DOCSLIB.ORG

Mrna Turnover Philip Mitchell* and David Tollervey†

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Mrna Turnover Philip Mitchell* and David Tollervey† 320 mRNA turnover Philip Mitchell* and David Tollervey† Nuclear RNA-binding proteins can record pre-mRNA are cotransported to the cytoplasm with the mRNP. These processing events in the structure of messenger proteins may preserve a record of the nuclear history of the ribonucleoprotein particles (mRNPs). During initial rounds of pre-mRNA in the cytoplasmic mRNP structure. This infor- translation, the mature mRNP structure is established and is mation can strongly influence the cytoplasmic fate of the monitored by mRNA surveillance systems. Competition for the mRNA and is used by mRNA surveillance systems that act cap structure links translation and subsequent mRNA as a checkpoint of mRNP integrity, particularly in the identi- degradation, which may also involve multiple deadenylases. fication of premature translation termination codons (PTCs). Addresses Cotransport of nuclear mRNA-binding proteins with mRNA Wellcome Trust Centre for Cell Biology, ICMB, University of Edinburgh, from the nucleus to the cytoplasm (nucleocytoplasmic shut- Kings’ Buildings, Edinburgh EH9 3JR, UK tling) was first observed for the heterogeneous nuclear *e-mail: [email protected] ribonucleoprotein (hnRNP) proteins. Some hnRNP proteins †e-mail: [email protected] are stripped from the mRNA at export [1], but hnRNP A1, Current Opinion in Cell Biology 2001, 13:320–325 A2, E, I and K are all exported (see [2]). Although roles for 0955-0674/01/$ — see front matter these hnRNP proteins in transport and translation have been © 2001 Elsevier Science Ltd. All rights reserved. reported [3•,4•], their affects on mRNA stability have been little studied. More is known about hnRNP D/AUF1 and Abbreviations AREs AU-rich sequence elements another nuclear RNA-binding protein, HuR, which act CBC cap-binding complex antagonistically to modulate the stability of a range of DAN deadenylating nuclease mRNAs containing AU-rich sequence elements (AREs) DSEs downstream sequence elements (reviewed in [2]). Several additional transcripts regulated by hnRNP heterogeneous nuclear ribonucleoprotein these factors have been reported over the past year (see, for mRNPs messenger ribonucleoprotein particles nt nucleotides example, [5,6]). A mutant form of hnRNP D that binds to PTCs premature translation termination codons AREs but does not localize to the nucleus fails to stimulate STEs stabilizing elements degradation, indicating that association with the nuclear pre- uORFs upstream open reading frames mRNA is required for its effects on mRNA metabolism UTR untranslated region (A-B Shyu, personal communication). Introduction A recently identified family of proteins that binds to HuR mRNA turnover plays an important role in the regulation of [7] may stimulate its interaction with nuclear AREs and gene expression, affecting both the total amount of protein promote the nuclear export of the mRNP via CRM1. HuR that can be synthesized from a given level of transcription expression in trypanosomes stabilizes developmentally reg- and the time that translation continues. It has long been ulated mRNAs containing AREs (L Quijada, C Hartmann, appreciated that the structure of the messenger ribonucle- C Clayton, personal communication), suggesting that ARE- oprotein particle (mRNP) complex is likely to play an mediated degradation is conserved among eukaryotes. important role in both translation and mRNA stability. Although the RNP structures remain poorly characterized, The recognition of PTCs during mRNA surveillance in recent data have started to shed some light on these mammalian cells is dependent upon pre-mRNA splicing. processes. It was also clear that there is a close relationship Introns are rarely found in the 3′ untranslated regions between the translational status of mRNAs and their rates (3′UTRs) of transcripts, and an exon junction (the position of degradation. Translation initiation factors, the decapping of a former intron) positioned more than about 50 enzyme complex and a deadenylase have now been shown nucleotides (nt) downstream from the translation termina- to compete for the cap structure, and multiple interactions tion codon causes this to be read as premature termination between these factors have been reported that may deter- site, triggering rapid mRNA degradation. Thus, for exon mine the outcome of this competition. Finally, the activity junctions to be recognized during translation, splicing must in yeast that removes the poly(A) tail — the rate limiting mark them in some way [8]. A good candidate marker is the step in the degradation of most mRNAs — has long been large (~335 kDa) (also known as the 20–24 complex) that sought and may now have been identified. We will attempt associates with the mRNA 20 to 24nt upstream from the to provide an overview of these developments. splice junction, probably at a late stage during the splicing reaction [9••,10•,11••,12,13•]. This complex includes the The burden of history: nuclear pre-mRNA splicing factors SRm160, DEK and RNPS1, the shuttling processing imprints mRNAs protein Y14 and the mRNA export factor REF/Aly. It is not Recent work has demonstrated that many diverse RNA- clear whether all these proteins accompany the mRNP into binding proteins associate with the nuclear pre-mRNA and the cytoplasm, but both Y14 and REF/Aly are exported. mRNA turnover Mitchell and Tollervey 321 Figure 1 (a) CBC m7G AAAAAAAAA Pre-mRNA splicing PABP CBC m7G Mark Mark Mark AAAAAAAAA Nucleocytoplasmic export PABP (b) CBC eIF4G AUG m7G Mark Mark Mark AAAAAAAAA Translation initiation 80S Wild-type mRNA PTC mRNA Translation elongation (c) RFSC PABP RFSC PABP CBC eIF4GAUG UAA CBC eIF4G AUG UAA m G 7 AAAAAAAAAm7G AAAAAAAAA 80S 80S Replacement of CBC by eIF4E mRNA surveillance detects Translation reinitation downstream exon junction mRNP circularisation marker (d) (e) AUG eIF4G SC PABP 4E CBC AUG m7G m7G AAAAAAAAA eIF4G AA Decapping and degradation AA PABP AA UAA AAA Decapping AUG complex eIF4G m7G SC AAA AAA AA A PABP Current Opinion in Cell Biology Models for mRNA surveillance. (a) Nuclear assembly and processing correct marker proteins are encountered the mature mRNP structure is generates complex RNPs. Exon junction markers are indicated. formed. eIF4E replaces CBC and the interaction between PABP and (b) Upon export from the nucleus, eIF4G binds to the CBC and eIF4G circularizes the mRNA. (e) Interaction of the surveillance translation is initiated. (c) During elongation, marker proteins located complex with inappropriate proteins triggers decapping and rapid within the ORF are dissociated. Upon translation termination, Upf1p is degradation. Upf2 and 3p may assemble with Upf1p before scanning recruited by the release factors (RF) and a surveillance complex (SC) or only after scanning is inhibited at the mark. that includes Upf1p then translocates through the 3′ UTR. (d) If only Pre-mRNA splicing requires other shuttling proteins, when the intron is deleted [15,16]. SR-proteins and other including the U2AF35–U2AF65 heterodimer and members factors bound to nearby ESEs are good candidates for this of the family of SR-proteins [14,15]. SR-proteins bind to fail-safe signal. sites, including exonic splicing enhancer (ESE) sequences, located close to the splice site. ‘Fail-safe’ sequences locat- Analyses in yeast have identified three proteins — ed around splice sites can trigger mRNA surveillance even Upf1p, Upf2p and Upf3p — that play a key role in 322 Nucleus and gene expression mRNA surveillance. Functional homologues have recent- presence of stabilizing elements (STEs) located between ly been characterized in humans (hUpf1p/RENT, the uORF and the major coding region [29,30]. These hUpf2p and hUpf3p) and Caenorhabditis elegans (smg-2, STEs bind to Pub1p [31••], an HuR-related protein that smg-3 and smg-4) [17••,18,19•]. Upf1p is more abundant presumably antagonizes DSE/Hrp1p-mediated decapping than Upf2p and Upf3p and functions directly in the ter- and degradation. Pub1p is a major nuclear RNA-binding mination of translation [20]. Unlike yeast, mammalian protein and is likely to be transported to the cytoplasm Upf1p appears to be essential for the viability of both with the mRNA. Even in human mRNAs, not all markers embryos and isolated blastocysts [21]. arise through splicing. An hnRNP complex bound within the c-fos ORF inhibits deadenylation until displaced by The three Upf proteins copurify from extracts of yeast and translation [32•]. human cell extracts, and the yeast mutants have identical phenotypes in mRNA surveillance, indicating that they Never like the first time: a privileged initial function as a complex. Consistent with this, tethering any round of translation of the hUpf proteins within the 3′ UTR of wild-type β-glo- Newly exported mRNAs have an RNP structure distinct bin mRNA, more than 50nt beyond the termination codon, from the ‘mature’ mRNP and may undergo an initial round triggered mRNA surveillance [17••]. Surprisingly, the of translation that is substantially different from the sub- human Upf proteins did not colocalize using immunofluo- sequent translation. During this initial round, the rescence [17••,19••]. hUpf1p is cytoplasmic, whereas hUpf2 7-methylguanosine cap carries the nuclear cap-binding is restricted to a region closely surrounding the nucleus. complex (CBC), a Cbp20p–Cbp80p dimer, which may be hUpf3p is a nucleocytoplasmic-shuttling protein that asso- exported with the mRNA [33•]. Furthermore, the mRNA ciates with nuclear mRNA in a splicing-dependent manner is decorated by many protein complexes marking splice [17••,] and is therefore another candidate marker for exon sites and other sites of hnRNP assembly. CBC interacts junctions. The Upf complex that mediates mRNA surveil- with the translation initiation factor eIF4G and can lance is likely to be present at the overlap of these promote initiation of translation [33•]. During the initial distributions, in the perinuclear region. Here, hUpf2p may translation, the mRNP structure is substantially remod- interact with hUpf3p bound to newly exported mRNP and eled; nuclear proteins bound within the ORF are displaced with hUpf1p recruited to the mRNA by the translation and rapidly reimported, allowing the major protein signals release factors.
Load more

Recommended publications
  • The Ribosome As a Regulator of Mrna Decay
    www.nature.com/cr www.cell-research.com RESEARCH HIGHLIGHT Make or break: the ribosome as a regulator of mRNA decay Anthony J. Veltri1, Karole N. D’Orazio1 and Rachel Green 1 Cell Research (2020) 30:195–196; https://doi.org/10.1038/s41422-019-0271-3 Cells regulate α- and β-tubulin levels through a negative present. To address this, the authors mixed pre-formed feedback loop which degrades tubulin mRNA upon detection TTC5–tubulin RNCs containing crosslinker with lysates from of excess free tubulin protein. In a recent study in Science, Lin colchicine-treated or colchicine-untreated TTC5-knockout cells et al. discover a role for a novel factor, TTC5, in recognizing (either having or lacking abundant free tubulin, respectively). the N-terminal motif of tubulins as they emerge from the After irradiation, TTC5 only crosslinked to the RNC in lysates ribosome and in signaling co-translational mRNA decay. from cells that had previously been treated with colchicine; Cells use translation-coupled mRNA decay for both quality these data suggested to the authors that some other (unknown) control and general regulation of mRNA levels. A variety of known factor may prevent TTC5 from binding under conditions of low quality control pathways including Nonsense Mediated Decay free tubulin. (NMD), No-Go Decay (NGD), and Non-Stop Decay (NSD) specifi- What are likely possibilities for how such coupling between cally detect and degrade mRNAs encoding potentially toxic translation and mRNA decay might occur? One example to protein fragments or sequences which cause ribosomes to consider is that of mRNA surveillance where extensive studies in translate poorly or stall.1 More generally, canonical mRNA yeast have identified a large group of proteins that recognize degradation is broadly thought to be translation dependent, and resolve stalled RNCs found on problematic mRNAs and 1234567890();,: though the mechanisms that drive these events are not target those mRNAs for decay.
    [Show full text]
  • Coupling of Spliceosome Complexity to Intron Diversity
    bioRxiv preprint doi: https://doi.org/10.1101/2021.03.19.436190; this version posted March 20, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Coupling of spliceosome complexity to intron diversity Jade Sales-Lee1, Daniela S. Perry1, Bradley A. Bowser2, Jolene K. Diedrich3, Beiduo Rao1, Irene Beusch1, John R. Yates III3, Scott W. Roy4,6, and Hiten D. Madhani1,6,7 1Dept. of Biochemistry and Biophysics University of California – San Francisco San Francisco, CA 94158 2Dept. of Molecular and Cellular Biology University of California - Merced Merced, CA 95343 3Department of Molecular Medicine The Scripps Research Institute, La Jolla, CA 92037 4Dept. of Biology San Francisco State University San Francisco, CA 94132 5Chan-Zuckerberg Biohub San Francisco, CA 94158 6Corresponding authors: [email protected], [email protected] 7Lead Contact 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.03.19.436190; this version posted March 20, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. SUMMARY We determined that over 40 spliceosomal proteins are conserved between many fungal species and humans but were lost during the evolution of S. cerevisiae, an intron-poor yeast with unusually rigid splicing signals. We analyzed null mutations in a subset of these factors, most of which had not been investigated previously, in the intron-rich yeast Cryptococcus neoformans.
    [Show full text]
  • Lin28b and Mir-142-3P Regulate Neuronal Differentiation by Modulating Staufen1 Expression
    Cell Death and Differentiation (2018) 25, 432–443 & 2018 ADMC Associazione Differenziamento e Morte Cellulare All rights reserved 1350-9047/18 www.nature.com/cdd Lin28B and miR-142-3p regulate neuronal differentiation by modulating Staufen1 expression Younseo Oh1,5, Jungyun Park1,5, Jin-Il Kim1, Mi-Yoon Chang2, Sang-Hun Lee3, Youl-Hee Cho*,4 and Jungwook Hwang*,1,4 Staufen1 (STAU1) and Lin28B are RNA-binding proteins that are involved in neuronal differentiation as a function of post- transcriptional regulation. STAU1 triggers post-transcriptional regulation, including mRNA export, mRNA relocation, translation and mRNA decay. Lin28B also has multiple functions in miRNA biogenesis and the regulation of translation. Here, we examined the connection between STAU1 and Lin28B and found that Lin28B regulates the abundance of STAU1 mRNA via miRNA maturation. Decreases in the expression of both STAU1 and Lin28B were observed during neuronal differentiation. Depletion of STAU1 or Lin28B inhibited neuronal differentiation, and overexpression of STAU1 or Lin28B enhanced neuronal differentiation. Interestingly, the stability of STAU1 mRNA was modulated by miR-142-3p, whose maturation was regulated by Lin28B. Thus, miR-142-3p expression increased as Lin28B expression decreased during differentiation, leading to the reduction of STAU1 expression. The transcriptome from Staufen-mediated mRNA decay (SMD) targets during differentiation was analyzed, confirming that STAU1 was a key factor in neuronal differentiation. In support of this finding, regulation of STAU1 expression in mouse neural precursor cells had the same effects on neuronal differentiation as it did in human neuroblastoma cells. These results revealed the collaboration of two RNA-binding proteins, STAU1 and Lin28B, as a regulatory mechanism in neuronal differentiation.
    [Show full text]
  • Ribosomes Slide on Lysine-Encoding Homopolymeric a Stretches
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Crossref RESEARCH ARTICLE elifesciences.org Ribosomes slide on lysine-encoding homopolymeric A stretches Kristin S Koutmou1, Anthony P Schuller1, Julie L Brunelle1,2, Aditya Radhakrishnan1, Sergej Djuranovic3, Rachel Green1,2* 1Department of Molecular Biology and Genetics, Johns Hopkins School of Medicine, Baltimore, United States; 2Howard Hughes Medical Institute, Johns Hopkins School of Medicine, Baltimore, United States; 3Department of Cell Biology and Physiology, Washington University School of Medicine, St. Louis, United States Abstract Protein output from synonymous codons is thought to be equivalent if appropriate tRNAs are sufficiently abundant. Here we show that mRNAs encoding iterated lysine codons, AAA or AAG, differentially impact protein synthesis: insertion of iterated AAA codons into an ORF diminishes protein expression more than insertion of synonymous AAG codons. Kinetic studies in E. coli reveal that differential protein production results from pausing on consecutive AAA-lysines followed by ribosome sliding on homopolymeric A sequence. Translation in a cell-free expression system demonstrates that diminished output from AAA-codon-containing reporters results from premature translation termination on out of frame stop codons following ribosome sliding. In eukaryotes, these premature termination events target the mRNAs for Nonsense-Mediated-Decay (NMD). The finding that ribosomes slide on homopolymeric A sequences explains bioinformatic analyses indicating that consecutive AAA codons are under-represented in gene-coding sequences. Ribosome ‘sliding’ represents an unexpected type of ribosome movement possible during translation. DOI: 10.7554/eLife.05534.001 *For correspondence: ragreen@ Introduction jhmi.edu Messenger RNA (mRNA) transcripts can contain errors that result in the production of incorrect protein products.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name DCP1 decapping enzyme homolog A (S. cerevisiae) Gene Symbol Dcp1a Organism Mouse Gene Summary Description Not Available Gene Aliases 1110066A22Rik, 4930568L04Rik, AU019772, D14Ertd817e, Mitc1, SMIF RefSeq Accession No. NC_000080.6, NT_039606.8 UniGene ID Mm.28733 Ensembl Gene ID ENSMUSG00000021962 Entrez Gene ID 75901 Assay Information Unique Assay ID qMmuCID0013841 Assay Type SYBR® Green Detected Coding Transcript(s) ENSMUST00000022535 Amplicon Context Sequence TAATCTGGGAAGCACCGAGACTCTAGAAGAGACACCCTCTGGGTCACAGGATAA GTCTGCTCCGTCTGGTCATAAACATCTGACAGTAGAAGAGTTATTTGGAACCTCC TTGCCAAAGGAA Amplicon Length (bp) 91 Chromosome Location 14:30513043-30518984 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 98 R2 0.9997 cDNA Cq 22.41 cDNA Tm (Celsius) 81 gDNA Cq 24.87 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report Dcp1a, Mouse Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Mouse Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect.
    [Show full text]
  • Exon Amplification: a Strategy to Isolate Mammalian Genes Based on RNA Splicing (Gene Cloning/Polymerase Chain Reaction) ALAN J
    Proc. Natl. Acad. Sci. USA Vol. 88, pp. 4005-4009, May 1991 Genetics Exon amplification: A strategy to isolate mammalian genes based on RNA splicing (gene cloning/polymerase chain reaction) ALAN J. BUCKLER*, DAVID D. CHANG, SHARON L. GRAw, J. DAVID BROOK, DANIEL A. HABER, PHILLIP A. SHARP, AND DAVID E. HOUSMAN Center for Cancer Research, Department of Biology, Massachusetts Institute of Technology, Cambridge, MA 02139 Contributed by Phillip A. Sharp, January 25, 1991 ABSTRACT We have developed a method, exon amplifi- (7, 8). Thus, this method may be generally applicable for the cation, for fast and efficient isolation of coding sequences from selection of exon sequences from any gene. The method is complex mammalian genomic DNA. This method is based on also both rapid and easily adapted to large scale experiments. the selection of RNA sequences, exons, which are flanked by A series of cloned genomic DNA fragments can be screened functional 5' and 3' splice sites. Fragments of cloned genomic within 1-2 weeks. The sensitivity of this method is high. DNA are inserted into an intron, which is flanked by 5' and 3' Genomic DNA segments of 20 kilobases (kb) or more can be splice sites of the human immunodeficiency virus 1 tat gene successfully screened in a single transfection by using a set contained within the plasmid pSPL1. COS-7 cells are trans- of pooled subclones. This method thus allows the rapid fected with these constructs, and the resulting RNA transcripts identification of exons in mammalian genomic DNA and are processed in vivo. Splice sites of exons contained within the should facilitate the isolation of a wide spectrum of genes of inserted genomic fragment are paired with splice sites of the significance in physiology and development.
    [Show full text]
  • RNA Components of the Spliceosome Regulate Tissue- and Cancer-Specific Alternative Splicing
    Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press Research RNA components of the spliceosome regulate tissue- and cancer-specific alternative splicing Heidi Dvinge,1,2,4 Jamie Guenthoer,3 Peggy L. Porter,3 and Robert K. Bradley1,2 1Computational Biology Program, Public Health Sciences Division, Fred Hutchinson Cancer Research Center, Seattle, Washington 98109, USA; 2Basic Sciences Division, Fred Hutchinson Cancer Research Center, Seattle, Washington 98109, USA; 3Human Biology Division, Fred Hutchinson Cancer Research Center, Seattle, Washington 98109, USA Alternative splicing of pre-mRNAs plays a pivotal role during the establishment and maintenance of human cell types. Characterizing the trans-acting regulatory proteins that control alternative splicing has therefore been the focus of much research. Recent work has established that even core protein components of the spliceosome, which are required for splicing to proceed, can nonetheless contribute to splicing regulation by modulating splice site choice. We here show that the RNA components of the spliceosome likewise influence alternative splicing decisions. Although these small nuclear RNAs (snRNAs), termed U1, U2, U4, U5, and U6 snRNA, are present in equal stoichiometry within the spliceosome, we found that their relative levels vary by an order of magnitude during development, across tissues, and across cancer samples. Physiologically relevant perturbation of individual snRNAs drove widespread gene-specific differences in alternative splic- ing but not transcriptome-wide splicing failure. Genes that were particularly sensitive to variations in snRNA abundance in a breast cancer cell line model were likewise preferentially misspliced within a clinically diverse cohort of invasive breast ductal carcinomas.
    [Show full text]
  • Nonsense Mediated Mrna Decay As a Tool for Gene Therapy and the Role of Human DIS3L2 in Transcript Degradation
    UNIVERSIDADE DE LISBOA FACULDADE DE CIÊNCIAS DEPARTAMENTO DE BIOLOGIA ANIMAL mRNA Metabolism: Nonsense Mediated mRNA Decay as a Tool for Gene Therapy and the Role of Human DIS3L2 in Transcript Degradation Mestrado em Biologia Humana e Ambiente Gerson Leonel Asper Amaral Dissertação orientada por: Doutora Luísa Romão Professora Doutora Deodália Dias 2016 II UNIVERSIDADE DE LISBOA FACULDADE DE CIÊNCIAS DEPARTAMENTO DE BIOLOGIA ANIMAL mRNA Metabolism: Nonsense Mediated mRNA Decay as a Tool for Gene Therapy and the Role of Human DIS3L2 in Transcript Degradation Mestrado em Biologia Humana e Ambiente Gerson Leonel Asper Amaral Dissertação orientada por: Doutora Luísa Romão (Instituto Nacional de Saúde Dr. Ricardo Jorge) Professora Doutora Deodália Dias (Departamento de Biologia Animal, Faculdade de Ciências da Universidade de Lisboa) 2016 III IV “It is finished.” – Jesus Christ (The Bible, John 19:30) V VI ACKNOWLEDGEMENTS _______________________________________________________________________ This dissertation is the result of the very hard work, patience and resources from a lot of people. They were instrumental in the accomplishment of this project, be it through their knowledge, plain lab work, their friendship, guidance, support or sheer trust. I am sincerely thankful that all of you made part of my life at least for this year, because without you this would never see the light of day and would remain in the darkness of night. Clichéd poetry aside, honestly, thank you all. I want to start by thanking my main advisor, Dr. Luísa Romão, for accepting me into her brilliant lab and trusting me and my work. Thank you for sharing your vast knowledge with me, helping me, guiding me, being patient and calling my attention to my mistakes, all this without ever stopping from being pleasant! I feel so honoured and thankful.
    [Show full text]
  • Supplemental Information
    Supplemental information Dissection of the genomic structure of the miR-183/96/182 gene. Previously, we showed that the miR-183/96/182 cluster is an intergenic miRNA cluster, located in a ~60-kb interval between the genes encoding nuclear respiratory factor-1 (Nrf1) and ubiquitin-conjugating enzyme E2H (Ube2h) on mouse chr6qA3.3 (1). To start to uncover the genomic structure of the miR- 183/96/182 gene, we first studied genomic features around miR-183/96/182 in the UCSC genome browser (http://genome.UCSC.edu/), and identified two CpG islands 3.4-6.5 kb 5’ of pre-miR-183, the most 5’ miRNA of the cluster (Fig. 1A; Fig. S1 and Seq. S1). A cDNA clone, AK044220, located at 3.2-4.6 kb 5’ to pre-miR-183, encompasses the second CpG island (Fig. 1A; Fig. S1). We hypothesized that this cDNA clone was derived from 5’ exon(s) of the primary transcript of the miR-183/96/182 gene, as CpG islands are often associated with promoters (2). Supporting this hypothesis, multiple expressed sequences detected by gene-trap clones, including clone D016D06 (3, 4), were co-localized with the cDNA clone AK044220 (Fig. 1A; Fig. S1). Clone D016D06, deposited by the German GeneTrap Consortium (GGTC) (http://tikus.gsf.de) (3, 4), was derived from insertion of a retroviral construct, rFlpROSAβgeo in 129S2 ES cells (Fig. 1A and C). The rFlpROSAβgeo construct carries a promoterless reporter gene, the β−geo cassette - an in-frame fusion of the β-galactosidase and neomycin resistance (Neor) gene (5), with a splicing acceptor (SA) immediately upstream, and a polyA signal downstream of the β−geo cassette (Fig.
    [Show full text]
  • Mrna Surveillance in Eukaryotes: Kinetic Proofreading of Proper Translation Termination As Assessed by Mrnp Domain Organization?
    Downloaded from rnajournal.cshlp.org on October 5, 2021 - Published by Cold Spring Harbor Laboratory Press RNA (1999), 5:711–719+ Cambridge University Press+ Printed in the USA+ Copyright © 1999 RNA Society+ REVIEW mRNA surveillance in eukaryotes: Kinetic proofreading of proper translation termination as assessed by mRNP domain organization? PATRICIA HILLEREN and ROY PARKER Department of Molecular and Cellular Biology, Howard Hughes Medical Institute, University of Arizona, Tucson, Arizona 85721, USA ABSTRACT In the last few years it has become clear that a conserved mRNA degradation system, referred to as mRNA surveil- lance, exists in eukaryotic cells to degrade aberrant mRNAs. This process plays an important role in checking that mRNAs have been properly synthesized and functions, at least in part, to increase the fidelity of gene expression by degrading aberrant mRNAs that, if translated, would produce truncated proteins. A critical issue is how normal and aberrant mRNAs are distinguished and how that distinction leads to differences in mRNA stability. Recent results suggest a model with three main points. First, mRNPs have a domain organization that is, in part, a reflection of the completion of nuclear pre-mRNA processing events. Second, the critical aspect of distinguishing a normal from an aberrant mRNA is the environment of the translation termination codon as determined by the organization of the mRNP domains. Third, the cell distinguishes proper from improper termination through an internal clock that is the rate of ATP hydrolysis by Upf1p. If termination is completed before ATP hydrolysis, the mRNA is protected from mRNA degradation. Conversely, if termination is slow, then ATP hydrolysis and a structural rearrangement occurs before termination is completed, which affects the fate of the terminating ribosome in a manner that fails to stabilize the mRNA.
    [Show full text]
  • Sequences at the Exon-Intron Boundaries* (Split Gene/Mrna Splicing/Eukaryotic Gene Structure) R
    Proc. Nati. Acad. Sci. USA Vol. 75, No. 10, pp. 4853-4857, October 1978 Biochemistry Ovalbumin gene: Evidence for a leader sequence in mRNA and DNA sequences at the exon-intron boundaries* (split gene/mRNA splicing/eukaryotic gene structure) R. BREATHNACH, C. BENOIST, K. O'HARE, F. GANNON, AND P. CHAMBON Laboratoire de Genetique Mol6culaire des Eucaryotes du Centre National de la Recherche Scientifique, Unite 44 de l'Institut National de la Sant6 et de la Recherche MWdicale, Institut de Chimie Biologique, Facult6 de Melecine, Strasbourg 67085, France Communicated by A. Frey-Wyssling, July 31, 1978 ABSTRACT Selected regions of cloned EcoRI fragments the 5' end of ov-mRNA and have revealed some interesting of the chicken ovalbumin gene have been sequenced. The po- features in the DNA sequences at exon-intron boundaries. sitions where the sequences coding for ovalbumin mRNA (ov- mRNA) are interrupted in the genome have been determined, and a previously unreported interruption in the DNA sequences MATERIALS AND METHODS coding for the 5' nontranslated region of the messenger has been discovered. Because directly repeated sequences are found at Plasmid pCR1 ov 2.1 containing the ov-ds-cDNA insert was exon-intron boundaries, the nucleotide sequence alone cannot prepared as described (9). EcoRI fragments "b," "c," and "d" define unique excision-ligation points for the processing of a previously cloned in X vectors (3) were transferred to the plas- possible ov-mRNA precursor. However, the sequences in these mid pBR 322. An EcoRI/HindIII of the EcoRI boundary regions share common features; this leads to the fragment proposal that there are, in fact, unique excision-ligation points fragment "a" containing the entirety of exon 7 (Fig.
    [Show full text]
  • Comprehensive Protein Interactome Analysis of a Key RNA Helicase: Detection of Novel Stress Granule Proteins
    Biomolecules 2015, 5, 1441-1466; doi:10.3390/biom5031441 OPEN ACCESS biomolecules ISSN 2218-273X www.mdpi.com/journal/biomolecules/ Article Comprehensive Protein Interactome Analysis of a Key RNA Helicase: Detection of Novel Stress Granule Proteins Rebecca Bish 1,†, Nerea Cuevas-Polo 1,†, Zhe Cheng 1, Dolores Hambardzumyan 2, Mathias Munschauer 3, Markus Landthaler 3 and Christine Vogel 1,* 1 Center for Genomics and Systems Biology, Department of Biology, New York University, 12 Waverly Place, New York, NY 10003, USA; E-Mails: [email protected] (R.B.); [email protected] (N.C.-P.); [email protected] (Z.C.) 2 The Cleveland Clinic, Department of Neurosciences, Lerner Research Institute, 9500 Euclid Avenue, Cleveland, OH 44195, USA; E-Mail: [email protected] 3 RNA Biology and Post-Transcriptional Regulation, Max-Delbrück-Center for Molecular Medicine, Berlin-Buch, Robert-Rössle-Str. 10, Berlin 13092, Germany; E-Mails: [email protected] (M.M.); [email protected] (M.L.) † These authors contributed equally to this work. * Author to whom correspondence should be addressed; E-Mail: [email protected]; Tel.: +1-212-998-3976; Fax: +1-212-995-4015. Academic Editor: André P. Gerber Received: 10 May 2015 / Accepted: 15 June 2015 / Published: 15 July 2015 Abstract: DDX6 (p54/RCK) is a human RNA helicase with central roles in mRNA decay and translation repression. To help our understanding of how DDX6 performs these multiple functions, we conducted the first unbiased, large-scale study to map the DDX6-centric protein-protein interactome using immunoprecipitation and mass spectrometry. Using DDX6 as bait, we identify a high-confidence and high-quality set of protein interaction partners which are enriched for functions in RNA metabolism and ribosomal proteins.
    [Show full text]