Identification of Genomic Biomarkers for Anthracycline
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Identification of Conserved Genes Triggering Puberty in European Sea
Blázquez et al. BMC Genomics (2017) 18:441 DOI 10.1186/s12864-017-3823-2 RESEARCHARTICLE Open Access Identification of conserved genes triggering puberty in European sea bass males (Dicentrarchus labrax) by microarray expression profiling Mercedes Blázquez1,2* , Paula Medina1,2,3, Berta Crespo1,4, Ana Gómez1 and Silvia Zanuy1* Abstract Background: Spermatogenesisisacomplexprocesscharacterized by the activation and/or repression of a number of genes in a spatio-temporal manner. Pubertal development in males starts with the onset of the first spermatogenesis and implies the division of primary spermatogonia and their subsequent entry into meiosis. This study is aimed at the characterization of genes involved in the onset of puberty in European sea bass, and constitutes the first transcriptomic approach focused on meiosis in this species. Results: European sea bass testes collected at the onset of puberty (first successful reproduction) were grouped in stage I (resting stage), and stage II (proliferative stage). Transition from stage I to stage II was marked by an increase of 11ketotestosterone (11KT), the main fish androgen, whereas the transcriptomic study resulted in 315 genes differentially expressed between the two stages. The onset of puberty induced 1) an up-regulation of genes involved in cell proliferation, cell cycle and meiosis progression, 2) changes in genes related with reproduction and growth, and 3) a down-regulation of genes included in the retinoic acid (RA) signalling pathway. The analysis of GO-terms and biological pathways showed that cell cycle, cell division, cellular metabolic processes, and reproduction were affected, consistent with the early events that occur during the onset of puberty. -
Characterization of the Small RNA Transcriptomes of Cell Protrusions and Cell Bodies of Highly Metastatic Hepatocellular Carcinoma Cells Via RNA Sequencing
ONCOLOGY LETTERS 22: 568, 2021 Characterization of the small RNA transcriptomes of cell protrusions and cell bodies of highly metastatic hepatocellular carcinoma cells via RNA sequencing WENPIN CAI1*, JINGZHANG JI2*, BITING WU2*, KAIXUAN HAO2, PING REN2, YU JIN2, LIHONG YANG2, QINGCHAO TONG2 and ZHIFA SHEN2 1Department of Laboratory Medicine, Wen Zhou Traditional Chinese Medicine Hospital; 2Zhejiang Provincial Key Laboratory of Medical Genetics, Key Laboratory of Laboratory Medicine, Ministry of Education, School of Laboratory Medicine and Life Sciences, Wenzhou Medical University, Wenzhou, Zhejiang 325035, P.R. China Received July 11, 2020; Accepted February 23, 2021 DOI: 10.3892/ol.2021.12829 Abstract. Increasing evidence suggest that hepatocellular differentially expressed miRNAs and circRNAs. The interac‑ carcinoma (HCC) HCCLM3 cells initially develop pseudo‑ tion maps between miRNAs and circRNAs were constructed, podia when they metastasize, and microRNAs (miRNAs/miRs) and signaling pathway maps were analyzed to determine the and circular RNAs (circRNAs) have been demonstrated to molecular mechanism and regulation of the differentially serve important roles in the development, progression and expressed miRNAs and circRNAs. Taken together, the results metastasis of cancer. The present study aimed to isolate the of the present study suggest that the Boyden chamber assay cell bodies (CBs) and cell protrusions (CPs) from HCCLM3 can be used to effectively isolate the somatic CBs and CPs of cells, and screen the miRNAs and circRNAs associated with HCC, which can be used to screen the miRNAs and circRNAs HCC infiltration and metastasis in CBs and CPs. The Boyden associated with invasion and metastasis of HCC. chamber assay has been confirmed to effectively isolate the CBs and CPs from HCCLM3 cells via observation of microtu‑ Introduction bule immunofluorescence, DAPI staining and nuclear protein H3 western blotting. -
Supplementary Materials
Supplementary materials Supplementary Table S1: MGNC compound library Ingredien Molecule Caco- Mol ID MW AlogP OB (%) BBB DL FASA- HL t Name Name 2 shengdi MOL012254 campesterol 400.8 7.63 37.58 1.34 0.98 0.7 0.21 20.2 shengdi MOL000519 coniferin 314.4 3.16 31.11 0.42 -0.2 0.3 0.27 74.6 beta- shengdi MOL000359 414.8 8.08 36.91 1.32 0.99 0.8 0.23 20.2 sitosterol pachymic shengdi MOL000289 528.9 6.54 33.63 0.1 -0.6 0.8 0 9.27 acid Poricoic acid shengdi MOL000291 484.7 5.64 30.52 -0.08 -0.9 0.8 0 8.67 B Chrysanthem shengdi MOL004492 585 8.24 38.72 0.51 -1 0.6 0.3 17.5 axanthin 20- shengdi MOL011455 Hexadecano 418.6 1.91 32.7 -0.24 -0.4 0.7 0.29 104 ylingenol huanglian MOL001454 berberine 336.4 3.45 36.86 1.24 0.57 0.8 0.19 6.57 huanglian MOL013352 Obacunone 454.6 2.68 43.29 0.01 -0.4 0.8 0.31 -13 huanglian MOL002894 berberrubine 322.4 3.2 35.74 1.07 0.17 0.7 0.24 6.46 huanglian MOL002897 epiberberine 336.4 3.45 43.09 1.17 0.4 0.8 0.19 6.1 huanglian MOL002903 (R)-Canadine 339.4 3.4 55.37 1.04 0.57 0.8 0.2 6.41 huanglian MOL002904 Berlambine 351.4 2.49 36.68 0.97 0.17 0.8 0.28 7.33 Corchorosid huanglian MOL002907 404.6 1.34 105 -0.91 -1.3 0.8 0.29 6.68 e A_qt Magnogrand huanglian MOL000622 266.4 1.18 63.71 0.02 -0.2 0.2 0.3 3.17 iolide huanglian MOL000762 Palmidin A 510.5 4.52 35.36 -0.38 -1.5 0.7 0.39 33.2 huanglian MOL000785 palmatine 352.4 3.65 64.6 1.33 0.37 0.7 0.13 2.25 huanglian MOL000098 quercetin 302.3 1.5 46.43 0.05 -0.8 0.3 0.38 14.4 huanglian MOL001458 coptisine 320.3 3.25 30.67 1.21 0.32 0.9 0.26 9.33 huanglian MOL002668 Worenine -
(P -Value<0.05, Fold Change≥1.4), 4 Vs. 0 Gy Irradiation
Table S1: Significant differentially expressed genes (P -Value<0.05, Fold Change≥1.4), 4 vs. 0 Gy irradiation Genbank Fold Change P -Value Gene Symbol Description Accession Q9F8M7_CARHY (Q9F8M7) DTDP-glucose 4,6-dehydratase (Fragment), partial (9%) 6.70 0.017399678 THC2699065 [THC2719287] 5.53 0.003379195 BC013657 BC013657 Homo sapiens cDNA clone IMAGE:4152983, partial cds. [BC013657] 5.10 0.024641735 THC2750781 Ciliary dynein heavy chain 5 (Axonemal beta dynein heavy chain 5) (HL1). 4.07 0.04353262 DNAH5 [Source:Uniprot/SWISSPROT;Acc:Q8TE73] [ENST00000382416] 3.81 0.002855909 NM_145263 SPATA18 Homo sapiens spermatogenesis associated 18 homolog (rat) (SPATA18), mRNA [NM_145263] AA418814 zw01a02.s1 Soares_NhHMPu_S1 Homo sapiens cDNA clone IMAGE:767978 3', 3.69 0.03203913 AA418814 AA418814 mRNA sequence [AA418814] AL356953 leucine-rich repeat-containing G protein-coupled receptor 6 {Homo sapiens} (exp=0; 3.63 0.0277936 THC2705989 wgp=1; cg=0), partial (4%) [THC2752981] AA484677 ne64a07.s1 NCI_CGAP_Alv1 Homo sapiens cDNA clone IMAGE:909012, mRNA 3.63 0.027098073 AA484677 AA484677 sequence [AA484677] oe06h09.s1 NCI_CGAP_Ov2 Homo sapiens cDNA clone IMAGE:1385153, mRNA sequence 3.48 0.04468495 AA837799 AA837799 [AA837799] Homo sapiens hypothetical protein LOC340109, mRNA (cDNA clone IMAGE:5578073), partial 3.27 0.031178378 BC039509 LOC643401 cds. [BC039509] Homo sapiens Fas (TNF receptor superfamily, member 6) (FAS), transcript variant 1, mRNA 3.24 0.022156298 NM_000043 FAS [NM_000043] 3.20 0.021043295 A_32_P125056 BF803942 CM2-CI0135-021100-477-g08 CI0135 Homo sapiens cDNA, mRNA sequence 3.04 0.043389246 BF803942 BF803942 [BF803942] 3.03 0.002430239 NM_015920 RPS27L Homo sapiens ribosomal protein S27-like (RPS27L), mRNA [NM_015920] Homo sapiens tumor necrosis factor receptor superfamily, member 10c, decoy without an 2.98 0.021202829 NM_003841 TNFRSF10C intracellular domain (TNFRSF10C), mRNA [NM_003841] 2.97 0.03243901 AB002384 C6orf32 Homo sapiens mRNA for KIAA0386 gene, partial cds. -
105.Full.Pdf
CANCER GENOMICS & PROTEOMICS 8: 105-126 (2011) Conservation of Multifunctional Ribosomal Protein Metallopanstimulin-1 (RPS27) through Complex Evolution Demonstrates its Key Role in Growth Regulation in Archaea, Eukaryotic Cells, DNA Repair, Translation and Viral Replication J. ALBERTO FERNANDEZ-POL Antagoras Agrobusiness, LLC., Biotechnology, Chesterfield, MO, U.S.A. Abstract. Background: When the functions of a protein serve determined by NMR. Results: The data presented here a useful survival and unique purpose, the selective pressures of indicates that anti-ZFP agents can potentially be used to evolutionary laws of nature conserve the DNA sequences prevent and control viral infections by disrupting viral ZFP encoding such proteins. In many instances, the conservation motifs. Different DNA/RNA virus-infected cells exposed to the of these sequences has occurred since the inception of life on antivirals resulted in distruption of both RPMPS-1/S27 and earth to the present in phylogenetically related species. The essential viral ZFPs. Picolinic acid (PA) and fusaric acid (FU) unique function(s) of metallopanstimulin (MPS-1/RPS27) were tested and have been shown to have both antiviral and ribosomal protein (RP) and a limited number of other RPs, in preventive antiviral activities which have been consistently growth regulation, and viral infection is further documented shown to be mediated, at least in part, via interacting with here. Based on the correlation of information concerning RPMPS-1/S27. The same antiviral agents simultaneously Genome Context Analysis, and new information presented disrupt essential viral ZFPs. Both antiviral events on ZFPs here, the author proposes that neutralization or elimination of render the pathogenic virus inactive. -
Two Separate Functions of NME3 Critical for Cell Survival Underlie a Neurodegenerative Disorder
Two separate functions of NME3 critical for cell survival underlie a neurodegenerative disorder Chih-Wei Chena, Hong-Ling Wanga, Ching-Wen Huangb, Chang-Yu Huangc, Wai Keong Lima, I-Chen Tua, Atmaja Koorapatia, Sung-Tsang Hsiehd, Hung-Wei Kand, Shiou-Ru Tzenge, Jung-Chi Liaof, Weng Man Chongf, Inna Naroditzkyg, Dvora Kidronh,i, Ayelet Eranj, Yousif Nijimk, Ella Selak, Hagit Baris Feldmanl, Limor Kalfonm, Hadas Raveh-Barakm, Tzipora C. Falik-Zaccaim,n, Orly Elpelego, Hanna Mandelm,p,1, and Zee-Fen Changa,q,1 aInstitute of Molecular Medicine, College of Medicine, National Taiwan University, 10002 Taipei, Taiwan; bDepartment of Medicine, College of Medicine, National Taiwan University, 10002 Taipei, Taiwan; cInstitute of Biochemistry and Molecular Biology, National Yang-Ming University, 11221 Taipei, Taiwan; dInstitute of Anatomy and Cell Biology, College of Medicine, National Taiwan University, 10002 Taipei, Taiwan; eInstitute of Biochemistry and Molecular Biology, College of Medicine, National Taiwan University, 10002 Taipei, Taiwan; fInstitute of Atomic and Molecular Sciences, Academia Sinica, 10617 Taipei, Taiwan; gDepartment of Pathology, Rambam Health Care Campus, 31096 Haifa, Israel; hDepartment of Pathology, Meir Hospital, 44100 Kfar Saba, Israel; iSackler School of Medicine, Tel Aviv University, 69978 Tel Aviv, Israel; jDepartment of Radiology, Rambam Health Care Campus, 31096 Haifa, Israel; kPediatric and Neonatal Unit, Nazareth Hospital EMMS, 17639 Nazareth, Israel; lThe Genetics Institute, Rambam Health Care Campus, 31096 Haifa, Israel; mInstitute of Human Genetics, Galilee Medical Center, 22100 Nahariya, Israel; nThe Azrieli Faculty of Medicine, Bar Ilan University, 13100 Safed, Israel; oDepartment of Genetic and Metabolic Diseases, Hadassah Hebrew University Medical Center, 91120 Jerusalem, Israel; pMetabolic Unit, Technion Faculty of Medicine, Rambam Health Care Campus, 31096 Haifa, Israel; and qCenter of Precision Medicine, College of Medicine, National Taiwan University, 10002 Taipei, Taiwan Edited by Christopher K. -
Ribosomal Protein S27-Like, a P53-Inducible Modulator of Cell Fate in Response to Genotoxic Stress
Research Article Ribosomal Protein S27-like, a p53-Inducible Modulator of Cell Fate in Response to Genotoxic Stress Jingsong Li,1 Jing Tan,1 Li Zhuang,1 Birendranath Banerjee,2 Xiaojing Yang,1 Jenny Fung Ling Chau,3 Puay Leng Lee,1 Manoor Prakash Hande,2 Baojie Li,3 and Qiang Yu1 1Laboratory of Molecular Pharmacology, Genome Institute of Singapore; 2Department of Physiology, Yong Loo Lin School of Medicine, National University of Singapore; and 3Institute of Molecular and Cell Biology, Singapore Abstract through transcriptional activation of apoptotic target genes, such as PUMA, BAX, NOXA, BID, PIG3, CD95, DR5,orp53AIP1 (6, 7, 11), Activation of the p53 tumor suppressor upon DNA damage elicits either cell cycle arrest or apoptosis, and the precise or through a transcription-independent mechanism involving mechanism governing cell fate after p53 response has not direct Bax/Bak activation in the mitochondria (12–15). been well defined. Through genomic analysis, we have The cellular response to p53 activation after DNA damage varies identified the ribosomal protein S27-like (RPS27L) as a novel by cell type and stimuli. The response could be the initiation of p53 transcriptional target gene. Although RPS27L mRNA DNA repair and the damage checkpoint, leading to cell cycle arrest levels were consistently induced after diverse p53 activating or apoptosis as a result of defective DNA repair. For example, signals, its change in protein level was stimuli-dependent: it activation of p53 by the DNA-damaging agent Adriamycin resulted was up-regulated when cells were arrested in response to in p53-dependent cell cycle arrest in HCT116 cells, whereas in the DNA-damaging agents Adriamycin or VP16 but was down- same cells p53 activation by the DNA analogue 5-flurouracil (5-FU) gave rise to apoptosis (16). -
Product Size GOT1 P00504 F CAAGCTGT
Table S1. List of primer sequences for RT-qPCR. Gene Product Uniprot ID F/R Sequence(5’-3’) name size GOT1 P00504 F CAAGCTGTCAAGCTGCTGTC 71 R CGTGGAGGAAAGCTAGCAAC OGDHL E1BTL0 F CCCTTCTCACTTGGAAGCAG 81 R CCTGCAGTATCCCCTCGATA UGT2A1 F1NMB3 F GGAGCAAAGCACTTGAGACC 93 R GGCTGCACAGATGAACAAGA GART P21872 F GGAGATGGCTCGGACATTTA 90 R TTCTGCACATCCTTGAGCAC GSTT1L E1BUB6 F GTGCTACCGAGGAGCTGAAC 105 R CTACGAGGTCTGCCAAGGAG IARS Q5ZKA2 F GACAGGTTTCCTGGCATTGT 148 R GGGCTTGATGAACAACACCT RARS Q5ZM11 F TCATTGCTCACCTGCAAGAC 146 R CAGCACCACACATTGGTAGG GSS F1NLE4 F ACTGGATGTGGGTGAAGAGG 89 R CTCCTTCTCGCTGTGGTTTC CYP2D6 F1NJG4 F AGGAGAAAGGAGGCAGAAGC 113 R TGTTGCTCCAAGATGACAGC GAPDH P00356 F GACGTGCAGCAGGAACACTA 112 R CTTGGACTTTGCCAGAGAGG Table S2. List of differentially expressed proteins during chronic heat stress. score name Description MW PI CC CH Down regulated by chronic heat stress A2M Uncharacterized protein 158 1 0.35 6.62 A2ML4 Uncharacterized protein 163 1 0.09 6.37 ABCA8 Uncharacterized protein 185 1 0.43 7.08 ABCB1 Uncharacterized protein 152 1 0.47 8.43 ACOX2 Cluster of Acyl-coenzyme A oxidase 75 1 0.21 8 ACTN1 Alpha-actinin-1 102 1 0.37 5.55 ALDOC Cluster of Fructose-bisphosphate aldolase 39 1 0.5 6.64 AMDHD1 Cluster of Uncharacterized protein 37 1 0.04 6.76 AMT Aminomethyltransferase, mitochondrial 42 1 0.29 9.14 AP1B1 AP complex subunit beta 103 1 0.15 5.16 APOA1BP NAD(P)H-hydrate epimerase 32 1 0.4 8.62 ARPC1A Actin-related protein 2/3 complex subunit 42 1 0.34 8.31 ASS1 Argininosuccinate synthase 47 1 0.04 6.67 ATP2A2 Cluster of Calcium-transporting -
New Approaches for Quantitative Reconstruction of Radiation Dose in Human Blood Cells Shanaz A
www.nature.com/scientificreports OPEN New Approaches for Quantitative Reconstruction of Radiation Dose in Human Blood Cells Shanaz A. Ghandhi 1,2*, Igor Shuryak1,2, Shad R. Morton1, Sally A. Amundson 1 & David J. Brenner1 In the event of a nuclear attack or large-scale radiation event, there would be an urgent need for assessing the dose to which hundreds or thousands of individuals were exposed. Biodosimetry approaches are being developed to address this need, including transcriptomics. Studies have identifed many genes with potential for biodosimetry, but, to date most have focused on classifcation of samples by exposure levels, rather than dose reconstruction. We report here a proof-of-principle study applying new methods to select radiation-responsive genes to generate quantitative, rather than categorical, radiation dose reconstructions based on a blood sample. We used a new normalization method to reduce efects of variability of signal intensity in unirradiated samples across studies; developed a quantitative dose-reconstruction method that is generally under-utilized compared to categorical methods; and combined these to determine a gene set as a reconstructor. Our dose-reconstruction biomarker was trained using two data sets and tested on two independent ones. It was able to reconstruct dose up to 4.5 Gy with root mean squared error (RMSE) of ± 0.35 Gy on a test dataset using the same platform, and up to 6.0 Gy with RMSE of ± 1.74 Gy on a test set using a diferent platform. In the event of a nuclear attack or large-scale radiation event, there would be an urgent need for assessing the dose to which hundreds or thousands of individuals were exposed1–4. -
Content Based Search in Gene Expression Databases and a Meta-Analysis of Host Responses to Infection
Content Based Search in Gene Expression Databases and a Meta-analysis of Host Responses to Infection A Thesis Submitted to the Faculty of Drexel University by Francis X. Bell in partial fulfillment of the requirements for the degree of Doctor of Philosophy November 2015 c Copyright 2015 Francis X. Bell. All Rights Reserved. ii Acknowledgments I would like to acknowledge and thank my advisor, Dr. Ahmet Sacan. Without his advice, support, and patience I would not have been able to accomplish all that I have. I would also like to thank my committee members and the Biomed Faculty that have guided me. I would like to give a special thanks for the members of the bioinformatics lab, in particular the members of the Sacan lab: Rehman Qureshi, Daisy Heng Yang, April Chunyu Zhao, and Yiqian Zhou. Thank you for creating a pleasant and friendly environment in the lab. I give the members of my family my sincerest gratitude for all that they have done for me. I cannot begin to repay my parents for their sacrifices. I am eternally grateful for everything they have done. The support of my sisters and their encouragement gave me the strength to persevere to the end. iii Table of Contents LIST OF TABLES.......................................................................... vii LIST OF FIGURES ........................................................................ xiv ABSTRACT ................................................................................ xvii 1. A BRIEF INTRODUCTION TO GENE EXPRESSION............................. 1 1.1 Central Dogma of Molecular Biology........................................... 1 1.1.1 Basic Transfers .......................................................... 1 1.1.2 Uncommon Transfers ................................................... 3 1.2 Gene Expression ................................................................. 4 1.2.1 Estimating Gene Expression ............................................ 4 1.2.2 DNA Microarrays ...................................................... -
Ribosomal Proteins and Human Diseases: Molecular Mechanisms and Targeted Therapy ✉ Jian Kang1,2, Natalie Brajanovski1, Keefe T
Signal Transduction and Targeted Therapy www.nature.com/sigtrans REVIEW ARTICLE OPEN Ribosomal proteins and human diseases: molecular mechanisms and targeted therapy ✉ Jian Kang1,2, Natalie Brajanovski1, Keefe T. Chan1,2, Jiachen Xuan1,2, Richard B. Pearson1,2,3,4 and Elaine Sanij1,2,5,6 Ribosome biogenesis and protein synthesis are fundamental rate-limiting steps for cell growth and proliferation. The ribosomal proteins (RPs), comprising the structural parts of the ribosome, are essential for ribosome assembly and function. In addition to their canonical ribosomal functions, multiple RPs have extra-ribosomal functions including activation of p53-dependent or p53- independent pathways in response to stress, resulting in cell cycle arrest and apoptosis. Defects in ribosome biogenesis, translation, and the functions of individual RPs, including mutations in RPs have been linked to a diverse range of human congenital disorders termed ribosomopathies. Ribosomopathies are characterized by tissue-specific phenotypic abnormalities and higher cancer risk later in life. Recent discoveries of somatic mutations in RPs in multiple tumor types reinforce the connections between ribosomal defects and cancer. In this article, we review the most recent advances in understanding the molecular consequences of RP mutations and ribosomal defects in ribosomopathies and cancer. We particularly discuss the molecular basis of the transition from hypo- to hyper-proliferation in ribosomopathies with elevated cancer risk, a paradox termed “Dameshek’s riddle.” Furthermore, we review the current treatments for ribosomopathies and prospective therapies targeting ribosomal defects. We also highlight recent advances in ribosome stress-based cancer therapeutics. Importantly, insights into the mechanisms of resistance to therapies targeting ribosome biogenesis bring new perspectives into the molecular basis of cancer susceptibility in ribosomopathies and new 1234567890();,: clinical implications for cancer therapy. -
Open Moore Sarah P53network.Pdf
THE PENNSYLVANIA STATE UNIVERSITY SCHREYER HONORS COLLEGE DEPARTMENT OF BIOCHEMISTRY AND MOLECULAR BIOLOGY A SYSTEMATIC METHOD FOR ANALYZING STIMULUS-DEPENDENT ACTIVATION OF THE p53 TRANSCRIPTION NETWORK SARAH L. MOORE SPRING 2013 A thesis submitted in partial fulfillment of the requirements for a baccalaureate degree in Biochemistry and Molecular Biology with honors in Biochemistry and Molecular Biology Reviewed and approved* by the following: Dr. Yanming Wang Associate Professor of Biochemistry and Molecular Biology Thesis Supervisor Dr. Ming Tien Professor of Biochemistry and Molecular Biology Honors Advisor Dr. Scott Selleck Professor and Head, Department of Biochemistry and Molecular Biology * Signatures are on file in the Schreyer Honors College. i ABSTRACT The p53 protein responds to cellular stress, like DNA damage and nutrient depravation, by activating cell-cycle arrest, initiating apoptosis, or triggering autophagy (i.e., self eating). p53 also regulates a range of physiological functions, such as immune and inflammatory responses, metabolism, and cell motility. These diverse roles create the need for developing systematic methods to analyze which p53 pathways will be triggered or inhibited under certain conditions. To determine the expression patterns of p53 modifiers and target genes in response to various stresses, an extensive literature review was conducted to compile a quantitative reverse transcription polymerase chain reaction (qRT-PCR) primer library consisting of 350 genes involved in apoptosis, immune and inflammatory responses, metabolism, cell cycle control, autophagy, motility, DNA repair, and differentiation as part of the p53 network. Using this library, qRT-PCR was performed in cells with inducible p53 over-expression, DNA-damage, cancer drug treatment, serum starvation, and serum stimulation.