DOCSLIB.ORG

Phylogenetic and Taxonomic Position of the Genus Wollea with the Description of Wollea Salina Sp

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Phylogenetic and Taxonomic Position of the Genus Wollea with the Description of Wollea Salina Sp Fottea, Olomouc, 16(1): 43–55, 2016 43 DOI: 10.5507/fot.2015.026 Phylogenetic and taxonomic position of the genus Wollea with the description of Wollea salina sp. nov. (Cyanobacteria, Nostocales) Eliška KozlíKová–zapomělová1, Thomrat CHATCHAWAN2, Jan KaštOVSKÝ3 & Jiří KOMÁREK3,4,* 1 Biology Centre of AS CR, Institute of Hydrobiology, Na Sádkách 7, CZ 37005 České Budějovice, Czech Re- public 2 Maejo University Phrae Campus, Mae Sai, Rong Kwang, 54140, Thailand 3 Department of Botany, Faculty of Science, University of South Bohemia, Branišovská 31, CZ–370 05 České Budějovice, Czech Republic 4 Institute of Botany AS CR and University of South Bohemia, Dukelská 135, CZ – 379 82 Třeboň, Czech Re- public; e–mail: [email protected] Abstract: The taxonomic separation of the related heterocytous cyanobacterial genera Wollea and Anabaena is unclear according to traditional taxonomic features, as modern polyphasic approach has not yet been applied to compare them. However, comparison of the type species of these genera and their polyphasic analyses enable the separation of both generic entities. Definitions of their diacritical characters follow from the combination of their phylogenetic and morphological criteria. The concepts of Anabaena sensu stricto (particularly without planktic types with gas vesicles in cells – Dolichospermum) and Wollea, derived from their types are proposed in the article and their review is presented in the table. A new species from saltworks in southern Thailand, W. salina, is described. Key words: Anabaena, Cyanobacteria, ecology, molecular analyses, morphology, polyphasic approach, taxonomy, Wollea INTRODUCTION larly with respect to molecular evaluation (16S rRNA gene sequences; zapomělová et al. 2013, in litt.). From The little known cyanobacterial genus Wollea is taxo- the traditional concept of Anabaena (GEITLER 1932; nomically classified in the vicinity of the wide, poly- FRITSCH 1949; HOLLERBACH et al. 1953; PRESCOTT 1962; morphic and heterogeneous group of Anabaena–types, BOURRELLY 1970), the generic clades of Chrysosporum, according to the modern combined genetic and mor- Dolichospermum, Sphaerospermopsis and Trichormus phological criteria (polyphasic approach). The mor- have already been separated according to both genetic phological diacritical markers that determine taxa be- and morphological criteria (KOMÁREK & ANAGNOSTIDIS longing to the genus Wollea are fasciculated trichomes 1989; RAJANIEMI et al. 2005a, b; KomáreK & zapomělo- (agglomerated usually in finger–like delimited colo- VÁ 2007, 2008; WACKLIN et al. 2009; zapomělová et al. nies), widely oval akinetes, their position in isopolar fi- 2012; KOMÁREK 2013). However, the part of the origi- laments from both sides of the intercalary heterocytes, nal genus Anabaena sensu stricto (particularly without form of more or less barrel–shaped vegetative cells and planktic and aerotopated genera Dolichospermum and ± rounded conical apical cells. However, according to Sphaerospermopsis) is still heterogeneous according to several authors (e.g., KISELEV from HOLLERBACH et al. phylogenetic analyses (HALINEN et al. 2008; zapomělo- 1953; KOMÁREK 1975), these characters are considered VÁ et al. 2013, in litt.). The different Anabaena clades not to be taxonomically important, and are similar in a (following from the phylogenetic studies) can only be few populations of the type species of the genus Ana- partially characterized by morphological markers, e.g., baena, An. oscillarioides. In principle, both genera (re- by the position and form of akinetes, form of vegetative specting concepts of the type species) contain similar cells, form of apical cells, etc., which have not yet been morphological characters. considered as taxonomically important. Another com- The genus Anabaena is very diverse, particu- plication is that several strains, identified as Anabaena 44 KozlíKová–zapomělová et al.: Position of the genus Wollea oscillarioides, are similar (both morphologically and Molecular analysis. The biomass was harvested in the expo- genetically) to several strains of Wollea saccata, which nential growth phase by repeated centrifugation (centrifuge Z is the type species of the genus Wollea (comp. GEITLER 233 MK–2; Hermle Labortechnik GmbH, Wehingen, Germa- ny), during which the trichomes were washed several times 1932, 1942; DROUET 1978; HINDÁK 2008; KOZHEVNIKOV by physiological solution (NaCl solution, concentration 1 g & KOZHEVNIKOVA 2011; KOMÁREK 2013; and others). .L–1) to remove mucilaginous substances. The biomass sam- The problem is also that the strains isolated and identi- ples were stored at 20 °C until DNA extraction. DNA was fied by various authors as An. oscillarioides and used extracted using the UltraClean (tm) Microbial DNA Isola- in the construction of later phylogenetic trees, occur in tion Kit (MO BIO Laboratories Inc., Carlsbad, CA, USA). a few distant places in the phylogenetic scheme (Fig. The 16S rRNA gene and ITS region were amplified using 1). It is therefore difficult to exactly identify from this primers 16S27F (5´–AGAGTTTGATCCTGGCTCAG–3´) situation, which modifications (resp. clusters) of “Ana- and 23S30R (5´– CTTCGCCTCTGTGTGCCTAGGT–3´) baena oscillarioides” correspond to the types of Ana- (TATON et al. 2003). Amplification was carried out as follows: baena or Wollea. one cycle of 5 min at 94 °C; 10 cycles of 45 s at 94 °C, 45 s at 57 °C, and 2 min at 72 °C; 25 cycles of 45 s at 94 °C, 45 s at The type species of Wollea is not available in 54 °C, and 2 min at 72 °C; followed by a final elongation step exsiccates. Only the typification of Anabaena accord- of 7 min at 72 °C. The PCR product was used as a template ing to the original material is possible, and can be mor- for sequencing with primers 16S27F (TATON et al. 2003) CY- phologically indicated by study of the type slide of An. A781F (a) (5´–AATGGGATTAGATACCCCAGTAGTC–3´) oscillarioides (from Museum National d´Historie Na- (NÜBEL et al. 1997), K6 (5´–GACGGGCCGGTGTGTA- turelle – PC; cf. DROUET 1978). The results presented CA–3´), which is the reverse complement of Primer14 of in this paper and meant to answer the problems stated WILMOTTE et al. (1993), and K8 (5´–AAGGAGGTGAT- above are: CCAGCCACA–3´) (FLECHTNER et al. 2002). Partial sequen- (i) The type exsiccate of Anabaena oscillarioides ces of the 16S rRNA gene (1369 bp) were aligned using the (from PC) has been revised and the concept of the program BioEdit version 7.0.9.0 (HALL 1999) and the alig- nment was edited manually. Phylogenetic trees were con- original genus Anabaena was derived. structed by maximum–likelihood (ML) maximum parsimo- (ii) The positions of strains morphologically iden- ny (MP) and neighbour–joining (NJ) (SAITOU & NEI 1987) tified as An. oscillarioides and distinguishable one algorithms in the program PAUP* version 4.0b10 (SWOFFORD from another according to molecular analysis (the 2003). The topology for the phylogenetic tree was derived 16S rRNA gene sequencing) were determined in from ML. The GTR+I+G evolutionary model of substitution the phylogenetic tree, and the clade morphologica- was found for the best fit to the data using ModelTest 3.7 lly corresponding to the type of An. oscillarioides (POSADA 2008). The parameters (base frequencies, rate ma- was determined. trix of substitution types and shape of gamma distribution) (iii) Phylogenetic relations of cultures, prelimina- were estimated from the data. 100 and 1000 bootstrap repli- cates were performed for ML and NJ analysis, respectively. rily identified as various Wollea–strains (including Nucleotide sequences were deposited at GenBank under the the type species W. saccata) are described, and accession numbers (comp. Tab. S1). comparisons of the genus Wollea to different strains of “Anabaena oscillarioides” (with respect either to the type, or in the sense of the later authors) are presented. ESULTS (iv) The review of the genus Wollea is summarized R in the table, respecting all material available (mor- Separation of the type species of the genera Ana- phological descriptions and results from the 16S baena and Wollea rRNA gene sequencing). The type species of the genus Anabaena, An. oscillari- (v) The taxonomic description of a new species of oides, occurs in literature in several concepts, differing Wollea from halophilic habitats from the marine co- in the form of akinetes (cylindrical up to oval, widely asts of Petchaburi Province, Thailand, is presented. oval to almost spherical), situated either side of the het- erocytes. However, the correct concept must be derived from the type specimen (exsiccate) of An. oscillarioi- METHODS des, which is deposited in the PC Museum collection in Paris. This material was microscopically studied with Optical microscopy. The material used in this study was ob- the following results (Fig. 2): The exsiccate, designat- served using Leitz Dialux 22 and Olympus BX51 microsco- ed MNHN–PC–PC0558651, contains a natural sample pes up to 1000× magnification. Samples of W. salina were with a macroscopic blue–green mat of probably one collected from artificial ponds in solar salterns at 13.30˚N la- morphologically homogeneous colony of densely en- titude and 100.07˚E longitude in Petchaburi Province, Thai- tangled, joined, ± straight or mostly irregularly flexu- land, in November and December 2009 and cultured from the same soil samples on agarised BG11 medium (STANIER ous, not branched and not ensheated filaments or their et al. 1971; with various salt concentrations) at 25 °C, light fragments. Trichomes were composed of wider parts intensity of 28 µmol.m–2.s–1 and a light cycle of 12:12 light/ (segments) with barrel–shaped up to almost spherical dark periods. cells, 4˗6.5 µm wide, transient sometimes immediately DOI: 10.5507/fot.2015.026 Fottea, Olomouc, 16(1):43–55,2016 Table 1. Described species of the traditional genera Wollea, Anabaena (typical, without planktic genera Dolichospermum, Sphaerospermopsis and Chrysosporum), Hydrocoryne and Trichormus, ordered in the table ac- cording to 16S rRNA gene sequencing and morphology (mainly according to the position and form of akinetes), alphabetically ordered in genera. Sequencing of the 16S rRNA gene was only performed in strains from taxa marked by asterisks.
Load more

Recommended publications
  • DOMAIN Bacteria PHYLUM Cyanobacteria
    DOMAIN Bacteria PHYLUM Cyanobacteria D Bacteria Cyanobacteria P C Chroobacteria Hormogoneae Cyanobacteria O Chroococcales Oscillatoriales Nostocales Stigonematales Sub I Sub III Sub IV F Homoeotrichaceae Chamaesiphonaceae Ammatoideaceae Microchaetaceae Borzinemataceae Family I Family I Family I Chroococcaceae Borziaceae Nostocaceae Capsosiraceae Dermocarpellaceae Gomontiellaceae Rivulariaceae Chlorogloeopsaceae Entophysalidaceae Oscillatoriaceae Scytonemataceae Fischerellaceae Gloeobacteraceae Phormidiaceae Loriellaceae Hydrococcaceae Pseudanabaenaceae Mastigocladaceae Hyellaceae Schizotrichaceae Nostochopsaceae Merismopediaceae Stigonemataceae Microsystaceae Synechococcaceae Xenococcaceae S-F Homoeotrichoideae Note: Families shown in green color above have breakout charts G Cyanocomperia Dactylococcopsis Prochlorothrix Cyanospira Prochlorococcus Prochloron S Amphithrix Cyanocomperia africana Desmonema Ercegovicia Halomicronema Halospirulina Leptobasis Lichen Palaeopleurocapsa Phormidiochaete Physactis Key to Vertical Axis Planktotricoides D=Domain; P=Phylum; C=Class; O=Order; F=Family Polychlamydum S-F=Sub-Family; G=Genus; S=Species; S-S=Sub-Species Pulvinaria Schmidlea Sphaerocavum Taxa are from the Taxonomicon, using Systema Natura 2000 . Triochocoleus http://www.taxonomy.nl/Taxonomicon/TaxonTree.aspx?id=71022 S-S Desmonema wrangelii Palaeopleurocapsa wopfnerii Pulvinaria suecica Key Genera D Bacteria Cyanobacteria P C Chroobacteria Hormogoneae Cyanobacteria O Chroococcales Oscillatoriales Nostocales Stigonematales Sub I Sub III Sub
    [Show full text]
  • Efficiency of Partial 16S Rrna Gene Sequencing As Molecular Marker for Phylogenetic Study of Cyanobacteria, with Emphasis on Some Complex Taxa
    Volume 61(1):59-68, 2017 Acta Biologica Szegediensis http://www2.sci.u-szeged.hu/ABS ARTICLE Efficiency of partial 16S rRNA gene sequencing as molecular marker for phylogenetic study of cyanobacteria, with emphasis on some complex taxa Zeinab Shariatmadari1*, Farideh Moharrek2, Hossein Riahi1, Fatemeh Heidari1, Elaheh Aslani1 1Faculty of Life Sciences and Biotechnology, Shahid Beheshti University, G.C. Tehran, Iran 2Department of Plant Biology, Faculty of Biological Sciences, Tarbiat Modares University, Tehran, Iran ABSTRACT At present, the analysis of 16S rRNA gene sequences is the most commonly used KEY WORDS molecular marker for phylogenetic studies of cyanobacteria. However, in many studies partial cyanobacteria sequences is used. To evaluate the performance of this molecular marker, phylogenetic relation- intermixed taxa ship of several taxa from this phylum, especially some intermixed taxa, was studied. We analyzed molecular phylogeny a data set consisting of three categories of cyanobacterial strains, traditionally classified in three taxonomy orders, by morphological and phylogenetic analyses. The phylogenetic analyses were performed 16S rRNA gene with an emphasis on partial 16S rRNA gene sequences (600 bp) and the phylogenetic relation- ships were assessed using Maximum Parsimony, Maximum Likelihood and Bayesian Inference. In morphometric study, numerical taxonomy was performed on several morphospecies, and cluster analysis was performed using SPSS software. Based on the findings of this study, unlike the morphological analysis which was useful in several taxonomic ranks, this molecular marker is recommended for use only in high taxonomic levels such as order and family, because, contrary to our expectations, using partial 16S rRNA gene sequencing in the lower taxonomic levels, even in the genus level, was not necessarily successful.
    [Show full text]
  • The Study on the Cultivable Microbiome of the Aquatic Fern Azolla Filiculoides L
    applied sciences Article The Study on the Cultivable Microbiome of the Aquatic Fern Azolla Filiculoides L. as New Source of Beneficial Microorganisms Artur Banach 1,* , Agnieszka Ku´zniar 1, Radosław Mencfel 2 and Agnieszka Woli ´nska 1 1 Department of Biochemistry and Environmental Chemistry, The John Paul II Catholic University of Lublin, 20-708 Lublin, Poland; [email protected] (A.K.); [email protected] (A.W.) 2 Department of Animal Physiology and Toxicology, The John Paul II Catholic University of Lublin, 20-708 Lublin, Poland; [email protected] * Correspondence: [email protected]; Tel.: +48-81-454-5442 Received: 6 May 2019; Accepted: 24 May 2019; Published: 26 May 2019 Abstract: The aim of the study was to determine the still not completely described microbiome associated with the aquatic fern Azolla filiculoides. During the experiment, 58 microbial isolates (43 epiphytes and 15 endophytes) with different morphologies were obtained. We successfully identified 85% of microorganisms and assigned them to 9 bacterial genera: Achromobacter, Bacillus, Microbacterium, Delftia, Agrobacterium, and Alcaligenes (epiphytes) as well as Bacillus, Staphylococcus, Micrococcus, and Acinetobacter (endophytes). We also studied an A. filiculoides cyanobiont originally classified as Anabaena azollae; however, the analysis of its morphological traits suggests that this should be renamed as Trichormus azollae. Finally, the potential of the representatives of the identified microbial genera to synthesize plant growth-promoting substances such as indole-3-acetic acid (IAA), cellulase and protease enzymes, siderophores and phosphorus (P) and their potential of utilization thereof were checked. Delftia sp. AzoEpi7 was the only one from all the identified genera exhibiting the ability to synthesize all the studied growth promoters; thus, it was recommended as the most beneficial bacteria in the studied microbiome.
    [Show full text]
  • Gradient of Algal and Cyanobacterial Assemblages in a Temporary Lake with Melting Water at Solorina Valley, James Ross Island, Antarctica
    CZECH POLAR REPORTS 4 (2): 185-192, 2014 Gradient of algal and cyanobacterial assemblages in a temporary lake with melting water at Solorina Valley, James Ross Island, Antarctica * Kateřina Skácelová , Miloš Barták Department of Plant Physiology and Anatomy, Institute of Experimental Biology, Faculty of Science, Masaryk University, Kamenice 5, 625 00 Brno, Czech Republic Abstract The aim of presented study is to contribute to species list of algae, cyanobacteria and diatoms from moist localities of James Ross Island, Solorina Valley (63° 53' S, 57° 48' W) in particular. In 2012, samples of microbiological mats were taken from a bottom of shallow depression close to a seashore line. The sampling site has been filled with melt- ing water from glacier for some weeks preceding the collection. On collection date, however it was dried out. The samples were analysed using optical microscopy approach after the transport of samples to Czech Republic (Masaryk University, Brno). Algal and cyanobacterial taxa forming the microbiological mats were determined according to their morphological characteristics and the frequencies of individual taxa occurrence evalu- ated. Species richness differed between individual sampling sites located across a shallow depression suggesting an ecological role of duration of stagnant water for bio- diversity in temporary freshwater ponds. Altogether, 37 algal and cyanobacterial taxa were found. While 23 taxa present in the centre of the depression, only 10 taxa were found close to the margin where the dry period was the longest. Key words: James Ross Island, mats, temporary pond, algae, cyanobacteria DOI: 10.5817/CPR2014-2-19 Introduction Within last decades, species diversity in open question (Vincent 2000).
    [Show full text]
  • Disszertáció
    DOKTORI (PhD) ÉRTEKEZÉS HORVÁTH NÁNDOR MOSONMAGYARÓVÁR 2020 SZÉCHENYI ISTVÁN EGYETEM MEZŐGAZDASÁG- ÉS ÉLELMISZERTUDOMÁNYI KAR MOSONMAGYARÓVÁR Növénytudományi Tanszék Wittmann Antal Növény-, Állat- és Élelmiszer-tudományi Multidiszciplináris Doktori Iskola Doktori Iskola vezetője: Prof. Dr. Ördög Vince egyetemi tanár, az MTA doktora Készült a „Haberlandt Gottlieb Növénytudományi Doktori Program” keretében Programvezető: Prof. Dr. Ördög Vince egyetemi tanár, az MTA doktora Témavezetők: Prof. Dr. Ördög Vince egyetemi tanár, az MTA doktora Dr. habil. Molnár Zoltán, PhD, egyetemi docens A MOSONMAGYARÓVÁRI ALGAGYŰJTEMÉNY (MACC) KORÁBBAN ALAKTANI SZEMPONTBÓL ANABAENA CIANOBAKTÉRIUM NEMZETSÉGBE SOROLT TÖRZSEINEK MOLEKULÁRIS TAXONÓMIAI JELLEMZÉSE Készítette: Horváth Nándor Mosonmagyaróvár 2020 A MOSONMAGYARÓVÁRI ALGAGYŰJTEMÉNY (MACC) KORÁBBAN ALAKTANI SZEMPONTBÓL ANABAENA CIANOBAKTÉRIUM NEMZETSÉGBE SOROLT TÖRZSEINEK MOLEKULÁRIS TAXONÓMIAI JELLEMZÉSE Írta: Horváth Nándor Értekezés doktori (PhD) fokozat elnyerésére Készült a Széchenyi István Egyetem Mezőgazdaság- és Élelmiszertudományi Kar, Wittmann Antal Növény-, Állat- és Élelmiszertudományi Multidiszciplináris Doktori Iskola, Haberlandt Gottlieb Növénytudományi Doktori program keretében Témavezetők: Prof. Dr. Ördög Vince egyetemi tanár, az MTA doktora Dr. habil. Molnár Zoltán, PhD, egyetemi docens Elfogadásra javaslom (igen / nem) (aláírás) A jelölt a doktori szigorlaton…………...% -ot ért el, Mosonmagyaróvár,…..…………………. a Szigorlati Bizottság elnöke Az értekezést bírálóként elfogadásra javaslom
    [Show full text]
  • Cianobactérias Marinhas Bentônicas De Ilhas Costeiras Do Estado De São Paulo, Brasil LILIAN MOS BLOIS CRISPINO1,2,3 E CÉLIA LEITE SANT’ANNA2
    Revista Brasil. Bot., V.29, n.4, p.639-656, out.-dez. 2006 Cianobactérias marinhas bentônicas de ilhas costeiras do Estado de São Paulo, Brasil LILIAN MOS BLOIS CRISPINO1,2,3 e CÉLIA LEITE SANT’ANNA2 (recebido: 18 de agosto de 2005; aceito: 9 de novembro de 2006) ABSTRACT – (Marine benthic cyanobacteria of coastal islands, São Paulo State, Brazil). Marine benthic Cyanobacteria have always been neglected by taxonomic surveys of the Brazilian coast, exception made for some works focusing the shore of the São Paulo State. For island habitats there is only one study carried out for the Cardoso Island. Therefore, the aim of this study is to improve the knowledge about the richness of cyanobacterial species in marine benthic communities from coastal islands of the São Paulo State. The results show the occurrence of 24 species of Cyanobacteria: Oscillatoriales are represented by 12 species (50%), Nostocales by 6 species (25%) and Chroococcales by 6 species (25%). Among the identified species, four represent new references for the South Atlantic: Cyanodermatium gonzaliensis H. Leon-Tejera et al., Xenococcus pallidus (Hansg.) Komárek & Anagn., Microchaete aeruginea Batters and Hydrocoryne spongiosa Bornet & Flahault, and one is a new occurrence for the coast of Brazil: Rivularia atra Roth. Some nomenclatural updatings were adopted according to the Komárek & Agnostidis more recent system of classification. Key words - benthic Cyanobacteria, coastal islands, São Paulo, taxonomy RESUMO – (Cianobactérias marinhas bentônicas de ilhas costeiras do Estado de São Paulo, Brasil). O grupo das cianobactérias marinhas bentônicas vem sendo freqüentemente excluído dos levantamentos taxonômicos da costa brasileira, com exceção de alguns trabalhos para o litoral paulista.
    [Show full text]
  • (Cyanobacterial Genera) 2014, Using a Polyphasic Approach
    Preslia 86: 295–335, 2014 295 Taxonomic classification of cyanoprokaryotes (cyanobacterial genera) 2014, using a polyphasic approach Taxonomické hodnocení cyanoprokaryot (cyanobakteriální rody) v roce 2014 podle polyfázického přístupu Jiří K o m á r e k1,2,JanKaštovský2, Jan M a r e š1,2 & Jeffrey R. J o h a n s e n2,3 1Institute of Botany, Academy of Sciences of the Czech Republic, Dukelská 135, CZ-37982 Třeboň, Czech Republic, e-mail: [email protected]; 2Department of Botany, Faculty of Science, University of South Bohemia, Branišovská 31, CZ-370 05 České Budějovice, Czech Republic; 3Department of Biology, John Carroll University, University Heights, Cleveland, OH 44118, USA Komárek J., Kaštovský J., Mareš J. & Johansen J. R. (2014): Taxonomic classification of cyanoprokaryotes (cyanobacterial genera) 2014, using a polyphasic approach. – Preslia 86: 295–335. The whole classification of cyanobacteria (species, genera, families, orders) has undergone exten- sive restructuring and revision in recent years with the advent of phylogenetic analyses based on molecular sequence data. Several recent revisionary and monographic works initiated a revision and it is anticipated there will be further changes in the future. However, with the completion of the monographic series on the Cyanobacteria in Süsswasserflora von Mitteleuropa, and the recent flurry of taxonomic papers describing new genera, it seems expedient that a summary of the modern taxonomic system for cyanobacteria should be published. In this review, we present the status of all currently used families of cyanobacteria, review the results of molecular taxonomic studies, descriptions and characteristics of new orders and new families and the elevation of a few subfamilies to family level.
    [Show full text]
  • Morphometric and Phylogenetic Analyses of Anabaena Strains (Cyanoprokaryota) from Terrestrial Habitats of Iran
    DOI: http://dx.doi.org/10.22092/ijb.2014.6163 MORPHOMETRIC AND PHYLOGENETIC ANALYSES OF ANABAENA STRAINS (CYANOPROKARYOTA) FROM TERRESTRIAL HABITATS OF IRAN Z. Shariatmadari, H. Riahi & A. Sonboli Received 2013. 11. 09. Accepted for publication 2014. 03. 01 Shariatmadari, Z., Riahi, H. & Sonboli, A. 2014. 06. 31: Morphometric and phylogenetic analyses of Anabaena strains (Cyanoprokaryota) from terrestrial habitats of Iran.- Iran. J. Bot. 20 (1): 119-129. Tehran. In present study, Anabaena isolates were collected from paddy field soils of seven main rice cultivation provinces situated in north, centre, south, west and east of Iran during 2 years from April 2008 to May 2010. Identification of taxa was carried out based on morphometric and molecular methods. Twenty one morphological characters and numerical taxonomic methods were used for classifying the several species of this genus. Numerical taxonomic studies were performed on 34 populations of 13 Anabaena morphospecies. A cluster analysis and principal component analysis performed using SPSS software and rate of resemblance among the species recognized. In the other section of this study phylogenetic relationships were determined by constructing 16S rRNA gene tree using the neighbor-joining algorithm. The results showed that populations of each species were placed close to each other and separate from the other species base on morphological characters. According to factor analysis, colonies form, filament structure, apoheterocytic or paraheterocytic form of filaments, position, shape and number of akinetes in filament, presence or absence of gelatinous sheath were the most variable characters which have been used for identification. Phylogenetic analysis based on 16S rRNA gene sequences also indicated that this gene site cannot separate genera such as Anabaena, Trichormus and Wollea which are morphologicaly close to each other.
    [Show full text]
  • The Diversity of Cyanobacterial Toxins on Structural Characterization, Distribution and Identification: a Systematic Review
    toxins Review The Diversity of Cyanobacterial Toxins on Structural Characterization, Distribution and Identification: A Systematic Review Xingde Du 1, Haohao Liu 1, Le Yuan 1, Yueqin Wang 1, Ya Ma 1, Rui Wang 1, Xinghai Chen 2, Michael D. Losiewicz 2, Hongxiang Guo 3,* and Huizhen Zhang 1,* 1 College of Public Health, Zhengzhou University, Zhengzhou 450001, China; [email protected] (X.D.); [email protected] (H.L.); [email protected] (L.Y.); [email protected] (Y.W.); [email protected] (Y.M.); [email protected] (R.W.) 2 Department of Chemistry and Biochemistry, St Mary’s University, San Antonio, TX 78228, USA; [email protected] (X.C.); [email protected] (M.D.L.) 3 College of Life Sciences, Henan Agricultural University, Zhengzhou 450002, China * Correspondence: [email protected] (H.Z.); [email protected] (H.G.); Tel.: +86-151-8835-7252 (H.Z.); +86-136-4386-7952 (H.G.) Received: 27 August 2019; Accepted: 9 September 2019; Published: 12 September 2019 Abstract: The widespread distribution of cyanobacteria in the aquatic environment is increasing the risk of water pollution caused by cyanotoxins, which poses a serious threat to human health. However, the structural characterization, distribution and identification techniques of cyanotoxins have not been comprehensively reviewed in previous studies. This paper aims to elaborate the existing information systematically on the diversity of cyanotoxins to identify valuable research avenues. According to the chemical structure, cyanotoxins are mainly classified into cyclic peptides, alkaloids, lipopeptides, nonprotein amino acids and lipoglycans. In terms of global distribution, the amount of cyanotoxins are unbalanced in different areas.
    [Show full text]
  • Public Release of Subsurface Management Plan
    Oregon Caves National Monument Subsurface Management Plan 1 TABLE OF CONTENTS I. INTRODUCTION A. Purpose and Significance........................................................................................ 4 B. Legislative and Administrative Requirements......................................................... 5 II. PRESENT RESOURCE STATUS............................................................................. 7 III. DATA COLLECTION A. Cave Classification………………………………………………………………... 12 B. Inventories…………………………………………………………………………. 12 IV. RESOURCE PROTECTION A. Visitor Use 1. Carrying Capacity……………………………………….……………………….12 2. Caving Permits…………………………………………………………………. 13 B. Interpretation 1. Publications............................................................................................ 15 2. Interpretive Tours................................................................................... 16 3. Outreach Programs................................................................................ 16 4. Audio-visual.......................................................................................... 16 5. Visitor Survey....................................................................................... 16 C. Ranger Patrols.......................................................................................................... 17 D. Cave Locations.................................. E. Gates......................................................................................................................... 18 F. Cave Alteration........................................................................................................
    [Show full text]
  • ISPP 2012 14Th Internacional Symposium on Phototrophic Prokaryotes Abstract Book
    ISPP 2012 14th Internacional Symposium on Phototrophic Prokaryotes Abstract Book August 5 to 10 - Porto, Portugal Congress at Porto Palácio Congress Hotel & Spa WWW.IBMC.UP.PT/ISPP2012 ISPP 2012 | INTERNATIONAL SYMPOSIUM ON PHOTOTROPHIC PROKARYOTES Welcome address It’s our great pleasure to welcome all participants to the 14th International Symposium on Pho- totrophic Prokaryotes, in Porto. This symposium aims to cover the current knowledge and the most recent advances of research on phototrophic prokaryotes. The program will focus on the latest scien- tific achievements in the genetics and physiology of these organisms, also addressing their evolution, ecology, mechanisms of interaction with the environment, and biotechnological applications. In addi- tion, this meeting constitutes an opportunity for a valuable exchange of ideas between scientists with different backgrounds and strengths that can help provide future directions to research works. In addition to the social events planned, we hope that you are able to get to know and enjoy the beau- tiful city of Porto. This city is one of the most ancient European cities, classified as World Heritage by UNESCO. Internationally known for its famous Port Wine, the city has other interesting aspects such as landscapes and the historical centre. Besides its welcoming and conservative environment, Porto is also contemporary and artistic. This is shown not only in the streets, architecture, monuments and museums but also in the terraces, restaurants and shopping areas. The organizing committee is looking forward to a very successful meeting! Paula Tamagnini ISPP 2012 Conference Chair IBMC & FCUP University of Porto 03 ISPP 2012 | INTERNATIONAL SYMPOSIUM ON PHOTOTROPHIC PROKARYOTES Date 5-10 August 2012 Venue Porto Palácio Congress Hotel & Spa Av.
    [Show full text]
  • Multiple Adaptations to Polar and Alpine Environments Within Cyanobacteria: a Phylogenomic and Bayesian Approach
    ORIGINAL RESEARCH published: 13 October 2015 doi: 10.3389/fmicb.2015.01070 Multiple adaptations to polar and alpine environments within cyanobacteria: a phylogenomic and Bayesian approach Nathan A. M. Chrismas, Alexandre M. Anesio and Patricia Sánchez-Baracaldo* Bristol Glaciology Centre, School of Geographical Sciences, University of Bristol, Bristol, UK Cyanobacteria are major primary producers in the polar and alpine regions contributing significantly to nitrogen and carbon cycles in the cryosphere. Recent advancements in environmental sequencing techniques have revealed great molecular diversity of microorganisms in cold environments. However, there are no comprehensive phylogenetic analyses including the entire known diversity of cyanobacteria from these Edited by: extreme environments. We present here a global phylogenetic analysis of cyanobacteria Brian D. Lanoil, including an extensive dataset comprised of available small subunit (SSU) rRNA gene University of Alberta, Canada sequences of cyanobacteria from polar and high altitude environments. Furthermore, we Reviewed by: David Moreira, used a large-scale multi-gene (135 proteins and 2 ribosomal RNAs) genome constraint Centre National de la Recherche including 57 cyanobacterial genomes. Our analyses produced the first phylogeny of Scientifique, France cold cyanobacteria exhibiting robust deep branching relationships implementing a Craig Lee Moyer, Western Washington University, USA phylogenomic approach. We recovered several clades common to Arctic, Antarctic *Correspondence: and alpine sites suggesting that the traits necessary for survival in the cold have Patricia Sánchez-Baracaldo, been acquired by a range of different mechanisms in all major cyanobacteria lineages. Bristol Glaciology Centre, School of Geographical Sciences, University Bayesian ancestral state reconstruction revealed that 20 clades each have common of Bristol, Bristol BS8 1SS, UK ancestors with high probabilities of being capable of surviving in cold environments.
    [Show full text]