DCP1B Mouse Monoclonal Antibody [Clone ID: OTI1G4] Product Data

Total Page:16

File Type:pdf, Size:1020Kb

Load more

OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for TA809930 DCP1B Mouse Monoclonal Antibody [Clone ID: OTI1G4] Product data: Product Type: Primary Antibodies Clone Name: OTI1G4 Applications: WB Recommended Dilution: WB 1:500~2000 Reactivity: Human Host: Mouse Isotype: IgG1 Clonality: Monoclonal Immunogen: Human recombinant protein fragment corresponding to amino acids 167-473 of human DCP1B(NP_689853) produced in E.coli. Formulation: PBS (PH 7.3) containing 1% BSA, 50% glycerol and 0.02% sodium azide. Concentration: 1 mg/ml Purification: Purified from mouse ascites fluids or tissue culture supernatant by affinity chromatography (protein A/G) Conjugation: Unconjugated Storage: Store at -20°C as received. Stability: Stable for 12 months from date of receipt. Predicted Protein Size: 67.5 kDa Gene Name: decapping mRNA 1B Database Link: NP_689853 Entrez Gene 196513 Human Q8IZD4 Background: DCP1B is a core component of the mRNA decapping complex, a key factor in the regulation of mRNA decay (Lykke-Andersen, 2002 [PubMed 12417715]). [supplied by OMIM, Mar 2008]. ##Evidence-Data-START## Transcript exon combination :: AY146652.1, AK056200.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support ERS025081, ERS025082 [ECO:0000350] ##Evidence-Data-END## This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 2 DCP1B Mouse Monoclonal Antibody [Clone ID: OTI1G4] – TA809930 Synonyms: DCP1 Protein Pathways: RNA degradation Product images: HEK293T cells were transfected with the pCMV6- ENTRY control (Left lane) or pCMV6-ENTRY DCP1B ([RC207398], Right lane) cDNA for 48 hrs and lysed. Equivalent amounts of cell lysates (5 ug per lane) were separated by SDS-PAGE and immunoblotted with anti-DCP1B (1:2000). Positive lysates [LY407370] (100ug) and [LC407370] (20ug) can be purchased separately from OriGene. Western blot analysis of extracts (35ug) from 3 different cell lines by using anti-DCP1B monoclonal antibody (1:500). This product is to be used for laboratory only. Not for diagnostic or therapeutic use. ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 2 / 2.
Recommended publications
  • IP6K1 Upregulates the Formation of Processing Bodies by Promoting Proteome Remodeling on the Mrna Cap

    IP6K1 Upregulates the Formation of Processing Bodies by Promoting Proteome Remodeling on the Mrna Cap

    bioRxiv preprint doi: https://doi.org/10.1101/2020.07.13.199828; this version posted July 13, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. IP6K1 upregulates the formation of processing bodies by promoting proteome remodeling on the mRNA cap Akruti Shah1,2 and Rashna Bhandari1* 1Laboratory of Cell Signalling, Centre for DNA Fingerprinting and Diagnostics (CDFD), Inner Ring Road, Uppal, Hyderabad 500039, India. 2Graduate studies, Manipal Academy of Higher Education, Manipal 576104, India. *Correspondence to Rashna Bhandari; Email: [email protected] Running title: IP6K1 promotes mRNA turnover to induce P-bodies ORCID IDs Akruti Shah - 0000-0001-9557-4952 Rashna Bhandari - 0000-0003-3101-0204 This PDF file includes: Main Text Figures 1 to 6 Keywords mRNA decay/mRNA metabolism/P-bodies/translation suppression 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.07.13.199828; this version posted July 13, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Abstract Inositol hexakisphosphate kinases (IP6Ks) are ubiquitously expressed small molecule kinases that catalyze the conversion of the inositol phosphate IP6 to 5-IP7. IP6Ks have been reported to influence cellular functions by protein-protein interactions independent of their enzymatic activity.
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
  • Primepcr™Assay Validation Report

    Primepcr™Assay Validation Report

    PrimePCR™Assay Validation Report Gene Information Gene Name DCP1 decapping enzyme homolog A (S. cerevisiae) Gene Symbol Dcp1a Organism Mouse Gene Summary Description Not Available Gene Aliases 1110066A22Rik, 4930568L04Rik, AU019772, D14Ertd817e, Mitc1, SMIF RefSeq Accession No. NC_000080.6, NT_039606.8 UniGene ID Mm.28733 Ensembl Gene ID ENSMUSG00000021962 Entrez Gene ID 75901 Assay Information Unique Assay ID qMmuCID0013841 Assay Type SYBR® Green Detected Coding Transcript(s) ENSMUST00000022535 Amplicon Context Sequence TAATCTGGGAAGCACCGAGACTCTAGAAGAGACACCCTCTGGGTCACAGGATAA GTCTGCTCCGTCTGGTCATAAACATCTGACAGTAGAAGAGTTATTTGGAACCTCC TTGCCAAAGGAA Amplicon Length (bp) 91 Chromosome Location 14:30513043-30518984 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 98 R2 0.9997 cDNA Cq 22.41 cDNA Tm (Celsius) 81 gDNA Cq 24.87 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report Dcp1a, Mouse Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Mouse Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect.
  • Exon Amplification: a Strategy to Isolate Mammalian Genes Based on RNA Splicing (Gene Cloning/Polymerase Chain Reaction) ALAN J

    Exon Amplification: a Strategy to Isolate Mammalian Genes Based on RNA Splicing (Gene Cloning/Polymerase Chain Reaction) ALAN J

    Proc. Natl. Acad. Sci. USA Vol. 88, pp. 4005-4009, May 1991 Genetics Exon amplification: A strategy to isolate mammalian genes based on RNA splicing (gene cloning/polymerase chain reaction) ALAN J. BUCKLER*, DAVID D. CHANG, SHARON L. GRAw, J. DAVID BROOK, DANIEL A. HABER, PHILLIP A. SHARP, AND DAVID E. HOUSMAN Center for Cancer Research, Department of Biology, Massachusetts Institute of Technology, Cambridge, MA 02139 Contributed by Phillip A. Sharp, January 25, 1991 ABSTRACT We have developed a method, exon amplifi- (7, 8). Thus, this method may be generally applicable for the cation, for fast and efficient isolation of coding sequences from selection of exon sequences from any gene. The method is complex mammalian genomic DNA. This method is based on also both rapid and easily adapted to large scale experiments. the selection of RNA sequences, exons, which are flanked by A series of cloned genomic DNA fragments can be screened functional 5' and 3' splice sites. Fragments of cloned genomic within 1-2 weeks. The sensitivity of this method is high. DNA are inserted into an intron, which is flanked by 5' and 3' Genomic DNA segments of 20 kilobases (kb) or more can be splice sites of the human immunodeficiency virus 1 tat gene successfully screened in a single transfection by using a set contained within the plasmid pSPL1. COS-7 cells are trans- of pooled subclones. This method thus allows the rapid fected with these constructs, and the resulting RNA transcripts identification of exons in mammalian genomic DNA and are processed in vivo. Splice sites of exons contained within the should facilitate the isolation of a wide spectrum of genes of inserted genomic fragment are paired with splice sites of the significance in physiology and development.
  • Mrna Turnover Philip Mitchell* and David Tollervey†

    Mrna Turnover Philip Mitchell* and David Tollervey†

    320 mRNA turnover Philip Mitchell* and David Tollervey† Nuclear RNA-binding proteins can record pre-mRNA are cotransported to the cytoplasm with the mRNP. These processing events in the structure of messenger proteins may preserve a record of the nuclear history of the ribonucleoprotein particles (mRNPs). During initial rounds of pre-mRNA in the cytoplasmic mRNP structure. This infor- translation, the mature mRNP structure is established and is mation can strongly influence the cytoplasmic fate of the monitored by mRNA surveillance systems. Competition for the mRNA and is used by mRNA surveillance systems that act cap structure links translation and subsequent mRNA as a checkpoint of mRNP integrity, particularly in the identi- degradation, which may also involve multiple deadenylases. fication of premature translation termination codons (PTCs). Addresses Cotransport of nuclear mRNA-binding proteins with mRNA Wellcome Trust Centre for Cell Biology, ICMB, University of Edinburgh, from the nucleus to the cytoplasm (nucleocytoplasmic shut- Kings’ Buildings, Edinburgh EH9 3JR, UK tling) was first observed for the heterogeneous nuclear *e-mail: [email protected] ribonucleoprotein (hnRNP) proteins. Some hnRNP proteins †e-mail: [email protected] are stripped from the mRNA at export [1], but hnRNP A1, Current Opinion in Cell Biology 2001, 13:320–325 A2, E, I and K are all exported (see [2]). Although roles for 0955-0674/01/$ — see front matter these hnRNP proteins in transport and translation have been © 2001 Elsevier Science Ltd. All rights reserved. reported [3•,4•], their affects on mRNA stability have been little studied. More is known about hnRNP D/AUF1 and Abbreviations AREs AU-rich sequence elements another nuclear RNA-binding protein, HuR, which act CBC cap-binding complex antagonistically to modulate the stability of a range of DAN deadenylating nuclease mRNAs containing AU-rich sequence elements (AREs) DSEs downstream sequence elements (reviewed in [2]).
  • Supplemental Information

    Supplemental Information

    Supplemental information Dissection of the genomic structure of the miR-183/96/182 gene. Previously, we showed that the miR-183/96/182 cluster is an intergenic miRNA cluster, located in a ~60-kb interval between the genes encoding nuclear respiratory factor-1 (Nrf1) and ubiquitin-conjugating enzyme E2H (Ube2h) on mouse chr6qA3.3 (1). To start to uncover the genomic structure of the miR- 183/96/182 gene, we first studied genomic features around miR-183/96/182 in the UCSC genome browser (http://genome.UCSC.edu/), and identified two CpG islands 3.4-6.5 kb 5’ of pre-miR-183, the most 5’ miRNA of the cluster (Fig. 1A; Fig. S1 and Seq. S1). A cDNA clone, AK044220, located at 3.2-4.6 kb 5’ to pre-miR-183, encompasses the second CpG island (Fig. 1A; Fig. S1). We hypothesized that this cDNA clone was derived from 5’ exon(s) of the primary transcript of the miR-183/96/182 gene, as CpG islands are often associated with promoters (2). Supporting this hypothesis, multiple expressed sequences detected by gene-trap clones, including clone D016D06 (3, 4), were co-localized with the cDNA clone AK044220 (Fig. 1A; Fig. S1). Clone D016D06, deposited by the German GeneTrap Consortium (GGTC) (http://tikus.gsf.de) (3, 4), was derived from insertion of a retroviral construct, rFlpROSAβgeo in 129S2 ES cells (Fig. 1A and C). The rFlpROSAβgeo construct carries a promoterless reporter gene, the β−geo cassette - an in-frame fusion of the β-galactosidase and neomycin resistance (Neor) gene (5), with a splicing acceptor (SA) immediately upstream, and a polyA signal downstream of the β−geo cassette (Fig.
  • Sequences at the Exon-Intron Boundaries* (Split Gene/Mrna Splicing/Eukaryotic Gene Structure) R

    Sequences at the Exon-Intron Boundaries* (Split Gene/Mrna Splicing/Eukaryotic Gene Structure) R

    Proc. Nati. Acad. Sci. USA Vol. 75, No. 10, pp. 4853-4857, October 1978 Biochemistry Ovalbumin gene: Evidence for a leader sequence in mRNA and DNA sequences at the exon-intron boundaries* (split gene/mRNA splicing/eukaryotic gene structure) R. BREATHNACH, C. BENOIST, K. O'HARE, F. GANNON, AND P. CHAMBON Laboratoire de Genetique Mol6culaire des Eucaryotes du Centre National de la Recherche Scientifique, Unite 44 de l'Institut National de la Sant6 et de la Recherche MWdicale, Institut de Chimie Biologique, Facult6 de Melecine, Strasbourg 67085, France Communicated by A. Frey-Wyssling, July 31, 1978 ABSTRACT Selected regions of cloned EcoRI fragments the 5' end of ov-mRNA and have revealed some interesting of the chicken ovalbumin gene have been sequenced. The po- features in the DNA sequences at exon-intron boundaries. sitions where the sequences coding for ovalbumin mRNA (ov- mRNA) are interrupted in the genome have been determined, and a previously unreported interruption in the DNA sequences MATERIALS AND METHODS coding for the 5' nontranslated region of the messenger has been discovered. Because directly repeated sequences are found at Plasmid pCR1 ov 2.1 containing the ov-ds-cDNA insert was exon-intron boundaries, the nucleotide sequence alone cannot prepared as described (9). EcoRI fragments "b," "c," and "d" define unique excision-ligation points for the processing of a previously cloned in X vectors (3) were transferred to the plas- possible ov-mRNA precursor. However, the sequences in these mid pBR 322. An EcoRI/HindIII of the EcoRI boundary regions share common features; this leads to the fragment proposal that there are, in fact, unique excision-ligation points fragment "a" containing the entirety of exon 7 (Fig.
  • Comprehensive Protein Interactome Analysis of a Key RNA Helicase: Detection of Novel Stress Granule Proteins

    Comprehensive Protein Interactome Analysis of a Key RNA Helicase: Detection of Novel Stress Granule Proteins

    Biomolecules 2015, 5, 1441-1466; doi:10.3390/biom5031441 OPEN ACCESS biomolecules ISSN 2218-273X www.mdpi.com/journal/biomolecules/ Article Comprehensive Protein Interactome Analysis of a Key RNA Helicase: Detection of Novel Stress Granule Proteins Rebecca Bish 1,†, Nerea Cuevas-Polo 1,†, Zhe Cheng 1, Dolores Hambardzumyan 2, Mathias Munschauer 3, Markus Landthaler 3 and Christine Vogel 1,* 1 Center for Genomics and Systems Biology, Department of Biology, New York University, 12 Waverly Place, New York, NY 10003, USA; E-Mails: [email protected] (R.B.); [email protected] (N.C.-P.); [email protected] (Z.C.) 2 The Cleveland Clinic, Department of Neurosciences, Lerner Research Institute, 9500 Euclid Avenue, Cleveland, OH 44195, USA; E-Mail: [email protected] 3 RNA Biology and Post-Transcriptional Regulation, Max-Delbrück-Center for Molecular Medicine, Berlin-Buch, Robert-Rössle-Str. 10, Berlin 13092, Germany; E-Mails: [email protected] (M.M.); [email protected] (M.L.) † These authors contributed equally to this work. * Author to whom correspondence should be addressed; E-Mail: [email protected]; Tel.: +1-212-998-3976; Fax: +1-212-995-4015. Academic Editor: André P. Gerber Received: 10 May 2015 / Accepted: 15 June 2015 / Published: 15 July 2015 Abstract: DDX6 (p54/RCK) is a human RNA helicase with central roles in mRNA decay and translation repression. To help our understanding of how DDX6 performs these multiple functions, we conducted the first unbiased, large-scale study to map the DDX6-centric protein-protein interactome using immunoprecipitation and mass spectrometry. Using DDX6 as bait, we identify a high-confidence and high-quality set of protein interaction partners which are enriched for functions in RNA metabolism and ribosomal proteins.
  • Nuclear PTEN Safeguards Pre-Mrna Splicing to Link Golgi Apparatus for Its Tumor Suppressive Role

    Nuclear PTEN Safeguards Pre-Mrna Splicing to Link Golgi Apparatus for Its Tumor Suppressive Role

    ARTICLE DOI: 10.1038/s41467-018-04760-1 OPEN Nuclear PTEN safeguards pre-mRNA splicing to link Golgi apparatus for its tumor suppressive role Shao-Ming Shen1, Yan Ji2, Cheng Zhang1, Shuang-Shu Dong2, Shuo Yang1, Zhong Xiong1, Meng-Kai Ge1, Yun Yu1, Li Xia1, Meng Guo1, Jin-Ke Cheng3, Jun-Ling Liu1,3, Jian-Xiu Yu1,3 & Guo-Qiang Chen1 Dysregulation of pre-mRNA alternative splicing (AS) is closely associated with cancers. However, the relationships between the AS and classic oncogenes/tumor suppressors are 1234567890():,; largely unknown. Here we show that the deletion of tumor suppressor PTEN alters pre-mRNA splicing in a phosphatase-independent manner, and identify 262 PTEN-regulated AS events in 293T cells by RNA sequencing, which are associated with significant worse outcome of cancer patients. Based on these findings, we report that nuclear PTEN interacts with the splicing machinery, spliceosome, to regulate its assembly and pre-mRNA splicing. We also identify a new exon 2b in GOLGA2 transcript and the exon exclusion contributes to PTEN knockdown-induced tumorigenesis by promoting dramatic Golgi extension and secretion, and PTEN depletion significantly sensitizes cancer cells to secretion inhibitors brefeldin A and golgicide A. Our results suggest that Golgi secretion inhibitors alone or in combination with PI3K/Akt kinase inhibitors may be therapeutically useful for PTEN-deficient cancers. 1 Department of Pathophysiology, Key Laboratory of Cell Differentiation and Apoptosis of Chinese Ministry of Education, Shanghai Jiao Tong University School of Medicine (SJTU-SM), Shanghai 200025, China. 2 Institute of Health Sciences, Shanghai Institutes for Biological Sciences of Chinese Academy of Sciences and SJTU-SM, Shanghai 200025, China.
  • Investigation of RNA Quality Control Pathways in RNP Hypo-Assembly

    Investigation of RNA Quality Control Pathways in RNP Hypo-Assembly

    Investigation of RNA quality control pathways in RNP hypo-assembly diseases by Siddharth Shukla Integrated M.Sc., Indian Institute of Technology Bombay, 2011 A thesis submitted to the Faculty of the Graduate School of the University of Colorado in partial fulfillment of the requirement for the degree of Doctor of Philosophy Department of Chemistry and Biochemistry 2016 i This thesis entitled: Investigation of RNA quality control pathways in RNP hypo-assembly diseases written by Siddharth Shukla has been approved for the Department of Chemistry and Biochemistry ________________________________ Roy Parker ________________________________ James Goodrich Date ___________ The final copy of this thesis has been examined by the signatories, and we find that both the content and the form meet acceptable presentation standards of scholarly work in the above mentioned discipline. ii Shukla, Siddharth (Ph.D., Biochemistry) Investigation of RNA quality control pathways in RNP hypo-assembly diseases Thesis directed by Professor Roy Parker A key aspect of cellular function is the proper assembly and utilization of ribonucleoproteins (RNPs). Defects in the formation of RNPs lead to "RNP hypo- assembly diseases", which can be caused by RNA degradation out-competing RNP assembly. Examples of such human diseases include Dyskeratosis Congenita (DC) and Spinal Muscular Atrophy (SMA). In order to test the hypothesis that specific RNA quality control pathways were responsible for degradation of RNAs in these diseases, I used yeast and mammalian cell lines as model systems to investigate two different diseases, SMA and DC. In SMA, Sm-site mutations in yeast U1 snRNA led to their rapid degradation by two different RNA decay pathways: 3’ to 5’ decay in the nucleus by Trf4/Rrp6, and 5’ to 3’ decay in the cytoplasm by Dcp2/Xrn1.
  • Deep Sequencing of Subcellular RNA Fractions Shows Splicing to Be Predominantly Co-Transcriptional in the Human Genome but Inefficient for Lncrnas

    Deep Sequencing of Subcellular RNA Fractions Shows Splicing to Be Predominantly Co-Transcriptional in the Human Genome but Inefficient for Lncrnas

    Research Deep sequencing of subcellular RNA fractions shows splicing to be predominantly co-transcriptional in the human genome but inefficient for lncRNAs Hagen Tilgner,1,3 David G. Knowles,1 Rory Johnson,1 Carrie A. Davis,2 Sudipto Chakrabortty,2 Sarah Djebali,1 Joao~ Curado,1 Michael Snyder,3 Thomas R. Gingeras,2 and Roderic Guigo´ 1,4 1Centre for Genomic Regulation (CRG) and UPF, E-08003, Barcelona, Catalonia, Spain; 2Cold Spring Harbor Laboratory, Cold Spring Harbor, New York 11724, USA; 3Department of Genetics, Stanford University School of Medicine, Stanford, California 94305, USA Splicing remains an incompletely understood process. Recent findings suggest that chromatin structure participates in its regulation. Here, we analyze the RNA from subcellular fractions obtained through RNA-seq in the cell line K562. We show that in the human genome, splicing occurs predominantly during transcription. We introduce the coSI measure, based on RNA-seq reads mapping to exon junctions and borders, to assess the degree of splicing completion around internal exons. We show that, as expected, splicing is almost fully completed in cytosolic polyA+ RNA. In chromatin- associated RNA (which includes the RNA that is being transcribed), for 5.6% of exons, the removal of the surrounding introns is fully completed, compared with 0.3% of exons for which no intron-removal has occurred. The remaining exons exist as a mixture of spliced and fewer unspliced molecules, with a median coSI of 0.75. Thus, most RNAs undergo splicing while being transcribed: ‘‘co-transcriptional splicing.’’ Consistent with co-transcriptional spliceosome assembly and splicing, we have found significant enrichment of spliceosomal snRNAs in chromatin-associated RNA compared with other cellular RNA fractions and other nonspliceosomal snRNAs.
  • Unraveling Regulation and New Components of Human P-Bodies Through a Protein Interaction Framework and Experimental Validation

    Unraveling Regulation and New Components of Human P-Bodies Through a Protein Interaction Framework and Experimental Validation

    Downloaded from rnajournal.cshlp.org on September 25, 2021 - Published by Cold Spring Harbor Laboratory Press PERSPECTIVE Unraveling regulation and new components of human P-bodies through a protein interaction framework and experimental validation DINGHAI ZHENG,1,2 CHYI-YING A. CHEN,1 and ANN-BIN SHYU3 Department of Biochemistry and Molecular Biology, The University of Texas Medical School, Houston, Texas 77021, USA ABSTRACT The cellular factors involved in mRNA degradation and translation repression can aggregate into cytoplasmic domains known as GW bodies or mRNA processing bodies (P-bodies). However, current understanding of P-bodies, especially the regulatory aspect, remains relatively fragmentary. To provide a framework for studying the mechanisms and regulation of P-body formation, maintenance, and disassembly, we compiled a list of P-body proteins found in various species and further grouped both reported and predicted human P-body proteins according to their functions. By analyzing protein–protein interactions of human P-body components, we found that many P-body proteins form complex interaction networks with each other and with other cellular proteins that are not recognized as P-body components. The observation suggests that these other cellular proteins may play important roles in regulating P-body dynamics and functions. We further used siRNA-mediated gene knockdown and immunofluorescence microscopy to demonstrate the validity of our in silico analyses. Our combined approach identifies new P-body components and suggests that protein ubiquitination and protein phosphorylation involving 14-3-3 proteins may play critical roles for post-translational modifications of P-body components in regulating P-body dynamics. Our analyses provide not only a global view of human P-body components and their physical interactions but also a wealth of hypotheses to help guide future research on the regulation and function of human P-bodies.