Role of Glutathione Metabolism in Host Defense Against Borrelia

Role of glutathione metabolism in host defense PNAS PLUS against Borrelia burgdorferi infection

Mariska Kerstholta,b, Hedwig Vrijmoetha,b, Ekta Lachmandasa,b, Marije Oostinga,b, Mihaela Lupsec, Mirela Flontac, Charles A. Dinarelloa,b,d,1, Mihai G. Neteaa,b,e, and Leo A. B. Joostena,b,1

aDepartment of Internal Medicine, Radboud University Medical Center, 6525 GA Nijmegen, The Netherlands; bRadboud Center for Infectious Diseases, Radboud University Medical Center, 6525 GA Nijmegen, The Netherlands; cDepartment of Infectious Diseases, University of Medicine and Pharmacy “Iuliu Hatieganu,” 400349 Cluj-Napoca, Romania; dDepartment of Medicine, University of Colorado Denver, Aurora, CO 80045; and eHuman Genomics Laboratory, Craiova University of Medicine and Pharmacy, 200349 Craiova, Romania

Contributed by Charles A. Dinarello, January 18, 2018 (sent for review December 7, 2017; reviewed by Pietro Ghezzi and Georg Schett) Pathogen-induced changes in host cell metabolism are known to central glucose metabolism in host mononuclear cells which was be important for the immune response. In this study, we in- crucial for cytokine production (13). vestigated how infection with the Lyme disease-causing bacterium In the present study, we aimed to further explore the metabolic Borrelia burgdorferi (Bb) affects host metabolic pathways and pathways induced by Bb and analyze their role in immune cell how these metabolic pathways may impact host defense. First, function. To achieve this, we performed metabolomic analysis metabolome analysis was performed on human primary mono- of primary human monocytes stimulated with Bb or other in- cytes from healthy volunteers, stimulated for 24 h with Bb at flammatory stimuli. Identified pathways were then further validated low multiplicity of infection (MOI). Pathway analysis indicated that using in vitro intervention experiments to elucidate their role in glutathione (GSH) metabolism was the pathway most significantly the inflammatory response. Lastly, we examined the relevant affected by Bb. Specifically, intracellular levels of GSH increased on metabolites in serum samples from acute Lyme disease patients. average 10-fold in response to Bb exposure. Furthermore, these changes were found to be specific, as they were not seen during Results stimulation with other pathogens. Next, metabolome analysis was Primary Human Monocytes Exposed to Bb Display Altered Glutathione performed on serum samples from patients with early-onset Lyme Metabolism. To determine which metabolic pathways were affected INFLAMMATION IMMUNOLOGY AND disease in comparison with patients with other infections. Sup- by Bb infection, metabolome analysis was performed on primary porting the in vitro analysis, we identified a cluster of GSH-related human monocytes stimulated with Bb or medium control for 24 h. metabolites, the γ-glutamyl amino acids, specifically altered in pa- Pathway analysis was performed to identify specific metabolic tients with Lyme disease, and not in other infections. Lastly, we performed in vitro experiments to validate the role for GSH metab- pathways altered by Bb exposure (Table S1). As seen in Fig. 1A,the olism in host response against Bb. We found that the GSH pathway pathways most significantly affected by Bb were glutathione (GSH) is essential for Bb-induced cytokine production and identified glu- metabolism, arachidonic acid metabolism, and pyrimidine metab- tathionylation as a potential mediating mechanism. Taken together, olism. When analyzing individual metabolites, eight compounds these data indicate a central role for the GSH pathway in the host related to GSH metabolism were found among the top 25 most response to Bb. GSH metabolism and glutathionylation may therefore be important factors in the pathogenesis of Lyme disease and Significance potentially other inflammatory diseases as well. Inflammation plays a crucial role in the pathogenesis of Lyme Lyme disease | B. burgdorferi | cell metabolism | glutathione disease, caused by the spirochete Borrelia burgdorferi. In- tracellular metabolism is increasingly being recognized as a yme disease, caused by Borrelia burgdorferi (Bb) sensu lato,is major determinant of inflammation. In this study, we in- Lthe most common vector-borne disease in the Northern vestigated how B. burgdorferi affects host cell metabolism by hemisphere (1, 2), transmitted by ticks. Lyme disease most often analyzing the intracellular metabolome in vitro, as well as the presents locally with a migrating skin rash called erythema circulating metabolome in patients with early-onset Lyme dis- migrans (EM) but, if left untreated, can give rise to inflammatory ease. We identify glutathione metabolism as the most impor- complications in the joints (3), heart (4), or nervous system (5). tant target of B. burgdorferi infection and discover that this In most cases, Lyme disease can be effectively treated by antibi- pathway is essential for cytokine production, likely through otics, yet a small percentage of patients experience persisting glutathionylation. These findings not only provide more insight into the pathogenesis of Lyme disease but also underline symptoms even after extensive antibiotic treatment (6, 7). how host–pathogen interactions in metabolism can play crucial Interestingly, Bb is not known to produce toxic factors (8). The roles in host defense against pathogens. majority of Lyme disease symptoms are therefore attributed to ’ the host s immune response against the pathogen. In addition, it Author contributions: M.K., C.A.D., M.G.N., and L.A.B.J. designed research; M.K. per- is hypothesized that persistent symptoms after treatment are not formed research; H.V., E.L., M.O., M.L., M.F., M.G.N., and L.A.B.J. contributed new re- due to continuous infection, but rather due to an aberrant in- agents/analytic tools; M.K., H.V., E.L., M.O., and C.A.D. analyzed data; M.K. and C.A.D. flammatory response (7, 9, 10). Together, this suggests a crucial wrote the paper; and M.G.N. supervised research. role for the host immune response in the initiation and outcome Reviewers: P.G., Brighton and Sussex Medical School; and G.S., University of Erlangen– Nuremberg. of the infection. The authors declare no conflict of interest. An upcoming topic in the study of the immune system is immunometabolism, which investigates the impact of cellular Published under the PNAS license. metabolism on immune cell function. This is of particular in- Data deposition: The metabolome data reported in this paper have been deposited in the MetaboLights database, https://www.ebi.ac.uk/metabolights/ (accession no. MTBLS625). terest in the case of Bb as the spirochete is known to have very 1To whom correspondence may be addressed. Email: [email protected] or limited metabolic capabilities (11, 12). This might cause the [email protected]. spirochete to induce specific changes in host cell metabolism. This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. Supporting this, we recently showed that Bb induces a switch in 1073/pnas.1720833115/-/DCSupplemental.

www.pnas.org/cgi/doi/10.1073/pnas.1720833115 PNAS Latest Articles | 1of9 Downloaded by guest on September 24, 2021 AC Glutathione metabolism GSH 6 s 10

el **

Arachidonic acid ev Pyrimidine metabolism l 1

metabolism H 5 S 0.1 eG iv 4 0.01 lat

Re 0.001 3 Bb -log(p) D RPMI GSSG s 10 * 12 SG level

S 1

0.0 0.2 0.4 0.6 ative G

Pathway impact Rel 0.1 b B B Bb RPMI RPMI

N6,N6,N6-Trimethyl-L-lysine Cysteineglutathione disulfide # N-Acetylputrescine Orotidine Eicosapentaenoic acid Gamma Glutamylglutamic acid 11 Homocysteine 4 Cysteinylglycine 12 Putrescine L-Lactic acid Maltotriose Maltotetraose Erythronic acid L-Glutamic acid Pyridoxal 5'-phosphate 13 Phosphorylcholine PE(16:0/18:2(9Z,12Z)) Gamma-Glutamylcysteine 8 Uridine diphosphategalactose Niacinamide Glutathione 9 Acetylcysteine 6 Quinolinic acid 4-Guanidinobutanoic acid Adenosine monophosphate

Fig. 1. Metabolome analysis of primary monocytes stimulated with Bb versus RPMI. (A) Scatter plot of KEGG metabolic pathways in primary human monocytes (n = 5) affected by Bb stimulation, showing log P value of the enrichment analysis (y axis and visualized by node color) and pathway impact, taking into account the importance of the affected metabolites within a pathway (x axis and visualized by node radius; range 0 to 1, where 1 is maximal impact). (B) Heat map depicting the top 25 most significantly affected metabolites after Bb stimulation, where red indicates an increase and blue indicates a decrease. Numbers represent references to Fig. S1. #, GSH derivative, formed upon oxidative stress of GSH. (C and D)Rawdataof(C) reduced glutathione (GSH) and (D)oxidized glutathione (GSSG) levels in primary monocytes stimulated with Bb or control (RPMI). Box plot indicates median ± min/max values. Max *P > 0.05, **P > 0.01.

significantly affected metabolites (Fig. 1B, with references to Fig. lism in Bb infection (13), lactate was among the most significantly S1). Most noteworthy, Bb stimulation induced a dramatic increase affected metabolites. in reduced GSH levels (Fig. 1C), while only modestly increasing Next, we compared fold changes (FCs) relative to medium oxidized glutathione (GSSG) (Fig. 1D). This indicates a shift in the control (RPMI) in metabolite levels in monocytes exposed to Bb GSH/GSSG ratio, suggesting a more antioxidative state. Other with cells exposed to the TLR4 ligand LPS and the TLR2 ligand metabolites significantly increased by Bb stimulation included Pam3Cys. Fig. 2A shows the top 50 most differentially regulated polyamines, nucleotide metabolites, and phospholipid metabolites. metabolites between the stimuli. Interestingly, one cluster of eight Supporting the previously demonstrated role of glucose metabo- metabolites (indicated in red) was identified, which were up-regulated

2of9 | www.pnas.org/cgi/doi/10.1073/pnas.1720833115 Kerstholt et al. Downloaded by guest on September 24, 2021 (FC > 1) by Bb, while being down-regulated (FC < 1) by LPS tabolism is given in Fig. S1. All together, these data indicate that PNAS PLUS stimulation and Pam3Cys stimulation. From this cluster, three GSH metabolism is significantly and specifically influenced by metabolites could be linked to GSH metabolism (see Fig. S1 for Bb stimulation. reference): homocysteine, pyridoxal phosphate (PLP), and flavin adenine dinucleotide (FAD). The other metabolites in this Altered GSH Metabolism Affects Bb-Induced Cytokine Production, but cluster were adenosine monophosphate (AMP), inosinic acid (or Not Reactive Oxygen Species Production. To investigate whether inosine monophosphate) (IMP), tetradecanoylcarnitine A, beta- altered GSH metabolism plays a role in immune cell function in alanine, and hypotaurine. GSH was also slightly increased in response to Bb, we performed several in vitro validation exper- LPS- and Pam3Cys-stimulated samples. However, LPS and iments. First, we determined whether the increase in GSH levels Pam3Cys induced a twofold increase in GSH levels, while a 10- affects the capacity of host cells to generate reactive oxygen fold increase was seen after Bb stimulation (Fig. 2 B and C). An species (ROS). To investigate this, human peripheral blood overview of all metabolites and enzymes involved in GSH me- mononuclear cells (PBMCs) were exposed for 24 h to Bb and

A Bb LPS P3Cys Adenosine monophosphate Pyridoxal 5'-phosphate 13 FAD 14 Homocysteine 4 Inosinic acid Tetradecanoylcarnitine Beta-Alanine Hypotaurine Sphinganine Cer(d18:0/16:0) Sphingosine Ceramide (d18:1/18:0) 1-Methylnicotinamide LysoPC(18:2(9Z,12Z))

LysoPC(20:4(5Z,8Z,11Z,14Z)) INFLAMMATION

N1-Acetylspermine IMMUNOLOGY AND Cytidine 2-Palmitoylglycerophosphocholine LysoPC(18:1(9Z)) LysoPC(16:0) D-Glucuronic acid Mesaconic acid D-Fructose Quinolinic acid Cytosine Citric acid Itaconic acid L-Kynurenine 3-Hydroxybutyric acid Acetaminophen Myoinositol Paracetamol sulfate Methionine sulfoxide Dihydrothymine Guanidoacetic acid D-Glucose L-Histidine L-Proline L-Arginine L-Tyrosine Glycine D-Mannose Maltotriose Adenine Acetylglycine L-Aspartic acid L-Glutamic acid Serotonin Choline Pseudouridine BCFold change GSH Fold change GSSG 1000 8 e

100 g 6

10 chan 4 old Fold change 1 F 2

0.1 0 s Bb Bb LPS 3Cy LPS P P3Cys

Fig. 2. Metabolome analysis of primary monocytes stimulated with Bb versus LPS and P3cys. (A) Heat map depicting top 50 most differentially regulated metabolites in primary monocytes stimulated with Bb or the TLR ligands LPS or P3cys (all n = 5), based on fold changes in metabolite levels relative to unstimulated controls. Numbers represent references to Fig. S1.(B and C) Fold changes (relative to unstimulated controls) in levels of GSH (B) and GSSG (C)in primary monocytes stimulated with Bb compared with LPS and Pam3cys. Box plot indicates median ± min/max.

Kerstholt et al. PNAS Latest Articles | 3of9 Downloaded by guest on September 24, 2021 Surprisingly, increasing GSH synthesis by the addition of the ABZymosan-induced ROS Zymosan-induced ROS CZymosan-induced ROS 6 8×10 1×107 1×107 precursor N-acetyl-cysteine (NAC) also strongly decreased pro- 6 6 6×106 8×10 8×10 duction of both cytokines, as seen from Fig. 3F. This suggests *** 6×106 6 6 6×10 that both inhibition and inducing GSH synthesis can decrease 4×10 4×106 4×106 scence (AUC) cytokine production. 2×106 e 2×106 2×106

0 0 lumin luminescence (AUC) luminescence (AUC) 0 GSH Metabolism Affects Cytokine Production Through Different I 0 M Bb 00 P MI Bb 1 00 PMI Bb 500 R P 1 R Mechanisms. To unravel how modulation of GSH metabolism R O BS +DEM 50 + affects Bb-induced cytokine production, we first analyzed the DEIL-1β_BSO IL-1β_DEM FIL-1β_NAC 10000 10000 10000 effect of modulators of GSH metabolism on mRNA transcrip- *** * ** * ** tion. For BSO and NAC, the highest concentrations were used to 1000 1000 1000 detect the maximal effect. For DEM, the lower concentration was selected to rule out cytotoxic effects. As seen in Fig. 4A,a (pg/ml) (pg/ml) (pg/ml) 100 100 100 substantial increase in mRNA levels of IL1B was seen after 4 h and 24 h of stimulation with Bb. However, these mRNA levels 10 10 10 0 b 0 0 Bb 00 Bb 0 B 0 were unaffected by treatment with the GSH modulators. 5 .00 1000 0 O1 1 S +DEM 50 For TNF, a significant increase in mRNA expression was seen +B α α +NAC 10 TNF _BSO TNF _DEM TNFα_NAC after 4 h, but not 24 h of stimulation with Bb (Fig. 4B), suggesting 10000 10000 ** *** 10000 * * ** that induction of TNF mRNA is rapid but short-lasting. De- ** pletion of GSH by DEM was able to mildly potentiate mRNA 1000 1000 l) 1000 m levels, yet the other inhibitors showed no significant effect. (pg/ml) (pg/ml) 100 100 (pg/ 100 Taken together, these data indicate that the induction of IL1B and TNF mRNA by Bb is largely unaltered by modulation of 10 10 10 b 0 b 0 GSH metabolism. This suggests that the previously shown effects 0 0 B 1 000 B 50 Bb 0 1 .0 O S EM 50 10 on cytokine secretion mostly take place posttranscriptionally. AC 1000 +B +D N + To further elucidate this, we measured the intracellular levels of (pro)IL-1β and TNFα to determine whether mRNA was ef- Fig. 3. Effect of inhibitors of GSH metabolism on ROS production and cytokine production. (A) Area under the curve (AUC) of ROS-induced lumi- fectively being translated into protein. As shown in Fig. 4C, nescence on serum-opsonized zymosan (SOZ)-stimulated PBMCs (n = 11) stimulation with Bb drastically increased levels of intracellular pretreated for 24 h with Bb or control (RPMI). (B and C) AUC of ROS-induced luminescence on SOZ-stimulated PBMCs (n = 8 and n = 6, respectively) pretreated with Bb in the presence of different doses of the GSH synthesis in- = = – IL1B TNF hibitor BSO (B)(n 8) or the GSH-depleting agent DEM (C) (n 6). (D F) AB4hr 24hr 4hr 24hr Production of IL-1β (Upper) and TNFα (Lower) by PBMCs after 24 h stimula- 10000 100 * * tion with Bb in the presence of different doses (in μM) of (D) BSO (n = 14), 1000 * 10 (E) DEM (n = 14), or (F) N-acetylcysteine (NAC, n = 15). Bar graphs represent 100 * mean ± SEM. *P > 0.05, **P > 0.01, ***P < 0.001. 10 1 1 Relative expression

Relative expression 0.1 0.1 I then stimulated with serum-opsonized zymosan (SOZ), a potent M C M O Bb E MI Bb A Bb E M Bb S D DEM N B inducer of ROS. Indeed, exposure to Bb strongly decreased RPMI + +BSO+NAC RP + +BSO+ RPMI +D +BSO+NAC RP +DEM+ +NAC SOZ-induced ROS production (Fig. 3A). However, lowering C IL-1β_intracellular D TNFα_intracellular 1000000 1500 GSH concentrations using buthionine sulfoximine (BSO) or 100000 * diethyl maleate (DEM) did not reverse the effect of Bb stimu- 1000 * 10000

lation on ROS production (Fig. 3 B and C), indicating that this (pg/ml)

(pg/ml) 500 effect was independent of GSH levels. 1000 Next, we determined whether altered GSH metabolism affects 100 0 C Bb M C MI Bb Bb-induced cytokine production. PBMCs were pretreated with P DEM RPMI DE BSO NA R + +BSO+NA modulators of GSH metabolism and then stimulated for 24 h + + + EFIL-1β_secreted TNFα_secreted GHIL-1β_intracellular TNFα_intracellular with Bb. All compounds were checked for cytotoxicity, and, with 10000 * 10000 * 100000 * 1500 the exception of the high DEM concentration, no signs of cy- * * 1000 1000 10000 1000 * totoxicity were seen (Fig. S2). First, GSH biosynthesis was tar- * ml) γ 100 100 1000 500 (pg/ml) geted by inhibiting -glutamylcysteine synthase (GCS) using (pg/ (pg/ml) (pg/ml)

BSO. As shown in Fig. 3D, BSO showed disparate effects on 10 10 100 0 1 h .1 I h 1 1 β e M e eh cytokine production, with low concentration decreasing IL-1 PMI V P V A R RPMI + PA 1 PA 1 RPMI A0. P b PA 0 A R b+V A b+ P A α Bb+Veh -AAPA B -A B -A B A A production, while increasing TNF . Depleting GSH with low- 2 2 AAPA2 0.1 A + + - + 2- +2- concentration DEM gave similar results to GCS inhibition, de- +2-AAPA 0.1 +2-AA +2 + β α creasing IL-1 production and increasing TNF production (Fig. Fig. 4. Effect of modulators of GSH metabolism on cytokine transcription 3E). High concentrations of DEM strongly decreased the pro- and translation. (A and B) mRNA expression of IL1B (A)andTNF (B) in PBMCs duction of both cytokines although this may be confounded by from healthy volunteers (n = 6) pretreated for 1 h with DEM, BSO, or NAC effects on cell viability (Fig. S2). The more potent effect of DEM and stimulated for 4 h and 24 h with Bb. Box plot indicates median ± min/max. on cytokine production was reflected by GSH levels as DEM led (C and D) Measurement of (total) IL-1β (C)andTNFα (D) protein levels in to an earlier and stronger decrease in intracellular GSH levels cellular lysates of PBMCs from healthy volunteers (n = 6) pretreated for 1 h – than BSO (Fig. S3). Furthermore, DEM may have additional with DEM, BSO, or NAC and stimulated for 24 h with Bb. (E H) Protein levels of (total) IL-1β and TNFα in cellular lysates (intracellular) (G and H)orcell-free effects by reacting with other thiols and/or activating the tran- supernatants (secreted) (E and F) of PBMCs from healthy volunteers (n = 6) scription factor NRF2 (14). All together, these data suggest that pretreated for 1 h with the glutathionylation inducer 2-AAPA and stimulated modulation of GSH metabolism strongly affects cytokine pro- for 24 h with Bb. Vehicle controls were included as needed (indicated by duction although the effect is dose-dependent. +Veh). Bar graphs represent mean ± SEM. *P > 0.05.

4of9 | www.pnas.org/cgi/doi/10.1073/pnas.1720833115 Kerstholt et al. Downloaded by guest on September 24, 2021 (pro)IL-1β. However, similar to the transcriptome data, in- cling of oxidized GSH (see Fig. S1 for reference). Interestingly, PNAS PLUS tracellular concentrations were not significantly altered by the L-methionine, a possible precursor for GSH, was found to be addition of GSH modulators. This suggests that the effects of strongly decreased compared with both healthy controls and pa- GSH modulation on IL-1β secretion occur posttranslationally. tients with other infections (Fig. 5B, indicated by “#”). In contrast to the IL-1β data, intracellular TNFα levels were Apart from the γ-glutamyl amino acids, several eicosanoid substantially affected by modulation of GSH metabolism. Similar metabolites were found to be significantly elevated in EM pa- to what was seen for secreted TNFα levels, stimulation with Bb tients compared with both healthy controls and patients with led to increased intracellular TNFα levels, which were potenti- other infections. ated by the addition of DEM and inhibited by the addition of Together, these findings indicate that strong and specific al- NAC (Fig. 4D). BSO had no significant effect on intracellular terations in GSH metabolism, as well as eicosanoid/arachidonic TNFα levels. The effect of DEM treatment could at least par- acid metabolism, are found systemically after Bb infection. tially be explained by increased mRNA levels. However, NAC To further support these findings, we made use of publicly treatment did not significantly affect mRNA levels of TNF, while available transcriptome data from PBMCs of patients with EM completely shutting down intracellular levels. This suggests that to analyze gene expression levels of GSH-related genes (16). the inhibitory effect of this compound is due to an effect on the Noteworthy, several genes in GSH metabolism were differen- translation of TNF mRNA into protein. tially expressed in patients with Lyme disease in the acute stage Taken together, these data suggest that modulation of GSH (CBS, GSS, GGT1) but also up to 3 wk (MAT2A, GSS, GGT1) metabolism affects cytokine production through different mecha- and even 6 mo (CBS, GGT1) after diagnosis (Fig. S4). GGT1, nisms, for a large part taking place at the (post)translational level. the gene encoding for γ-glutamyl transpeptidase (GGT) was the Therefore, we hypothesized that the process of glutathionylation only gene significantly altered in Lyme patients at all time points. may play a role. Glutathionylation is a posttranslational modifi- However, contrary to the increased levels of γ-glutamyl amino cation in which a GSH molecule binds directly to a protein. To acids found in serum, gene expression of GGT was consistently determine whether glutathionylation plays a role in Bb-induced down-regulated. This suggests a feedback mechanism in which cytokine production, we made use of 2-AAPA, an inhibitor of high levels of breakdown products down-regulate gene expres- glutaredoxin-1 (15), which is expected to increase gluta- sion. Nevertheless, these data support the conclusion that GGT thionylation. As shown in Fig. 4 E and F, a high dose 2-AAPA β α activity is altered in patients with Bb infection. decreased secretion of both IL-1 and TNF . However, similar Taken together, we show that GSH metabolism is strongly

to the GSH modulators, intracellular levels of (pro)IL-1β re- INFLAMMATION α affected in patients with EM, as seen from altered metabolite IMMUNOLOGY AND mained unchanged (Fig. 4G), while intracellular levels of TNF levels in serum and persistently altered transcriptional activity were affected to the same extent as secreted levels (Fig. 4H). in PBMCs. This suggests that 2-AAPA modulates cytokine production in a similar fashion as modulators of GSH metabolism, supporting Discussion the hypothesis that glutathionylation mediates the effect of GSH In this study, we have shown that exposure of primary human on cytokines. monocytes to Bb results in significant and specific changes in Overall, these data show that modulation of GSH metabolism GSH metabolism. In addition, we show that modulating GSH substantially affects the secretion of IL-1β and TNFα through metabolism significantly affects cytokine production, possibly different mechanisms. For IL-1β, GSH seems to affect activation through glutathionylation. Finally, we provide evidence that and/or processing of IL-1β.ForTNFα, decreasing GSH levels GSH metabolism is altered in patients with EM and that these appeared to induce mRNA transcription, while increasing GSH alterations might persist for months after the initial infection. levels interfered with mRNA translation. In both cases, these al- Previous studies have shown the important role for metabolic terations may be mediated by altered levels of glutathionylation. pathways in the inflammatory response to pathogens. In this GSH Metabolism Is Altered in Patients with EM. To further validate study, we investigated which metabolic pathways are involved in our in vitro data, we performed metabolome analysis on serum the host response against Bb. Both our metabolome analysis on of patients with EM. First, pathway analysis was performed to monocytes and our analysis on serum samples from patients compare patients with EM to healthy controls. As shown in Fig. showed altered GSH metabolism after Bb infection. Specifically, 5A, the aminoacyl-tRNA biosynthesis pathway, involved in intracellular levels of reduced GSH were dramatically increased mRNA translation, was the most significantly affected pathway in Bb-stimulated monocytes. in EM patients. Next to this, arachidonic acid metabolism was Considering the antioxidative properties of GSH, it was in- found to be altered in these patients, in accordance with our teresting to find that stimulation with Bb lowered ROS generation monocyte metabolome data. Further supporting our monocyte in response to a secondary stimulus. Surprisingly, this dampen- metabolome data, GSH metabolism was among the top 10 most ing of the oxidative response appeared independent of GSH significantly affected pathways. In addition, cysteine metabolism levels. Nevertheless, this may have important implications as and methionine metabolism, both upstream from GSH metabo- ROS is an important component of the antimicrobial defense lism, were found in the top 10 most affected pathways. Taken and decreased ROS production might increase susceptibility to together, this suggests that our model of primary human mono- other pathogens. cytes exposed to Bb correlates very well to the circulating metab- Despite not affecting ROS generation, we found that modu- olome in vivo. lation of GSH metabolism substantially influenced the pro- Next, we compared patients with EM and healthy controls to duction of IL-1β and TNFα, two crucial innate cytokines. These patients with acute bacterial infection. Fig. 5B depicts the top findings are in accordance to a recent study by Diotallevi et al. 45 most differentially expressed metabolites between the four (17), who showed that GSH influences cell signaling and in- groups. Notably, one cluster was seen, indicated in blue, with flammation independent from its antioxidative properties. In- metabolites significantly increased in patients with Bb infection, terestingly, both inducing GSH synthesis and depleting GSH while remaining unchanged in patients with other infections. The strongly decreased cytokine production while moderate inhibi- top five metabolites in this cluster turned out to be γ-glutamyl tion increased cytokine production. Multiple studies have pre- amino acids (Fig. 5B, indicated by “¥”), breakdown products viously suggested a role for GSH levels in cytokine production from γ-glutamyl transpeptidase activity (GGT). This is again (18–20), yet the underlying mechanism has so far not completely supportive of our previous data as GGT is involved in the recy- been elucidated.

Kerstholt et al. PNAS Latest Articles | 5of9 Downloaded by guest on September 24, 2021 1 p-value A 3 Rank Pathway -log(p) Impact 52 4 2 (adjust) 5 Aminoacyl-tRNA 8 7 6 1 biosynthesis 26.2 2.68E-10 0.23

0 9 Arachidonic acid 2 10 2 metabolism 26.2 2.74E-10 0.23 3 Sulfur metabolism 25.7 4.21E-10 0.04 25.1 7.53E-10 0.01

51 4 Nitrogen metabolism )p(gol- 5 Thiamine metabolism 23.7 3.02E-09 0 D-Glutamine and D-

6 glutamate metabolism 21.3 3.48E-08 0.14 01 Ubiquinone and other terpenoid-quinone 7 biosynthesis 21.2 3.75E-08 0.12

5 Porphyrin and chlorophyll 8 metabolism 20.9 5.11E-08 0.03

Cysteine and 0 0.0 0.2 0.4 0.6 9 methionine metabolism 20.0 1.23E-07 0.54 Pathway impact 10 Glutathione metabolism 18.3 6.52E-07 0.05 B G-neg G-pos EM HC

Sphingomyelin(d18:1/20:0) Sphingomyelin(d18:1/22:1(13Z)) Sphingosine- 1 phosphate Sphinganine- 1 phosphate Stearoylcarni ne LysoPC(20:4(5Z,8Z,11Z,14Z)) Glycerophosphorylcholine 4E,15Z-Bilirubin IXa Bilirubin Oxalicacid PC(18:2(9Z,12Z)/18:3(9Z,12Z,15Z)) Alpha-tocopherol L-Glutamine beta-Cryptoxanthin L-Methionine # L-Asparagine 4-Hydroxyphenylpyruvicacid PE(P-16:0/18:1(9Z)) PE(P-18:0/18:2(9Z,12Z)) PE(P-16:0/18:2(9Z,12Z)) PC(P-16:0/20:4(5Z,8Z,11Z,14Z)) PE(O-18:1(1Z)/20:4(5Z,8Z,11Z,14Z)) PE(P-16:0/20:4(5Z,8Z,11Z,14Z)) Guanidoace cacid LysoPC(24:0) PC(18:2(9Z,12Z)/20:4(5Z,8Z,11Z,14Z)) Vitamin A 1,5-Anhydrosorbitol ᵞ-Glutamyl Glutamine PC(18:2(9Z,12Z)/18:2(9Z,12Z)) LysoPC(18:2(9Z,12Z)) 5-L-Glutamylglycine ¥ L-ᵞ - glutamyl-L-valine L-ᵞ -glutamyl-L-leucine Epsilon-ᵞ-Glutamyl-lysine ᵞ-Glutamylglutamicacid Cysteicacid Leukotriene B4 Caproicacid 5-HETE 5-KETE 7b-Hydroxycholesterol Isovalericacid Leukotriene B5 Valyl-Glutamine

Fig. 5. Metabolome analysis on serum samples of acute EM patients compared with other infections. (A) Scatter plot of KEGG metabolic pathways in serum samples from patients with erythema migrans (EM) (n = 10) versus healthy controls (HC) (n = 10), showing enrichment log(P) value (y axis) and pathway impact, determined by topological analysis (x axis). Node color is based on its P value, and the node size is based on pathway impact values. The top 10 most significantly affected metabolic pathways are included for reference. (B) Heat map depicting the top 50 most differentially regulated metabolites, determined by ANOVA, between acute EM patients (n = 10), patients with acute Gram-negative infection (G-neg, n = 5), patients with acute Gram-positive infection (G-pos, n = 5), and healthy controls (HC, n = 10). #, Fig. S1, metabolite 1; ¥, Fig. S1, metabolite 11.

To provide more insight into how GSH levels affect Bb- GSH to a protein as a posttranslational modification. Gluta- induced cytokine production, we examined the effect of GSH thionylation is increasingly being recognized as a modifica- modulators on cytokine mRNA levels and intracellular levels. tion with important functional consequences (22–24). A recent For TNFα, we found that altering GSH levels significantly af- proteomic analysis on potential targets of glutathionylation fected TNFA mRNA levels, in accordance to what was found by found a strong enrichment of proteins involved in RNA pro- Fratelli et al. (21). However, the mRNA levels could not fully cessing and translation (25). Alterations in the levels of gluta- account for the effect of the GSH modulators, indicating that part thionylation may therefore affect mRNA translation, thereby of the effect of GSH metabolism occurs posttranscriptionally. influencing protein synthesis. Alternatively, glutathionylation Elaborating on this, we found that modulation of GSH metabo- may affect TNFα release through peroxiredoxin-2, as shown by lism likely also affects translation of TNF mRNA into protein as Salzano et al. (26) intracellular protein levels were affected by the inhibitors in a Contrary to TNFα, GSH-mediated effects on IL-1β secretion similar fashion as secreted levels of TNFα. We hypothesize that appear to take place at the posttranslational level as intracellular this effect might be mediated by glutathionylation: the binding of levels of (pro)IL-1β were unaffected by GSH modulation. We

6of9 | www.pnas.org/cgi/doi/10.1073/pnas.1720833115 Kerstholt et al. Downloaded by guest on September 24, 2021 believe that glutathionylation may again play a role here as one antibody production against Bb although this will require further PNAS PLUS of the proteins found to be glutathionylated was caspase-1, an investigation. enzyme known to be crucial for cleaving pro-IL-1β into active IL- Taken together, these data show that infection with B. burg- 1β and subsequent secretion of the cytokine. Meissner et al. (27) dorferi strongly modulates GSH metabolism both in vitro and in showed that glutathionylation of caspase-1 was an inhibitory patients with EM. As we have shown that GSH metabolism plays modification as blockade of the GSH-binding sites significantly a crucial role in B. burgdorferi-induced cytokine production, increased IL-1β secretion. these findings provide more insight into the pathogenesis of To confirm the role for glutathionylation in TNFα and IL-1β Lyme disease and may help explain the variability in clinical signs production, we made use of an inhibitor of glutaredoxin-1. This and disease outcome. enzyme is involved in reversal of glutathionylation, and inhibition of glutaredoxin-1 is therefore used to increase levels of gluta- Methods thionylation (15). Importantly, we found that inducing gluta- Primary Human Monocytes. PBMCs were isolated from blood donated by thionylation inhibited cytokine production in a similar fashion as healthy male volunteers (n = 5) after written informed consent. Ethical ap- GSH modulation, affecting TNFα at the level of protein synthesis proval was obtained from the committee on research involving human subjects (CMO) Arnhem-Nijmegen (NL32357.091.10). and IL-1β at the posttranslational level. + CD14 monocytes were isolated from PBMCs by positive selection using + Taken together, these data suggest that modulation of GSH MACS CD14 magnetic beads (Miltenyi Biotec) according to the manufac- metabolism significantly affects secretion of cytokines, possibly turer’s instructions. Cells were resuspended in RPMI (RPMI medium 1640, no mediated by protein glutathionylation. As Bb exposure leads to a glucose; Thermo Fisher Scientific) supplemented with 5.5 mM glucose substantial increase in intracellular GSH levels, this might also (Sigma-Aldrich), 1 mM pyruvate (sodium pyruvate; Thermo Fisher Scientific), affect the levels of glutathionylation. In fact, induction of GSH 10% pooled human serum, 1% Hepes (Sigma), and 1% gentamycin and levels by Bb may be a mechanism to down-regulate TNFα pro- seeded in six-well plates (3 × 106 cells per well). Cells were left to adhere for duction as Bb is known to be a poor inducer of TNFα compared 30 min and stimulated as described. with other pathogenic stimuli (13). This is noteworthy as TNFα is known to be a central player in the pathogenesis of many in- Peripheral Blood Mononuclear Cells. PBMCs were isolated from buffy coats fections and inflammatory diseases (28). Indeed, inhibiting GSH from healthy volunteers obtained from the Sanquin blood bank after informed consent. All human experiments were conducted according to the significantly increased TNFα production while potentiating GSH α principles of the Declaration of Helsinki. The study was approved by the levels completely shut down TNF synthesis. In contrast, both Arnhem-Nijmegen ethical review board. Briefly, blood was diluted with β INFLAMMATION inhibition and induction of GSH negatively affected IL-1 pro- sterile PBS (1:1), and a density centrifugation was applied over Ficoll-Paque IMMUNOLOGY AND duction, suggesting that Bb induces GSH levels to an optimal (Pharmacia Biotech). Next, the interphase containing the PBMCs was col- level for IL-1β secretion. Accordingly, Bb is known to be a very lected and washed with ice-cold PBS, and cells were resuspended in medium potent inducer of IL-1β, and this cytokine is known to be an im- (RPMI 1640, without glucose, without glutamine; MP Biomedicals) supple- portant driving force in Lyme arthritis (29, 30). Taken together, this mented with 5.5 mM D-glucose (Sigma-Aldrich), 0.2 mM glutamine (gluta- suggests that Bb-induced changes in GSH metabolism might play a MAX; Thermo Fisher Scientific), and 0.1 mM pyruvate, 1% Hepes, and 1% gentamycin. role in skewing the cytokine profile from TNFα toward IL-1β. Next to our in vitro data, we found evidence for specific al- B. burgdorferi Spirochetes. B. burgdorferi, ATCC strain 35210 [American Type terations in GSH metabolism in patients with a Bb infection. Culture Collection (ATCC)] was cultured at 24 °C in Barbour–Stoenner–Kelley Metabolome analysis showed increased levels of metabolites (BSK)-H medium (Sigma-Aldrich) supplemented with 6% rabbit serum until related to GSH metabolism in serum of patients with EM spirochete growth commenced. Cells were then grown at 34 °C to late compared with both healthy controls and patients with other logarithmic phase, at which point the spirochetes were checked for motility infections. Supporting this, transcriptome data showed sub- by dark-field microscopy and harvested. Spirochetes were quantified using a stantial and long-lasting changes in mRNA expression for GSH- Petroff–Hauser counting chamber, washed with PBS, and stored at −80 °C. related genes in PBMCs from patients with EM compared with healthy controls. Noteworthy, one of the genes most significantly Serum Sample Patients. Serum samples were obtained from patients at the affected in patients with EM, was GGT1, encoding γ-glutamyl University Hospital of Infectious Diseases, Cluj-Napoca, Romania. The study protocol was approved by the local medical ethics committee of the Uni- transpeptidase (GGT). This corresponded well to our data as we γ versity Hospital of Infectious Diseases, Cluj-Napoca (2013/01). Written in- found increased levels of GGT breakdown products, -glutamyl formed consent was obtained from all participants. Patients with EM (n = 10) amino acids, in serum of patients with EM. Serum GGT levels were clinically diagnosed by an infectious disease specialist and confirmed by are regularly measured as a marker of liver function and have an independent Lyme disease expert. Serum samples were taken before also been studied in patients with EM although increased GGT onset of treatment. For comparison, patients with acute bacterial sepsis (n = levels were only found in a minority of cases (31). However, 10) from the same center were included, as well as healthy controls (n = 10). standard GGT measurements only account for excreted enzyme while GGT is mainly membrane-bound (32). Therefore, we hy- Metabolome Analysis. For the primary monocyte analysis, cells were stimu- = pothesize that the elevated levels of γ-glutamyl amino acids in lated for 24 h with B. burgdorferi [multiplicity of infection (MOI) 0.05] or medium control. After incubation, cell-free supernatants were collected, and serum of patients with EM are due to increased activity of cells were scraped and spun down, and dry pellets were snap frozen and membrane-bound GGT. Taken together, these findings point to- stored at −80 °C. Serum samples were stored at −20 °C before analysis. ward an important role for GGT in the response to Bb infection. Metabolomic analysis was performed by Metabolon Inc. In short, proteins Our data suggesting an important role for GSH metabolism in were precipitated with methanol, and the resulting extract was divided into Bb infection are supported by several previous studies. Recently, five fractions: two for analysis by two separate reverse phase (RP)/ultra- Casselli et al. (33) reported two GST genes (GSTT1 and GSTM1) performance liquid chromatography (UPLC)-tandem mass spectrometry to be among the most significantly affected genes after Bb expo- (MS/MS) methods with positive ion mode electrospray ionization (ESI), one sure in primary human astrocytes. Next to this, a recent genome- for analysis by RP/UPLC-MS/MS with negative ion mode ESI, one for analy- wide association study (GWAS) found a genetic variant in MAT2B sis by hydrophilic interaction chromatography (HILIC)/UPLC-MS/MS with associated to Bb seropositivity (34). MAT2B encodes for the negative ion mode ESI, and one sample reserved for backup. Briefly, samples were placed on a TurboVap (Zymark) to remove the organic solvent. All regulatory subunit of MAT2A, one of the upstream enzymes in methods utilized Waters ACQUITY ultra-performance liquid chromatogra- GSH metabolism. In our study, we found gene expression of phy (UPLC) and a Thermo Scientific Q-Exactive high resolution/accurate MAT2A to be affected by Bb infection in PBMCs of patients with mass spectrometer interfaced with a heated electrospray ionization (HESI-II) EM. This suggests that GSH metabolism may also play a role in source and Orbitrap mass analyzer operated at 35,000 mass resolution. The

Kerstholt et al. PNAS Latest Articles | 7of9 Downloaded by guest on September 24, 2021 sample extract was dried and then reconstituted in solvents compatible to instructions. Isolated RNA was checked for purity and transcribed using an each of the four methods. One aliquot was analyzed using acidic positive ion iScript cDNA Synthesis Kit (Bio-Rad). For quantitative polymerase chain conditions, chromatographically optimized for more hydrophilic compounds. reaction (qPCR), Power Sybr Green PCR Master Mix (Applied Biosystems) The second aliquot was also analyzed using acidic positive ion conditions; was used with a 7300 Real-time PCR system (Applied Biosystems). Primers however, it was chromatographically optimized for more hydrophobic com- used were as follows: B2M (housekeeping gene) [forward (Fw): ATGAG- pounds. The third aliquot was analyzed using basic negative ion optimized TATGCCTGCCGTGTG, reverse (Rv): CCAAATGCGGCATCTTCAAAC], IL1B (Fw: conditions using a separate dedicated C18 column. The fourth aliquot was GCCCTAAACAGATGAAGTGCTC, Rv: GAACCAGCATCTTCCTCAG), and TNF analyzed via negative ionization following elution from a HILIC column (Waters (Fw: GAGGCCAAGCCCTGGTATG, Rv: CGGGCCGATTGATCTCAGC). UPLC BEH Amide 2.1 × 150 mm, 1.7 μm) using a gradient consisting of water and acetonitrile with 10 mM ammonium formate, pH 10.8. Raw data were Transcriptome Analysis. Previously published RNA sequencing data of PBMCs extracted, peak-identified, and quality control processed using Metabolon’s from patients (n = 29) with EM and healthy controls (n = 13) (16) were hardware and software. Compounds were identified by comparison with library obtained from the publicly available National Center for Biotechnology entries of purified standards or recurrent unknown entities. Peaks were Information (NCBI) Gene Expression Omnibus (GEO) database (accession quantified using area-under-the-curve values, which were rescaled to the me- number GSE63085). Expression of selected genes was compared between EM dian and normalized by Bradford protein concentration. Missing values were patients at different time points and healthy controls by Kruskal–Wallis one- imputed with the minimum. way ANOVA with Dunn’s post hoc test using R Software for Statistical Computing, version 3.2.4. Stimulation Experiments. For measurements of cytokines and metabolic parameters, cells were seeded in duplicate in round-bottom 96-well plates (5 × 105 cells per well). Cells were pretreated with one of the following inhibi- Analysis of Metabolome Data. Pathway analysis and statistical analysis were performed using Metaboanalyst 3.0 (33) on 332 metabolites (monocytes) or tors: 3-deazaneplanocin A (Cayman Chemical), DL-buthionine-sulfoximine (Sigma), di-ethyl maleate (Sigma), N-acetyl cysteine (Sigma), mercapto- 638 metabolites (serum samples) with available Human Metabolome Data- succinic acid (Sigma), OU749 (Cayman Chemical), 2-AAPA hydrate (Sigma), or base (HMDB) identifiers. For pathway analysis, metabolites were mapped to vehicle control [i.e., RPMI or dimethyl sulfoxide (DMSO) (WAK-Chemie Kyoto Encyclopedia of Genes and Genomes (KEGG) metabolic pathways, and Medical GmbH)] for 1 h and then stimulated with B. burgdorferi for 24 h, quantitative pathway enrichment and pathway topology analysis were unless otherwise indicated. After incubation, plates were spun down, and performed. For comparison of Bb-induced metabolic changes to metabolic cell-free supernatants were collected and stored at −20 °C until assayed. For changes induced by other TLR-ligands, a parallel dataset of primary mono- intracellular cytokine measurements, cells were lysed in 0.5% Triton-X (20 μL cytes stimulated with LPS and Pam3Cys was used (34). Samples were acquired per well), and lysates were stored at −20 °C until assayed. in an identical manner, and sample analysis was performed simultaneously. For all conditions, fold changes in metabolite levels relative to untreated control Measurement of Reactive Oxygen Species. Generation of reactive oxygen (RPMI) were calculated. Further statistical details can be found in the appro- species by PBMCs was measured using a luminol-based chemiluminescent priate figure legends. assay. Briefly, PBMCs were collected after stimulation and added in sixfold to a white 96-well plate (1 × 105 cells per well). ROS production was induced in Statistics. Statistics for measurements of cytokines and metabolic parameters four wells by the addition of 3 mg/mL serum-opsonized zymosan in HBSS; were performed using GraphPad Prism version 5.03 for Windows (GraphPad the two remaining wells served as controls. Luminol (10 mM), which was Software). Data represent mean ± SEM of n different donors. Unless otherwise added to all wells, is oxidized by ROS to produce the luminescent in- stated, means were compared using the nonparametric Wilcoxon matched- termediate luminophore. Luminescence, correlating to total ROS production pairs signed ranks test, with two-tailed significance level set as P > 0.05. Fur- (both intra- and extracellular), was measured continuously at 425 nM for 1 h ther statistical details can be found in the appropriate figure legends. using an Infinite 200 PRO microplate reader (Tecan). Data Availability. The metabolome data in this paper have been deposited in the Cytokine Measurements. Cytokine concentrations in cell culture supernatants publicly available MetaboLights database (https://www.ebi.ac.uk/metabolights/, β were measured by sandwich ELISA using commercial kits specific for IL-1 and accession no. MTBLS625). TNFα (R&D Systems) according to the manufacturer’s instructions. Cell lysates were spun down before measuring to remove insoluble material. Absor- ACKNOWLEDGMENTS. We thank Carla Bartels (Medical Microbiology De- bance was measured using an Infinite 200 PRO microplate reader (Tecan). partment, Radboudumc) for culturing Bb spirochetes. M.G.N. was supported by a Spinoza Grant of the Netherlands Organization for Scientific Research mRNA Isolation and RT-PCR. After stimulation, cells were lysed and homogenized and a Competitiveness Operational Programme Grant from the Romanian inTRIzol(ThermoFischer),andRNAwasisolatedaccordingtothemanufacturer’s Ministry of European Funds (FUSE).

1. Rizzoli A, et al. (2011) Lyme borreliosis in Europe. Euro Surveill 16:19906. 15. Sadhu SS, Callegari E, Zhao Y, Guan X, Seefeldt T (2013) Evaluation of a di- 2. Bacon RM, Kugeler KJ, Mead PS; Centers for Disease Control and Prevention (CDC) (2008) thiocarbamate derivative as an inhibitor of human glutaredoxin-1. J Enzyme Inhib Surveillance for Lyme disease–United States, 1992-2006. MMWR Surveill Summ 57:1–9. Med Chem 28:456–462. 3. Weinstein A, Britchkov M (2002) Lyme arthritis and post-Lyme disease syndrome. Curr 16. Bouquet J, et al. (2016) Longitudinal transcriptome analysis reveals a sustained dif- Opin Rheumatol 14:383–387. ferential gene expression signature in patients treated for acute Lyme disease. MBio 4. Sigal LH (1995) Early disseminated Lyme disease: Cardiac manifestations. Am J Med 7:e00100-16. – – 98:25S 28S, discussion 28S 29S. 17. Diotallevi M, et al. (2017) Glutathione fine-tunes the innate immune response toward 5. Pachner AR, Steiner I (2007) Lyme neuroborreliosis: Infection, immunity, and in- antiviral pathways in a macrophage cell line independently of its antioxidant prop- flammation. Lancet Neurol 6:544–552. erties. Front Immunol 8:1239. 6. Cairns V, Godwin J (2005) Post-Lyme borreliosis syndrome: A meta-analysis of re- 18. Peristeris P, et al. (1992) N-acetylcysteine and glutathione as inhibitors of tumor ne- ported symptoms. Int J Epidemiol 34:1340–1345. crosis factor production. Cell Immunol 140:390–399. 7. Berende A, et al. (2016) Randomized trial of longer-term therapy for symptoms at- 19. Haddad JJ, Harb HL (2005) L-γ-Glutamyl-L-cysteinyl-glycine (glutathione; GSH) and tributed to Lyme disease. N Engl J Med 374:1209–1220. GSH-related enzymes in the regulation of pro- and anti-inflammatory cytokines: A 8. Barbour AG, Hayes SF (1986) Biology of Borrelia species. Microbiol Rev 50:381–400. signaling transcriptional scenario for redox(y) immunologic sensor(s)? Mol Immunol 9. Steere AC, et al. (2006) Antibiotic-refractory Lyme arthritis is associated with HLA-DR – molecules that bind a Borrelia burgdorferi peptide. J Exp Med 203:961–971. 42:987 1014. 10. Carlson D, et al. (1999) Lack of Borrelia burgdorferi DNA in synovial samples from 20. Brigelius-Flohé R, Banning A, Kny M, Böl G-F (2004) Redox events in interleukin- – patients with antibiotic treatment-resistant Lyme arthritis. Arthritis Rheum 42: 1 signaling. Arch Biochem Biophys 423:66 73. 2705–2709. 21. Fratelli M, et al. (2005) Gene expression profiling reveals a signaling role of gluta- – 11. von Lackum K, Stevenson B (2005) Carbohydrate utilization by the Lyme borreliosis thione in redox regulation. Proc Natl Acad Sci USA 102:13998 14003. spirochete, Borrelia burgdorferi. FEMS Microbiol Lett 243:173–179. 22. Fratelli M, et al. (2002) Identification by redox proteomics of glutathionylated pro- 12. Fraser CM, et al. (1997) Genomic sequence of a Lyme disease spirochaete, Borrelia teins in oxidatively stressed human T lymphocytes. Proc Natl Acad Sci USA 99: burgdorferi. Nature 390:580–586. 3505–3510. 13. Oosting M, et al. (2016) Functional and genomic architecture of Borrelia burgdorferi- 23. Lim SY, Raftery MJ, Goyette J, Geczy CL (2010) S-glutathionylation regulates in- induced cytokine responses in humans. Cell Host Microbe 20:822–833. flammatory activities of S100A9. J Biol Chem 285:14377–14388. 14. Itoh K, et al. (1999) Keap1 represses nuclear activation of antioxidant responsive elements 24. Shelton MD, Mieyal JJ (2008) Regulation by reversible S-glutathionylation: Molecular by Nrf2 through binding to the amino-terminal Neh2 domain. Genes Dev 13:76–86. targets implicated in inflammatory diseases. Mol Cells 25:332–346.

8of9 | www.pnas.org/cgi/doi/10.1073/pnas.1720833115 Kerstholt et al. Downloaded by guest on September 24, 2021 25. Samarasinghe KT, et al. (2016) A clickable glutathione approach for identification of 30. Miller LC, et al. (1993) Balance of synovial fluid IL-1 β and IL-1 receptor antagonist and PNAS PLUS protein glutathionylation in response to glucose metabolism. Mol Biosyst 12:2471–2480. recovery from Lyme arthritis. Lancet 341:146–148. 26. Salzano S, et al. (2014) Linkage of inflammation and oxidative stress via release of 31. Horowitz HW, et al. (1996) Liver function in early Lyme disease. Hepatology 23: glutathionylated peroxiredoxin-2, which acts as a danger signal. Proc Natl Acad Sci 1412–1417. USA 111:12157–12162. 32. Tate SS, Meister A (1981) γ-Glutamyl transpeptidase: Catalytic, structural and func- 27. Meissner F, Molawi K, Zychlinsky A (2008) Superoxide dismutase 1 regulates caspase- tional aspects. Mol Cell Biochem 39:357–368. 1 and endotoxic shock. Nat Immunol 9:866–872. 33. Casselli T, et al. (2017) MicroRNA and mRNA transcriptome profiling in primary hu- 28. Bradley JR (2008) TNF-mediated inflammatory disease. J Pathol 214:149–160. man astrocytes infected with Borrelia burgdorferi. PLoS One 12:e0170961. 29. Oosting M, et al. (2012) Murine Borrelia arthritis is highly dependent on ASC and 34. Hammer C, et al. (2015) A coding variant of ANO10, affecting volume regulation of caspase-1, but independent of NLRP3. Arthritis Res Ther 14:R247. macrophages, is associated with Borrelia seropositivity. Mol Med 21:26–37. INFLAMMATION IMMUNOLOGY AND

Kerstholt et al. PNAS Latest Articles | 9of9 Downloaded by guest on September 24, 2021