin, levofloxacin, chromosome, but the gene encoding ETB Azithromycin and vancomycin, on is located on the plasmid. ETA and ETB Mueller Hinton agar Plate (Lab M Limited are composed of 242 and 246 amino acids, Topley House,United Kingdom), using respectively and they have overnight culture at a 0.5 McFarland approximately40% amino acid similarity standard followed by incubation at 35oC (Ladhani et al., 1999). The aim of this for 16 to 18 h. study was to determine the frequency of pvl and eta genes in MRSA in cutaneous DNA Preparation and PCR infections,and also to determine the nitrogen bases sequence of the pvl gene A PCR reactions with specific primers present in the Staphylococcus aureus in were performed to identify pvl and eta Baghdad. genes of each MRSA isolates (Table 1).DNA template was prepared as Materials and Methods described by (Olsvik and Strockbin, 1993) (25 l) of PCR amplification mixture Bacterial isolates contained deionized sterile water,(12.5) l Green Go Taq Master Mix pH (8) A total of 100 MRSA isolates were (Promega,USA) . collected from cutaneous samples (abscess and wound) from patients who were The thermocycling were as follows: Initial admitted to Baghdad hospitals in denaturation at 94°C for 10 min and 35 596 Int.J.Curr.Microbiol.App.Sci (2014) 3(6) 595-600 cycles of denaturation at 94°C for 1 min, vancomycin was reported from Japan, annealing at 55°C for 1min and extension after that ,two more cases were reported at 72 C for 45 Sec. and a final extension from united state . In 2002 ,the first was performed at 72°C for 10 minutes . clinical isolate of vancomycin resistant All PCR products were analyzed by Staphylococcus aureus was reported by electrophoresis through 1% agarose gels. workers from Brazil and Jordan (Ng et al.,2011). DNA sequence analysis A total of 100 isolates of MRSA were The DNA fragments for sequencing were tested for the presence of the pvl and eta obtained by PCR amplification, the genes by PCR, 27% and 13 % were fragments of each PCR products were positive respectively (Fig 1) (Fig 2). sequenced with the set of primers by Narita et al (2001) showed that the Macrogen , USA). The program (BioEdit temperate phage SLT infected only 3% Pro.version: 7.0.0) was used for of clinical PVL-negative S. aureus strains, bioinformatic analysis of nucleotide leading to PVL production. Cabrera et al sequences. (2010) showed that 83% of S. aureus isolates carrying pvl genes. When isolates Results and Discussion were categorized according to type of staphylococcal infection, the PVL genes In this research 100 Methicillin resistant S. were strongly associated with skin and soft aureus isolates were collected from tissue infections, such as abscesses, skin hospitalized patients in Baghdad . The lesions, and boils (furuncles). By contrast, resistance patterns of MRSA isolates to no statistically significant association was 12 antimicrobial agents are shown in observed with impetigo, blisters, or SSS Table 2. (Holmes et al., 2005). PVL has been linked to specific human S. aureus All isolates were resistant to cloxacillin , infections such as primary skin and soft followed by cefoxitin (86%) and tissue disease and severe necrotizing cephalexin (51 %), 26% to lincomycin, pneumonia, where the mortality rate is 23% to trimethoprim and 22% to about 75% (Gillet et al.,2002). rifampicin .First recognized in 1960, methicillin-resistant Staphylococcus A higher occurrence of exfoliative toxins aureus (MRSA) was considered to be a is associated with SSSS diagnosis, where medical oddity. Now, MRSA is the most eta is present at higher rates , but the common nosocomial bacterial pathogen prevalence shows geographical differences isolated in many parts of the world (in Japan, etb is more frequent) (Sauer et (Grundmann et al., 2006). Other resistance al., 2008 ) . rates were: 18 % gentamicin, 17% vancomycin, while the minimum Results of Nitrogen bases sequencing for resistance were seen with teicoplanin PCR product of 16 samples in this study (4%). revealed consistency reaching up to 99 % as compared Nitrogen bases sequence of In 1997, first strain of Staphylococcus the pvl gene present in the Staphylococcus aureus reduced susceptibility to aureus strain in NCBI . 597 Int.J.Curr.Microbiol.App.Sci (2014) 3(6) 595-600 Table.1 Sequence of forward and reverse primers used for detecting pvl and eta genes among MRSA isolates. Primer type Primer sequence 5----3 Product reference size Forward primer pvl 'ATCATTAGGTAAAATGTCTGCACATGATCCA Jarraud et 433bp al.,2002 Reverse primer pvl GCATCAASTGTATTGGATAGCCAAAAGC Forward primer eta ACTGTAGGAGCTAGTGCATTTGT Jarraud et 190 bp al.,2002 Reverse primer eta TGGATACTTTTGTCTATCTTTTTCATCAAC Table.2 Susceptibility of the 100 isolates of methicillin-resistant S.aureus to 12 Antibiotics. Antibiotic Resistant (%) Rifampicin RA 22 Clindamycin DA 13 Lincomycin L 26 Levofloxacin LEV 13 Trimethoprime TEM 23 Cloxacillin CX 100 Azithromycin AZM 16 Cefoxitine CX 86 Gentamicin CN 18 Cephalexine CL 51 Tecoplanine TEC 4 Vancomycin VA 17 598 Int.J.Curr.Microbiol.App.Sci (2014) 3(6) 595-600 Figure.1 Gel electrophoresis (1% agarose, 7 v/cm ) of pvl ( 433 bp) . Figure.2 Gel electrophoresis (1% agarose, 7 v/cm ) of eta ( 190 bp) References leukocidin gene. Philippine Science Letters , 3(1) .4-12. Archer, G., 1998. Staphylococcus aureus: a Clinical and Laboratory Standards Institute well-armed pathogen. Clin Infect Dis (CLSI) .2009.