RNA–RNA Interactions and Pre-Mrna Mislocalization As Drivers of Group II Intron Loss from Nuclear Genomes

RNA–RNA interactions and pre-mRNA mislocalization as drivers of group II intron loss from nuclear genomes

Guosheng Qua, Xiaolong Donga, Carol Lyn Piazzaa, Venkata R. Chalamcharlab,1, Sheila Lutzb, M. Joan Curciob, and Marlene Belforta,2

aDepartment of Biological Sciences, RNA Institute, University at Albany, State University of New York, Albany, NY 12222; and bWadsworth Center, New York State Department of Health, Albany, NY 12201-2002

Contributed by Marlene Belfort, March 10, 2014 (sent for review January 22, 2014; reviewed by Lynne Maquat and Roy Parker) Group II introns are commonly believed to be the progenitors of and the spliced mRNA (S-mRNA) are subject to nonsense- spliceosomal introns, but they are notably absent from nuclear mediated decay (NMD) and translational repression, respectively genomes. Barriers to group II intron function in nuclear genomes (12) (Fig. S1). Strikingly, this intron-stimulated gene silencing is therefore beg examination. A previous study showed that nuclear unique to group II introns, with neither group I nor spliceosomal expression of a group II intron in yeast results in nonsense- introns in the same location having any effect on RNA stability mediated decay and translational repression of mRNA, and that or translation (12). Here, we investigated possible mechanisms these roadblocks to expression are group II intron-specific. To for group II intron-specific gene silencing in yeast. Our data determine the molecular basis for repression of gene expression, demonstrate strong mRNA–pre-mRNA interactions and RNA we investigated cellular dynamics of processed group II intron miscompartmentalization, reflected in export of the pre-mRNA RNAs, from transcription to cellular localization. Our data show to the cytoplasm and its localization to cytoplasmic foci, possibly pre-mRNA mislocalization to the cytoplasm, where the RNAs are including processing bodies (PBs) and stress granules (SGs). – targeted to foci. Furthermore, tenacious mRNA pre-mRNA interac- Both phenomena result in a reduction in the abundance of tions, based on intron-exon binding sequences, result in reduced mRNAs from which group II introns were removed and a re- abundance of spliced mRNAs. Nuclear retention of pre-mRNA pre- duction of gene expression. This work supports a relationship vents this interaction and relieves these expression blocks. In between nucleus-cytoplasm compartmentalization and evolution addition to providing a mechanistic rationale for group II intron- of gene-silencing group II introns into spliceosomal introns in specific repression, our data support the hypothesis that RNA si- nuclear genomes. lencing of the host gene contributed to expulsion of group II introns from nuclear genomes and drove the evolution of Results spliceosomal introns. RNA Modification and Processing Are Normal. In eukaryotic cells, mRNA translation can be regulated at multiple levels, from the intron-mediated nuclear gene silencing | spliceosomal intron evolution processing of the transcript, through RNA–RNA or RNA–protein interactions, to cellular localization. Aberrations at any step could roup II introns that reside in genomes of bacteria, archaea, account for reduced expression of spliced mRNA (S-mRNA) Gand eukaryotic organelles are ribozymes that self-splice that previously contained a group II intron. We therefore first from pre-mRNA transcripts independent of protein catalysis examined the nature of RNA transcripts from a construct used – (1 3). Group II introns are also mobile retroelements that in- as a group II intron-splicing reporter (12) (Fig. 1A and Fig. S2A). tegrate into DNAs via an RNA intermediate (2, 3). Group II intron splicing is usually facilitated in vivo by an intron-encoded protein Significance that acts as a maturase to help form the required secondary and tertiary structures (3). The intron RNA–protein complex is also required for group II intron retromobility. Both splicing and mo- For over three decades, group II introns have been conjectured bility of group II introns require interactions between exon-binding to be the ancestors of splicesomal introns, but there are no sequences (EBSs) within the intron and intron-binding sequences group II introns in extant nuclear genomes. Might these introns (IBSs) in the flanking exons of RNA or DNA targets (2, 3). have been expunged as spliceosomal introns proliferated? We The chemical steps of group II intron splicing are identical showed previously that nuclear expression of a group II intron to those of nuclear spliceosomal introns (4, 5). There are also in yeast resulted specifically in down-regulation of its host gene. similarities of RNA sequences at the splice sites and of RNA Here, we report on the discovery that pre-mRNA mislocalization and a consequent interaction between the pre-mRNA or intron structures within the ribozyme and the spliceosome (6–9). Be- and spliced mRNA together account for the mechanism of gene cause of these parallels, the catalytic group II introns are be- silencing. Our data support the hypothesis that such road- lieved to be the progenitors of spliceosomal introns (6, 10, 11). It blocks to gene expression resulted in purging of group II is widely speculated that group II introns entered the eukaryotic introns from nuclear genomes while promoting the evolution lineage with the mitochondrial endosymbiosis, invaded the nu- of spliceosomal introns. cleus, and evolved from RNA catalysts into efficient spliceosome-

dependent introns. However, group II introns are strikingly ab- Author contributions: G.Q. and M.B. designed research; G.Q., X.D., C.L.P., and V.R.C. sent from modern nuclear genomes (1), which are replete with performed research; S.L. and M.J.C. contributed new reagents/analytic tools; G.Q. and spliceosomal introns. It is still elusive how the ancestral group II M.B. analyzed data; and G.Q. and M.B. wrote the paper. introns might have evolved into spliceosomal introns or how they Reviewers: L.M., University of Rochester; and R.P., University of Colorado Boulder. were expunged from nuclear genomes. The authors declare no conflict of interest. As an initial effort to answer these questions, we had probed See Commentary on page 6536. the fate of group II introns introduced into RNA polymerase II 1Present address: Laboratory of Biochemistry and Molecular Biology, National Cancer transcripts in Saccharomyces cerevisiae (12). We used LtrB, a Institute, National Institutes of Health, Bethesda, MD 20892. group II intron from Lactococcus lactis, as a model. That work 2To whom correspondence should be addressed. E-mail: [email protected]. showed that the group II intron splices accurately and efficiently, This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. albeit in the cytoplasm, and that the intron-containing pre-mRNA 1073/pnas.1404276111/-/DCSupplemental.

6612–6617 | PNAS | May 6, 2014 | vol. 111 | no. 18 www.pnas.org/cgi/doi/10.1073/pnas.1404276111 Downloaded by guest on October 1, 2021 A SA the streptavidin resin. No C-mRNA bound to the resin (Fig. 1 B, ii SEE COMMENTARY Pre-mRNA E1 E2 CUP1 Myc ), supporting the conclusion that the unspliced precursor and the S-mRNA interact in vivo. Splicing Group II intron interferes with S-mRNA expression. Considering sequence complementarities between IBSs in the exons and EBSs in the intron (Fig. 2A, Left), we hypothesized that an interaction S-mRNA E1 E2 CUP1 Myc between pre-mRNA or excised intron and S-mRNA might re- C-mRNA E1 E2 CUP1 Myc press S-mRNA expression (Fig. 2A, Right). To test this hypothesis, an intron-containing ORF fused to URA3 (Fig. 2B, GpII- B (i) Intron Ex2 URA3) was coexpressed with C-mRNA, containing ligated exons fused to CUP1 (Figs. 1A and 2B). The resulting strain showed GCGGUACCUCCCUACUUCAC CAUAUCAUUUUU Pre-mRNA 40 slightly less resistance to copper than a strain in which C-mRNA UCGUGAACACAUCCAUAAC CAUAUCAUUUUU mRNA was coexpressed with an intronless URA3 counterpart (Fig. 2C, 38 compare rows 1 and 2). A more dramatic result was observed Ex1 when LtrA was expressed (Fig. 2C, rows 3 and 4). It is unclear if (ii) (iii) the LtrA effect is due to excision of the intron, which interacts S- mRNA C- mRNA Avidin 0X 1X 4X 8X 16X Mock L F B L F B B U B U B U B U B U with the S-mRNA; to RNA binding by LtrA, which could affect the phenotype; or to an observed slowing of cellular growth caused by LtrA expression. Regardless, the phenotypic difference between isogenic intron-containing and intron-lacking strains is consistent with the expectation that the group II intron represses – % 65 75 65 65 61 C-mRNA expression by RNA RNA interactions. To relate phenotypes to gene expression levels, Cup1 protein (Cup1p) and Fig. 1. mRNA–pre-mRNA interactions. (A) Schematic of RNA aptamer- mRNA levels, respectively, were monitored by Western blotting harboring construct. Pre-mRNA bears the ΔORF variant of the LtrB intron and RT. Coexpression of the group II intron from GpII-URA3 (black line), which is flanked by exon 1 and exon 2 (E1 and E2) and fused to RNA (Fig. 2D, lane 2) caused the protein product of C-mRNA to the CUP1 ORF containing a C-terminal Myc tag (12). The mRNA generated decrease to 47% of that in the strain expressing the intronless from splicing (S-mRNA) has the same RNA sequence as the intron-lacking C-mRNA (12). The streptavidin aptamer (SA) in the intron was used as an URA3 (Fig. 2D, lane 1; control C1 and C2 contain plasmids affinity tag for pre-mRNA purification. (B)mRNA–pre-mRNA interactions in expressing only CUP1 C-mRNA or the group II intron, respec- vivo. (i) RT termination assay. Affinity-purified RNAs were detected as per tively). Interestingly, coexpression of the intron-bearing RNA the schematic (12) with a primer that terminates differentially at the sites also led to a significant decrease of abundance of both C-mRNA depicted by black ovals. (ii) RNA–RNA interactions. cDNAs from i were re- [Fig. 2E, lane 2 vs. lane 1 (21% vs. 100%)] and GpII-URA3 (Fig. solved on a 10% (wt/vol) polyacrylamide gel. (iii) Stability of RNA binding. S5A, lane 2 vs. lane C2). These results imply an interaction be- Competition of binding to streptavidin by increasing concentrations of avidin tween exon sequences in CUP1 C-mRNA and intron sequences (from 1× to 16×) was measured on an 8% (wt/vol) polyacrylamide gel. The in GpII-URA3, corroborating the putative RNA–RNA inter- ‘‘ ’’ relative ratio (%) of S-mRNA to pre-mRNA is shown below. In ii, Mock actions. The decreased RNA levels also suggest that these inter- BIOCHEMISTRY indicates the absence of RNA templates. B, resin-bound; F, flow-through; L, lysate; U, unbound. actions target RNA for degradation. Taken together, these data indicate that interactions of the mRNA with an intron-containing pre-mRNA result in reduction of translatable mRNA and Examination of the 5′-ends, the RNA 5′-cap structures, and the gene expression. length of the 3′-polyadenylated [poly(A)] tail (Figs. S2 and S3) EBS-IBS base pairings mediate mRNA–pre-mRNA interactions. To dem- – revealed no obvious differences between the S-mRNA and control onstrate that mRNA silencing was caused by EBS IBS interactions, mRNA (C-mRNA), the latter of which is identical to S-mRNA a mutant C-mRNA was made with IBS nucleotide substitutions in coding sequence but never contained the group II intron (12), to disrupt the potential pairings between C-mRNA and the intron- countering the possibility that silencing of the S-mRNA is due to containing RNA GpII-URA3 while maintaining the frame of the aberrant RNA processing. Cup1 protein (Fig. 3A). The copper resistance phenotype of the WT IBS strains was slightly stronger in the absence of the EBS- RNA–RNA Interactions Repress Gene Expression. Unspliced pre-mRNA containing group II intron than in its presence (Fig. 3B, row 1 vs. interacts with S-mRNA. To identify molecules that might bind to row 2). However, this subtle difference disappeared when muta- pre-mRNA, a streptavidin aptamer was introduced into the group tions in IBS disrupted the EBS-IBS pairing (Fig. 3B, row 4 vs. row 3). A reduction in Cup1p was revealed by Western blotting in the II intron (Fig. 1A) and the resulting pre-mRNA was coexpressed – with the intron-encoded protein, LtrA, which promotes splicing. presence of WT EBS IBS interaction [Fig. 3C, lane 2 vs. lane 1 (47% vs. 100%)] and was reversed with disruption of EBS-IBS Lysates were applied to streptavidin resin to purify pre-mRNAs [Fig. 3C, lane 4 vs. lane 3 (92% vs. 100%)]. Likewise, formation of that were analyzed by a reverse transcription (RT) termination EBS–IBS interaction reduced C-mRNA levels to 21% of those assay developed previously to distinguish pre-mRNA from S-mRNA when the interaction could not form (Fig. 3D,lane2vs.lane1), (12) (Fig. 1 B, i). Remarkably, S-mRNA was coisolated with the whereas EBS-IBS disruption restored levels of C-mRNA to 97% pre-mRNA (Fig. 1 B, ii). Conditions, such as wash times (Fig. S4A); of those when the interaction could not form (Fig. 3D, lane 4 vs. resin-to-lysate ratio (Fig. S4B); magnesium concentration in lysis/ lane 3). The GpII-URA3 RNA was also reduced in abundance washing buffer (Fig. S4C); and preincubation of cell lysate with when coexpressed with C-mRNA bearing a WT IBS and was re- avidin, a streptavidin analog, did not prevent either pre-mRNA or stored to 62% with the IBS mutant compared with the complete S-mRNA from binding, and the relative ratio of S-mRNA to pre- absence of IBS sequences (Fig. S5B,lane4vs.laneC2).Silencing mRNA was generally constant (Fig. 1 B, iii and Fig. S4). While of C-mRNA was eliminated by mutation of IBS sequences in the demonstrating the specificity of pre-mRNA binding to the strep- C-mRNA and was recovered when IBS-EBS base pairings tavidin resin, these observations indicated an interaction between were restored by compensatory mutations of EBS sequences S-mRNA and intron-containing pre-mRNA. To eliminate the in GpII-URA3 RNA (Fig. S6). Together, these results indicate possibility that mRNA binds directly to the streptavidin resin, that EBS-IBS base pairings mediate interactions between a group lysate from cells expressing C-mRNA (Fig. 1A) was passed over II intron-containing pre-mRNA and an mRNA and that these

Qu et al. PNAS | May 6, 2014 | vol. 111 | no. 18 | 6613 Downloaded by guest on October 1, 2021 A Group II Intron RNAs Are Mislocalized to the Cytoplasm, Where They EBS2 III Form Foci. Pre-mRNA and S-mRNA accumulate in the cytoplasm as defined EBS1 EBSs – ORF E1 E2 CUP1 foci. Demonstration of the mRNA pre-mRNA interaction prompted II us to examine cellular localization of these RNAs. To visualize group I IV II intron RNAs, FISH was performed with DNA oligonucleo- V tide probes against CUP1 coding sequence and with DAPI to ' E1 E2 CUP1 stain genomic DNA. In all cases, the CUP1 FISH signal A VI IBSs 3' appeared predominantly outside of the nucleus (Fig. 4A,RNA), O indicating that these RNAs are localized in the cytoplasm. This R EBSs IBS2 IBS1 observationisinaccordwithpreviousspeculationbasedon 5' NMD, which suggested cytoplasmic localization of pre-mRNA (12). EBS2 EBS1 Additionally, foci were often observed in cells that expressed pre- mRNA or both pre-mRNA and S-mRNA (Fig. 4A). In contrast, foci GUGUA GUGUUGGUA E1 E2 CUP1 were seldom present in cells containing C-mRNA. Foci accu- 5'- ... U G A A CACAUC CAUAACCAUA U C A ... -3' IBSs mulated in approximately one-third as many cells when C- mRNA was expressed as opposed to when pre-mRNA or pre-mRNA IBS2 IBS1 plus S-mRNA was expressed. These results suggest a correlation between the silencing of S-mRNA expression and its localization in B E E1 E2 CUP1 - cytoplasmic foci. Ex-URA3 E1 E2 URA3 (GpII) ~ 82 5'- end Dcp2 and Pab1 are both enriched in pre-mRNA–S-mRNA complexes. PBs EBSs + and SGs are two cytoplasmic ribonucleoprotein particles that GpII-URA3 E1 E2 URA3 (GpII) M C1 C2 1 2 form under stress and are enriched with translationally re- pressed mRNAs (13). Group II intron-related RNAs in punctate forms prompted us to examine a potential relationship C-mRNA E1 E2 CUP1 between these RNAs and cytoplasmic particles. We therefore IBSs used their respective core component proteins, decapping enzyme Dcp2 and poly(A)-binding protein Pab1, fused to C 0 0.05 0.1 0.5 1.0 mM C-terminal GFP tags. Because we were unable to demonstrate a 1 (-) differential colocalization of S-mRNA/pre-mRNA over C-mRNA 2 GpII 100 with GFP-tagged PB and SG proteins, we performed immuno- precipitation (IP) of Dcp2/GFP and Pab1/GFP using an anti-GFP 3 (-) + LtrA 82 C-mRNA 4 GpII + LtrA 66

A IBS2 IBS1 δ ' D C1 C2 1 2 IBS AAGTGCTAGCTGCACCCAGTA CAC ATC CAT AAC CAT TTTTTACTA Cup1p H I H I H 42 IBS-mut ATGACCCACGTCGATCGTGAA CAT GCC CAC CAA CAT ATCATTTTT Tubulin 40 ScR1 H A H Q H GpII +-+- GpII + -- + B 0 0.1 0.5 1.0 mM C-mRNA + - ++ C-mRNA + - ++ 1 IBS-wt + (-) % 106 0 100 47 % 211000183 2 IBS-wt + EBS Fig. 2. GroupIIintroncoexpressioninterfereswithmRNAexpression.(A) – δ 3 IBS-mut + (-) Models of intron exon interactions. Base pairings between EBS1, EBS2, and in D 1 2 3 4 the intron (red) and IBS1, IBS2, and δ′ in the flanking exons (black) are indicated 4 IBS-mut + EBS by dashed lines and detailed below (Left). Hypothesized mRNA–pre-mRNA or C-mRNA intron–mRNA interactions with EBS-IBS base pairings (Right)aredenotedby C 1 2 3 4 vertical dashed lines. (B) Schematics of coexpressed RNAs for model testing. The Cup1p ScR1 intron-less CUP1 C-mRNA was coexpressed with the group II intron fused with Tubulin URA3 (GpII-URA3, GpII+)orURA3 ligated exons (Ex-URA3, GpII−). (C)Copper- EBS +-+- EBS +-+- R IBS wtwt mutmut resistant (Cu ) phenotypes. The intron-less CUP1 C-mRNA was coexpressed with IBS mutmutwtwt % 9710021100 GpII-URA3 (rows 2 and 4, GpII) or without the group II intron [Ex-URA3, rows 1 % 9210047100 and 3, (−)], in the absence (rows 1 and 2) or presence (rows 3 and 4) of the intron-encoded protein, LtrA. Copper sulfate concentrations (millimolar) in the Fig. 3. EBS-IBS pairings mediate mRNA–pre-mRNA interactions. (A) Ligated plates are shown at the top and molecules coexpressed with the CUP1 C-mRNA LtrB exons. WT IBS and mutated IBS (IBS-mut) sequences are shown with are shown on the right. (D) CUP1 mRNA translation. Cup1p was detected by relevant codons underlined and corresponding amino acids shown below. Western blotting in strains with intron-less and intron-containing RNA coex- Nucleotide substitutions and resulting amino acid mutations are shown in pressed (strains 1 and 2 as in C). Tubulin was the loading control. Lanes C1 and larger bold letters. Exon ligation junction is indicated by an arrow. (B)CuR C2 are from control strains expressing Cup1p but no group II intron (C1) or the phenotypes. The intron-less CUP1 C-mRNA with WT IBS (rows 1 and 2) or IBS- group II intron fused to URA3 in the absence of CUP1 (C2). Cup1p levels (%) mut (rows 3 and 4) was coexpressed with the EBS-containing group II intron relative to strain 1 were normalized to the tubulin loading control. (E)RNA fused to URA3 (rows 2 and 4, EBS) or without the intron [rows 1 and 3, (−)]. levels. C-mRNA in strains 1 and 2 was analyzed by RT using Integrated DNA Features of coexpressed RNAs are shown on the right. (C) CUP1 mRNA Technologies (IDT) primer IDT3271 (arrow) with the cDNA length shown. translation. Cup1p levels in strains 1–4 (lanes 1–4) from B were analyzed by Strains C1 and C2 are as in D. ScR1 RNA served as a loading control to normalize Western blotting, with tubulin as the loading control. Levels of Cup1p (%) C-mRNA levels (%) relative to those in strain 1 (lane 1). M, P32-labeled ΦX174 from EBS-containing strains (lanes 2 and 4) are shown relative to their in- DNA ladder (Promega). An analysis of GpII-URA3 RNA levels is shown in Fig. S5A. tron-minus EBS-less counterparts (lanes 1 and 3). (D) RNA levels. Levels of CUP1 mRNA were analyzed as in Fig. 2E. Lanes 1–4 correspond to rows 1–4in B. The abundance of C-mRNA normalized to that of ScR1 RNA (%) in EBS- interactions are required for repressing mRNA abundance containing strains (lanes 2 and 4) is shown relative to EBS-less counterparts and expression. (lanes 1 and 3). Analysis of GpII-URA3 RNA levels is shown in Fig. S5B.

6614 | www.pnas.org/cgi/doi/10.1073/pnas.1404276111 Qu et al. Downloaded by guest on October 1, 2021 RNA DNA RNA (snoRNA) U24 (hU24) into the intron (Fig. 5A), taking A DIC Merge (Quasar 570) (DAPI) advantage of hU24’s K-turn structure for nuclear localization SEE COMMENTARY 71% (14, 15). The hU24-containing strain showed a slightly increased resistance to copper (Fig. 5B, compare rows 2 and 3), suggesting Pre-mRNA that nuclear retention of CUP1 pre-mRNA increased S-mRNA expression. Consistent with this observation, Cup1p levels were almost doubled in the presence of hU24 [Fig. 5C, compare lanes 67% 2 and 3 (13% and 23%)]. Furthermore, the S-mRNA level was Pre-mRNA significantly elevated in the presence of hU24 [Fig. 5D, compare + S-mRNA lanes 2 and 3 (15% and 51%)], whereas pre-mRNA levels were comparable [Fig. 5D, compare lanes 2 and 3 (100% and 93%)], suggesting that nuclear retention of pre-mRNA boosts levels of 20% S-mRNA. Together, these results support the hypothesis that C-mRNA nuclear export of pre-mRNA to the cytoplasm contributes to mRNA–pre-mRNA interactions and S-mRNA silencing. Discussion B Dcp2 (PBs) Pab1 (SGs) Prompted by the absence of group II introns from nuclear S-mRNA C-mRNA S-mRNA C-mRNA genomes and the silencing of yeast genes into which a group II I F W4 W8 B IFW4 W8 B IFW4 W8 B IFW4 W8 B intron was inserted, we performed a study of mRNAs origi- Pre-mRNA mRNA nating from a group II intron-containing precursor (S-mRNA) or from its intron-less counterpart (C-mRNA) to investigate group II intron-specific inhibition of gene expression. Although S-mRNA and C-mRNA were identical in terms of RNA pro- U6 cessing and end-modification, we discovered that S-mRNA interacts avidly with the unspliced pre-mRNA and that the pre-

Pre-mRNA 0.52 0.58 mRNA is mislocalized to the cytoplasm, where the interacting S-mRNA 0.60 1.00 RNAs tend to form foci. Moreover, our data show that pre- C-mRNA 0.21 0.29 – U6 0.009 0.011 0.005 0.015 mRNA nuclear export and the resulting mRNA pre-mRNA interactions cause silencing of S-mRNA. Such blocks could Fig. 4. Localization of pre-mRNA and S-mRNA. (A) Cytoplasmic localization. profoundly affect the persistence of group II introns in nuclear Yeast cells were fixed, processed for FISH using CUP1 ORF-specific DNA genes (Fig. 6). oligomers labeled with Quasar570, and stained with DAPI. Fluorescence microscopy images were collected using filters for visualizing RNA (Qua- sar570, red) and genomic DNA (DAPI, blue). Images were collected using

differential interference contrast (DIC). RNA foci are indicated by white BIOCHEMISTRY arrows. The percentage of cells that have visible RNA foci is indicated for one A GpII Intron of a duplicate set of experiments that yielded similar ratios. (Scale bar: 10 μm.) (B) Group II intron-related RNAs were coprecipitated with marker Transcription proteins of PBs and SGs. Cell lysates containing GFP-tagged PB marker Dcp2 nucleus or SG marker Pab1 were incubated with anti-GFP monoclonal antibodies, and coprecipitated RNAs were analyzed by the RT termination assay. F, flow- 5' - cap AAAA - 3’ through; W4, fourth wash; W8, eighth wash. Relative ratios of the bound RNA (B) to the input (I) are shown under gel images. Splicing 5' - cap AAAA - 3’ antibody. Immunoprecipitated RNAs were compared with snRNA Export C 1 2 3 U6, which apparently does not exist in the cytoplasm. Indeed, very cytoplasm Cup1p little U6 RNA was copurified (relative IP ratio <0.02; Fig. 4B), 5' - cap AAAA - 3’ indicating its virtual absence from Dcp2- and Pab1-associated ri- Tubulin Translation bonucleoprotein complexes (Fig. 4B). In contrast, both pre-mRNA 100 13 23 % and S-mRNA were coisolated with Dcp2/GFP and Pab1/GFP. 5' - cap AAAA - 3’ D C-mRNA also appeared in both IP fractions, but with significantly 1 2 3 lower abundance. For example, the C-mRNA level was approxi- B Pre-mRNA mately threefold lower than the S-mRNA level (relative IP ratio: 0 0.010.040.02 0.05 0.1 0.5 mM mRNA 0.21 vs. 0.60 for Dcp2/GFP and 0.29 vs. 1.00 for Pab1/GFP). The 1 C-mRNA ScR1 co-IP results reveal a markedly enhanced interaction of the group 2 Pre-mRNA II intron RNA complex with Dcp2 and Pab1, possibly because of 0 100 93 pre-mRNA % 3 hU24-pre-mRNA mRNA % localization of the RNA to PBs and SGs (13). 100 15 51 Fig. 5. Nuclear retention of pre-mRNA relieves silencing of S-mRNA. (A) Nuclear Retention of Pre-mRNA Relieves Gene Silencing. Splicing of Schematic of nuclear retention by hU24 snoRNA (blue ovals). (B)CuR phe- spliceosomal intron-containing RNAs is usually completed in the notypes. Intron-containing pre-mRNA with (row 3) or without (row 2) the nucleus, and S-mRNA is exported to the cytoplasm. In contrast, hU24 insertion was coexpressed with a nuclear localization signal-bearing LtrA (NLS-LtrA) (12). C-mRNA coexpressed with NLS-LtrA (row 1) served as group II intron-containing pre-mRNA is exported to the cyto- R plasm, where it interacts with the S-mRNA (Figs. 1 and 4). It was the Cu control. Molecules coexpressed with NLS-LtrA are shown on the right. (C) CUP1 mRNA translation. Cup1p levels in strains 1–3 from B were therefore of interest to test whether nuclear retention of pre- – analyzed as in Fig. 2D.(D) RNA levels. mRNA and pre-mRNA were analyzed mRNA may disrupt mRNA pre-mRNA interactions and relieve from strains 1–3 as described in Fig. 1B, with ScR1 as the loading control. The gene silencing. To retain the pre-mRNA in the nucleus, we relative level (%) of S-mRNA was normalized to C-mRNA in strain 1 (lane 1), inserted the sequence of the human box C/D small nucleolar and pre-mRNA was normalized to that in strain 2 (lane 2).

Qu et al. PNAS | May 6, 2014 | vol. 111 | no. 18 | 6615 Downloaded by guest on October 1, 2021 GpII Intron respectively (19). Evolution of the spliceosome, which is postu- lated to have occurred concurrently with development of the Transcription nuclear membrane (20), may have been concomitant with loss nucleus – 5' - cap AAAA - 3’ of the EBS IBS interaction. However, there are still examples of cytoplasmic splicing in eukaryotic cells, such as in anucleate Export platelets (21) and in the dendroplasm of neuronal cells (22). cytoplasm Moreover, cytoplasmic splicing by the minor spliceosome pathway has been reported (23). Nevertheless, gene expression seems un- 5’ - cap AAAA - 3’ perturbed, likely because of the absence of EBS–IBS interactions. Nonsense Splicing Interestingly, a brown algal group IIB intron, which differs from AAAA - 3’ recognition the L. lactis group IIA intron in part by its extensive EBS-IBS interactions, is similarly silenced when expressed from the yeast 5' - cap AAAA - 3’ nucleus (24). These considerations raise the question of how the 5' - cap AAAA - 3’ potential mRNA–pre-mRNA interactions and resulting gene silencing are avoided in bacteria or organelles, where there is no Silenced Expression 5' - cap AAAA - 3’ nuclear-cytoplasmic compartmentalization. Possibly, in these 3’- AAAA cap - 5’ host environments, there are different mechanisms that either 3’ - AAAA cap - 5’ NMD prevent RNAs from interacting or melt the duplex to achieve AAAA - 3’ protein synthesis. The absence of degradative cytoplasmic com- AAAA - 3’ plexes, such as PBs and SGs, may also play a role in preserving translation in bacteria. 3’ - AAAA RNA Miscompartmentalization as a Roadblock to Gene Expression.

5’- cap AAAAAAAA - 3’ Two main quality control mechanisms prevent nuclear export 3’ - AAAA cap - 5’ of mRNAs containing errors (25). One is nuclear mRNA decay, AAAAAAAA - 3’ which degrades RNAs (26), and the other is the Mlp1-Mlp2 3’ - AAAA cap - 5’ gating system, which holds premature mRNA in the nucleus with AAAAAAAA - 3’

AAAAAAAA - 3’ the nuclear pore complex (27). Interestingly, group I introns, which also have intron-exon pairings but do not impose silencing, are retained in the nucleus (28), whereas group II intron-containing Cytoplasmic granules pre-mRNAs bypass these nuclear RNA surveillance systems. Fig. 6. Model for the mechanism of group II intron-specific nuclear gene Thus, premature termination codons in pre-mRNAs are not silencing. Intron-bearing pre-mRNAs are exported to the cytoplasm, where sufficient for nuclear retention, specifically for group II introns. RNA splicing occurs, and pre-mRNAissubjecttoNMD(12).Pre-mRNAs Like eukaryotic pre-mRNAs that are accidently exported to the that escape NMD or excised introns interact with S-mRNAs by EBS-IBS base cytoplasm, group II intron-containing pre-mRNAs are subject to pairings, resulting in silencing of mRNAs, which are localized to cytoplasmic granules. NMD (12). Interestingly, we observed a lower abundance of intron-containing RNA when interacting mRNA was provided in trans (Figs. 2 and 3 and Fig. S5), suggesting that RNA–RNA RNA–RNA Interactions, Gene Silencing, and Nuclear Membrane interactions might stimulate RNA decay as well. Notably, the Evolution. S-mRNA–pre-mRNA interaction, revealed by affinity reduction of pre-mRNA and S-mRNA levels caused by NMD purification of pre-mRNA (Fig. 1), is consistent with coenrichment did not account for silenced expression (12); thus, we invoked of S-mRNA and pre-mRNA in nonpolysomal sucrose gradient translational repression as a possible explanation for silencing fractions observed previously (12). The group II intron-containing caused by the intron in cis. The relative roles of RNA stability, pre-mRNA coexists with the S-mRNA in the cytoplasm (Fig. 4), NMD, and translational repression when the intron is expressed which provides the opportunity for mRNA–pre-mRNA inter- in cis or in trans remain to be determined. actions that result in gene silencing. This hypothesis was verified by A striking feature of group II intron-related RNAs is the demonstrating down-regulation of a translation-competent mRNA punctate appearance of pre-mRNA and S-mRNA in contrast by coexpression with a group II intron-containing RNA. The basis to the C-mRNA transcribed from an intron-less construct. As for this interaction is base pairing between the intron’sEBS mentioned before, the NMD protein Upf1, which is transiently and the mRNA’s IBS (Figs. 2 and 3 and Fig. S6). This scenario localized to PBs (13), appeared to be involved in polysome/ was further supported by retaining pre-mRNA in the nucleus, monosome partitioning of group II intron-containing pre-mRNA thereby minimizing the opportunity for mRNA–pre-mRNA (12). Our current data reveal that Dcp2 and Pab1 are signifi- interactions and resulting in partial relief of silencing (Fig. 5). cantly enriched in intron-related RNA–protein complexes (Fig. It is unclear how the formation of the 14-bp duplex between 4). Dcp2 catalyzes removal of the 5′-cap of mRNAs triggered by S-mRNA and pre-mRNA is facilitated and maintained. Pos- 3′-deadenylation (29, 30), whereas Pab1, the major poly(A)-tail sibly, a dsRNA-binding protein is required for stabilizing the binding protein in yeast, functions in mRNA biogenesis, nuclear RNA–RNA complex, as Staufen proteins do on duplexes between export, translation, and RNA decay [refs. 31, 32 and references long noncoding RNA (lncRNA) short interspersed nuclear ele- therein]. Although the association of the group II intron-related ments (SINEs) and mRNA SINEs (16, 17). Previously, coenrich- RNAs with Dcp2 and Pab1 needs to be interpreted with caution, ment of pre-mRNA and S-mRNA in polysomal fractions was this association may be reflective of translational repression disrupted in an UPF1 deletion mutant (12), suggesting that Upf1 or sequestration of group II intron-related RNAs in ribonucleo- might be a partner of the protein that maintains the RNA–RNA protein (RNP) granules, particularly PBs and SGs, which com- interaction (18). municate NMD (33, 34) and inhibit mRNA translation (13). It Eukaryotes seem to have solved the problem of interactions remains to be determined if targeting to these particles may between intron-containing pre-mRNA and its spliced product by result from mRNA–pre-mRNA interactions, or if mRNA–pre- development of a nuclear membrane and compartmentaliza- mRNA interactions could result from in situ splicing in PBs and/ tion of pre-mRNA and S-mRNA in the nucleus and cytoplasm, or SGs.

6616 | www.pnas.org/cgi/doi/10.1073/pnas.1404276111 Qu et al. Downloaded by guest on October 1, 2021 Expulsion of Group II Introns and Evolution of Spliceosomal Introns. Materials and Methods The origin and evolution of spliceosomal introns has been the Details of yeast strains, plasmid construction, RT analyses, the copper re- SEE COMMENTARY subject of much debate (11, 35, 36), but given structural equiv- sistance assay, Western blotting, RNA FISH and fluorescence microscopy, and alences, splicing parallels, and chemical reaction identities, there IP are provided in SI Materials and Methods. is little doubt that they evolved from group II introns (37). The For RNA affinity purification, cell lysate was prepared as previously de- mobile and invasive group II introns are proposed to have en- scribed (39). Briefly, yeast cells were collected at midlog phase (OD600 of tered the ancestral eukaryotic lineage with the mitochondrial ∼0.8) and disrupted in RNP-lysis buffer [20 mM Tris·HCl (pH 8.0), 140 mM KCl, endosymbiosis. It is argued that nucleus-cytoplasm compart- 1.8 mM MgCl2, and 0.1% Nonidet P-40] by vortexing (24 s, resting for 1 min, 18 cycles) using zirconia glass beads (Biospec). Lysates were cleared by two mentalization and NMD evolved as a defense against the rounds of ultracentrifugation in a TLA120.1 rotor (Beckman) (40,000 rpm for deleterious effects of group II intron invasion (10, 36, 38). The 28 min and 60,000 rpm for 34 min). To pull down RNAs, extract containing host is then surmised to have evolved the spliceosome, also 2.5 mg of protein was incubated with 25–50 μL of streptavidin resin (Thermo as an adaptive response to intron invasion (36). Our previous Scientific) with rocking at 4 °C overnight; the resin was then washed six times study showed that roadblocks to gene expression in S. cerevisiae with RNP-lysis buffer. For competition assays, cell extract was preincubated are NMD and translational repression (12). Here, we further with 12.5 μg of egg-white avidin (1× corresponds to 5 μg of avidin per demonstrated that RNA mislocalization to the cytoplasm and milligram of protein) for 1 h and the mixture was incubated with strepta- mRNA–pre-mRNA interactions account for reduction of S-mRNA vidin resin. RNPs were eluted with 5 mM biotin for 1 h. RNAs were extracted and translation products. The group II intron-mediated gene from the eluates, and their identities were determined by the primer ex- tension termination assay. silencing could have been the pressure that stimulated spli- DNA oligonucleotides and plasmids used in this work are listed in Tables S1 ceosome evolution and nuclear splicing. Indeed, gene silencing and S2, respectively. was relieved by separation of splicing and translation through retaining pre-mRNA in the nucleus (Fig. 5). Therefore, these ACKNOWLEDGMENTS. We thank Roy Parker for yeast strains and useful observations provide a molecular basis for understanding why discussions, Robert Singer and Susan W. Liebman for plasmids, Hua Shi for group II introns are absent from nuclear genomes, and they the streptavidin aptamer template, Karl Bertrand and Jeff Travis for technical help with the confocal microscope, and Cara Pager and Prashanth support the hypothesis that cytoplasm-nucleus partitioning con- Rangan for comments on the manuscript. This work was supported by tributed to the emergence of spliceosomal introns with the ex- National Institutes of Health Grants GM39422 and GM44844 (to M.B.) and pulsion of group II introns from nuclear genomes. Grant GM52072 (to M.J.C.).

1. Candales MA, et al. (2012) Database for bacterial group II introns. Nucleic Acids Res 22. Glanzer J, et al. (2005) RNA splicing capability of live neuronal dendrites. Proc Natl 40(Database issue):D187–D190. Acad Sci USA 102(46):16859–16864. 2. Belfort M, et al. (2000) Mobile Introns: Pathways and Proteins. Mobile DNA II, eds 23. König H, Matter N, Bader R, Thiele W, Müller F (2007) Splicing segregation: The minor Craig NL, et al. (ASM Press, Washington, DC), pp 761–783. spliceosome acts outside the nucleus and controls cell proliferation. Cell 131(4): 3. Lambowitz AM, Zimmerly S (2011) Group II introns: Mobile ribozymes that invade 718–729. DNA. Cold Spring Harb Perspect Biol 3(8):a003616. 24. Zerbato M, et al. (2013) The brown algae Pl.LSU/2 group II intron-encoded protein has 4. Sontheimer EJ, Gordon PM, Piccirilli JA (1999) Metal ion catalysis during group II in- functional reverse transcriptase and maturase activities. PLoS One 8(3):e58263. – tron self-splicing: Parallels with the spliceosome. Genes Dev 13(13):1729 1741. 25. Kelly SM, Corbett AH (2009) Messenger RNA export from the nucleus: A series of 5. Fica SM, et al. (2013) RNA catalyses nuclear pre-mRNA splicing. Nature 503(7475): – – molecular wardrobe changes. Traffic 10(9):1199 1208.

229 234. BIOCHEMISTRY 26. Saguez C, Olesen JR, Jensen TH (2005) Formation of export-competent mRNP: Es- 6. Cech TR (1986) The generality of self-splicing RNA: Relationship to nuclear mRNA caping nuclear destruction. Curr Opin Cell Biol 17(3):287–293. splicing. Cell 44(2):207–210. 27. Casolari JM, Silver PA (2004) Guardian at the gate: Preventing unspliced pre-mRNA 7. Keating KS, Toor N, Perlman PS, Pyle AM (2010) A structural analysis of the group II – intron active site and implications for the spliceosome. RNA 16(1):1–9. export. Trends Cell Biol 14(5):222 225. 8. Toor N, Keating KS, Taylor SD, Pyle AM (2008) Crystal structure of a self-spliced group 28. Brehm SL, Cech TR (1983) Fate of an intervening sequence ribonucleic acid: Excision II intron. Science 320(5872):77–82. and cyclization of the Tetrahymena ribosomal ribonucleic acid intervening sequence 9. Galej WP, Oubridge C, Newman AJ, Nagai K (2013) Crystal structure of Prp8 reveals in vivo. Biochemistry 22(10):2390–2397. active site cavity of the spliceosome. Nature 493(7434):638–643. 29. Muhlrad D, Decker CJ, Parker R (1994) Deadenylation of the unstable mRNA encoded 10. Martin W, Koonin EV (2006) Introns and the origin of nucleus-cytosol compartmen- by the yeast MFA2 gene leads to decapping followed by 5′→3′ digestion of the talization. Nature 440(7080):41–45. transcript. Genes Dev 8(7):855–866. 11. Roy SW, Gilbert W (2006) The evolution of spliceosomal introns: Patterns, puzzles and 30. Franks TM, Lykke-Andersen J (2008) The control of mRNA decapping and P-body progress. Nat Rev Genet 7(3):211–221. formation. Mol Cell 32(5):605–615. 12. Chalamcharla VR, Curcio MJ, Belfort M (2010) Nuclear expression of a group II intron 31. Chritton JJ, Wickens M (2011) A role for the poly(A)-binding protein Pab1p in PUF is consistent with spliceosomal intron ancestry. Genes Dev 24(8):827–836. protein-mediated repression. J Biol Chem 286(38):33268–33278. 13. Decker CJ, Parker R (2012) P-bodies and stress granules: possible roles in the control of 32. Tsuboi T, Inada T (2010) Tethering of poly(A)-binding protein interferes with non- translation and mRNA degradation. Cold Spring Harb Perspect Biol 4(9):a012286. translated mRNA decay from the 5′ end in yeast. J Biol Chem 285(44):33589–33601. – 14. Yin QF, et al. (2012) Long noncoding RNAs with snoRNA ends. Mol Cell 48(2):219 230. 33. Sheth U, Parker R (2006) Targeting of aberrant mRNAs to cytoplasmic processing 15. Samarsky DA, Fournier MJ, Singer RH, Bertrand E (1998) The snoRNA box C/D motif bodies. Cell 125(6):1095–1109. directs nucleolar targeting and also couples snoRNA synthesis and localization. EMBO 34. Shyu AB, Wilkinson MF, van Hoof A (2008) Messenger RNA regulation: To translate or J 17(13):3747–3757. to degrade. EMBO J 27(3):471–481. 16. Gong C, Maquat LE (2011) lncRNAs transactivate STAU1-mediated mRNA decay by 35. Rodríguez-Trelles F, Tarrío R, Ayala FJ (2006) Origins and evolution of spliceosomal duplexing with 3′ UTRs via Alu elements. Nature 470(7333):284–288. introns. Annu Rev Genet 40:47–76. 17. Gong C, Tang Y, Maquat LE (2013) mRNA-mRNA duplexes that autoelicit Staufen1- 36. Rogozin IB, Carmel L, Csuros M, Koonin EV (2012) Origin and evolution of spliceo- mediated mRNA decay. Nat Struct Mol Biol 20(10):1214–1220. 18. Kim YK, Furic L, Desgroseillers L, Maquat LE (2005) Mammalian Staufen1 recruits Upf1 somal introns. Biol Direct 7:11. to specific mRNA 3′UTRs so as to elicit mRNA decay. Cell 120(2):195–208. 37. Strobel SA (2013) Biochemistry: Metal ghosts in the splicing machine. Nature 503(7475): – 19. Lodish H, Berk A, Zipursky S (2000) Processing of Eukaryotic mRNA. Molecular Cell 201 202. Biology (Freeman, New York), 4th Ed. 38. Lynch M, Kewalramani A (2003) Messenger RNA surveillance and the evolutionary 20. Koonin EV (2006) The origin of introns and their role in eukaryogenesis: A compro- proliferation of introns. Mol Biol Evol 20(4):563–571. mise solution to the introns-early versus introns-late debate? Biol Direct 1:22. 39. Beach DL, Keene JD (2008) Ribotrap: Targeted purification of RNA-specific RNPs from 21. Denis MM, et al. (2005) Escaping the nuclear confines: Signal-dependent pre-mRNA cell lysates through immunoaffinity precipitation to identify regulatory proteins and splicing in anucleate platelets. Cell 122(3):379–391. RNAs. Methods Mol Biol 419:69–91.

Qu et al. PNAS | May 6, 2014 | vol. 111 | no. 18 | 6617 Downloaded by guest on October 1, 2021