DOCSLIB.ORG

Morphometric and Phylogenetic Analyses of Anabaena Strains (Cyanoprokaryota) from Terrestrial Habitats of Iran

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Morphometric and Phylogenetic Analyses of Anabaena Strains (Cyanoprokaryota) from Terrestrial Habitats of Iran DOI: http://dx.doi.org/10.22092/ijb.2014.6163 MORPHOMETRIC AND PHYLOGENETIC ANALYSES OF ANABAENA STRAINS (CYANOPROKARYOTA) FROM TERRESTRIAL HABITATS OF IRAN Z. Shariatmadari, H. Riahi & A. Sonboli Received 2013. 11. 09. Accepted for publication 2014. 03. 01 Shariatmadari, Z., Riahi, H. & Sonboli, A. 2014. 06. 31: Morphometric and phylogenetic analyses of Anabaena strains (Cyanoprokaryota) from terrestrial habitats of Iran.- Iran. J. Bot. 20 (1): 119-129. Tehran. In present study, Anabaena isolates were collected from paddy field soils of seven main rice cultivation provinces situated in north, centre, south, west and east of Iran during 2 years from April 2008 to May 2010. Identification of taxa was carried out based on morphometric and molecular methods. Twenty one morphological characters and numerical taxonomic methods were used for classifying the several species of this genus. Numerical taxonomic studies were performed on 34 populations of 13 Anabaena morphospecies. A cluster analysis and principal component analysis performed using SPSS software and rate of resemblance among the species recognized. In the other section of this study phylogenetic relationships were determined by constructing 16S rRNA gene tree using the neighbor-joining algorithm. The results showed that populations of each species were placed close to each other and separate from the other species base on morphological characters. According to factor analysis, colonies form, filament structure, apoheterocytic or paraheterocytic form of filaments, position, shape and number of akinetes in filament, presence or absence of gelatinous sheath were the most variable characters which have been used for identification. Phylogenetic analysis based on 16S rRNA gene sequences also indicated that this gene site cannot separate genera such as Anabaena, Trichormus and Wollea which are morphologicaly close to each other. Zeinab Shariatmadari & Hossein Riahi (correspondence< [email protected]>), Faculty of Biosciences, Shahid Beheshti University, G.C., Tehran, Iran.- Ali Sonboli Biology Department, Medicinal plants and Drugs Research Institute, Shahid Beheshti University, G.C. Tehran, Iran. Key words: Anabaena; cluster analysis; factor analysis; morphospecies; numerical taxonomy ﻣﻄﺎﻟﻌﻪ ﻣﻮرﻓﻮﻣﺘﺮﻳﻚ و ﻓﻴﻠﻮژﻧﺘﻴﻚ ﺳﻮﻳﻪﻫﺎي ﺟﻨﺲ Anabaena در اﻛﻮﺳﻴﺴﺘﻢﻫﺎي ﺧﺸﻜﻲ اﻳﺮان زﻳﻨﺐ ﺷﺮﻳﻌﺘﻤﺪاري: اﺳﺘﺎدﻳﺎر داﻧﺸﻜﺪه ﻋﻠﻮم زﻳﺴﺘﻲ، داﻧﺸﮕﺎه ﺷﻬﻴﺪ ﺑﻬﺸﺘﻲ، ﺗﻬﺮان ﺣﺴﻴﻦ رﻳﺎﺣﻲ: اﺳﺘﺎد داﻧﺸﻜﺪه ﻋﻠﻮم زﻳﺴﺘﻲ، داﻧﺸﮕﺎه ﺷﻬﻴﺪ ﺑﻬﺸﺘﻲ، ﺗﻬﺮان ﻋﻠﻲ ﺳﻨﺒﻠﻲ: اﺳﺘﺎدﻳﺎر ﭘﮋوﻫﺸﻜﺪه ﮔﻴﺎﻫﺎن داروﻳﻲ، داﻧﺸﮕﺎه ﺷﻬﻴﺪ ﺑﻬﺸﺘﻲ، ﺗﻬﺮان ﻣﺰارع ﺑﺮﻧﺞ از ﺟﻤﻠﻪ اﻛﻮﺳﻴﺴﺘﻢﻫﺎي ﺧﺸﻜﻲ ﻫﺴﺘﻨﺪ ﻛﻪ از ﺷﺮاﻳﻂ ﻣﺤﻴﻄﻲ ﻣﻨﺎﺳﺒﻲ ﺑﺮاي رﺷﺪ و اﻧﺘﺸﺎر ﺳﻴﺎﻧﻮﺑﺎﻛﺘﺮيﻫﺎ ﺑﺮﺧﻮردارﻧﺪ. ﺟﻨﺲ Anabaena Bory ex Bornet et Flahault از ﺟﻤﻠﻪ ﻣﻬﻤﺘﺮﻳﻦ ﺟﻠﺒﻚﻫﺎي ﺳﺒﺰ-آﺑﻲ رﺷﺘﻪاي داراي ﻫﺘﺮوﺳﻴﺴﺖ در اﻳﻦ اﻛﻮﺳﻴﺴﺘﻢﻫﺎي ﺧﺸﻜﻲ ﺑﻪﺷﻤﺎر ﻣﻲآﻳﺪ. در ﻣﻄﺎﻟﻌﻪ ﺣﺎﺿﺮ، اﻳﺰوﻟﻪﻫﺎي ﻣﺨﺘﻠﻒ از اﻳﻦ ﺟﻨﺲ، از ﺧﺎك ﻣﺰارع ﺑﺮﻧﺞ 7 اﺳﺘﺎن داراي ﻛﺸﺖ ﺑﺮﻧﺞ واﻗﻊ در ﻣﻨﺎﻃﻖ ﺷﻤﺎﻟﻲ، ﺟﻨﻮﺑﻲ، ﺷﺮﻗﻲ، ﻏﺮﺑﻲ و ﻣﺮﻛﺰي ﻛﺸﻮر، از اردﻳﺒﻬﺸﺖ ﻣﺎه 1387 ﺗﺎ ﺧﺮداد ﻣﺎه 1389، ﺟﻤﻊ آوري و ﻣﻄﺎﻟﻌﻪ ﺷﺪﻧﺪ. ﺷﻨﺎﺳﺎﻳﻲ اﻳﻦ ﺗﺎﻛﺴﻮن ﻫﺎ ﺑﺎ اﺳﺘﻔﺎده از روشﻫﺎي ﻣﻮرﻓﻮﻣﺘﺮﻳﻚ و ﻓﻴﻠﻮژﻧﺘﻴﻚ اﻧﺠﺎم ﺷﺪ. در ﻣﺠﻤﻮع 21 ﺻﻔﺖ ﻣﻮرﻓﻮﻟﻮژﻳﻚ و روشﻫﺎي ﺗﺎﻛﺰوﻧﻮﻣﻲ ﻋﺪدي ﺑﻪ ﻣﻨﻈﻮر ﻃﺒﻘﻪ ﺑﻨﺪي 34 ﺟﻤﻌﻴﺖ از 13 رﻳﺨﺖﮔﻮﻧﻪ از اﻳﻦ ﺟﻨﺲ ﻣﻮرد ارزﻳﺎﺑﻲ ﻗﺮار ﮔﺮﻓﺖ. ﻫﻤﭽﻨﻴﻦ رواﺑﻂ ﻓﻴﻠﻮژﻧﺘﻴﻚ ﺗﺎﻛﺴﻮن ﻫﺎي ﺧﺎﻟﺺ ﺳﺎزي ﺷﺪه از ﻃﺮﻳﻖ رﺳﻢ درﺧﺘﭽﻪ ﻓﻴﻠﻮژﻧﺘﻴﻚ 16S rRNA و ﺑﺎ اﺳﺘﻔﺎده از اﻟﮕﻮرﻳﺘﻢ neighbor-joining ﻣﻮرد ﺑﺮرﺳﻲ ﻗﺮار ﮔﺮﻓﺖ. ﻧﺘﺎﻳﺞ ﺣﺎﺻﻞ از ﺗﺠﺰﻳﻪ ﺧﻮﺷﻪ اي و ﺗﺠﺰﻳﻪ ﺑﻪ ﻣﻮﻟﻔﻪﻫﺎي اﺻﻠﻲ ﺑﺎ اﺳﺘﻔﺎده از ﻧﺮم اﻓﺰار SPSS ﻧﺸﺎﻧﮕﺮ ﮔﺮو هﺑﻨﺪي ﻣﻨﺎﺳﺐ ﺟﻤﻌﻴﺖﻫﺎي ﻣﺘﻌﻠﻖ ﺑﻪ ﻫﺮ ﮔﻮﻧﻪ و ﺗﻔﻜﻴﻚ آﻧﻬﺎ از دﻳﮕﺮ ﮔﻮﻧﻪ ﻫﺎ، ﺗﻨﻬﺎ ﺑﺮ ﻣﺒﻨﺎي ﺻﻔﺎت رﻳﺨﺘﻲ ارزﻳﺎﺑﻲ ﺷﺪه ﺑﻮد. ﻣﺘﻐﻴﻴﺮﺗﺮﻳﻦ ﺻﻔﺎت رﻳﺨﺘﻲ اراﺋﻪ ﺷﺪه در اﻳﻦ ﺑﺮرﺳﻲ ﻋﺒﺎرت ﺑﻮدﻧﺪ از: ﺷﻜﻞ ﻛﻠﻨﻲ؛ ﺳﺎﺧﺘﺎر رﺷﺘﻪ؛ آﭘﻮﻫﺘﺮوﺳﻴﺘﻴﻚ ﻳﺎ ﭘﺎراﻫﺘﺮوﺳﻴﺘﻴﻚ ﺑﻮدن رﺷﺘﻪ؛ ﺟﺎﻳﮕﺎه، ﺷﻜﻞ و ﺗﻌﺪاد اﻛﺎﻳﻨﺖ در رﺷﺘﻪ و ﻧﻴﺰ ﺣﻀﻮر ﻳﺎ ﻋﺪم ﺣﻀﻮر ﻏﻼف ژﻻﺗﻴﻨﻲ. ﻧﺘﺎﻳﺞ ﺣﺎﺻﻞ از آﻧﺎﻟﻴﺰ ﻓﻴﻠﻮژﻧﺘﻴﻚ ﻧﻴﺰ ﺣﺎﻛﻲ از ﻋﺪم ﻛﺎراﻳﻲ آﻧﺎﻟﻴﺰﻫﺎي ﻣﺒﺘﻨﻲ ﺑﺮ ﺳﻜﺎﻧﺲﻫﺎي ژﻧﻲ 16S rRNA در ﺟﺪاﺳﺎزي ﺗﺎﻛﺴﻮنﻫﺎي ﻣﺘﻌﻠﻖ ﺑﻪ ﺟﻨﺲﻫﺎي ﻧﺰدﻳﻚ ﺑﻪ ﻳﻜﺪﻳﮕﺮ ﻧﻈﻴﺮ Anabaena, Wollea و Trichormus و ﻧﻴﺰ ﻧﺸﺎﻧﮕﺮ ﻗﺮاﺑﺖ ژﻧﺘﻴﻜﻲ ﺑﺴﻴﺎر ﺑﺎﻻي اﻳﻦ ﺗﺎﻛﺴﻮﻧﻬﺎ ﺑﻮد. IRAN. J. BOT. 20 (1), 2014 Shariatmadari & al. 120 INTRODUCTION dishes were placed in a culture chamber at 25±1°C and Paddy fields are terrestrial ecosystems that represent a 12/12h light-dark cycle at artificial illumination (2000- favorable environment for the growth of cyanobacteria. 2500 Lux) for two weeks. After colonization, The genus Anabaena Bory ex Bornet et Flahault is the taxonomic determination was carried out by light most important among filamentous heterocystous microscopy (Olympus, Model BH-2) and based on cyanobacteria in these terrestrial ecosystems. This Desikachary (1959), Prescott (1970), Whitford & genus is one of the filamentous, heterocystous, Schumacher (1973), Wehr et al. (2002), John et al. unbranched and not polarized cyanobacteria, classified (2002), Komárek (2005) and Komárek & Zapomělová traditionally in Nostocaceae family (Komárek 2010). In (2008) by prepared semipermanent slides. The stable the most recent classification, the genus Anabaena has vegetative and reproductive characters were used in the been classified under subsection IV family I (Rippka et taxonomic determination. al. 2001). Although there are different opinions Morphometric study on Anabaena strains: regarding to the numbers of species, but for many years Morphometric studies were performed on 34 the 57 Anabaena species recognized by Geitler was the populations of 13 Anabaena morphospecies isolated main reference for the classification in this genus from paddy soils of diverse geographic locations in Iran (Zapomělová 2008). Discrepancy about the number of (Fig. 1, Table 1). In addition two morphospecies of Anabaena species is due to taxonomic problems Nostoc were also used as outgroup in this study. Ten existing in this genus. Contemporaneous use of filaments from each population were used for botanical and bacteriological codes in cyanobacteria morphometric studies. In total 21 quantitative and nomenclature and lack of general nomenclature system qualitative morphological characters were studied for them is one of these problems (Zapomělová 2006). (Table 3). Characters were selected based on those Anabaena species are distributed in several habitats reported by Nayak & Prasanna (2007) and our own such as aquatic and terrestrial ecosystems. One of the field observations. favorable environments for distribution of this genus is Statistical analysis: In order to determine the species paddy fields. Up to now several species from this genus interrelationships, cluster analysis and principal have been reported from paddy field soils (Desikachary component analysis (PCA) were performed. For 1959, Komárek 2005). The number of Anabaena multivariate analyses the mean of quantitative species reported from paddy soils of Iran is around 15 characters were used, while qualitative characters were according to different authors (Nowruzi & coded as binary/multistate characters. Standardized Ahmadimoghadam 2006, Saadatnia & Riahi 2009, variables (mean=0, variance=1) were used for Shariatmadari et al. 2011, Shariatmadari et al. 2013). multivariate statistical analyses. The average taxonomic Available literatures dealing with systematic and distance and squared Euclidean distance were used as biosystematic of Anabaena species also indicate the dissimilarity coefficient in cluster analysis of importance of these taxa (Komárek 2005, Nayak & morphological data (Podani 2000). In this study, SPSS Prasanna 2007, Komárek & Zapomělová 2008, Nayak software was used for statistical analysis. et al. 2009, Tuji & Niiyama 2010), but no report is Culture condition and DNA extraction: 12 cultures available on the biosystematic of Anabaena species and of purified Anabaena isolates were used for their populations from Iran. The present study therefore phylogenetic study. The most important taxonomic is considering numerical taxonomic study of 34 details of isolates are listed in Table 4. DNA extraction populations belonging to 13 Anabaena morphospecies was carried out by AccuPrep® genomic DNA and trying to reveal the inter-population morphological extraction kit from Bioneer Inc. variation and inter-specific relationships. Phylogenetic Amplification of the 16S rRNA gene and sequencing: analysis based on 16S rRNA gene sequences also was PCR amplification was performed according to used to demonstrate the correct position of the other Ezhilarasi and Anand (2009). Amplification of the 16S close genera such as Trichormus and Wollea. rRNA gene was carried out by PCR using primers A2 (AGAGTTTGATCCTGGCTCAG) and S8 MATERIALS AND METHODS (TCTACGCATTTCACCGCTAC). The PCR mixture Isolation and identification of cyanobacteria: Soil contained 10 µl Taq commercial buffer, 10 µl purified samples were collected from 13 paddy fields from DNA, 150 µM of each dNTP, 500 ng of each primer and April 2008 to May 2010 according to Rangaswamy 2.5 U Taq polymerase. Total reaction volume was 100 µl method (1996). The collected soil samples were after an initial cycle consisting of 4 min at 95˚C, 35 transferred to sterile Petri dishes and sterilized nitrate cycles of amplification were started (1 min at 95˚C, 1 free BG-11 medium (Stanier et al. 1971) was added min at 59˚C and 2 min at 72˚C). The termination cycle and the pH adjusted in 8.1 after sterilization. The Petri was 8 min at 72˚C. The PCR products were migrated 121 Anabaena strains from terrestrial habitats of Iran IRAN. J. BOT. 20 (1), 2014 Fig. 1. Geographical distribution of studied area. either on 1% (w/v) agarose gel and visualized by separated taxa of these two genera from each other ethidium bromide. Proper
Load more

Recommended publications
  • Phylogenetic and Taxonomic Position of the Genus Wollea with the Description of Wollea Salina Sp
    Fottea, Olomouc, 16(1): 43–55, 2016 43 DOI: 10.5507/fot.2015.026 Phylogenetic and taxonomic position of the genus Wollea with the description of Wollea salina sp. nov. (Cyanobacteria, Nostocales) Eliška KozlíKová–zapomělová1, Thomrat CHATCHAWAN2, Jan KaštOVSKÝ3 & Jiří KOMÁREK3,4,* 1 Biology Centre of AS CR, Institute of Hydrobiology, Na Sádkách 7, CZ 37005 České Budějovice, Czech Re- public 2 Maejo University Phrae Campus, Mae Sai, Rong Kwang, 54140, Thailand 3 Department of Botany, Faculty of Science, University of South Bohemia, Branišovská 31, CZ–370 05 České Budějovice, Czech Republic 4 Institute of Botany AS CR and University of South Bohemia, Dukelská 135, CZ – 379 82 Třeboň, Czech Re- public; e–mail: [email protected] Abstract: The taxonomic separation of the related heterocytous cyanobacterial genera Wollea and Anabaena is unclear according to traditional taxonomic features, as modern polyphasic approach has not yet been applied to compare them. However, comparison of the type species of these genera and their polyphasic analyses enable the separation of both generic entities. Definitions of their diacritical characters follow from the combination of their phylogenetic and morphological criteria. The concepts of Anabaena sensu stricto (particularly without planktic types with gas vesicles in cells – Dolichospermum) and Wollea, derived from their types are proposed in the article and their review is presented in the table. A new species from saltworks in southern Thailand, W. salina, is described. Key words: Anabaena, Cyanobacteria, ecology, molecular analyses, morphology, polyphasic approach, taxonomy, Wollea INTRODUCTION larly with respect to molecular evaluation (16S rRNA gene sequences; zapomělová et al. 2013, in litt.).
    [Show full text]
  • DOMAIN Bacteria PHYLUM Cyanobacteria
    DOMAIN Bacteria PHYLUM Cyanobacteria D Bacteria Cyanobacteria P C Chroobacteria Hormogoneae Cyanobacteria O Chroococcales Oscillatoriales Nostocales Stigonematales Sub I Sub III Sub IV F Homoeotrichaceae Chamaesiphonaceae Ammatoideaceae Microchaetaceae Borzinemataceae Family I Family I Family I Chroococcaceae Borziaceae Nostocaceae Capsosiraceae Dermocarpellaceae Gomontiellaceae Rivulariaceae Chlorogloeopsaceae Entophysalidaceae Oscillatoriaceae Scytonemataceae Fischerellaceae Gloeobacteraceae Phormidiaceae Loriellaceae Hydrococcaceae Pseudanabaenaceae Mastigocladaceae Hyellaceae Schizotrichaceae Nostochopsaceae Merismopediaceae Stigonemataceae Microsystaceae Synechococcaceae Xenococcaceae S-F Homoeotrichoideae Note: Families shown in green color above have breakout charts G Cyanocomperia Dactylococcopsis Prochlorothrix Cyanospira Prochlorococcus Prochloron S Amphithrix Cyanocomperia africana Desmonema Ercegovicia Halomicronema Halospirulina Leptobasis Lichen Palaeopleurocapsa Phormidiochaete Physactis Key to Vertical Axis Planktotricoides D=Domain; P=Phylum; C=Class; O=Order; F=Family Polychlamydum S-F=Sub-Family; G=Genus; S=Species; S-S=Sub-Species Pulvinaria Schmidlea Sphaerocavum Taxa are from the Taxonomicon, using Systema Natura 2000 . Triochocoleus http://www.taxonomy.nl/Taxonomicon/TaxonTree.aspx?id=71022 S-S Desmonema wrangelii Palaeopleurocapsa wopfnerii Pulvinaria suecica Key Genera D Bacteria Cyanobacteria P C Chroobacteria Hormogoneae Cyanobacteria O Chroococcales Oscillatoriales Nostocales Stigonematales Sub I Sub III Sub
    [Show full text]
  • Efficiency of Partial 16S Rrna Gene Sequencing As Molecular Marker for Phylogenetic Study of Cyanobacteria, with Emphasis on Some Complex Taxa
    Volume 61(1):59-68, 2017 Acta Biologica Szegediensis http://www2.sci.u-szeged.hu/ABS ARTICLE Efficiency of partial 16S rRNA gene sequencing as molecular marker for phylogenetic study of cyanobacteria, with emphasis on some complex taxa Zeinab Shariatmadari1*, Farideh Moharrek2, Hossein Riahi1, Fatemeh Heidari1, Elaheh Aslani1 1Faculty of Life Sciences and Biotechnology, Shahid Beheshti University, G.C. Tehran, Iran 2Department of Plant Biology, Faculty of Biological Sciences, Tarbiat Modares University, Tehran, Iran ABSTRACT At present, the analysis of 16S rRNA gene sequences is the most commonly used KEY WORDS molecular marker for phylogenetic studies of cyanobacteria. However, in many studies partial cyanobacteria sequences is used. To evaluate the performance of this molecular marker, phylogenetic relation- intermixed taxa ship of several taxa from this phylum, especially some intermixed taxa, was studied. We analyzed molecular phylogeny a data set consisting of three categories of cyanobacterial strains, traditionally classified in three taxonomy orders, by morphological and phylogenetic analyses. The phylogenetic analyses were performed 16S rRNA gene with an emphasis on partial 16S rRNA gene sequences (600 bp) and the phylogenetic relation- ships were assessed using Maximum Parsimony, Maximum Likelihood and Bayesian Inference. In morphometric study, numerical taxonomy was performed on several morphospecies, and cluster analysis was performed using SPSS software. Based on the findings of this study, unlike the morphological analysis which was useful in several taxonomic ranks, this molecular marker is recommended for use only in high taxonomic levels such as order and family, because, contrary to our expectations, using partial 16S rRNA gene sequencing in the lower taxonomic levels, even in the genus level, was not necessarily successful.
    [Show full text]
  • The Study on the Cultivable Microbiome of the Aquatic Fern Azolla Filiculoides L
    applied sciences Article The Study on the Cultivable Microbiome of the Aquatic Fern Azolla Filiculoides L. as New Source of Beneficial Microorganisms Artur Banach 1,* , Agnieszka Ku´zniar 1, Radosław Mencfel 2 and Agnieszka Woli ´nska 1 1 Department of Biochemistry and Environmental Chemistry, The John Paul II Catholic University of Lublin, 20-708 Lublin, Poland; [email protected] (A.K.); [email protected] (A.W.) 2 Department of Animal Physiology and Toxicology, The John Paul II Catholic University of Lublin, 20-708 Lublin, Poland; [email protected] * Correspondence: [email protected]; Tel.: +48-81-454-5442 Received: 6 May 2019; Accepted: 24 May 2019; Published: 26 May 2019 Abstract: The aim of the study was to determine the still not completely described microbiome associated with the aquatic fern Azolla filiculoides. During the experiment, 58 microbial isolates (43 epiphytes and 15 endophytes) with different morphologies were obtained. We successfully identified 85% of microorganisms and assigned them to 9 bacterial genera: Achromobacter, Bacillus, Microbacterium, Delftia, Agrobacterium, and Alcaligenes (epiphytes) as well as Bacillus, Staphylococcus, Micrococcus, and Acinetobacter (endophytes). We also studied an A. filiculoides cyanobiont originally classified as Anabaena azollae; however, the analysis of its morphological traits suggests that this should be renamed as Trichormus azollae. Finally, the potential of the representatives of the identified microbial genera to synthesize plant growth-promoting substances such as indole-3-acetic acid (IAA), cellulase and protease enzymes, siderophores and phosphorus (P) and their potential of utilization thereof were checked. Delftia sp. AzoEpi7 was the only one from all the identified genera exhibiting the ability to synthesize all the studied growth promoters; thus, it was recommended as the most beneficial bacteria in the studied microbiome.
    [Show full text]
  • Disszertáció
    DOKTORI (PhD) ÉRTEKEZÉS HORVÁTH NÁNDOR MOSONMAGYARÓVÁR 2020 SZÉCHENYI ISTVÁN EGYETEM MEZŐGAZDASÁG- ÉS ÉLELMISZERTUDOMÁNYI KAR MOSONMAGYARÓVÁR Növénytudományi Tanszék Wittmann Antal Növény-, Állat- és Élelmiszer-tudományi Multidiszciplináris Doktori Iskola Doktori Iskola vezetője: Prof. Dr. Ördög Vince egyetemi tanár, az MTA doktora Készült a „Haberlandt Gottlieb Növénytudományi Doktori Program” keretében Programvezető: Prof. Dr. Ördög Vince egyetemi tanár, az MTA doktora Témavezetők: Prof. Dr. Ördög Vince egyetemi tanár, az MTA doktora Dr. habil. Molnár Zoltán, PhD, egyetemi docens A MOSONMAGYARÓVÁRI ALGAGYŰJTEMÉNY (MACC) KORÁBBAN ALAKTANI SZEMPONTBÓL ANABAENA CIANOBAKTÉRIUM NEMZETSÉGBE SOROLT TÖRZSEINEK MOLEKULÁRIS TAXONÓMIAI JELLEMZÉSE Készítette: Horváth Nándor Mosonmagyaróvár 2020 A MOSONMAGYARÓVÁRI ALGAGYŰJTEMÉNY (MACC) KORÁBBAN ALAKTANI SZEMPONTBÓL ANABAENA CIANOBAKTÉRIUM NEMZETSÉGBE SOROLT TÖRZSEINEK MOLEKULÁRIS TAXONÓMIAI JELLEMZÉSE Írta: Horváth Nándor Értekezés doktori (PhD) fokozat elnyerésére Készült a Széchenyi István Egyetem Mezőgazdaság- és Élelmiszertudományi Kar, Wittmann Antal Növény-, Állat- és Élelmiszertudományi Multidiszciplináris Doktori Iskola, Haberlandt Gottlieb Növénytudományi Doktori program keretében Témavezetők: Prof. Dr. Ördög Vince egyetemi tanár, az MTA doktora Dr. habil. Molnár Zoltán, PhD, egyetemi docens Elfogadásra javaslom (igen / nem) (aláírás) A jelölt a doktori szigorlaton…………...% -ot ért el, Mosonmagyaróvár,…..…………………. a Szigorlati Bizottság elnöke Az értekezést bírálóként elfogadásra javaslom
    [Show full text]
  • (Cyanobacterial Genera) 2014, Using a Polyphasic Approach
    Preslia 86: 295–335, 2014 295 Taxonomic classification of cyanoprokaryotes (cyanobacterial genera) 2014, using a polyphasic approach Taxonomické hodnocení cyanoprokaryot (cyanobakteriální rody) v roce 2014 podle polyfázického přístupu Jiří K o m á r e k1,2,JanKaštovský2, Jan M a r e š1,2 & Jeffrey R. J o h a n s e n2,3 1Institute of Botany, Academy of Sciences of the Czech Republic, Dukelská 135, CZ-37982 Třeboň, Czech Republic, e-mail: [email protected]; 2Department of Botany, Faculty of Science, University of South Bohemia, Branišovská 31, CZ-370 05 České Budějovice, Czech Republic; 3Department of Biology, John Carroll University, University Heights, Cleveland, OH 44118, USA Komárek J., Kaštovský J., Mareš J. & Johansen J. R. (2014): Taxonomic classification of cyanoprokaryotes (cyanobacterial genera) 2014, using a polyphasic approach. – Preslia 86: 295–335. The whole classification of cyanobacteria (species, genera, families, orders) has undergone exten- sive restructuring and revision in recent years with the advent of phylogenetic analyses based on molecular sequence data. Several recent revisionary and monographic works initiated a revision and it is anticipated there will be further changes in the future. However, with the completion of the monographic series on the Cyanobacteria in Süsswasserflora von Mitteleuropa, and the recent flurry of taxonomic papers describing new genera, it seems expedient that a summary of the modern taxonomic system for cyanobacteria should be published. In this review, we present the status of all currently used families of cyanobacteria, review the results of molecular taxonomic studies, descriptions and characteristics of new orders and new families and the elevation of a few subfamilies to family level.
    [Show full text]
  • ISPP 2012 14Th Internacional Symposium on Phototrophic Prokaryotes Abstract Book
    ISPP 2012 14th Internacional Symposium on Phototrophic Prokaryotes Abstract Book August 5 to 10 - Porto, Portugal Congress at Porto Palácio Congress Hotel & Spa WWW.IBMC.UP.PT/ISPP2012 ISPP 2012 | INTERNATIONAL SYMPOSIUM ON PHOTOTROPHIC PROKARYOTES Welcome address It’s our great pleasure to welcome all participants to the 14th International Symposium on Pho- totrophic Prokaryotes, in Porto. This symposium aims to cover the current knowledge and the most recent advances of research on phototrophic prokaryotes. The program will focus on the latest scien- tific achievements in the genetics and physiology of these organisms, also addressing their evolution, ecology, mechanisms of interaction with the environment, and biotechnological applications. In addi- tion, this meeting constitutes an opportunity for a valuable exchange of ideas between scientists with different backgrounds and strengths that can help provide future directions to research works. In addition to the social events planned, we hope that you are able to get to know and enjoy the beau- tiful city of Porto. This city is one of the most ancient European cities, classified as World Heritage by UNESCO. Internationally known for its famous Port Wine, the city has other interesting aspects such as landscapes and the historical centre. Besides its welcoming and conservative environment, Porto is also contemporary and artistic. This is shown not only in the streets, architecture, monuments and museums but also in the terraces, restaurants and shopping areas. The organizing committee is looking forward to a very successful meeting! Paula Tamagnini ISPP 2012 Conference Chair IBMC & FCUP University of Porto 03 ISPP 2012 | INTERNATIONAL SYMPOSIUM ON PHOTOTROPHIC PROKARYOTES Date 5-10 August 2012 Venue Porto Palácio Congress Hotel & Spa Av.
    [Show full text]
  • Cyanobacteria)
    573 Non-marine algae of Australia: 1. Survey of colonial gelatinous blue-green macroalgae (Cyanobacteria) Stephen Skinner and Timothy J. Entwisle Abstract Skinner, S. and Entwisle, T.J. (Royal Botanic Gardens Sydney, Mrs Macquaries Road, Sydney NSW 2000, Australia. e-mail: [email protected]) 2001. Non-marine algae of Australia: 1. Survey of colonial gelatinous blue-green macroalgae (Cyanobacteria). Telopea 9(3): 573–599. Non-planktonic freshwater and terrestrial blue-green algae (Cyanobacteria) large enough to be noticeable even to casual observers, are frequently encountered in Australia, but appear only occasionally in the literature. Sixteen species of gelatinous colonial blue-green algae (Cyanobacteria) from Australia, are documented here. Two species — Nostoc borzioides and Rivularia concentrica — are new to science, and nine (Aphanothece caldariorum Richter, A. pallida (Kützing) Rabenhorst; Nostochopsis lobatus H.C. Wood ex Bornet & Flahault; Rivularia aquatica de Wilde; Gloeotrichia pilgeri Schmidle; Dichothrix gypsophila (Kützing) Bornet & Flahault; Nostoc flagelliforme Berkley & Curtis; Nostoc pruniforme (L.) C. Agardh ex Bornet & Flahault; Nostoc gelatinosum Schousboe in Bornet) are newly recorded from Australia. The others are Rivularia beccariana; Cylindrospermum licheniforme; Cylindrospermum stagnale; Nostoc commune and Nostoc verrucosum. Keys to the genera and species occurring in Australia are provided. Introduction This is the first of an occasional series of papers documenting new algal records and new taxa from non-marine habitats in Australia. The information is floristic rather than monographic, responding to an urgent need for information about the diversity of algae in freshwater and terrestrial habitats in Australia. The descriptions and illustrations are from Australian material, while protologues or authoratitive oversees descriptions have been consulted.
    [Show full text]
  • Pdf 150.46 K
    رﺳﺘﻨﯿﻬﺎ 19(2): 188–184 (1397) - ﻣﻘﺎﻟﻪ ﮐﻮﺗﺎه Rostaniha 19(2): 184–188 (2018) - Short Article Cylindrospermum voukii and Wollea saccata, new records for algal flora of Iran Received: 22.09.2018 / Accepted: 21.11.2018 Zeinab Shariatmadari: Assistant Prof., Faculty of Life Sciences and Biotechnology, Shahid Beheshti University, G.C. Tehran, Iran Maedeh Davari: MSc Student, Faculty of Life Sciences and Biotechnology, Shahid Beheshti University, G.C. Tehran, Iran Hossein Riahi: Prof., Faculty of Life Sciences and Biotechnology, Shahid Beheshti University, G.C. Tehran, Iran ([email protected]) Zakieh Modaressi: MSc Student, Faculty of Life Sciences and Biotechnology, Shahid Beheshti University, G.C. Tehran, Iran Abstract Cyanobacteria represent a small taxonomic group of photosynthetic prokaryotes which some of them are capable of N2 fixation and also possess a tremendous potential for producing a wide range of secondary metabolites. It has been suggested that, some of these microorganisms, especially heterocystous cyanobacteria, assist higher plant growth by supplying growth stimulating substances. During a floristic study of algae in the terrestrial habitats of Iran, cyanobacterial taxa presented in natural habitats of a medicinal plant (Tanacetum parthenium), located in Lorestan province (Iran) is isolated and identified. Among identified taxa, two species, Cylindrospermum voukii, and Wollea saccata are reported as new records from Nostocaceae family in Iran. Beside description of the new taxa, general distribution, as well as camera lucida
    [Show full text]
  • Archive of SID
    Archive of SID رﺳﺘﻨﯿﻬﺎ 19(2): 188–184 (1397) - ﻣﻘﺎﻟﻪ ﮐﻮﺗﺎه Rostaniha 19(2): 184–188 (2018) - Short Article Cylindrospermum voukii and Wollea saccata, new records for algal flora of Iran Received: 22.09.2018 / Accepted: 21.11.2018 Zeinab Shariatmadari: Assistant Prof., Faculty of Life Sciences and Biotechnology, Shahid Beheshti University, G.C. Tehran, Iran Maedeh Davari: MSc Student, Faculty of Life Sciences and Biotechnology, Shahid Beheshti University, G.C. Tehran, Iran Hossein Riahi: Prof., Faculty of Life Sciences and Biotechnology, Shahid Beheshti University, G.C. Tehran, Iran ([email protected]) Zakieh Modaressi: MSc Student, Faculty of Life Sciences and Biotechnology, Shahid Beheshti University, G.C. Tehran, Iran Abstract Cyanobacteria represent a small taxonomic group of photosynthetic prokaryotes which some of them are capable of N2 fixation and also possess a tremendous potential for producing a wide range of secondary metabolites. It has been suggested that, some of these microorganisms, especially heterocystous cyanobacteria, assist higher plant growth by supplying growth stimulating substances. During a floristic study of algae in the terrestrial habitats of Iran, cyanobacterial taxa presented in natural habitats of a medicinal plant (Tanacetum parthenium), located in Lorestan province (Iran) is isolated and identified. Among identified taxa, two species, Cylindrospermum voukii, and Wollea saccata are reported as new records from Nostocaceae family in Iran. Beside description of the new taxa, general distribution, as well
    [Show full text]
  • Nomenclatural Changes in Heterocytous Cyanoprokaryotes (Cyanobacteria, Cyanophytes)
    Fottea 12(1): 141–148, 2012 141 Nomenclatural changes in heterocytous Cyanoprokaryotes (Cyanobacteria, Cyanophytes) Jiří KOMÁRE K Institute of Botany AS CR, Dukelská 135, CZ–37982 Třeboň, Czech Republic Abstract: The criteria for systematic classification of Cyanoprokaryota (Cyanobacteria, Cyanophyta) were changed considerably in last decades. The molecular and morphological analyses, ecological characterization and biochemical markers are indispensable premises for modern cyanobacterial taxonomic re–classification. Many genera were divided, newly described and numerous species were transferred in generic entities, characterized on the basis of molecular, ecological and revised morphological criteria. All of the proposed taxonomic changes are included in the manuscript of the recently prepared 3rd volume of “Cyanoprokaryotes” in the frame of the new edited compendium Süsswasserflora von Mitteleuropa” (2nd edition, volume 19/3, Heterocytous genera). The used taxonomic status of many taxa is already clearly revised in numerous modern publications, but in several cases the nomenclatural consequences were not yet validly published (new combinations, few new names of taxa). However, it is necessary to publish validly the corrected names before edition of any monographic review. The valid nomenclatural transfer of 9 species, one new name and description of two species, the changed position of which follows without doubts from the recent modern revisions, are therefore included in the present article. The validation is published in agreement with the last edition of Botanical Nomenclatoric Code (ICBN; MCNEILL et al., ed. 2007). All the mentioned species belong to the heterocytous monophyletic group Nostocales (or Nostochineae, respectively), and are arranged alphabetically. Key words: Cyanoprokaryotes, Cyanobacteria, Cyanophyceae, taxonomy, nomenclature, new combinations, new taxa Introduction COMPÈRE , Bull.
    [Show full text]
  • New Insights in the Morphology and Phylogeny of Heterocytous Cyanobacteria from Peru, Including the Description of New Taxa
    University of South Bohemia in České Budějovice Faculty of Sciences New insights in the morphology and phylogeny of heterocytous cyanobacteria from Peru, including the description of new taxa Master’s thesis Leonardo Humberto Mendoza Carbajal Supervisor: PhD. Esther Berrendero Gómez České Budějovice 2018 Mendoza Carbajal, L. H. 2018: New insights in the morphology and phylogeny of heterocytous cyanobacteria from Peru, including the description of new taxa. Mgr. Thesis, in English. - 88 p. + Appendix (10 figures and 1 table), Faculty of Sciences, University of South Bohemia, České Budějovice, Czech Republic. Annotation: Morphology and phylogeny for 36 heterocytous cyanobacterial strains are studied. Discussion with morphological, ecological, and phylogenetically related taxa is given for each strain. Potentially new genera and species are found, one of them being proposed as a novel genus. I hereby declare that I have worked on my master thesis independently and used only the sources listed in the bibliography. I hereby declare that, in accordance with Article 47b of Act No. 111/1998 in the valid wording, I agree with the publication of my master dissertation thesis, in full form resulting from deletion of indicated parts to be kept in the Faculty of Science archive, in electronic form in publicly accessible part of the STAG database operated by the University of South Bohemia in České Budějovice accessible through its web pages. Further, I agree to the electronic publication of the comments of my supervisor and thesis opponents and the record of the proceedings and results of the thesis defence in accordance with aforementioned Act No. 111/1998. I also agree to the comparison of the text of my thesis with the Theses.cz thesis database operated by the National Registry of University Theses and a plagiarism detection system.
    [Show full text]