The Effects of Melatonin on Colonization of Neonate Spermatogonial Mouse Stem Cells in a Three-Dimensional Soft Agar Culture

Navid et al. Stem Cell Research & Therapy (2017) 8:233 DOI 10.1186/s13287-017-0687-y

RESEARCH Open Access The effects of melatonin on colonization of neonate spermatogonial mouse stem cells in a three-dimensional soft agar culture system Shadan Navid1, Mehdi Abbasi1* and Yumi Hoshino2

Abstract Background: Melatonin is a pleiotropic hormone with powerful antioxidant activity both in vivo and in vitro. The present study aimed to investigate the effects of melatonin on the proliferation efficiency of neonatal mouse spermatogonial stem cells (SSCs) using a three-dimensional soft agar culture system (SACS) which has the capacity to induce development of SSCs similar to in vivo conditions. Methods: SSCs were isolated from testes of neonate mice and their purities were assessed by flow cytometry using PLZF antibody. Isolated testicular cells were cultured in the upper layer of the SACS in αMEM medium in the absence or presence of melatonin extract for 4 weeks. Results: The identity of colonies was confirmed by alkaline phosphatase staining and immunocytochemistry using PLZF and α6 integrin antibodies. The number and diameter of colonies of SSCs in the upper layer were evaluated at days 14 and 28 of culture. The number and diameter of colonies of SSCs were significantly higher in the melatonin group compared with the control group. The levels of expression of ID-4 and Plzf, unlike c-kit, were significantly higher in the melatonin group than in the control group. Conclusions: Results of the present study show that supplementation of the culture medium (SACS) with 100 μM melatonin significantly decreased reactive oxygen species (ROS) production in the treated group compared with the control group, and increased SSC proliferation. Keywords: Spermatogonial stem cell, Melatonin, Colonization, Three-dimensional soft agar culture system, Proliferation

Background critical role in sperm preservation and management of Spermatogonial stem cells (SSCs) are germline precursor infertility, particularly among cancer survivors [3, 4]. cells with the potential to self-renew and generate differ- Recent investigations have focused on the factors entiated germ cells which have the capability of produ- associated with the proliferation of cultured SSCs, such cing progeny cells that form sperms [1]. A paucity of as leukemia inhibitory factor (LIF) [5, 6], glia cell line- these stem cells in the mature testis has limited their derived neurotrophic factor (GDNF) [5, 7], basic fibro- isolation for in vitro studies [2]. In addition, long-term blast growth factor [5, 8], and stem cell factor [9, 10]. All chemotherapy or radiation therapy in cancer patients of these factors have been found to play crucial roles in has a devastating impact on these cells and can result in the development of SSCs in vitro. However, most of these male infertility after the treatment. Therefore, methods experiments commonly investigated two-dimensional cell for efficient in vitro proliferation of SSCs could play a culture systems using culture dishes or flasks [11–13]. The main disadvantage of the two-dimensional model is the lack of metabolic and proliferative gradients similar to * Correspondence: [email protected] 1Department of Anatomy, School of Medicine, Tehran University of Medical the natural SSC niche. In a three-dimensional culture Sciences, Tehran, Iran system, Sertoli cells proliferate and create a monolayer of Full list of author information is available at the end of the article

© The Author(s). 2017 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Navid et al. Stem Cell Research & Therapy (2017) 8:233 Page 2 of 10

cells which forms a feeder layer on top of which SSCs col- Isolation of neonatal testis cells onies are formed [14]. It has been shown that three- Testicular cells were obtained from 3- to 6-day-old NMRI dimensional culture systems improve cell proliferation male mice. Testes were removed from the scrotum and [15]. Some studies have also demonstrated the importance tunica albuginea was removed to obtain the testis tissue. of a three-dimensional structure on the proliferation and The testis tissues were cut into small pieces and trans- differentiation of animal and human SSCs [15–17]. The ferred to the digestion solution containing collagenase soft agar culture system (SACS) is a qualitative, three- type IV (1 mg/ml; Sigma, Germany), DNase (10 μg/ml; dimensional cell culture structure that was first used for Sigma, Germany), and hyaluronidase (0.5 mg/ml; Sigma, clonal expansion of bone marrow cells and exploration of Germany) for 20 min at 37 °C in a 5% CO2 incubator. factors that are associated with the regulation of their pro- Cells were dispersed by pipetting every 2–5 min until the liferation and differentiation [18, 19]. In 2008, Stukenborg tubules were separated. The dispersed cells were centri- et al. published a paper in which they used SACS as a fuged at 1500 g for 5 min and then washed with novel approach to study factors involved in the regulation phosphate-buffered saline (PBS). The second step of en- of the proliferation and differentiation of SSCs. This cul- zymatic digestion was carried out using the same proced- ture system provides a microenvironment similar to in ure and enzymes (15 min). The isolated cells were washed vivo conditions and mimics some aspects of the natural again with PBS [29]. three-dimensional environment to which the SSCs are ex- posed [15]. Melatonin (N-acetyl-5-methoxytryptamine) is Cell viability considered as an important hormone with antioxidant, The viability of testicular cells was assessed by immune response, cell signaling, and neuroprotective methylthiazoltetrazolium (MTT; Sigma, Germany) be- properties [20, 21]. A normal physiological metabolism of fore and after SSC culture in the SACS. Initially, the soft cells generates reactive oxygen species (ROS), especially in upper layer was removed and the cell pellet at the bot- the mitochondria, which can have adverse effects on cell tom of the 15-ml falcon tube was obtained by pipetting signaling involved in the regulation of proliferation and several times with PBS (heated to 37 °C). Following each survival [22]. Melatonin plays a critical role in reducing pipetting, centrifugation was performed at 1500 g for ROS production in cells, and inhibits a potential DNA 5 min. The isolated cells were counted using a mutation resulting from oxidative damage [23]. Similarly, hemocytometer. Finally, the cells were transferred into a Cruz et al. found that the amphiphilic nature of melatonin 96-well culture plate with each well containing a density has an important implication in the protection of mam- of 20 × 103 cells per well per 200 μl; 400 μl MEM and malian gametes and embryos from free radical-mediated 40 μl MTT were added to each well and incubated for oxidative damage and cellular death in vitro [24]. Mela- 4 h at 37 °C in a 5% CO2 incubator. Following the incu- tonin receptors (MT1, MT2) are G protein coupled recep- bation, the medium was replaced with 400 μl dimethyl tors. Several reports have indicated the expression of sulfoxide (DMSO; 1.4 M; Sigma, Germany), and the cells melatonin receptors in rat, mouse, sheep, bovine, and hu- were kept for 30 min at room temperature. The optical man Sertoli cells [25–28]. In this study, we obtained SSCs density (OD) of the plate was measured at 540 nm with from the neonate mouse using two-step enzymatic diges- the microplate reader. tion. The goal of the present study was to investigate the effects of melatonin (antioxidant) supplementation to the Intracellular ROS measurement SACS culture medium containing LIF and GDNF on the The general oxidative stress indicator CM-H2DCFDA was proliferation of neonate mouse SSCs. Our findings show used for the detection of intracellular ROS production. that SACS, along with the novel innovative medium used DCFDA (10 ml; Sigma, Life Technologies C6827) was in this study, inhibits the release of free radicals during in added to the cells and then incubated at 37 °C for 25 min. vitro culture of SSCs and provides a promising strategy The DCFDA fluorescent probe reacts with intracellular for the expansion of SSCs; the survival rate of SSCs was H2O2 to generate fluorescence emission that can be de- enhanced during a 4-week culture period using melatonin tected by flow cytometry. Measurement of intracellular as an important antioxidant in the culture medium. H2O2 production in SACS, before and after culture, was carried out by flow cytometry using DCFDA. The cells Method were washed twice with PBS and then centrifuged at Animals 2500 g for 5 min. Green fluorescence emission was mea- Three- to 6-day-old NMRI (National Medical Research sured between 500 and 530 nm using flow cytometry [30]. Institute) male mice were maintained under standard conditions. Animal experiments in this study were approved Flow cytometry by the ethics committee of Tehran University of Medical The efficiency and purity of the isolated SSCs were Sciences in accordance with the university’sguidelines. quantitatively assessed by flow cytometry. The two-step Navid et al. Stem Cell Research & Therapy (2017) 8:233 Page 3 of 10

enzymatic digestion protocol yielded a single-cell sus- the colonies in each well of the same group (4–6wellsin pension from 3- to 6-day-old male mice. The majority of each group). The culture medium was replaced every these cells were SSCs. The cell suspension (density of 3 days. Three techniques were used to confirm the pres- 2×105 cells/cm2) was transferred to a petri dish coated ence of colonies of SSCs: alkaline phosphatase staining, with gelatin and maintained for 24 h at 37 °C in a 5% immunocytochemistry using plzf and α6 integrin anti- CO2 incubator. The coated dish was then washed twice bodies, and the level of expression of the undifferentiated with PBS and centrifuged at 1500 g for 5 min. To assess genes ID-4 and Plzf using real-time polymerase chain the cellular enrichment percentage after the placement reaction (PCR). of the gelatin-coated dish, flow cytometry was performed by applying standard procedures and using a PLZF Alkaline phosphatase staining (promyelocytic leukemia zinc finger protein) antibody. Alkaline phosphatase activity was assayed by Fast Red Following permeabilization with 0.4% Triton X100 TR/Naphthol AS-MX Tablets (Sigma USA, F4648) ac- (Sigma), 10 μl of primary antibody (anti-PLZF antibody; cording to the manufacturer’s instructions. Alkaline dye Abcam, rabbit polyclonal to plzf) was added to the cells was briefly made by dissolving a Tris tablet in 1 ml of for 1 h at room temperature. The dish was again washed deionized water to form a Tris buffer, after which a twice with 1 ml PBS, and 10 μl of secondary antibody Fast-Red TR/Naphthol AS-MX Tablet was added. The (donkey anti-rabbit; Abcam) conjugated with fluorescein cells were added to the alkaline dye and incubated at 37 °C isothiocyanate (FITC) was added (1 h at 4 °C). In the for 30 min. Subsequently, the cells were observed under an control cells, the primary antibody was omitted [31]. inverted microscope.

SACS Immunocytochemistry for characterization of SSC The SSC culture was prepared according to the proced- colonies ure used by Stukenborg et al. [15]. The SACS was com- Immunocytochemical detection of the PLZF antibody was posed of two layers: the soft layer (upper) and solid layer used to identify the colonies formed by the SSCs. After (lower). The single-cell suspension was added to the soft fixation with 4% paraformaldehyde for 24 h, the cells were upper layer (0.37% (w/v) agar) established on the solid permeabilized with 0.4% Triton X100 (Sigma) and then lower layer (0.5% (w/v) agar), and cultured in a 24-well blocked in 10% goat serum (Sigma). The cells were then plate. The cells (106 cells per well per 200 μl) were cul- incubated with two primary antibodies, rabbit polyclonal tured for 4 weeks in the upper layer of the soft agar anti-PLZF (1:100; Abcam) and rat polyclonal anti-α6- medium consisting of 0.37% agar plus the basic culture integrin (1:100; Sigma-Aldrich), for 2 h at 37 °C. After 2 h medium αMEM containing 10% fetal bovine serum of incubation, the cells were washed with PBS and the sec- (FBS; Sigma, Germany), 1× nonessential amino acids ondary antibody, donkey anti-rabbit or anti-rat labeled (Invitrogen, USA), 0.1 mM 2-mercaptoethanol (Sigma, with FITC and diluted at 1:200 (Sigma), was added for Germany), 100 U/ml penicillin (Sigma, Germany), 3 h. Control cells were treated under similar conditions 100 μg/ml streptomycin (Sigma, Germany), 103 U/ml except for the removal of the primary antibodies. Nuclei human recombinant leukemia inhibitory factor (LIF; were stained with 4,6-diamidino-2-phenylindole (DAPI; B&D, USA), and 10 μg/ml glial cell line-derived neuro- 1 μg/ml; Sigma, Germany). trophic factor (GDNF; R&D, USA). The final volume of the upper layer was 200 μl. The solid lower layer had Real-time PCR 0.5% (w/v) agar plus the basic culture medium αMEM After 4 weeks of culture, the expression levels of containing 10% fetal bovine serum only. Prior to cultur- promyelocytic leukaemia zinc finger protein (Plzf, ing, the solid layer was formed and kept for 2 h at 37 °C undifferentiated gene), DNA-binding protein inhibitor in a 5% CO2 incubator. The final volume of the lower (ID4, undifferentiated gene), and tyrosine-protein kinase layer was 800 μl. Cell suspension was added to the Kit (c-kit, differentiated gene) were measured by real- αMEM culture medium before mixing with the agar. time PCR. Total RNA was extracted by Trizol reagent The agar and the αMEM culture medium were mixed at (Ready Mini Kit, Qiagen, USA) according to the manu- 37 °C and the cells settled on top of the solid lower facturer’s instructions. Total RNA (1 μg) was applied for layer. In the treatment group, melatonin at 50 μMor cDNA synthesis using a cDNA synthesis kit (Transcript 100 μM (Sigma) was added to the basic medium culture First Strand cDNA Synt, Roche, USA) according to the [32]. All culture experiments were maintained in manufacturer’s guidelines. Real-time PCR was carried standard cell culture incubators at 37 °C and 5% CO2.At out in 40 reaction amplification cycles, and Applied the end of days 14 and 28 (the second and fourth week Bioscience 7500 fast with SYBR Green detection was after seeding in the two groups), the diameter and number used for the analysis. Melt curve analysis was performed of colonies formed were measured. We separately counted after each run to detect the presence of nonspecific PCR Navid et al. Stem Cell Research & Therapy (2017) 8:233 Page 4 of 10

products and primer dimers. All samples were normal- group. This concentration was thus used for further ized against glyceraldehyde-3-phosphate dehydrogenase studies (Fig. 2). (GAPDH) (internal control), and the relative quantifica- tion of gene expression was determined using the Evaluation of SSC development using the SACS comparative CT method (ΔΔCT). Primer sequences for After the two-step enzymatic digestion, we cultured the RT-PCR are listed in Table 1. testicular cells for 4 weeks. Isolated testicular cells were cultured in the upper layer of the SACS. Distinct col- Statistical analysis onies appeared in the upper layer of the SACS between Results are expressed as the mean ± standard deviation days 9 and 11 during the culture period. The diameter (SD). Statistical analysis was performed using the unpaired and number of colonies in the upper layer were mea- t test for the gene expression studies. The comparison of sured at the end of second and fourth week (days 14 and the diameter and number of colonies, cell viability, and 28 after seeding in the two groups) (Fig. 3a–d). SSC col- ROS measurements between the test groups were onies appeared between days 9 and 11 in the experimen- performed by repeated analysis of variance (ANOVA) tal group, and on day 13 in the control group. Alkaline followed by a Tukey post-hoc test for internal compari- phosphatase activity of the isolated colonies strongly sons. P ≤ 0.05 was considered statistically significant. suggests a well-accepted embryonic characterization of the stem cells (Fig. 3e). Moreover, for the identification Results of colonies of SSCs in the SACS we detected the expres- Assessment of the purification of SSCs by flow cytometry sion levels of PLZF and α6 integrin by immunocyto- A flow cytometry technique was carried out on the chemistry, and this was confirmed by the presence of supernatant after the placement of the gelatin-coated PLZF protein in the nuclei and α6 integrin protein in dish to assess the percentage of purity of SSCs following SSC cytoplasm, respectively (Fig. 4). The number and the two-step enzymatic digestion. We observed that diameter of colonies in the upper layer were compared 96.1% of all cells expressed Plzf (Fig. 1) which is one of between the groups on days 14 and 28 of culture. In the the most suitable markers for the isolation of undifferen- colony assay, the number and diameter of colonies in tiated SSCs [33]. Other cells of the testes, predominantly the control group were 2.57 ± 1.2 and 150.7 ± 39.5 μm, Sertoli cells, that were transferred into the SACS played respectively, at the end of the second week, and important roles in the formation of colonies of SSCs. 6.07 ± 1.6 and 407.7 ± 77.3 μm, respectively, at the end of the fourth week. In the experimental group, Effect of SACS on the viability of SSCs the number and diameter of colonies were 3.57 ± 0.9 The MTT assay was used to evaluate the viability of and 329.9 ± 76.5 μm, respectively, at the end of the cells. The results show that the majority of the cells second week, and 9.28 ± 1.7 and 602.8 ± 179.5 μm, (91.32 ± 4.2%) were viable immediately after the two-step respectively, at the end of the fourth week. The number enzymatic digestion (P ≤ 0.05). After 4 weeks of culture and diameter of colonies formed in the experimental of SSCs in the SACS, the survival rates of the cells in the group after the fourth week of culture were significantly control group (80.13 ± 9%) and 50 μM melatonin group higher than in the control group (P ≤ 0.001), although the (80.57 ± 5.8%) were not significantly different compared differences were not significant at the end of the second with the fresh cells group (79.8 ± 8%; P ≥ 0.05). However, week. These results show that melatonin supplementation cell viability was significantly (P ≤ 0.05) increased when in the culture medium, along with SACS, can mimic in 100 μM melatonin (91.11 ± 4.3%) was added to the cul- vivo conditions and has a significant effect on the diam- ture medium compared with the control (80.13 ± 9%) eter and number of SSC colonies (Fig. 5).

Table 1 The primer sequences for ID4, Plzf, c-kit, and GAPDH genes Gene name Sequence Product size (bp) Annealing temperature (° C) ID4 Forward: 5'- TCCCGCCCAACAAGAAAGTC -3' 102 60.54 Reverse: 5'- TCAGCAAAGCAGGGTGAGTC-3' Plzf Forward: 5'- CGTTGGGGGTCAGCTAGAAAG -3' 301 57.14 Reverse: 5'- CACCATGATGACCACATCGC-3' c-kit Forward: 5'- AACAACAAAGAGCAAATCCAGG -3' 200 57.67 Reverse: 5'- GGAAGTTGCGTCGGGTCTAT -3' GAPDH Forward: 5'-AGCAAGGACACTGAGCAAGAG-3' 151 60.35 Reverse: 5'- TCGTTCCTCTGATCGTTTCC -3' Navid et al. Stem Cell Research & Therapy (2017) 8:233 Page 5 of 10

C-kit gene had a lower level of expression in the melatonin group compared with the control group; however, the difference was not significant (P ≥ 0.05) (Fig. 6).

Flow cytometric evaluation of intracellular ROS production To measure intracellular ROS production, we used DCFDA which is a specific probe for intracellular H2O2 detection. Measurement of intracellular ROS production before and after SACS was carried out by flow cytometry using the DCFDA probe. ROS production in the fresh group (25.7 ± 0.8%) was significantly (P ≤ 0.0001) higher compared with the control (10.67 ± 0.7%) and melatonin groups (6.46 ± 0.5%) (Fig. 7).

Discussion The present study makes noteworthy contributions by providing valuable tools for the in vitro investigation of SSC proliferation which can be useful in the treatment of male infertility. In the present study, we developed SSC culture in SACS along with melatonin supplementa- Fig. 1 Flow cytometry analysis for the detection of the percentage of purity of SSCs with Plzf marker after the placement of the dish tion as the optimal culture protocol which prevented the coated with gelatin. M1: PLZF-negative cells, M2: PLZF-positive cells release of free radicals during spermatogonial stem cell culture in vitro. In a previous study, the number and diameter of colonies increased in a group treated with Gene expression analysis melatonin in SACS compared with a two-dimensional Expression levels of Plzf, ID-4, and c-kit were examined culture supplemented with date palm pollen (Phoenix using real-time PCR for the evaluation of the prolifera- dactylifera), which confirms our study describing a suc- tion of SSCs in the SACS. The results indicate that the cessive maturation of pre-meiotic SSCs in the culture levels of Plzf and ID-4 expression in the melatonin system. Neonatal mouse SSCs were isolated and group were significantly higher than in the control group enriched with Plzf antibody, which was also used to con- (Plzf, P ≤ 0.001 vs. control; ID-4, P ≤ 0.01 vs. control). firm SSC colonies in the SACS. Plzf antibody has been used in many studies as an indicator for SSC colony detection and purification studies [14, 34]. Several other studies have used different markers for the isolation and detection of these cells, including GFRα1, ID-4, PAX7, etc. [35–37]. However, there is no strong evidence for the efficient isolation of SSCs using these markers, and no efficient and specific SSC markers have yet been identified [38]. The SACS consisted of two phases of different agar concentrations: a softer upper layer and a more solid lower layer. The synthesis of SACS was performed according to the procedure applied by Stukenborg et al. [15]. In this study, we added SSCs to the upper layer of the agar system. Similarly, Elhija et al. [17], Stukenborg et al. [15], and Huleihel et al. [39] reported the addition of SSCs (106 cells per well per 200 μl) to the upper layer of the agar system before culturing in a 24-well plate during their investigations on SSC proliferation. Unlike these studies, we only used a flow cytometry technique for the assessment of the purity of SSCs using Plzf Fig. 2 MTT analysis for assessment of SSC viability in different antibody; 96.1% of all cells expressed this antibody. treatment groups. Data are expressed as means ± SD. **P ≤ 0.01 Other cells of the testes, especially Sertoli cells, were Navid et al. Stem Cell Research & Therapy (2017) 8:233 Page 6 of 10

Fig. 3 Microscopic morphology of SSCs derived from neonatal male mice (five mice at a time in each group). Each type of experiment has three replicates. The sizes of the colonies are shown at the end of the second week (a, c) and the end of the fourth week (b, d) of SACS, as well as being positive for alkaline phosphatase activity (e). After cultivation of SSCs, the diameter and number of colonies increased in both groups, particularly in the experimental (melatonin) group. All the tests performed at least five times

Fig. 4 Immunofluorescent staining of SSC colonies. SSCs were positive for Plzf in the nuclei and α6 integrin in the cytoplasm (green)(b, e), and nuclei were stained with DAPI (blue)(a, d). c, f A merge of Plzf and α6 integrin DAPI. A single SSC cell (arrowhead) proliferated and created a colony of SSCs (arrow). Scale bars =50μm Navid et al. Stem Cell Research & Therapy (2017) 8:233 Page 7 of 10

Fig. 5 Comparison of colony numbers (a)anddiameter(b) between the control and antioxidant groups. Data are expressed as means ± SD. ***P ≤ 0.001 transferred into the upper layer of the SACS which have been identified as the most important upstream shows that these cells have positive effects on factors that regulate SSC self-renewal and spermatocyte development and colony formation in SSCs [15]. Sertoli meiosis [40]. Recent studies have demonstrated the cells are involved in the regulation of proliferation and expression of melatonin receptors (MT1 and MT2) in differentiation of SSCs, particularly through paracrine- Sertoli cells [25] and SSCs [28]. Thus, the fact that mela- and endocrine-mediated signaling pathways. Sertoli cell tonin, in addition to its antioxidant activity, can have growth factor, GDNF, fibroblast growth factor 2 (FGF2), complex biological functions through its receptor ap- Sertoli cell transcription factor, ETS variant 5, nocicep- pears to be justified. Based on these findings, it seems tin, neuregulin 1 (NRG1), and androgen receptor (AR) likely that melatonin, through its receptor on Sertoli cells or SSCs, can directly play a role in the proliferation of SSCs. The isolated cells were cultured in SACS in the absence or presence of melatonin extract. Their viability was evaluated by MTT assay. In this study, we observed a dose-dependent (100 μM) activity of melatonin on SSCs in culture. As previously published, the presence of melatonin in a cell culture can increase the number of viable cells [20, 28]. We added melatonin to the basic culture medium in the SACS, which yielded an increase in cell viability up to 90%. Our results also show that the number of viable cells in the SACS supplemented with melatonin was higher compared with a two-dimensional culture system supplemented with catalase or alpha- tocopherol before culture [41]. We also examined the effects of SACS in combination with LIF and GDNF on the proliferation of SSCs. Although several reports have described culturing SSCs in SACS, they have most commonly focused on stem cell differentiation [15, 17, 39]. Fig. 6 Expression pattern of c-kit, Plzf, and ID4 genes after culture Previous studies have shown that some growth factors, (with antioxidant) analyzed by real-time PCR. Levels of ID4 and Plzf most notably GDNF, can have a long-term positive effect in the antioxidant group had an increased value compared with the on the maintenance of SSCs and may also stimulate control group, but the level of c-kit in the antioxidant group had no division of SSCs [7, 12, 42, 43]. Other studies reported significant differences compared with the control group. Data are that LIF is an essential factor for maintaining pluripo- expressed as means ± SD. **P ≤ 0.01, ***p ≤ 0.001. ns not significant tency and the self-renewing capacity of embryonic stem Navid et al. Stem Cell Research & Therapy (2017) 8:233 Page 8 of 10

Fig. 7 Flow cytometry analysis for the detection of reactive oxygen species (ROS) in different groups. a Fresh group, b control group (without melatonin), c experimental group (melatonin 100 μM). M2: DCFDA-negative cells, M1: DCFDA-positive cells. d ROS production of SSCs before and after SACS analyzed by flow cytometry. Note the significantly lower production of ROS after SACS with 100 μM melatonin compared to the control group. Data are expressed as means ± SD. ***P ≤ 0.0001

cells [44] and SSCs [45]. On the other hand, the pres- of ROS is somewhat necessary for SSC self-renewal in ence of LIF in the culture medium inhibited meiotic vivo [51]. gene expression and increased the percentage of alkaline In another study, Li et al. [52] claimed that melatonin phosphatase-positive cells. Previous studies have also promotes manganese superoxide dismutase (MnSOD) demonstrated that melatonin can play different roles in and sirtuin type 1 (SIRT1) expression, and therefore pro- the cells of the body such as cell signaling, protection of motes busulfan-induced SSC apoptosis in the presence fatty acids from oxidation, oncostatic action, and antia- of high concentrations of ROS and p53. poptotic and anti-aging properties in many cells [21, 46]. A number of studies have demonstrated that the In recent years, much attention has focused on the role addition of melatonin to culture medium can reduce the of melatonin as an antioxidant. Melatonin, as a free rad- potential effects of ROS-induced cell stress in cells such as ical scavenger, plays a vital role in the reduction of ROS oocyte and adipose-derived stem cells (ASCs) [48, 49]. production, and prevents cellular death and potential Gholami et al. [53] carried out a number of investigations DNA mutations resulting from oxidative damage in cul- on the effects of melatonin on SSC transplantation in ture systems [20, 23, 26, 47–49]. One of the most com- azoospermic mice. They showed that melatonin can mon intracellular ROS molecules is H2O2 [50]. We thus improve the structure of testis tissue. In another study evaluated intracellular H2O2 content using a DCFDA- conducted by the same researchers [54], they demon- specific probe. Our findings demonstrate that supple- strated positive effects of melatonin supplementation in mentation with melatonin in SACS can contribute vitrified-thawed testicular germ cells of neonatal mice. greatly to the prevention of the propagation of lipid per- They indicated that melatonin can induce cell prolifera- oxidation in SSC membranes caused by ROS production, tion in normal cells and apoptosis in damaged cells. and can protect SSCs from the adverse effects of these Similarly, Niu et al. [55] found that adding melatonin to free radicals. Conversely, Morimoto et al. [51] reported the culture medium of goat SSCs could increase SSC pro- that ROS formation plays a pivotal role in SSC self- liferation by stimulating the production of GDNF in the renewal via the activation of stress kinases p38 mitogen- Sertoli cell. Measuring the number and diameter of col- activated protein kinase (MAPK) and c-Jun N-terminal onies of SSCs can be used as morphological criteria in in kinase (JNK) pathways. They suggested that the presence vitro studies [41, 56]. In another study, we investigated the Navid et al. Stem Cell Research & Therapy (2017) 8:233 Page 9 of 10

effect of melatonin on SSCs in a two-dimensional culture, Abbreviations and emphasized on the importance of adding melatonin c-kit: Tyrosine-protein kinase Kit; FBS: Fetal bovine serum; FITC: Fluorescein isothiocyanate; GDNF: Glia cell line-derived neurotrophic factor; ID-4: DNA-binding to the culture medium as an antioxidant. We also showed protein inhibitor; LIF: Leukemia inhibitory factor; MTT: Methylthiazoltetrazolium; that the culture of SSCs in SACS is more successful com- NMRI: National Medical Research Institute; PBS: Phosphate-buffered saline; pared to the two-dimensional culture system [57]. PCR: Polymerase chain reaction; PLZF: Promyelocytic leukemia zinc finger protein; ROS: Reactive oxygen species; SACS: Soft agar culture system; In this study, we observed that the number and diam- SSC: Spermatogonial stem cell eter of the colonies increased at the end of each week of culture in the SACS in both groups. The most striking Acknowledgments aspect of our results is the vital antioxidant role of mela- The authors thank the staff of Tehran University of Medical Sciences for animal care. tonin in the culture of SSCs in the SACS which provided protection against lipid peroxidation. Similar to our re- Funding sults, Elhija et al. [17] isolated colonies in the upper layer This is an original article which has been supported by Tehran University of Medical Sciences (grant no. 28042). We are grateful for the funding support of SACS after 14 and 28 days of culture and classified provided by the University. The results described in this article were part of a them according to their size. In contrast to our findings, student thesis. Eslahi et al. [16] indicated that the number and diameter Availability of data and materials of the colonies of SSCs in a poly-L-lactic acid (PLLA) All analyzed data are available in the manuscript or supplementary information. nanofiber scaffold decreased significantly after the first, Raw data or other materials produced in the conduct of these studies are second, and third weeks of culture compared with the available from the authors to qualified investigators upon request. control groups (culture of SSCs not seeded on PLLA). In Authors’ contributions the present study, colonies were composed of cells that SN conceived of the study, performed animal treatments, collected and expressed and stained positive for the mitosis markers analyzed specimens, and analyzed/interpreted data. SN analyzed the PLZF and α6 integrin. Moreover, we used alkaline phos- real-time PCR. SN and YH conceived of and oversaw the study, interpreted data, assisted with figure preparation, and wrote the manuscript. All authors phatase staining to evaluate the colonies of SSCs for al- read and approved the final manuscript. kaline phosphatase activity. It is well known that PLZF and α6 integrin are markers for spermatogonial stem/ Authors’ information progenitor cells in many species [14, 16, 45]. Not applicable. After the fourth week of culture, we analyzed ID-4, Ethics approval Plzf, and c-kit gene expression levels. Our data clearly Animal experiments were approved by the Ethics Committee of Tehran show that melatonin supplementation can increase the University of Medical Sciences and all procedures were performed in ’ proliferation rate of SSCs. The level of PLZF and ID-4 accordance with the university s guidelines. In the present work, we used an animal model considering all the rights based on the Ethical Committee of (undifferentiated genes) expression in the melatonin the Medical Faculty of Tehran University. group were significantly higher than in the control group, whereas the level of c-kit (differentiated gene) ex- Consent for publication Not applicable. pression decreased in the melatonin group. In support of our results, Aliakbari et al. also reported a decrease in Competing interests c-kit expression after they cultured post-thawed SSCs The authors declare that they have no competing interests. treated with antioxidants in both control and treated groups [41]. Our findings are in line with the results of Publisher’s note other previous studies [14, 16, 58]. Springer Nature remains neutral with regard to jurisdictional claims in Results of this research suggest several practical appli- published maps and institutional affiliations. cations. We emphasize the importance of adding mela- Author details tonin to the culture medium as an antioxidant. 1Department of Anatomy, School of Medicine, Tehran University of Medical Sciences, Tehran, Iran. 2Laboratory of Reproductive Endocrinology, Graduate School of Biosphere Science, Hiroshima University, Higashi-Hiroshima, Conclusions Kagamiyama 1-4-4Hiroshima 739-8528, Japan. We conclude that the presence of LIF and GDNF in Received: 7 August 2017 Revised: 18 September 2017 SACS, along with melatonin supplementation in the Accepted: 2 October 2017 basic culture medium, likely creates a testis-like microenvironment in which proliferation of SSCs is promoted. References On the other hand, the major limitation of this study 1. Aponte PM, et al. Propagation of bovine spermatogonial stem cells in vitro. Reproduction. 2008;136(5):543–57. was the inability to isolate live cells from the SACS. 2. Morena AR, et al. Isolation of highly purified type A spermatogonia from Therefore, we could not investigate later stages, and fur- prepubertal rat testis. J Androl. 1996;17(6):708–17. ther study is needed to evaluate their differential fertility 3. Sadri-Ardekani H, et al. Propagation of human spermatogonial stem cells in vitro. JAMA. 2009;302(19):2127–34. potential which is the gold standard for the management 4. Liu S, et al. Isolation and characterization of human spermatogonial stem of those suffering from infertility. cells. Reprod Biol Endocrinol. 2011;9(1):1. Navid et al. Stem Cell Research & Therapy (2017) 8:233 Page 10 of 10

5. Kanatsu-Shinohara M, et al. Long-term proliferation in culture and germline 33. Costa GM, et al. Spermatogonial stem cell markers and niche in equids. transmission of mouse male germline stem cells. Biol Reprod. PLoS One. 2012;7(8):e44091. 2003;69(2):612–6. 34. Costoya JA, et al. Essential role of Plzf in maintenance of spermatogonial 6. De Miguel MP, et al. Leukemia inhibitory factor and ciliary neurotropic stem cells. Nat Genet. 2004;36(6):653–9. factor promote the survival of Sertoli cells and gonocytes in coculture 35. Kumar TR. The quest for male germline stem cell markers: PAX7 gets ID’d. system. Endocrinology. 1996;137(5):1885–93. J Clinical Invest. 2014;124(10):4219–22. 7. Meng X, et al. Regulation of cell fate decision of undifferentiated 36. Sun F, et al. Id4 marks spermatogonial stem cells in the mouse testis. spermatogonia by GDNF. Science. 2000;287(5457):1489–93. Scientific reports. 2015;5:17594. 8. Kubota H, Avarbock MR, Brinster RL. Culture conditions and single growth 37. Khajavi N, et al. Role of somatic testicular cells during mouse spermatogenesis factors affect fate determination of mouse spermatogonial stem cells. Biol in three-dimensional collagen gel culture system. Cell J. 2014;16(1):79. Reprod. 2004;71(3):722–31. 38. Dym M, Kokkinaki M, He Z. Spermatogonial stem cells: mouse and human 9. Allard EK, Blanchard KT, Boekelheide K. Exogenous stem cell factor (SCF) comparisons. Birth Defects Res C Embryo Today. 2009;87(1):27–34. compensates for altered endogenous SCF expression in 2,5-hexanedione- 39. Huleihel M, Nourashrafeddin S, Plant TM. Application of three-dimensional induced testicular atrophy in rats. Biol Reprod. 1996;55(1):185–93. culture systems to study mammalian spermatogenesis, with an emphasis 10. Lee J, Boekelheide K, Blanchard KT. Leuprolide, a gonadotropin-releasing on the rhesus monkey (Macaca mulatta). Asian J Androl. 2015;17(6):972. hormone agonist, reestablishes spermatogenesis after 2,5-hexanedione- 40. Chen S-R, Liu Y-X. Regulation of spermatogonial stem cell self-renewal induced irreversible testicular injury in the rat, resulting in normalized stem and spermatocyte meiosis by sertoli cell signaling. Reproduction. cell factor expression 1. Endocrinology. 1998;139(1):236–44. 2015;149(4):R159–67. 11. Kanatsu-Shinohara M, et al. Generation of pluripotent stem cells from 41. Aliakbari F, et al. Improving the efficacy of cryopreservation of neonatal mouse testis. Cell. 2004;119(7):1001–12. spermatogonia stem cells by antioxidant supplements. Cell Reprogram. 12. Kanatsu-Shinohara M, et al. Long-term culture of mouse male germline 2016;18(2):87–95. stem cells under serum- or feeder-free conditions. Biol Reprod. 42. Kubota H, Avarbock MR, Brinster RL. Growth factors essential for self-renewal 2005;72(4):985–91. and expansion of mouse spermatogonial stem cells. Proc Natl Acad Sci U S A. 13. Nagano M, et al. Maintenance of mouse male germ line stem cells in vitro. 2004;101(47):16489–94. Biol Reprod. 2003;68(6):2207–14. 43. Ebata KT, et al. Soluble growth factors stimulate spermatogonial stem cell 14. Mahaldashtian M, et al. In vitro effects of date palm (Phoenix dactylifera L.) divisions that maintain a stem cell pool and produce progenitors in vitro. pollen on colonization of neonate mouse spermatogonial stem cells. Exp Cell Res. 2011;317(10):1319–29. J Ethnopharmacol. 2016;186:362–8. 44. Fukunaga N, et al. Leukemia inhibitory factor (LIF) enhances germ cell 15. Stukenborg JB, et al. Coculture of spermatogonia with somatic cells differentiation from primate embryonic stem cells. Cell Reprogram. – in a novel three dimensional soft agar culture system. J Androl. 2010;12(4):369 76. 2008;29(3):312–29. 45. Zanganeh BM, et al. Co-culture of spermatogonial stem cells with sertoli 16. Eslahi N, et al. The effects of poly L-lactic acid nanofiber scaffold on mouse cells in the presence of testosterone and FSH improved differentiation via spermatogonial stem cell culture. Inter J Nanomedicine. 2013;8:4563. up-regulation of post meiotic genes. Acta Med Iran. 2013;51(1):1. 17. Elhija MA, et al. Differentiation of murine male germ cells to spermatozoa in 46. Millán-Plano S, et al. Melatonin and structurally-related compounds protect a soft agar culture system. Asian J Androl. 2011;14:285–93. synaptosomal membranes from free radical damage. Inte J Mol Sci. – 18. Lin H, Kuhn C, Kuo T. The Clonal growth of hamster free alveolar cells in 2010;11(1):312 28. soft agar. J Exp Med. 1975;142(4):877–86. 47. Bonnefont-Rousselot D, Collin F. Melatonin: action as antioxidant and 19. Horowitz D, King AG. Colorimetric determination of inhibition of potential applications in human disease and aging. Toxicology. – hematopoietci progenitor cells in soft agar. J Immunol Methods. 2010;278(1):55 67. 2000;244(1):49–58. 48. Tan SS, et al. Melatonin protects human adipose-derived stem cells from – 20. Anisimov VN, et al. Melatonin as antioxidant, geroprotector and oxidative stress and cell death. Archive Plastic Surg. 2016;43(3):237 41. anticarcinogen. Biochim Biophys Acta. 2006;1757(5):573–89. 49. Maitra SK, Hasan KN. The role of melatonin as a hormone and an 21. Hardeland R, et al. Melatonin—a pleiotropic, orchestrating regulator antioxidant in the control of fish reproduction. Front Endocrinol. 2016;7:38. molecule. Prog Neurobiol. 2011;93(3):350–84. 50. Murphy MP. How mitochondria produce reactive oxygen species. – 22. Ray PD, Huang B-W, Tsuji Y. Reactive oxygen species (ROS) homeostasis and Biochemical J. 2009;417(1):1 13. 51. Morimoto H, et al. ROS are required for mouse spermatogonial stem cell redox regulation in cellular signaling. Cell Signal. 2012;24(5):981–90. self-renewal. Cell Stem Cell. 2013;12(6):774–86. 23. He C, et al. Melatonin to ameliorate its function and improve mitochondria 52. Li B, et al. Melatonin ameliorates busulfan-induced spermatogonial stem cell synthesize mice oocyte’s quality under in vitro conditions. Inter J Mol Sci. oxidative apoptosis in mouse testes. Antioxidant Redox Signal. 2017. 2016;17(6):939. 53. Gholami M, et al. Melatonin improves spermatogonial stem cells 24. Cruz MHC, et al. Role of melatonin on production and preservation of transplantation efficiency in azoospermic mice. Iran J Basic Med Sci. gametes and embryos: a brief review. Anim Reprod Sci. 2014;145(3):150–60. 2014;17(2):93. 25. Yang W-C, et al. Melatonin regulates the development and function of 54. Gholami M, et al. Effect of melatonin on the expression of apoptotic genes bovine sertoli cells via its receptors MT1 and MT2. Anim Reprod Sci. in vitrified-thawed spermatogonia stem cells type A of 6-day-old mice. Iran 2014;147(1):10–6. J Basic Med Sci. 2013;16(8):906–9. 26. Chabra A et al. Melatonin ameliorates oxidative stress and reproductive 55. Bowen Niu BL, et al. Melatonin promotes goat spermatogonia stem cells toxicity induced by cyclophosphamide in male mice. Hum Exp Toxicol. (SSCs) proliferation by stimulating glial cell line-derived neurotrophic factor 2014;33(2):185-95. (GDNF) production in sertoli cells. Oncotarget. 2016;7(47):77532. 27. Liu Y, et al. Melatonin modulates acute testicular damage induced by 56. Boyer A, et al. CTNNB1 signaling in sertoli cells downregulates carbon ions in r mice. Pharmazie. 2009;64(10):685. spermatogonial stem cell activity via WNT4. PLoS One. 2012;7(1):e29764. 28. Deng SL, et al. Melatonin promotes development of haploid germ cells 57. Navid S, et al. In vitro effects of melatonin on colonization of neonate from early developing spermatogenic cells of Suffolk sheep under in vitro mouse spermatogonial stem cells. Syst Biol Reprod Med. 2017;5:1–12. condition. J Pineal Res. 2016;60(4):435–47. 58. Mirzapour T, et al. Evaluation of the effects of cryopreservation on viability, 29. Guan K, et al. Isolation and cultivation of stem cells from adult mouse proliferation and colony formation of human spermatogonial stem cells in – testes. Nat Protoc. 2009;4(2):143 54. vitro culture. Andrologia. 2013;45(1):26–34. 30. Rhee SG, et al. Methods for detection and measurement of hydrogen peroxide and outside of cells. Mol Cell. 2010;29(6):539–49. 31. Baazm M, et al. An iproved protocol for reprogramming isolation and culturing of mouse spermatogonial stem cells. Cell Program. 2013;15(4):329–36. 32. Moriya T, et al. Melatonin influences the proliferative and differentiative activity of neural stem cells. J Pineal Res. 2007;42(4):411–8.