Chem 465 Biochemistry II Test 3

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Name: 1 point Chem 465 Biochemistry II Test 3 Multiple choice 4 points each 1. RNA polymerase: A) binds tightly to a region of DNA thousands of base pairs away from the DNA to be transcribed. B) can synthesize RNA chains de novo (without a primer). C) has a subunit called ë (lambda), which acts as a proofreading ribonuclease. D) separates DNA strands throughout a long region of DNA (up to thousands of base pairs), then copies one of them. E) synthesizes RNA chains in the 3'65' direction. 2. Splicing of introns in nuclear mRNA primary transcripts requires: A) a guanine nucleoside or nucleotide. B) endoribonucleases. C) polynucleotide phosphorylase. D) RNA polymerase II. E) small nuclear ribonucleoproteins (snurps). 3. Which one of the following statements about mRNA stability is true? A) Degradation always proceeds in the 5' to 3' direction. B) Degradation of mRNA by polynucleotide phosphorylase yields 5'-nucleoside monophosphates. C) In general, bacterial mRNAs have longer half-lives than do eukaryotic mRNAs. D) Rates of mRNA degradation ared always at least 10-fold slower than rates of mRNA synthesis. E) Secondary structure in mRNA (hairpins, for example) slows the rate of degradation. 4. Which of the following statements about the tRNA that normally accepts phenylalanine is false? (mRNA codons for phenylalanine are UUU and UUC.) A) It interacts specificially with the Phe synthetase. B) It will accept only the amino acid phenylalanine. C) Its molecular weight is about 25,000. D) Phenylalanine can be specifically attached to an -OH group at the 3' end. E) The tRNA must contain the sequence UUU. 5. In bacteria the elongation stage of protein synthesis does not involve: A) aminoacyl-tRNAs. B) EF-Tu. C) GTP. D) IF-2. E) peptidyl transferase. 1 Short answer questions (5 points each) You may skip ONE 6. What is the function of the ó subunit in the E. coli RNA polymerase The ó subunit of RNA polymerase is the unit that recognizes the promoter sequence. The ó70 is the most common one and it recognizes the seqence TTGACA in the -35 region and TATAAT in the -10 region. 7. Briefly describe the processing that goes into making a the structure of a eukaryotic mRNA. The brief part is that I wanted you just to mention: The 7-methylguanosine cap and some methylation of ribose at the 5' end by the Cap-synthesizing complex on the CTD region of the RNA polymerse The splicing our of introns in the middle of the mRNA by the snurps also on the CTD region of the RNA polymerase The cleavage of the message at the AAUAAA sequence and addition of a poly A tail of 80-250 A’s and the 3' end by polyadenylate kinase. 8. Why does a typical retrovirus particle contain both an RNA genome and a tRNA from the previous host cell? The tRNA from the previous host serves as a primer so the DNA polymerase of the reverse transcriptase can begin to make DNA from the single stranded RNA genome of the virus. 9. The eukaryotic cell has RNA polymerases, pol I, pol II, and pol III, what are the function of these three polymerases, and how are they different structurally? RNA pol I is specific for synthesizing preribosomal RNA which gets cleaved to make 18S,5.8S and 28S ribosomal RNA RNA pol II is specific for making mRNA and a few special functions RNA’s RNA pol III makes tRNAs and the 5S rRNA I thought there was a table in the text comparing the size of these polymerases, but I can’t find it, so I will forget about the part of ‘... how are they different structurally’ but one could mention how complex RNA pol II is due to all the different functions it serves. 10. There are two classes of Aminoacyl-tRNA Synthetases. How are the two classes different from each other. Both classes start by attaching an amino acid to the á phosphorous of ATP. In class I synthetases the amino acid is next transferred to the 2' OH of the 3' A of the tRNA. The AA is then transferred to the 3' OH of this ribose in a second step. I the class II synthetases the amino acid is transferred directly from the AA-AMP to the 3'OH of the tRNA. In addition class I synthetases recognize one side of the tRNA while the class II synthetases recognize the other side. 2 11.What is the function of the Shine and Dalgarno sequence. The Shine and Dalgarno sequence is the sequence on a eukaryotic mRNA that hybridizes to a segment of 16S RNA on the 30S subunit of a ribosome to initiate the binding of the mRNA to the 30S subunit and initiate the assembly of a ribosome. Longer questions (12.5 points each) - You make skip ONE (total of 6) 12. What are the 4 types of introns? In what organisms are they found? How are they the same? How are they different? Type I - Self splicing by the RNA itself. Found in some nuclear, mitochondrial and chloroplast. Uses the OH of the from a guanosine nucleoside or nucleotide to cleave the 5' end of the intron. The OH on the 5' exon then attacks the 3' end of the intron to fuse with the 3' exon and release the linear intron. Type II - Self splicing by the RNA itself, Found in mitochondrial and chloroplast in fungi, algae and plants. In this mechanism the OH of residue in the intron attacks the 5' end of the intron to release the 5' exon. The OH from terminus of the 5' exon then attacks the residue at the end of the 3' exon to fuse the exons together and release a lariat shaped intron. Type III This mechanism is used for most mRNA’s for most eukaryotic organisms. In this mechanism a spliceosome composed of several snRNPs is used to splice out lariat shaped introns Type IV is used only for certain tRNAs requires splicing endonucleases to cleave the intron at its 5' and 3' ends, and then ATP is used to join the exons together in a reaction similar to that used in DNA ligases. 13. Since the last test we have seen lots of RNA molecules that have important functions in the eukaryotic cell Identify each of the following RNA’s and what they do gRNA -guide RNA - used in mitochondria and chloroplasts to guide additions or deletions from some RNA messages mRNA - message RNA - the RNA that is used to carry a DNA sequence to a ribosome to translation to a protein sequence. miRNA -microRNA short pieces of RNA used in degradation and suppression of mRNA’s rRNA - ribosomal RNA - the RNA that has large structural and catalytic functions in ribosomes snRNA - small nuclear RNA’s - the RNA part of the spliceosomal small nuceoprotein complexs. snoRNA - small nucleolar RNA’s - guide nucleoside modifications in rRNA. ] tRNA - transfer RNA’s - the RNA molecule that an amino acid gets attached to and used in protein synthesis tmRNA (2 bonus points) - a specialized RNA used in ribosome rescue to release a ribosome from an mRNA that has lost its termination codon. 3 14. In the chapter on RNA metabolism you saw several different kinds of enzymes that make RNA. Tell me about the different enzymes, how are they different and what are their functions in the cell. DNA dependent RNA polymerase - makes RNA from a DNA template Polyadenylate polymerase - adds a polyA tail to mRNA. Primease - make a short sequence of RNA on DNA before the DNA polymerase takes over RNA dependent RNA polymerase (RNA replicase)- makes RNA from RNA. This activity is see in certain RNA viruses that do not copy RNA to DNA in their life-cycle. Interestingly the active replicase only has one subunit encoded on the virus genome. The other three subunits are host proteins normally used in protein synthesis It wasn’t till I was making this key that I realized that when I wrote this question I was thinking about reverse-transcriptases and telomerases, but they make DNA from RNA so the question I asked did not include them. 15. What is the tie between transposons, retroviruses and introns. Transposons are pieces of DNA that move from one place to another. Many transposons use a mechanism that involves an RNA intermediate, and that RNA intermediate resembles a retrovirus in structure and mechanism. The major difference being that the transposon is missing the sequences that would correspond to the viral coat proteins so it can’t make a virus particle. Group I and group II introns are also ‘mobile’ in that they can move around like a transposon. In addition to self-splicing the intron also contains DNA endonucleases that allow the intron to insert into DNA like a transposon. In particular the group II introns use an RNA intermediate in this homing process so it also looks like a retrovirus like mechanism. 16. What are ADAR’s and APOBEC’s. Describe how they functions and why they are important in eukaryotic cells. ADAR - Adenosine deaminases that act on RNA - changes adenosine to inosine. Common in primates and works primarily in Alu elements. These element are usually located in introns or in untranslated parts of the mRNA on the 3' and 5' ends of the message. While this activity would seem to have minimal effects since the modifications are usually not in coding regions of the message, defect in this system are associated with ALS, epilepsy and major depression. APOBEC - apoB mRNA catalytic peptide changes Cytidine to Uridine.
Recommended publications
  • Coupling of Spliceosome Complexity to Intron Diversity

    Coupling of Spliceosome Complexity to Intron Diversity

    bioRxiv preprint doi: https://doi.org/10.1101/2021.03.19.436190; this version posted March 20, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Coupling of spliceosome complexity to intron diversity Jade Sales-Lee1, Daniela S. Perry1, Bradley A. Bowser2, Jolene K. Diedrich3, Beiduo Rao1, Irene Beusch1, John R. Yates III3, Scott W. Roy4,6, and Hiten D. Madhani1,6,7 1Dept. of Biochemistry and Biophysics University of California – San Francisco San Francisco, CA 94158 2Dept. of Molecular and Cellular Biology University of California - Merced Merced, CA 95343 3Department of Molecular Medicine The Scripps Research Institute, La Jolla, CA 92037 4Dept. of Biology San Francisco State University San Francisco, CA 94132 5Chan-Zuckerberg Biohub San Francisco, CA 94158 6Corresponding authors: [email protected], [email protected] 7Lead Contact 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.03.19.436190; this version posted March 20, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. SUMMARY We determined that over 40 spliceosomal proteins are conserved between many fungal species and humans but were lost during the evolution of S. cerevisiae, an intron-poor yeast with unusually rigid splicing signals. We analyzed null mutations in a subset of these factors, most of which had not been investigated previously, in the intron-rich yeast Cryptococcus neoformans.
  • U6 Small Nuclear RNA Is Transcribed by RNA Polymerase III (Cloned Human U6 Gene/"TATA Box"/Intragenic Promoter/A-Amanitin/La Antigen) GARY R

    U6 Small Nuclear RNA Is Transcribed by RNA Polymerase III (Cloned Human U6 Gene/"TATA Box"/Intragenic Promoter/A-Amanitin/La Antigen) GARY R

    Proc. Nati. Acad. Sci. USA Vol. 83, pp. 8575-8579, November 1986 Biochemistry U6 small nuclear RNA is transcribed by RNA polymerase III (cloned human U6 gene/"TATA box"/intragenic promoter/a-amanitin/La antigen) GARY R. KUNKEL*, ROBIN L. MASERt, JAMES P. CALVETt, AND THORU PEDERSON* *Cell Biology Group, Worcester Foundation for Experimental Biology, Shrewsbury, MA 01545; and tDepartment of Biochemistry, University of Kansas Medical Center, Kansas City, KS 66103 Communicated by Aaron J. Shatkin, August 7, 1986 ABSTRACT A DNA fragment homologous to U6 small 4A (20) was screened with a '251-labeled U6 RNA probe (21, nuclear RNA was isolated from a human genomic library and 22) using a modified in situ plaque hybridization protocol sequenced. The immediate 5'-flanking region of the U6 DNA (23). One of several positive clones was plaque-purified and clone had significant homology with a potential mouse U6 gene, subsequently shown by restriction mapping to contain a including a "TATA box" at a position 26-29 nucleotides 12-kilobase-pair (kbp) insert. A 3.7-kbp EcoRI fragment upstream from the transcription start site. Although this containing U6-hybridizing sequences was subcloned into sequence element is characteristic of RNA polymerase II pBR322 for further restriction mapping. An 800-base-pair promoters, the U6 gene also contained a polymerase III "box (bp) DNA fragment containing U6 homologous sequences A" intragenic control region and a typical run of five thymines was excised using Ava I and inserted into the Sma I site of at the 3' terminus (noncoding strand). The human U6 DNA M13mp8 replicative form DNA (M13/U6) (24).
  • Protein-Free Small Nuclear Rnas Catalyze a Two-Step Splicing Reaction

    Protein-Free Small Nuclear Rnas Catalyze a Two-Step Splicing Reaction

    Protein-free small nuclear RNAs catalyze a two-step splicing reaction Saba Valadkhan1,2, Afshin Mohammadi1, Yasaman Jaladat, and Sarah Geisler Center for RNA Molecular Biology, Case Western Reserve University, 10900 Euclid Avenue, Cleveland, OH 44106 Edited by Joan A. Steitz, Yale University, New Haven, CT, and approved May 13, 2009 (received for review March 3, 2009) Pre-mRNA splicing is a crucial step in eukaryotic gene expression and is carried out by a highly complex ribonucleoprotein assembly, the spliceosome. Many fundamental aspects of spliceosomal function, including the identity of catalytic domains, remain unknown. We show that a base-paired complex of U6 and U2 small nuclear RNAs, in the absence of the Ϸ200 other spliceosomal components, performs a two-step reaction with two short RNA oligonucleotides as substrates that results in the formation of a linear RNA product containing portions of both oligonucleotides. This reaction, which is chemically identical to splicing, is dependent on and occurs in proximity of sequences known to be critical for splicing in vivo. These results prove that the complex formed by U6 and U2 RNAs is a ribozyme and can potentially carry out RNA-based catalysis in the spliceosome. catalysis ͉ ribozymes ͉ snRNAs ͉ spliceosome ͉ U6 xtensive mechanistic and structural similarities between spliceoso- BIOCHEMISTRY Emal small nuclear RNAs (snRNAs) and self-splicing group II introns (1, 2) have led to the hypothesis that the snRNAs are evolu- Fig. 1. The U6/U2 complex and splicing substrates. (A) The U6/U2 construct used tionary descendents of group II–like introns and thus could similarly in this study, which contains the central domains of the human U6 and U2 snRNAs.
  • Nuclear Expression of a Group II Intron Is Consistent with Spliceosomal Intron Ancestry

    Nuclear Expression of a Group II Intron Is Consistent with Spliceosomal Intron Ancestry

    Downloaded from genesdev.cshlp.org on September 30, 2021 - Published by Cold Spring Harbor Laboratory Press Nuclear expression of a group II intron is consistent with spliceosomal intron ancestry Venkata R. Chalamcharla, M. Joan Curcio, and Marlene Belfort1 Center for Medical Sciences, Wadsworth Center, New York State Department of Health, Albany, New York 12208, USA; and School of Public Health, State University of New York at Albany, Albany, New York 12201, USA Group II introns are self-splicing RNAs found in eubacteria, archaea, and eukaryotic organelles. They are mechanistically similar to the metazoan nuclear spliceosomal introns; therefore, group II introns have been invoked as the progenitors of the eukaryotic pre-mRNA introns. However, the ability of group II introns to function outside of the bacteria-derived organelles is debatable, since they are not found in the nuclear genomes of eukaryotes. Here, we show that the Lactococcus lactis Ll.LtrB group II intron splices accurately and efficiently from different pre-mRNAs in a eukaryote, Saccharomyces cerevisiae. However, a pre-mRNA harboring a group II intron is spliced predominantly in the cytoplasm and is subject to nonsense-mediated mRNA decay (NMD), and the mature mRNA from which the group II intron is spliced is poorly translated. In contrast, a pre-mRNA bearing the Tetrahymena group I intron or the yeast spliceosomal ACT1 intron at the same location is not subject to NMD, and the mature mRNA is translated efficiently. Thus, a group II intron can splice from a nuclear transcript, but RNA instability and translation defects would have favored intron loss or evolution into protein-dependent spliceosomal introns, consistent with the bacterial group II intron ancestry hypothesis.
  • Mediator Is Essential for Small Nuclear and Nucleolar RNA Transcription in Yeast

    Mediator Is Essential for Small Nuclear and Nucleolar RNA Transcription in Yeast

    bioRxiv preprint doi: https://doi.org/10.1101/352906; this version posted June 21, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 Mediator is essential for small nuclear and nucleolar RNA transcription in yeast 2 3 Jason P. Tourignya, Moustafa M. Saleha, Gabriel E. Zentnera# 4 5 aDepartment of Biology, Indiana University, Bloomington, IN, USA 6 7 #Address correspondence to Gabriel E. Zentner, [email protected] 8 9 Running head: Mediator regulates sn/snoRNAs 10 11 Abstract word count: 198 12 Introduction/results/discussion word count: 3,085 13 Materials and methods word count: 1,433 1 bioRxiv preprint doi: https://doi.org/10.1101/352906; this version posted June 21, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 14 Abstract 15 Eukaryotic RNA polymerase II (RNAPII) transcribes mRNA genes as well as non-protein coding 16 RNAs (ncRNAs) including small nuclear and nucleolar RNAs (sn/snoRNAs). In metazoans, 17 RNAPII transcription of sn/snoRNAs is facilitated by a number of specialized complexes, but no 18 such complexes have been discovered in yeast. It has thus been proposed that yeast 19 sn/snoRNA promoters use the same complement of factors as mRNA promoters, but the extent 20 to which key regulators of mRNA genes act at sn/snoRNA genes in yeast is unclear.
  • Primepcr™Assay Validation Report

    Primepcr™Assay Validation Report

    PrimePCR™Assay Validation Report Gene Information Gene Name DCP1 decapping enzyme homolog A (S. cerevisiae) Gene Symbol Dcp1a Organism Mouse Gene Summary Description Not Available Gene Aliases 1110066A22Rik, 4930568L04Rik, AU019772, D14Ertd817e, Mitc1, SMIF RefSeq Accession No. NC_000080.6, NT_039606.8 UniGene ID Mm.28733 Ensembl Gene ID ENSMUSG00000021962 Entrez Gene ID 75901 Assay Information Unique Assay ID qMmuCID0013841 Assay Type SYBR® Green Detected Coding Transcript(s) ENSMUST00000022535 Amplicon Context Sequence TAATCTGGGAAGCACCGAGACTCTAGAAGAGACACCCTCTGGGTCACAGGATAA GTCTGCTCCGTCTGGTCATAAACATCTGACAGTAGAAGAGTTATTTGGAACCTCC TTGCCAAAGGAA Amplicon Length (bp) 91 Chromosome Location 14:30513043-30518984 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 98 R2 0.9997 cDNA Cq 22.41 cDNA Tm (Celsius) 81 gDNA Cq 24.87 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report Dcp1a, Mouse Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Mouse Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect.
  • Exon Amplification: a Strategy to Isolate Mammalian Genes Based on RNA Splicing (Gene Cloning/Polymerase Chain Reaction) ALAN J

    Exon Amplification: a Strategy to Isolate Mammalian Genes Based on RNA Splicing (Gene Cloning/Polymerase Chain Reaction) ALAN J

    Proc. Natl. Acad. Sci. USA Vol. 88, pp. 4005-4009, May 1991 Genetics Exon amplification: A strategy to isolate mammalian genes based on RNA splicing (gene cloning/polymerase chain reaction) ALAN J. BUCKLER*, DAVID D. CHANG, SHARON L. GRAw, J. DAVID BROOK, DANIEL A. HABER, PHILLIP A. SHARP, AND DAVID E. HOUSMAN Center for Cancer Research, Department of Biology, Massachusetts Institute of Technology, Cambridge, MA 02139 Contributed by Phillip A. Sharp, January 25, 1991 ABSTRACT We have developed a method, exon amplifi- (7, 8). Thus, this method may be generally applicable for the cation, for fast and efficient isolation of coding sequences from selection of exon sequences from any gene. The method is complex mammalian genomic DNA. This method is based on also both rapid and easily adapted to large scale experiments. the selection of RNA sequences, exons, which are flanked by A series of cloned genomic DNA fragments can be screened functional 5' and 3' splice sites. Fragments of cloned genomic within 1-2 weeks. The sensitivity of this method is high. DNA are inserted into an intron, which is flanked by 5' and 3' Genomic DNA segments of 20 kilobases (kb) or more can be splice sites of the human immunodeficiency virus 1 tat gene successfully screened in a single transfection by using a set contained within the plasmid pSPL1. COS-7 cells are trans- of pooled subclones. This method thus allows the rapid fected with these constructs, and the resulting RNA transcripts identification of exons in mammalian genomic DNA and are processed in vivo. Splice sites of exons contained within the should facilitate the isolation of a wide spectrum of genes of inserted genomic fragment are paired with splice sites of the significance in physiology and development.
  • Mrna Turnover Philip Mitchell* and David Tollervey†

    Mrna Turnover Philip Mitchell* and David Tollervey†

    320 mRNA turnover Philip Mitchell* and David Tollervey† Nuclear RNA-binding proteins can record pre-mRNA are cotransported to the cytoplasm with the mRNP. These processing events in the structure of messenger proteins may preserve a record of the nuclear history of the ribonucleoprotein particles (mRNPs). During initial rounds of pre-mRNA in the cytoplasmic mRNP structure. This infor- translation, the mature mRNP structure is established and is mation can strongly influence the cytoplasmic fate of the monitored by mRNA surveillance systems. Competition for the mRNA and is used by mRNA surveillance systems that act cap structure links translation and subsequent mRNA as a checkpoint of mRNP integrity, particularly in the identi- degradation, which may also involve multiple deadenylases. fication of premature translation termination codons (PTCs). Addresses Cotransport of nuclear mRNA-binding proteins with mRNA Wellcome Trust Centre for Cell Biology, ICMB, University of Edinburgh, from the nucleus to the cytoplasm (nucleocytoplasmic shut- Kings’ Buildings, Edinburgh EH9 3JR, UK tling) was first observed for the heterogeneous nuclear *e-mail: [email protected] ribonucleoprotein (hnRNP) proteins. Some hnRNP proteins †e-mail: [email protected] are stripped from the mRNA at export [1], but hnRNP A1, Current Opinion in Cell Biology 2001, 13:320–325 A2, E, I and K are all exported (see [2]). Although roles for 0955-0674/01/$ — see front matter these hnRNP proteins in transport and translation have been © 2001 Elsevier Science Ltd. All rights reserved. reported [3•,4•], their affects on mRNA stability have been little studied. More is known about hnRNP D/AUF1 and Abbreviations AREs AU-rich sequence elements another nuclear RNA-binding protein, HuR, which act CBC cap-binding complex antagonistically to modulate the stability of a range of DAN deadenylating nuclease mRNAs containing AU-rich sequence elements (AREs) DSEs downstream sequence elements (reviewed in [2]).
  • Supplemental Information

    Supplemental Information

    Supplemental information Dissection of the genomic structure of the miR-183/96/182 gene. Previously, we showed that the miR-183/96/182 cluster is an intergenic miRNA cluster, located in a ~60-kb interval between the genes encoding nuclear respiratory factor-1 (Nrf1) and ubiquitin-conjugating enzyme E2H (Ube2h) on mouse chr6qA3.3 (1). To start to uncover the genomic structure of the miR- 183/96/182 gene, we first studied genomic features around miR-183/96/182 in the UCSC genome browser (http://genome.UCSC.edu/), and identified two CpG islands 3.4-6.5 kb 5’ of pre-miR-183, the most 5’ miRNA of the cluster (Fig. 1A; Fig. S1 and Seq. S1). A cDNA clone, AK044220, located at 3.2-4.6 kb 5’ to pre-miR-183, encompasses the second CpG island (Fig. 1A; Fig. S1). We hypothesized that this cDNA clone was derived from 5’ exon(s) of the primary transcript of the miR-183/96/182 gene, as CpG islands are often associated with promoters (2). Supporting this hypothesis, multiple expressed sequences detected by gene-trap clones, including clone D016D06 (3, 4), were co-localized with the cDNA clone AK044220 (Fig. 1A; Fig. S1). Clone D016D06, deposited by the German GeneTrap Consortium (GGTC) (http://tikus.gsf.de) (3, 4), was derived from insertion of a retroviral construct, rFlpROSAβgeo in 129S2 ES cells (Fig. 1A and C). The rFlpROSAβgeo construct carries a promoterless reporter gene, the β−geo cassette - an in-frame fusion of the β-galactosidase and neomycin resistance (Neor) gene (5), with a splicing acceptor (SA) immediately upstream, and a polyA signal downstream of the β−geo cassette (Fig.
  • Explore the RNA Universe!

    Explore the RNA Universe!

    Explore the RNA Universe! Circulating cell-free RNA (ccfRNA) Exosomes Exosomal RNA (exRNA) Ribonuclease P (RNase P) Small (short) interfering RNA (siRNA) Pre-miRNA Small nucleolar RNA Exportin-5 (snoRNA) MicroRNA (miRNA) Drosha Pri-miRNA RISC DGCR8 Ribosomal RNA (rRNA) Small nuclear RNA Ribonuclease MRP Y RNA (snRNA) (RNase MRP) Long non-coding RNA Messenger RNA (mRNA) (IncRNA) Transfer RNA (tRNA) Telomerase RNA Ribosomes Signal recognition particle RNA (SRP RNA) Mitochondria Piwi-interacting RNA (piRNA) Sample to Insight Explore the RNA Universe! RNA function RNA type Detailed role in the cell Protein synthesis Messenger RNA (mRNA) Carrying the genetic information copied from DNA in the form of three-nucleotide bases “codon,” each specifying a particular amino acid for protein synthesis at the ribosomes. Purify with: RNeasy® Plus Kits*, RNeasy Kits*, QIAamp® RNA Blood Kit*, QIAcube® Assay using: QuantiNova® Kits, RT2 Profiler™ PCR Assays and Arrays, Rotor-Gene® Q , QIAseq™ Targeted RNA Panels, QIAseq Stranded mRNA Select Library Kit, QIAseq UPX 3' Targeted RNA Panel, QIAseq UPX 3' Transcriptome RNA Library Kit, QIAseq Targeted RNAscan Panels, QIAseq FX Single Cell RNA Library Kit Transfer RNA Adapter molecule bringing the amino acid corresponding to a specific mRNA codon to the ribosome. Having an anticodon (complementary to the codon), a site (tRNA) binding a specific amino acid and a site binding aminoacyl-tRNA synthetase (enzyme catalyzing amino acid-tRNA binding). Ribosomal RNA (rRNA) RNA component of the ribosome, where protein is translated. Ribosomes align the anticodon of tRNA with the mRNA codon and are required for the peptidyl transferase activity catalyzing the assembly of amino acids into protein chains.
  • Sequences at the Exon-Intron Boundaries* (Split Gene/Mrna Splicing/Eukaryotic Gene Structure) R

    Sequences at the Exon-Intron Boundaries* (Split Gene/Mrna Splicing/Eukaryotic Gene Structure) R

    Proc. Nati. Acad. Sci. USA Vol. 75, No. 10, pp. 4853-4857, October 1978 Biochemistry Ovalbumin gene: Evidence for a leader sequence in mRNA and DNA sequences at the exon-intron boundaries* (split gene/mRNA splicing/eukaryotic gene structure) R. BREATHNACH, C. BENOIST, K. O'HARE, F. GANNON, AND P. CHAMBON Laboratoire de Genetique Mol6culaire des Eucaryotes du Centre National de la Recherche Scientifique, Unite 44 de l'Institut National de la Sant6 et de la Recherche MWdicale, Institut de Chimie Biologique, Facult6 de Melecine, Strasbourg 67085, France Communicated by A. Frey-Wyssling, July 31, 1978 ABSTRACT Selected regions of cloned EcoRI fragments the 5' end of ov-mRNA and have revealed some interesting of the chicken ovalbumin gene have been sequenced. The po- features in the DNA sequences at exon-intron boundaries. sitions where the sequences coding for ovalbumin mRNA (ov- mRNA) are interrupted in the genome have been determined, and a previously unreported interruption in the DNA sequences MATERIALS AND METHODS coding for the 5' nontranslated region of the messenger has been discovered. Because directly repeated sequences are found at Plasmid pCR1 ov 2.1 containing the ov-ds-cDNA insert was exon-intron boundaries, the nucleotide sequence alone cannot prepared as described (9). EcoRI fragments "b," "c," and "d" define unique excision-ligation points for the processing of a previously cloned in X vectors (3) were transferred to the plas- possible ov-mRNA precursor. However, the sequences in these mid pBR 322. An EcoRI/HindIII of the EcoRI boundary regions share common features; this leads to the fragment proposal that there are, in fact, unique excision-ligation points fragment "a" containing the entirety of exon 7 (Fig.
  • Nuclear PTEN Safeguards Pre-Mrna Splicing to Link Golgi Apparatus for Its Tumor Suppressive Role

    Nuclear PTEN Safeguards Pre-Mrna Splicing to Link Golgi Apparatus for Its Tumor Suppressive Role

    ARTICLE DOI: 10.1038/s41467-018-04760-1 OPEN Nuclear PTEN safeguards pre-mRNA splicing to link Golgi apparatus for its tumor suppressive role Shao-Ming Shen1, Yan Ji2, Cheng Zhang1, Shuang-Shu Dong2, Shuo Yang1, Zhong Xiong1, Meng-Kai Ge1, Yun Yu1, Li Xia1, Meng Guo1, Jin-Ke Cheng3, Jun-Ling Liu1,3, Jian-Xiu Yu1,3 & Guo-Qiang Chen1 Dysregulation of pre-mRNA alternative splicing (AS) is closely associated with cancers. However, the relationships between the AS and classic oncogenes/tumor suppressors are 1234567890():,; largely unknown. Here we show that the deletion of tumor suppressor PTEN alters pre-mRNA splicing in a phosphatase-independent manner, and identify 262 PTEN-regulated AS events in 293T cells by RNA sequencing, which are associated with significant worse outcome of cancer patients. Based on these findings, we report that nuclear PTEN interacts with the splicing machinery, spliceosome, to regulate its assembly and pre-mRNA splicing. We also identify a new exon 2b in GOLGA2 transcript and the exon exclusion contributes to PTEN knockdown-induced tumorigenesis by promoting dramatic Golgi extension and secretion, and PTEN depletion significantly sensitizes cancer cells to secretion inhibitors brefeldin A and golgicide A. Our results suggest that Golgi secretion inhibitors alone or in combination with PI3K/Akt kinase inhibitors may be therapeutically useful for PTEN-deficient cancers. 1 Department of Pathophysiology, Key Laboratory of Cell Differentiation and Apoptosis of Chinese Ministry of Education, Shanghai Jiao Tong University School of Medicine (SJTU-SM), Shanghai 200025, China. 2 Institute of Health Sciences, Shanghai Institutes for Biological Sciences of Chinese Academy of Sciences and SJTU-SM, Shanghai 200025, China.