Centre for Arab Genomic Studies a Division of Sheikh Hamdan Award for Medical Sciences

Total Page：16

File Type：pdf, Size：1020Kb

Centre for Arab Genomic Studies A Division of Sheikh Hamdan Award for Medical Sciences The atalogue for ransmission enetics in rabs C T G A CTGA Database Nonmetastatic Cells 3, Protein Expressed in Alternative Names myeloid differentiation of highly purified CD34+ NME3 cells. DR-NM23 Nonmetastatic Protein 23, Homolog of Epidemiology in the Arab World NM23H3 Saudi Arabia Record Category Shtir et al. (2016) aimed to identify candidate genes Gene locus with SNPs that provide a protective effect against Diabetic Retinopathy (DR). A total of 43 diabetics WHO-ICD that had not developed DR 10-years after their N/A to gene loci diabetes diagnosis were recruited as cases, while 64 diabetics with DR were enrolled as controls. Incidence per 100,000 Live Births Whole exome sequencing was carried out, and N/A to gene loci statistical analysis involved the combined multivariate and collapsing method at the gene OMIM Number level. This helped identify the gene NME3 as a 601817 significant candidate (p=1.55x10-10). The SNP rs11890 (g.1820992T>A) was more frequent in Mode of Inheritance cases than controls and was hence suggested to N/A to gene loci confer protection against DR in diabetic patients [Risk Ratio= 4.61 (2.53, 8.40)]. Gene Map Locus 16p13.3 References Shtir C, Aldahmesh MA, Al-Dahmash S, Abboud Description E, Alkuraya H, Abouammoh MA, Nowailaty SR, The NME3 gene encodes a nucleoside diphosphate Al-Thubaiti G, Naim EA, ALYounes B, Binhumaid kinase protein. As a kinase, this protein plays a FS, ALOtaibi AB, Altamimi AS, Alamer FH, major role in the synthesis of nucleoside Hashem M, Abouelhoda M, Monies D, Alkuraya triphosphates. It is also involved in the purine and FS. Exome-based case-control association study pyrimidine nucleotide metabolic process and in the using extreme phenotype design reveals novel regulation of cell apoptosis. Additionally, the candidates with protective effect in diabetic NME3 protein is speculated to be involved in retinopathy. Hum Genet. 2016; 135(2):193-200. hematopoiesis by the inhibition of granulocyte PMID: 26693933. differentiation. Related CTGA Records Molecular Genetics Microvascular Complications of Diabetes, The NME3 gene is located on the short arm of Susceptibility to, 1 chromosome 16. It spans a length of 1.4 kb and its coding sequence consists of five exons. The gene External Links contains putative binding sites for Sp1, AP2, MYB, https://www.genecards.org/cgi- ETS, GATA, and HOX1. The protein encoded by bin/carddisp.pl?gene=NME3 this gene has a mass of 19 kDa and is made up of https://www.ncbi.nlm.nih.gov/gene/4832 169 amino acids. The gene is found to be expressed highly in the nasal epithelium. Studies of Contributors murine NME3 have found the gene to be Sayeeda Hana : 20.10.2016 preferentially expressed in the early stages of Copyright © Centre for Arab Genomic Studies 1 Copyright © Centre for Arab Genomic Studies 2 .

Copy Link

Recommended publications

Identification of Conserved Genes Triggering Puberty in European Sea
Blázquez et al. BMC Genomics (2017) 18:441 DOI 10.1186/s12864-017-3823-2 RESEARCHARTICLE Open Access Identification of conserved genes triggering puberty in European sea bass males (Dicentrarchus labrax) by microarray expression profiling Mercedes Blázquez1,2* , Paula Medina1,2,3, Berta Crespo1,4, Ana Gómez1 and Silvia Zanuy1* Abstract Background: Spermatogenesisisacomplexprocesscharacterized by the activation and/or repression of a number of genes in a spatio-temporal manner. Pubertal development in males starts with the onset of the first spermatogenesis and implies the division of primary spermatogonia and their subsequent entry into meiosis. This study is aimed at the characterization of genes involved in the onset of puberty in European sea bass, and constitutes the first transcriptomic approach focused on meiosis in this species. Results: European sea bass testes collected at the onset of puberty (first successful reproduction) were grouped in stage I (resting stage), and stage II (proliferative stage). Transition from stage I to stage II was marked by an increase of 11ketotestosterone (11KT), the main fish androgen, whereas the transcriptomic study resulted in 315 genes differentially expressed between the two stages. The onset of puberty induced 1) an up-regulation of genes involved in cell proliferation, cell cycle and meiosis progression, 2) changes in genes related with reproduction and growth, and 3) a down-regulation of genes included in the retinoic acid (RA) signalling pathway. The analysis of GO-terms and biological pathways showed that cell cycle, cell division, cellular metabolic processes, and reproduction were affected, consistent with the early events that occur during the onset of puberty.
[Show full text]
Characterization of the Small RNA Transcriptomes of Cell Protrusions and Cell Bodies of Highly Metastatic Hepatocellular Carcinoma Cells Via RNA Sequencing
ONCOLOGY LETTERS 22: 568, 2021 Characterization of the small RNA transcriptomes of cell protrusions and cell bodies of highly metastatic hepatocellular carcinoma cells via RNA sequencing WENPIN CAI1*, JINGZHANG JI2*, BITING WU2*, KAIXUAN HAO2, PING REN2, YU JIN2, LIHONG YANG2, QINGCHAO TONG2 and ZHIFA SHEN2 1Department of Laboratory Medicine, Wen Zhou Traditional Chinese Medicine Hospital; 2Zhejiang Provincial Key Laboratory of Medical Genetics, Key Laboratory of Laboratory Medicine, Ministry of Education, School of Laboratory Medicine and Life Sciences, Wenzhou Medical University, Wenzhou, Zhejiang 325035, P.R. China Received July 11, 2020; Accepted February 23, 2021 DOI: 10.3892/ol.2021.12829 Abstract. Increasing evidence suggest that hepatocellular differentially expressed miRNAs and circRNAs. The interac‑ carcinoma (HCC) HCCLM3 cells initially develop pseudo‑ tion maps between miRNAs and circRNAs were constructed, podia when they metastasize, and microRNAs (miRNAs/miRs) and signaling pathway maps were analyzed to determine the and circular RNAs (circRNAs) have been demonstrated to molecular mechanism and regulation of the differentially serve important roles in the development, progression and expressed miRNAs and circRNAs. Taken together, the results metastasis of cancer. The present study aimed to isolate the of the present study suggest that the Boyden chamber assay cell bodies (CBs) and cell protrusions (CPs) from HCCLM3 can be used to effectively isolate the somatic CBs and CPs of cells, and screen the miRNAs and circRNAs associated with HCC, which can be used to screen the miRNAs and circRNAs HCC infiltration and metastasis in CBs and CPs. The Boyden associated with invasion and metastasis of HCC. chamber assay has been confirmed to effectively isolate the CBs and CPs from HCCLM3 cells via observation of microtu‑ Introduction bule immunofluorescence, DAPI staining and nuclear protein H3 western blotting.
[Show full text]
Supplementary Materials
Supplementary materials Supplementary Table S1: MGNC compound library Ingredien Molecule Caco- Mol ID MW AlogP OB (%) BBB DL FASA- HL t Name Name 2 shengdi MOL012254 campesterol 400.8 7.63 37.58 1.34 0.98 0.7 0.21 20.2 shengdi MOL000519 coniferin 314.4 3.16 31.11 0.42 -0.2 0.3 0.27 74.6 beta- shengdi MOL000359 414.8 8.08 36.91 1.32 0.99 0.8 0.23 20.2 sitosterol pachymic shengdi MOL000289 528.9 6.54 33.63 0.1 -0.6 0.8 0 9.27 acid Poricoic acid shengdi MOL000291 484.7 5.64 30.52 -0.08 -0.9 0.8 0 8.67 B Chrysanthem shengdi MOL004492 585 8.24 38.72 0.51 -1 0.6 0.3 17.5 axanthin 20- shengdi MOL011455 Hexadecano 418.6 1.91 32.7 -0.24 -0.4 0.7 0.29 104 ylingenol huanglian MOL001454 berberine 336.4 3.45 36.86 1.24 0.57 0.8 0.19 6.57 huanglian MOL013352 Obacunone 454.6 2.68 43.29 0.01 -0.4 0.8 0.31 -13 huanglian MOL002894 berberrubine 322.4 3.2 35.74 1.07 0.17 0.7 0.24 6.46 huanglian MOL002897 epiberberine 336.4 3.45 43.09 1.17 0.4 0.8 0.19 6.1 huanglian MOL002903 (R)-Canadine 339.4 3.4 55.37 1.04 0.57 0.8 0.2 6.41 huanglian MOL002904 Berlambine 351.4 2.49 36.68 0.97 0.17 0.8 0.28 7.33 Corchorosid huanglian MOL002907 404.6 1.34 105 -0.91 -1.3 0.8 0.29 6.68 e A_qt Magnogrand huanglian MOL000622 266.4 1.18 63.71 0.02 -0.2 0.2 0.3 3.17 iolide huanglian MOL000762 Palmidin A 510.5 4.52 35.36 -0.38 -1.5 0.7 0.39 33.2 huanglian MOL000785 palmatine 352.4 3.65 64.6 1.33 0.37 0.7 0.13 2.25 huanglian MOL000098 quercetin 302.3 1.5 46.43 0.05 -0.8 0.3 0.38 14.4 huanglian MOL001458 coptisine 320.3 3.25 30.67 1.21 0.32 0.9 0.26 9.33 huanglian MOL002668 Worenine
[Show full text]
Two Separate Functions of NME3 Critical for Cell Survival Underlie a Neurodegenerative Disorder
Two separate functions of NME3 critical for cell survival underlie a neurodegenerative disorder Chih-Wei Chena, Hong-Ling Wanga, Ching-Wen Huangb, Chang-Yu Huangc, Wai Keong Lima, I-Chen Tua, Atmaja Koorapatia, Sung-Tsang Hsiehd, Hung-Wei Kand, Shiou-Ru Tzenge, Jung-Chi Liaof, Weng Man Chongf, Inna Naroditzkyg, Dvora Kidronh,i, Ayelet Eranj, Yousif Nijimk, Ella Selak, Hagit Baris Feldmanl, Limor Kalfonm, Hadas Raveh-Barakm, Tzipora C. Falik-Zaccaim,n, Orly Elpelego, Hanna Mandelm,p,1, and Zee-Fen Changa,q,1 aInstitute of Molecular Medicine, College of Medicine, National Taiwan University, 10002 Taipei, Taiwan; bDepartment of Medicine, College of Medicine, National Taiwan University, 10002 Taipei, Taiwan; cInstitute of Biochemistry and Molecular Biology, National Yang-Ming University, 11221 Taipei, Taiwan; dInstitute of Anatomy and Cell Biology, College of Medicine, National Taiwan University, 10002 Taipei, Taiwan; eInstitute of Biochemistry and Molecular Biology, College of Medicine, National Taiwan University, 10002 Taipei, Taiwan; fInstitute of Atomic and Molecular Sciences, Academia Sinica, 10617 Taipei, Taiwan; gDepartment of Pathology, Rambam Health Care Campus, 31096 Haifa, Israel; hDepartment of Pathology, Meir Hospital, 44100 Kfar Saba, Israel; iSackler School of Medicine, Tel Aviv University, 69978 Tel Aviv, Israel; jDepartment of Radiology, Rambam Health Care Campus, 31096 Haifa, Israel; kPediatric and Neonatal Unit, Nazareth Hospital EMMS, 17639 Nazareth, Israel; lThe Genetics Institute, Rambam Health Care Campus, 31096 Haifa, Israel; mInstitute of Human Genetics, Galilee Medical Center, 22100 Nahariya, Israel; nThe Azrieli Faculty of Medicine, Bar Ilan University, 13100 Safed, Israel; oDepartment of Genetic and Metabolic Diseases, Hadassah Hebrew University Medical Center, 91120 Jerusalem, Israel; pMetabolic Unit, Technion Faculty of Medicine, Rambam Health Care Campus, 31096 Haifa, Israel; and qCenter of Precision Medicine, College of Medicine, National Taiwan University, 10002 Taipei, Taiwan Edited by Christopher K.
[Show full text]
Identification of Genomic Biomarkers for Anthracycline
Arch Toxicol DOI 10.1007/s00204-015-1623-5 IN VITRO SYSTEMS Identification of genomic biomarkers for anthracycline‑induced cardiotoxicity in human iPSC‑derived cardiomyocytes: an in vitro repeated exposure toxicity approach for safety assessment Umesh Chaudhari1 · Harshal Nemade1 · Vilas Wagh1 · John Antonydas Gaspar1 · James K. Ellis2 · Sureshkumar Perumal Srinivasan1 · Dimitry Spitkovski1 · Filomain Nguemo1 · Jochem Louisse3 · Susanne Bremer3 · Jürgen Hescheler1 · Hector C. Keun2 · Jan G. Hengstler4 · Agapios Sachinidis1 Received: 16 August 2015 / Accepted: 20 October 2015 © The Author(s) 2015. This article is published with open access at Springerlink.com Abstract The currently available techniques for the safety long-term arrhythmic beating in hiPSC-CMs accompanied evaluation of candidate drugs are usually cost-intensive and by significant cytotoxicity. Global gene expression changes time-consuming and are often insufficient to predict human were studied using microarrays and bioinformatics tools. relevant cardiotoxicity. The purpose of this study was to Analysis of the transcriptomic data revealed early expres- develop an in vitro repeated exposure toxicity methodology sion signatures of genes involved in formation of sarcom- allowing the identification of predictive genomics biomark- eric structures, regulation of ion homeostasis and induction ers of functional relevance for drug-induced cardiotoxicity of apoptosis. Eighty-four significantly deregulated genes in human induced pluripotent stem cell-derived cardiomyo- related to cardiac
[Show full text]
The NDPK/NME Superfamily: State of the Art Mathieu Boissan1,2, Uwe Schlattner3 and Marie-Lise Lacombe1
Laboratory Investigation (2018) 98, 164–174 © 2018 USCAP, Inc All rights reserved 0023-6837/18 EDITORIAL The NDPK/NME superfamily: state of the art Mathieu Boissan1,2, Uwe Schlattner3 and Marie-Lise Lacombe1 Nucleoside diphosphate kinases (NDPK) are nucleotide metabolism enzymes encoded by NME genes (also called NM23). Given the fact that not all NME-encoded proteins are catalytically active NDPKs and that NM23 generally refers to clinical studies on metastasis, we use here NME/NDPK to denote the proteins. Since their discovery in the 1950’s, NMEs/NDPKs have been shown to be involved in multiple physiological and pathological cellular processes, but the molecular mechanisms have not been fully determined. Recent progress in elucidating these underlying mechanisms has been presented by experts in the field at the 10th International Congress on the NDPK/NME/AWD protein family in October 2016 in Dubrovnik, Croatia, and is summarized in review articles or original research in this and an upcoming issue of Laboratory Investigation. Within this editorial, we discuss three major cellular processes that involve members of the multi-functional NME/NDPK family: (i) cancer and metastasis dissemination, (ii) membrane remodeling and nucleotide channeling, and iii) protein histidine phosphorylation. Laboratory Investigation (2018) 98, 164–174; doi:10.1038/labinvest.2017.137 ucleoside diphosphate kinases mitochondria (Lacombe et al, upcoming issue8). (NDPK) are nucleotide metabolism NME1, NME2, NME3, and NME4 form hexamers enzymes encoded by NME (also as the catalytically active form (Ćetković et al, next named NM23) genes. NDPKs are issue9). Group II is comprised of more divergent ubiquitous enzymes catalyzing the proteins sharing only 22 to 44% identity with Ntransfer of a phosphate from nucleoside group I enzymes and between each other.
[Show full text]
Two Separate Functions of NME3 Critical for Cell Survival Underlie a Neurodegenerative Disorder
Two separate functions of NME3 critical for cell survival underlie a neurodegenerative disorder Chih-Wei Chena, Hong-Ling Wanga, Ching-Wen Huangb, Chang-Yu Huangc, Wai Keong Lima, I-Chen Tua, Atmaja Koorapatia, Sung-Tsang Hsiehd, Hung-Wei Kand, Shiou-Ru Tzenge, Jung-Chi Liaof, Weng Man Chongf, Inna Naroditzkyg, Dvora Kidronh,i, Ayelet Eranj, Yousif Nijimk, Ella Selak, Hagit Baris Feldmanl, Limor Kalfonm, Hadas Raveh-Barakm, Tzipora C. Falik-Zaccaim,n, Orly Elpelego, Hanna Mandelm,p,1, and Zee-Fen Changa,q,1 aInstitute of Molecular Medicine, College of Medicine, National Taiwan University, 10002 Taipei, Taiwan; bDepartment of Medicine, College of Medicine, National Taiwan University, 10002 Taipei, Taiwan; cInstitute of Biochemistry and Molecular Biology, National Yang-Ming University, 11221 Taipei, Taiwan; dInstitute of Anatomy and Cell Biology, College of Medicine, National Taiwan University, 10002 Taipei, Taiwan; eInstitute of Biochemistry and Molecular Biology, College of Medicine, National Taiwan University, 10002 Taipei, Taiwan; fInstitute of Atomic and Molecular Sciences, Academia Sinica, 10617 Taipei, Taiwan; gDepartment of Pathology, Rambam Health Care Campus, 31096 Haifa, Israel; hDepartment of Pathology, Meir Hospital, 44100 Kfar Saba, Israel; iSackler School of Medicine, Tel Aviv University, 69978 Tel Aviv, Israel; jDepartment of Radiology, Rambam Health Care Campus, 31096 Haifa, Israel; kPediatric and Neonatal Unit, Nazareth Hospital EMMS, 17639 Nazareth, Israel; lThe Genetics Institute, Rambam Health Care Campus, 31096 Haifa, Israel; mInstitute of Human Genetics, Galilee Medical Center, 22100 Nahariya, Israel; nThe Azrieli Faculty of Medicine, Bar Ilan University, 13100 Safed, Israel; oDepartment of Genetic and Metabolic Diseases, Hadassah Hebrew University Medical Center, 91120 Jerusalem, Israel; pMetabolic Unit, Technion Faculty of Medicine, Rambam Health Care Campus, 31096 Haifa, Israel; and qCenter of Precision Medicine, College of Medicine, National Taiwan University, 10002 Taipei, Taiwan Edited by Christopher K.
[Show full text]
NME/NM23/NDPK and Histidine Phosphorylation
International Journal of Molecular Sciences Review NME/NM23/NDPK and Histidine Phosphorylation Kevin Adam y , Jia Ning y, Jeffrey Reina y and Tony Hunter * Molecular and Cell Biology Laboratory, Salk Institute for Biological Studies, La Jolla, CA 92037, USA; [email protected] (K.A.); [email protected] (J.N.); [email protected] (J.R.) * Correspondence: [email protected] These authors contributed equally to this work. y Received: 17 June 2020; Accepted: 7 August 2020; Published: 14 August 2020 Abstract: The NME (Non-metastatic) family members, also known as NDPKs (nucleoside diphosphate kinases), were originally identified and studied for their nucleoside diphosphate kinase activities. This family of kinases is extremely well conserved through evolution, being found in prokaryotes and eukaryotes, but also diverges enough to create a range of complexity, with homologous members having distinct functions in cells. In addition to nucleoside diphosphate kinase activity, some family members are reported to possess protein-histidine kinase activity, which, because of the lability of phosphohistidine, has been difficult to study due to the experimental challenges and lack of molecular tools. However, over the past few years, new methods to investigate this unstable modification and histidine kinase activity have been reported and scientific interest in this area is growing rapidly. This review presents a global overview of our current knowledge of the NME family and histidine phosphorylation, highlighting the underappreciated protein-histidine kinase activity of NME family members, specifically in human cells. In parallel, information about the structural and functional aspects of the NME family, and the knowns and unknowns of histidine kinase involvement in cell signaling are summarized.
[Show full text]
Targeting Altered Nme Heterooligomerization in Disease?
www.impactjournals.com/oncotarget/ Oncotarget, 2018, Vol. 9, (No. 2), pp: 1492-1493 Editorial Targeting altered Nme heterooligomerization in disease? Issam H. Abu-Taha, Christiane Vettel and Thomas Wieland The enzymatic activity of nucleoside diphosphate bound to Gs, in end-stage heart failure Gi2 was found kinases (NDPK), which are encoded by members of predominantly in the complex. This switch has profound the nme gene family, has been discovered in the 1950s. consequences on the resulting signal transduction (Figure It removes the terminal phosphate from a nucleoside 1). An increased complex formation of Nme2/Nme3 triphosphate (NTP) and adds it to a nucleoside diphosphate with Gs increases cAMP formation and contractility. In (NDP) and thus it is important for nucleotide homeostasis contrast, if Gi2 is bound, cAMP formation is constitutively in every living cell. At least the four group I Nme proteins suppressed which is in accordance with the observations (Nme1 - Nme4) carry this enzymatic activity. Nme1 and from failing human hearts. Taken together, the data Nme2 are most abundant and ubiquitously expressed. showed that the composition and localization of G In the 1990s it became evident that enhanced cancer protein signaling complexes can change over time during metastasis was linked to reduced expression of Nme1. disease development and in response to altered Nme Metastasis, the colonization of distant sites by a tumor, heteroligomerization. is often more life threatening than the growth of the As Nme1 has also been shown to form primary tumor, which can be surgically removed in many heterooligomers at least with Nme2 [3], it is worthwhile cases.
[Show full text]
Concurrent Gene Signatures for Han Chinese Breast Cancers
Concurrent Gene Signatures for Han Chinese Breast Cancers Chi-Cheng Huang1,2,3,4, Shih-Hsin Tu4,5, Heng-Hui Lien3,5, Jaan-Yeh Jeng2,3, Ching-Shui Huang4,5, Chi-Jung Huang3,6, Liang-Chuan Lai7, Eric Y. Chuang1* 1 Graduate Institute of Biomedical Electronics and Bioinformatics, National Taiwan University, Taipei City, Taiwan, 2 Cathay General Hospital SiJhih, New, Taipei City, Taiwan, 3 School of Medicine, Fu-Jen Catholic University, New Taipei City, Taiwan, 4 School of Medicine, Taipei Medical University, Taipei City, Taiwan, 5 Department of Surgery, Cathay General Hospital, Taipei City, Taiwan, 6 Cathay Medical Research Institute, New Taipei City, Taiwan, 7 Graduate Institute of Physiology, National Taiwan University, Taipei City, Taiwan Abstract The interplay between copy number variation (CNV) and differential gene expression may be able to shed light on molecular process underlying breast cancer and lead to the discovery of cancer-related genes. In the current study, genes concurrently identified in array comparative genomic hybridization (CGH) and gene expression microarrays were used to derive gene signatures for Han Chinese breast cancers. We performed 23 array CGHs and 81 gene expression microarrays in breast cancer samples from Taiwanese women. Genes with coherent patterns of both CNV and differential gene expression were identified from the 21 samples assayed using both platforms. We used these genes to derive signatures associated with clinical ER and HER2 status and disease-free survival. Distributions of signature genes were strongly associated with chromosomal location: chromosome 16 for ER and 17 for HER2. A breast cancer risk predictive model was built based on the first supervised principal component from 16 genes (RCAN3, MCOLN2, DENND2D, RWDD3, ZMYM6, CAPZA1, GPR18, WARS2, TRIM45, SCRN1, CSNK1E, HBXIP, CSDE1, MRPL20, IKZF1, and COL20A1), and distinct survival patterns were observed between the high- and low-risk groups from the combined dataset of 408 microarrays.
[Show full text]
Figure S1. GO Analysis in the Treated Versus HBV(+) Groups
Figure S1. GO analysis in the treated versus HBV(+) groups. (A) BPs, (B) CCs and (C) MFs were classified by GO annotation in treated mice compared with that of HBV(+) mice. GO, Gene Ontology; HBV, hepatitis B virus; BPs, biological processes; CCs, cell components; MFs, molecular functions. Figure S2. KEGG analysis in the treated vs. HBV(+) groups. (A) The PPAR signaling pathway was significantly enriched. (B) FABP1 and ME1 were regulated in PPAR signaling pathway after treatment. KEGG, Kyoto Encyclopedia of Genes and Genomes; HBV, hepatitis B virus; PPAR, peroxisome proliferator‑activated receptor; FABP1, fatty acid binding protein 1; ME1, malic enzyme 1. Figure S3. Verification of transfection. LX‑2 cells were transfected with pSSV9‑HBV with or without pAAV‑shRNA. (A) HBsAg and (B) HBeAg in the supernatant were detected by ELISA. Positive and negative were the controls in the ELISA kit. HBV, hepatitis B virus; HBsAg, HBV surface antigen; HBeAg, HBV e antigen; ELISA, enzyme‑linked immunosorbent assay. Table SI. The sequence of shRNAs for HBV and TGF‑β. Oligos Sequence (5'→3') shRNA‑1 TTCCAGGATCCTCAACAAC shRNA‑3 TGTCAACGACCGACCTTGA shRNA‑TGF‑β CTATTGCTTCAGCTCCACAGA shRNA‑Scrambler GCACCTATAACAACGGTAG shRNAs, short hairpin RNAs; HBV, hepatitis B virus; TGF, trans‑ forming growth factor. Table SII. Basic information for iTRAQ‑labeling reagents. Group iTRAQ‑labeling Treated 127N 129C 130N HBV(+) mice 128N 130C 129N HBV(‑) mice 128C 131 127C Mix 126 iTRAQ, isobaric tags for relative and absolute quantitation; HBV, hepatitis B virus. Table SIII. Total proteins in the treated vs. HBV(+) groups. Fold change <0.77 0.77‑1.0 1.0‑1.3 >1.3 Number of proteins 76 1262 1283 122 Total proteins 2743 HBV, hepatitis B virus.
[Show full text]
The Potential Functional Roles of NME1 Histidine Kinase Activity in Neuroblastoma Pathogenesis
International Journal of Molecular Sciences Article The Potential Functional Roles of NME1 Histidine Kinase Activity in Neuroblastoma Pathogenesis Kevin Adam 1 , Jacqueline Lesperance 2, Tony Hunter 1 and Peter E. Zage 2,* 1 Molecular and Cell Biology Laboratory, Salk Institute for Biological Studies, 10010 N Torrey Pines Road, La Jolla, CA 92037, USA; [email protected] (K.A.); [email protected] (T.H.) 2 Department of Pediatrics, Division of Hematology-Oncology, University of California San Diego, La Jolla, CA 92093, USA; [email protected] * Correspondence: [email protected] Received: 3 April 2020; Accepted: 5 May 2020; Published: 7 May 2020 Abstract: Neuroblastoma is the most common extracranial solid tumor in childhood. Gain of chromosome 17q material is found in >60% of neuroblastoma tumors and is associated with poor patient prognosis. The NME1 gene is located in the 17q21.3 region, and high NME1 expression is correlated with poor neuroblastoma patient outcomes. However, the functional roles and signaling activity of NME1 in neuroblastoma cells and tumors are unknown. NME1 and NME2 have been shown to possess histidine (His) kinase activity. Using anti-1- and 3-pHis specific monoclonal antibodies and polyclonal anti-pH118 NME1/2 antibodies, we demonstrated the presence of pH118-NME1/2 and multiple additional pHis-containing proteins in all tested neuroblastoma cell lines and in xenograft neuroblastoma tumors, supporting the presence of histidine kinase activity in neuroblastoma cells and demonstrating the potential significance of histidine kinase signaling in neuroblastoma pathogenesis. We have also demonstrated associations between NME1 expression and neuroblastoma cell migration and differentiation. Our demonstration of NME1 histidine phosphorylation in neuroblastoma and of the potential role of NME1 in neuroblastoma cell migration and differentiation suggest a functional role for NME1 in neuroblastoma pathogenesis and open the possibility of identifying new therapeutic targets and developing novel approaches to neuroblastoma therapy.
[Show full text]