DOCSLIB.ORG

Gill Symbionts of the Cold-Seep Mussel Bathymodiolus Platifrons

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Gill Symbionts of the Cold-Seep Mussel Bathymodiolus Platifrons Fish and Shellfish Immunology 86 (2019) 246–252 Contents lists available at ScienceDirect Fish and Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi Full length article Gill symbionts of the cold-seep mussel Bathymodiolus platifrons: Composition, environmental dependency and immune control T ∗ ∗∗ Jiajia Yua,c, Minxiao Wanga,b, Baozhong Liua,b, Xin Yuea, , Chaolun Lia,b, a CAS Key Laboratory of Experimental Marine Biology, Institute of Oceanology, Center for Ocean Mega-Science, Chinese Academy of Sciences, 7 Nanhai Road, Qingdao, 266071, China b Laboratory for Marine Biology and Biotechnology, Qingdao National Laboratory for Marine Science and Technology, 1 Wenhai Road, Qingdao, 266000, China c University of Chinese Academy of Sciences, Beijing, 100049, China ARTICLE INFO ABSTRACT Keywords: Deep-sea Bathymodiolus mussels depend on the organic carbon supplied by symbionts inside their gills. In this Bathymodiolus platifrons study, optimized methods of quantitative real-time PCR and fluorescence in situ hybridization targeted to both Methanotrophs mRNA and 16S rRNA were used to investigate the gill symbionts of the cold-seep mussel Bathymodiolus platifrons, FISH including species composition, environmental dependency and immune control by the host. Our results showed qRT-PCR that methanotrophs were the major symbiotic bacteria in the gills of B. platifrons, while thiotrophs were scarce. Lysosomal system In the mussels freshly collected from the deep sea, methanotrophs were housed in bacteriocytes in a unique circular pattern, and a lysosome-related gene (VAMP) encoding a vesicle-associated membrane protein was expressed at a high level and presented exactly where the methanotrophs occurred. After the mussels were reared for three months in aquaria without methane supply, the abundance of methanotrophs decreased sig- nificantly and their circle-shaped distribution pattern disappeared; in addition, the expression of VAMP de- creased significantly. These results suggest that the symbiosis between B. platifrons and methanotrophs is in- fluenced by the environment and that the lysosomal system plays an important immune role in controlling the abundance of endosymbionts in host. This study provides a reliable method for investigating symbionts in deep- sea mussels and enriches the knowledge about symbionts in B. platifrons. 1. Introduction type I methanotrophs that use methane as an electron donor and energy source, have been observed in the gills of B. platifrons [10,11]. How- Mussels of the genus Bathymodiolus are one of the dominant species ever, thiotrophs, another type of typical symbiotic bacteria in Bath- in two kinds of unique deep-sea habitats, cold seeps and hydrothermal ymodiolus mussels, have not been investigated in B. platifrons. A study vents, which are characterized by abundant reduced compounds (i.e., investigating the composition of symbiotic bacteria in B. platifrons CH4,H2S). These mussels exhibit a very high biomass in the harsh deep- would provide more information about this mussel and its deep-sea sea environment [1], owning to their symbiosis with chemosynthetic adaptations. bacteria which can provide energy. Methanotrophs and thiotrophs have A large number of symbionts are able to present inside B. platifrons been reported to be the most typical symbiotic bacteria in Bath- and be controlled without unregulated proliferation. Therefore, there ymodiolus mussels. Some mussel species, e.g., B. childressi, B. japonicas must be a control or immunity mechanism in the host mussel re- and B. thermophilus, harbor only one kind of symbiotic bacteria [2–4]. sponsible for maintaining the balance of endosymbionts. The lysosomal Some species of Bathymodiolus, e.g., B. azoricus, B. sp. and B. brooksi, system plays an important role in the immune response to bacteria by a live in dual symbioses with two types of bacteria [5–8]. B. platifrons, host [12]. Previous studies in pea aphids showed that the lysosomal first described by Hashimoto and Okutani in 1994, is a deep-sea mussel system could regulate the Buchnera endosymbiont population and common in both cold seeps and hydrothermal vents in the Western maintain homeostasis by degrading the symbionts [13,14]. In a study Pacific Ocean [9]. High densities of symbionts, which appeared to be comparing deep-sea mussels to the shallow-water mussel Modiolus ∗ Corresponding author. ∗∗ Corresponding author. CAS Key Laboratory of Experimental Marine Biology, Institute of Oceanology, Center for Ocean Mega-Science, Chinese Academy of Sciences, 7 Nanhai Road, Qingdao, 266071, China. E-mail addresses: [email protected] (X. Yue), [email protected] (C. Li). https://doi.org/10.1016/j.fsi.2018.11.041 Received 8 June 2018; Received in revised form 16 October 2018; Accepted 16 November 2018 Available online 17 November 2018 1050-4648/ © 2018 Elsevier Ltd. All rights reserved. J. Yu et al. Fish and Shellfish Immunology 86 (2019) 246–252 kurilensis, Zheng et al. [15] found that the expression of most genes Table 1 involved in the lysosomal system were upregulated in the deep-sea Primers used in this study. mussels. The concurrence of an upregulated lysosomal gene expression Primer Sequence(5‘-3‘)Tm and a high endosymbiosis biomass suggests a key role of the lysosomal system in controlling the abundance of symbionts. The vesicle-asso- 16S rDNA-1 F:AAGCGTTCGTAGGCGGTTATT 60 °C ciated membrane protein (VAMP) is a key component of the lysosomal R:CTTTCGTTCCTCAGCGTCAGT fi 16S rDNA-2 F:GAGTAACGCGTAGGAATCTGC 58 °C system and is required for the formation of speci c membrane com- R:CGAAGGTCCTCCACTTTACTCCATAGAG partments, in which symbionts are hosted in a controlled manner by the VAMP-RT-1 F: CACAGAAGTCACAGACCAGA 60 °C host [16]. In this study, the expression of VAMP was analyzed to R: TGCTCGAACACCATACTGA identify the role of the lysosomal system in controlling the symbionts in 28S rDNA F:CCATCTAAGGCTAAATACCGACAC 60 °C the deep-sea mussel B. platifrons. R:GCGGGTCTTTACAGATCCCTATC VAMP-1 F: GAACAACTGTCTTAGCCAAAT 58 °C The abundance of chemosynthetic symbionts in Bathymodiolus R: CACCACAAGCTGCTGATAT mussels is reportedly environmentally dependent. In B. azoricus, the relative abundances of methanotrophs and thiotrophs differed between mussels from two hydrothermal vent sites [17]. In addition, Bettencourt 2.2. PCR amplification of 16S rDNAs/specific genes for methanotrophs and et al. [18] transferred B. azoricus from a vent to aquaria at atmospheric thiotrophs pressure and found that after two weeks, the number of symbionts decreased significantly. Sun et al. [19] investigated the change in the To validate the existence of methanotrophs and thiotrophs in B. abundance of methanotrophs in B. platifrons after a 34-day rearing and platifrons, PCR amplifications of the 16S rDNAs and specific genes of found that the abundance of symbionts declined significantly. None- methanotrophs and thiotrophs were performed. The primer pairs spe- theless, limited information is available regarding the response of cific to the 16S rDNA of methanotrophs (16S rDNA-1, Table 1) and symbionts in deep-sea mussels after a longer laboratory-rearing period, thiotrophs (16S rDNA-2, Table 1) were designed by Primer Premier 5 e.g., more than two months. based on the 16S rDNA sequences of methanotrophs or thiotrophs in Several different detection methods have been used to investigate deep-sea mussels provided by the NCBI database. The primer pairs used the change in symbionts abundance in Bathymodiolus mussels, including to amplify pmoA, a gene encoding subunit A of the particulate methane fluorescence in situ hybridization (FISH) [17,20,21] and quantitative monooxygenase (A189gc and Mb661), and aprA, a gene encoding the real-time PCR (qRT-PCR) [19,22]. For FISH, two kinds of probes were alpha-subunit of adenosine-5‘-phosphosulfate reductase (AprA-1-FW used, including the 16S rRNA probe and mRNA probe targeted to a and AprA-5-RV), correspond to sequences from previous studies specific functional gene of the symbiotic bacteria. For qRT-PCR, it also [21,23,24]. Total genomic DNA was extracted from the gills of each commonly targets to the 16S rDNA or a specific functional gene of the sampled mussel using a commercial DNA extraction kit especially for symbiotic bacteria. FISH technique helped to visually study the dis- marine animals (Tiangen, China). The DNA mixture of all freshly col- tribution pattern of symbionts, while qRT-PCR was used for quantifying lected individuals from deep sea was used as the PCR template. The the abundance of symbionts. The combination of FISH and qRT-PCR PCR reactions were performed using a LA PCR kit (TaKaRa, Japan). The provides comprehensive information on both the distribution and PCR parameters were as follows: 94 °C for 5 min, 35 cycles of 94 °C for quantity of symbionts. 30 s, nºC (n = Tm of each primer pair, Table 1) for 30 s and 72 °C for In this study, FISH and qRT-PCR methods were applied to analyze 1min, followed by the final extension at 72 °C for 10 min. The PCR symbiont composition in the gills of B. platifrons and to detect both the products were purified and then cloned into the pGEM-T-Easy vector change in symbionts abundance and the expression variance of VAMP (Promega, USA). The recombinant plasmids were transformed into in B. platifrons under different environments (i.e., cold seep in the deep competent Escherichia coli cells, which were cultured on the LB plates at sea or laboratory-reared in methane-absent seawater for three months). 37 °C overnight. Positive clones with the recombinant plasmid were We focused on whether two kinds of popular symbiotic bacteria (i.e., further confirmed by PCR and then were cultured and regrown in LB methanotrophs and thiotrophs) occurred in B. platifrons and the en- broth. A large number of the recombinant plasmids were extracted from vironmental dependency of these bacteria; furthermore, the role of the the bacteria culture and then sequenced by the Sanger method. The lysosomal system in the control of symbionts by the host was in- sequences were analyzed with BLAST against the NCBI database.
Load more

Recommended publications
  • Adaptation to Deep-Sea Chemosynthetic Environments As Revealed by Mussel Genomes
    ARTICLES PUBLISHED: 3 APRIL 2017 | VOLUME: 1 | ARTICLE NUMBER: 0121 Adaptation to deep-sea chemosynthetic environments as revealed by mussel genomes Jin Sun1, 2, Yu Zhang3, Ting Xu2, Yang Zhang4, Huawei Mu2, Yanjie Zhang2, Yi Lan1, Christopher J. Fields5, Jerome Ho Lam Hui6, Weipeng Zhang1, Runsheng Li2, Wenyan Nong6, Fiona Ka Man Cheung6, Jian-Wen Qiu2* and Pei-Yuan Qian1, 7* Hydrothermal vents and methane seeps are extreme deep-sea ecosystems that support dense populations of specialized macro benthos such as mussels. But the lack of genome information hinders the understanding of the adaptation of these ani- mals to such inhospitable environments. Here we report the genomes of a deep-sea vent/seep mussel (Bathymodiolus plati- frons) and a shallow-water mussel (Modiolus philippinarum). Phylogenetic analysis shows that these mussel species diverged approximately 110.4 million years ago. Many gene families, especially those for stabilizing protein structures and removing toxic substances from cells, are highly expanded in B. platifrons, indicating adaptation to extreme environmental conditions. The innate immune system of B. platifrons is considerably more complex than that of other lophotrochozoan species, including M. philippinarum, with substantial expansion and high expression levels of gene families that are related to immune recognition, endocytosis and caspase-mediated apoptosis in the gill, revealing presumed genetic adaptation of the deep-sea mussel to the presence of its chemoautotrophic endosymbionts. A follow-up metaproteomic analysis of the gill of B. platifrons shows metha- notrophy, assimilatory sulfate reduction and ammonia metabolic pathways in the symbionts, providing energy and nutrients, which allow the host to thrive. Our study of the genomic composition allowing symbiosis in extremophile molluscs gives wider insights into the mechanisms of symbiosis in other organisms such as deep-sea tubeworms and giant clams.
    [Show full text]
  • New Records of Three Deep-Sea Bathymodiolus Mussels (Bivalvia: Mytilida: Mytilidae) from Hydrothermal Vent and Cold Seeps in Taiwan
    352 Journal of Marine Science and Technology, Vol. 27, No. 4, pp. 352-358 (2019) DOI: 10.6119/JMST.201908_27(4).0006 NEW RECORDS OF THREE DEEP-SEA BATHYMODIOLUS MUSSELS (BIVALVIA: MYTILIDA: MYTILIDAE) FROM HYDROTHERMAL VENT AND COLD SEEPS IN TAIWAN Meng-Ying Kuo1, Dun- Ru Kang1, Chih-Hsien Chang2, Chia-Hsien Chao1, Chau-Chang Wang3, Hsin-Hung Chen3, Chih-Chieh Su4, Hsuan-Wien Chen5, Mei-Chin Lai6, Saulwood Lin4, and Li-Lian Liu1 Key words: new record, Bathymodiolus, deep-sea, hydrothermal vent, taiwanesis (von Cosel, 2008) is the only reported species of cold seep, Taiwan. this genus from Taiwan. It was collected from hydrothermal vents near Kueishan Islet off the northeast coast of Taiwan at depths of 200-355 m. ABSTRACT Along with traditional morphological classification, mo- The deep sea mussel genus, Bathymodiolus Kenk & Wilson, lecular techniques are commonly used to study the taxonomy 1985, contains 31 species, worldwide. Of which, one endemic and phylogenetic relationships of deep sea mussels. Recently, species (Bathymodiolus taiwanesis) was reported from Taiwan the complete mitochondrial genomes have been sequenced (MolluscaBase, 2018). Herein, based on the mitochondrial COI from mussels of Bathymodiolus japonicus, B. platifrons and results, we present 3 new records of the Bathymodiolus species B. septemdierum (Ozawa et al., 2017). Even more, the whole from Taiwan, namely Bathymodiolus platifrons, Bathymodiolus genome of B. platifrons was reported with sequence length of securiformis, and Sissano Bathymodiolus sp.1 which were collected 1.64 Gb nucleotides (Sun et al., 2017). from vent or seep environments at depth ranges of 1080-1380 Since 2013, under the Phase II National energy program of m.
    [Show full text]
  • M208p147.Pdf
    MARINE ECOLOGY PROGRESS SERIES Vol. 208: 147–155, 2000 Published December 8 Mar Ecol Prog Ser Phylogenetic characterization of endosymbionts in three hydrothermal vent mussels: influence on host distributions Yoshihiro Fujiwara1,*, Ken Takai2, Katsuyuki Uematsu3, Shinji Tsuchida1, James C. Hunt1, Jun Hashimoto1 1Marine Ecosystems Research Department, Japan Marine Science and Technology Center (JAMSTEC), 2-15 Natsushima, Yokosuka 237-0061, Japan 2Frontier Research Program for Deep-Sea Environment, Japan Marine Science and Technology Center (JAMSTEC), 2-15 Natsushima, Yokosuka 237-0061, Japan 3Marine Work Japan Co., 2-15 Natsushima, Yokosuka 237-0061, Japan ABSTRACT: The bacterial endosymbionts of 3 hydrothermal vent mussels from Japanese waters were characterized by transmission electron microscopic (TEM) observation and phylogenetic analy- ses of 16S ribosomal RNA gene sequences. Endosymbionts of Bathymodiolus septemdierum were related to sulfur-oxidizing bacteria (thioautotrophs), while endosymbionts of B. platifrons and B. japonicus were related to methane-oxidizing bacteria (methanotrophs). This is the first report of deep-sea mussels containing only methanotrophs (lacking thioautotrophs) from hydrothermal vents. Comparison of methane and hydrogen sulfide concentrations in end-member fluids from deep-sea hydrothermal vents indicated that methane concentrations were much higher in habitats containing Bathymodiolus spp. which harbored only methanotrophs than in other habitats of hydrothermal vent mussels. The known distribution of other
    [Show full text]
  • Dispersal and Differentiation of Deep-Sea Mussels of the Genus Bathymodiolus (Mytilidae, Bathymodiolinae)
    Hindawi Publishing Corporation Journal of Marine Biology Volume 2009, Article ID 625672, 15 pages doi:10.1155/2009/625672 Research Article Dispersal and Differentiation of Deep-Sea Mussels of the Genus Bathymodiolus (Mytilidae, Bathymodiolinae) Akiko Kyuno,1 Mifue Shintaku,1 Yuko Fujita,1 Hiroto Matsumoto,1 Motoo Utsumi,2 Hiromi Watanabe,3 Yoshihiro Fujiwara,3 and Jun-Ichi Miyazaki4 1 Institute of Biological Sciences, University of Tsukuba, Tsukuba, Ibaraki 305-8572, Japan 2 Institute of Agricultural and Forest Engineering, University of Tsukuba, Tsukuba, Ibaraki 305-8572, Japan 3 Research Program for Marine Biology and Ecology, Japan Agency for Marine-Earth Science and Technology (JAMSTEC), Natsushima, Yokosuka, Kanagawa 237-0061, Japan 4 Faculty of Education and Human Sciences, University of Yamanashi, Kofu, Yamanashi 400-8510, Japan Correspondence should be addressed to Jun-Ichi Miyazaki, [email protected] Received 22 February 2009; Revised 27 May 2009; Accepted 30 July 2009 Recommended by Horst Felbeck We sequenced the mitochondrial ND4 gene to elucidate the evolutionary processes of Bathymodiolus mussels and mytilid relatives. Mussels of the subfamily Bathymodiolinae from vents and seeps belonged to 3 groups and mytilid relatives from sunken wood and whale carcasses assumed the outgroup positions to bathymodioline mussels. Shallow water mytilid mussels were positioned more distantly relative to the vent/seep mussels, indicating an evolutionary transition from shallow to deep sea via sunken wood and whale carcasses. Bathymodiolus platifrons is distributed in the seeps and vents, which are approximately 1500 km away. There was no significant genetic differentiation between the populations. There existed high gene flow between B. septemdierum and B.
    [Show full text]
  • Genomics and Transcriptomics of the Green Mussel Explain the Durability
    www.nature.com/scientificreports OPEN Genomics and transcriptomics of the green mussel explain the durability of its byssus Koji Inoue1*, Yuki Yoshioka1,2, Hiroyuki Tanaka3, Azusa Kinjo1, Mieko Sassa1,2, Ikuo Ueda4,5, Chuya Shinzato1, Atsushi Toyoda6 & Takehiko Itoh3 Mussels, which occupy important positions in marine ecosystems, attach tightly to underwater substrates using a proteinaceous holdfast known as the byssus, which is tough, durable, and resistant to enzymatic degradation. Although various byssal proteins have been identifed, the mechanisms by which it achieves such durability are unknown. Here we report comprehensive identifcation of genes involved in byssus formation through whole-genome and foot-specifc transcriptomic analyses of the green mussel, Perna viridis. Interestingly, proteins encoded by highly expressed genes include proteinase inhibitors and defense proteins, including lysozyme and lectins, in addition to structural proteins and protein modifcation enzymes that probably catalyze polymerization and insolubilization. This assemblage of structural and protective molecules constitutes a multi-pronged strategy to render the byssus highly resistant to environmental insults. Mussels of the bivalve family Mytilidae occur in a variety of environments from freshwater to deep-sea. Te family incudes ecologically important taxa such as coastal species of the genera Mytilus and Perna, the freshwa- ter mussel, Limnoperna fortuneri, and deep-sea species of the genus Bathymodiolus, which constitute keystone species in their respective ecosystems 1. One of the most important characteristics of mussels is their capacity to attach to underwater substrates using a structure known as the byssus, a proteinous holdfast consisting of threads and adhesive plaques (Fig. 1)2. Using the byssus, mussels ofen form dense clusters called “mussel beds.” Te piled-up structure of mussel beds enables mussels to support large biomass per unit area, and also creates habitat for other species in these communities 3,4.
    [Show full text]
  • Mytilidae: Bathymodiolinae)
    Open Journal of Marine Science, 2013, 3, 31-39 http://dx.doi.org/10.4236/ojms.2013.31003 Published Online January 2013 (http://www.scirp.org/journal/ojms) Dispersal Ability and Environmental Adaptability of Deep-Sea Mussels Bathymodiolus (Mytilidae: Bathymodiolinae) Jun-Ichi Miyazaki1*, Saori Beppu1, Satoshi Kajio1, Aya Dobashi1, Masaru Kawato2, Yoshihiro Fujiwara2, Hisako Hirayama2 1Faculty of Education and Human Sciences, University of Yamanashi, Kofu, Japan 2Institute of Biogeosciences, Japan Agency for Marine-Earth Science and Technology, Yokosuka, Japan Email: *[email protected] Received October 12, 2012; revised November 17, 2012; accepted November 29, 2012 ABSTRACT Dispersal ability and environmental adaptability are profoundly associated with colonization and habitat segregation of deep-sea animals in chemosynthesis-based communities, because deep-sea seeps and vents are patchily distributed and ephemeral. Since these environments are seemingly highly different, it is likely that vent and seep populations must be genetically differentiated by adapting to their respective environments. In order to elucidate dispersal ability and envi- ronmental adaptability of deep-sea mussels, we determined mitochondrial ND4 sequences of Bathymodiolus platifrons and B. japonicus obtained from seeps in the Sagami Bay and vents in the Okinawa Trough. Among more than 20 spe- cies of deep-sea mussels, only three species in the Japanese waters including the above species can inhabit both vents and seeps. We examined phylogenetic relationships, genetic divergences (Fst), gene flow (Nm), and genetic population structures to compare the seep and vent populations. Our results showed no genetic differentiation and extensive gene flow between the seep and vent populations, indicating high dispersal ability of the two species, which favors coloniza- tion in patchy and ephemeral habitats.
    [Show full text]
  • Sea Mussel Bathymodiolus Platifrons (Bivalvia: Mytilidae) in the Northwest Pacific
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Woods Hole Open Access Server Received: 13 September 2017 | Revised: 26 July 2018 | Accepted: 13 August 2018 DOI: 10.1111/eva.12696 ORIGINAL ARTICLE Population genetic structure of the deep- sea mussel Bathymodiolus platifrons (Bivalvia: Mytilidae) in the Northwest Pacific Ting Xu1 | Jin Sun2 | Hiromi K. Watanabe3 | Chong Chen3 | Masako Nakamura4 | Rubao Ji5 | Dong Feng6 | Jia Lv7 | Shi Wang7,8 | Zhenmin Bao7,9 | Pei-Yuan Qian2 | Jian-Wen Qiu1 1Department of Biology, Hong Kong Baptist University, Hong Kong, China Abstract 2Department of Ocean Science, Hong Kong Studying population genetics of deep- sea animals helps us understand their history University of Science and Technology, Hong of habitat colonization and population divergence. Here, we report a population ge- Kong, China netic study of the deep- sea mussel Bathymodiolus platifrons (Bivalvia: Mytilidae) 3Japan Agency for Marine-Earth Science and Technology (JAMSTEC), Yokosuka, Japan widely distributed in chemosynthesis- based ecosystems in the Northwest Pacific. 4School of Marine Science and Technology, Three mitochondrial genes (i.e., atp6, cox1, and nad4) and 6,398 genomewide single Tokai University, Shizuoka, Japan nucleotide polymorphisms (SNPs) were obtained from 110 individuals from four hy- 5Department of Biology, Woods Hole Oceanographic Institution, Woods Hole, drothermal vents and two methane seeps. When using the three mitochondrial Massachusetts genes, nearly no genetic differentiation was detected for B. platifrons in the Nor thwest 6 CAS Key Laboratory of Ocean and Marginal Pacific. Nevertheless, when using SNP datasets, all individuals in the South China Sea Sea Geology, South China Sea Institute of Oceanology, Chinese Academy of Sciences, (SCS) and three individuals in Sagami Bay (SB) together formed one genetic cluster Guangzhou, China that was distinct from the remaining individuals.
    [Show full text]
  • Does the Symbiotic Scale-Worm Feed on the Host Mussel in Deep-Sea Vent fi Elds?
    Res. Org. Geochem. 28, 23-26 (2012) Short Article Does the symbiotic scale-worm feed on the host mussel in deep-sea vent fi elds? Yoshimi Takahashi*,**, Yoko Sasaki**, Yoshito Chikaraishi**, Masashi Tsuchiya**, Hiromi Watanabe**, Takashi Asahida*, Tadashi Maruyama** and Katsunori Fujikura**,a （Received October 15, 2012; Accepted December 14, 2012） Abstract The scale-worm Branchipolynoe pettiboneae is frequently found in the mantle cavity of Bathymodiolus mussels living in hydrothermal vents and seeps around Japan. To investigate its feeding habits and symbiotic relationship with the host mussels, we determined the stable nitrogen isotopic composition of glutamic acid and phenylalanine for representative scale-worms including a symbiotic juvenile and a symbiotic adult, both with their host mussels, and a free-living adult, collected from hydrothermal vents of the Hatoma Knoll (～1532 m in depth) in the Okinawa Trough, Japan. The isotopic data suggested the feeding habits that Bathymodiolus platifrons is a major source of amino acids for symbiotic adult scale-worm but not for free-living adult and symbiotic juvenile scale-worms. Key words: Branchipolynoe pettiboneae, Bathymodiolus platifrons, feeding habits, nitrogen isotopic composition, symbiosis japonicus on hydrothermal vents and seeps in Japanese 1. Introduction waters (e.g., Miura and Hashimoto, 1991). Highly productive chemosynthetic communities are So far, however, few studies of Branchipolynoe associated with deep-sea hydrothermal vents and seeps, scale-worms have examined their biological and which are characterized by symbiotic interactions in- ecological behaviors including feeding habits and cluding primary chemosynthetic bacteria-animal (e.g., symbiotic relationship with the host mussels (e.g., bivalve and tubeworm) and secondary animal-animal Jollivet et al., 2000).
    [Show full text]
  • High Rates of Apoptosis Visualized in The
    High rates of apoptosis visualized in the symbiont-bearing gills of deep-sea Bathymodiolus mussels Bérénice Piquet, Bruce Shillito, François Lallier, Sébastien Duperron, Ann Andersen To cite this version: Bérénice Piquet, Bruce Shillito, François Lallier, Sébastien Duperron, Ann Andersen. High rates of apoptosis visualized in the symbiont-bearing gills of deep-sea Bathymodiolus mussels. PLoS ONE, Public Library of Science, 2019, 14 (2), pp.e0211499. 10.1371/journal.pone.0211499. hal-02042415 HAL Id: hal-02042415 https://hal.sorbonne-universite.fr/hal-02042415 Submitted on 20 Feb 2019 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. RESEARCH ARTICLE High rates of apoptosis visualized in the symbiont-bearing gills of deep-sea Bathymodiolus mussels 1,2 2 1 2,3,4 BeÂreÂnice Piquet , Bruce Shillito , FrancËois H. LallierID , SeÂbastien Duperron *, Ann C. Andersen1* 1 Sorbonne UniversiteÂ, CNRS, Lab. Adaptation et Diversite en Milieu Marin, AD2M, Team: Adaptation et Biologie des InverteÂbreÂs marins en Conditions Extrêmes (UMR 7144), ABICE, Station Biologique de Roscoff, SBR, Roscoff, France, 2 Sorbonne UniversiteÂ, MNHN, CNRS, IRD, UCN, UA, Lab. Biologie des Organismes a1111111111 et Ecosystèmes Aquatiques BOREA (UMR 7208), Team: Adaptation aux Milieux Extrêmes, AMEX, 7 Quai a1111111111 Saint-Bernard, Paris, France, 3 MuseÂum National d'Histoire Naturelle, CNRS, Lab.
    [Show full text]
  • Metagenomic Analyses of a Deep-Sea Mussel Symbiosis Merle Ücker
    Metagenomic analyses of a deep-sea mussel symbiosis Dissertation zur Erlangung des Grades eines Doktors der Naturwissenschaften – Dr. rer. nat. – dem Fachbereich Biologie / Chemie der Universität Bremen vorgelegt von Merle Ücker Bremen März 2021 Die vorliegende Doktorarbeit wurde von Juni 2017 bis März 2021 in der Abteilung Symbiose am Max-Planck-Institut für Marine Mikrobiologie unter der Leitung von Prof. Dr. Nicole Dubilier und direkter Betreuung von Dr. Rebecca Ansorge und Dr. Yui Sato angefertigt. The research presented in this thesis was performed from June 2017 until March 2021 at the Max Planck Institute for Marine Microbiology in the Department of Symbiosis under leadership of Prof. Dr. Nicole Dubilier and direct supervision of Dr. Rebecca Ansorge and Dr. Yui Sato. Gutachter*innen | reviewers Prof. Dr. Nicole Dubilier Prof. Dr. Thorsten Reusch Assist. Prof. Dr. Roxanne Beinart Tag des Promotionskolloquiums | date of doctoral defence 21 April 2021 Diese zur Veröffentlichung erstellte Version der Dissertation enthält Korrekturen. To the ocean. Contents Contents Summary .................................................................................................................................... 1 Zusammenfassung...................................................................................................................... 2 Chapter I | Introduction .............................................................................................................. 4 Aims of this thesis ...............................................................................................................
    [Show full text]
  • A Toll-Like Receptor Identified in Gigantidas Platifrons and Its
    A Toll-like receptor identified in Gigantidas platifrons and its potential role in the immune recognition of endosymbiotic methane oxidation bacteria Mengna Li1,2,*, Hao Chen1,3,4,*, Minxiao Wang1,3,4, Zhaoshan Zhong1,3,4, Hao Wang1,3,4, Li Zhou1,3,4, Huan Zhang1,3,4 and Chaolun Li1,2,3,4 1 Center of Deep Sea Research and Key Laboratory of Marine Ecology & Environmental Sciences (CODR and KLMEES), Institute of Oceanology, Chinese Academy of Sciences, Qingdao, China 2 University of Chinese Academy of Sciences, Beijing, China 3 CAS Key Laboratory of Marine Ecology and Environmental Sciences, Qingdao National Laboratory for Marine Science and Technology, Qingdao, China 4 Center for Ocean Mega-Science, Chinese Academy of Sciences, Qingdao, China * These authors contributed equally to this work. ABSTRACT Symbiosis with chemosynthetic bacteria is an important ecological strategy for the deep-sea megafaunas including mollusks, tubeworms and crustacean to obtain nutrients in hydrothermal vents and cold seeps. How the megafaunas recognize symbionts and establish the symbiosis has attracted much attention. Bathymodiolinae mussels are endemic species in both hydrothermal vents and cold seeps while the immune recognition mechanism underlying the symbiosis is not well understood due to the nonculturable symbionts. In previous study, a lipopolysaccharide (LPS) pull-down assay was conducted in Gigantidas platifrons to screen the pattern recognition receptors potentially involved in the recognition of symbiotic methane-oxidizing bacteria (MOB). Consequently, a total of 208 proteins including GpTLR13 were identified. Here the molecular structure, expression pattern and immune function of GpTLR13 were further analyzed. It was found that Submitted 4 January 2021 GpTLR13 could bind intensively with the lipid A structure of LPS through surface 24 March 2021 Accepted plasmon resonance analysis.
    [Show full text]
  • Cold Seeps of the Deep Gulf of Mexico: Community Structure and Biogeographic Comparisons to Atlantic Equatorial Belt Seep Communities
    ARTICLE IN PRESS Deep-Sea Research I 54 (2007) 637–653 www.elsevier.com/locate/dsri Cold seeps of the deep Gulf of Mexico: Community structure and biogeographic comparisons to Atlantic equatorial belt seep communities Erik E. Cordesa,Ã, Susan L. Carneya,1, Stephane Hourdezb, Robert S. Carneyc, James M. Brooksd, Charles R. Fishera aBiology Department, Pennsylvania State University, 208 Mueller Lab, University Park, PA, USA bEquipe Ecophysiologie, CNRS-UPMC UMR 7127, Station Biologique, BP74, 29682 Roscoff, France cCoastal Ecology Institute, Louisiana State University, South Stadium Road, Baton Rouge, LA, USA dTDI-Brooks International, 1902 Pinon, College Station, TX, USA Received 4 May 2006; received in revised form 3 January 2007; accepted 5 January 2007 Available online 25 January 2007 Abstract Quantitative collections of tubeworm- and mussel-associated communities were obtained from 3 cold seep sites in the deep Gulf of Mexico: in Atwater Valley at 1890 m depth, in Alaminos Canyon at 2200 m depth, and from the Florida Escarpment at 3300 m depth. A total of 50 taxa of macro- and megafauna were collected including 2 species of siboglinid tubeworms and 3 species of bathymodiolin mussels. In general, the highest degree of similarity was between communities collected from the same site. Most of the dominant families at the well-characterized upper Louisiana slope seep sites of the Gulf of Mexico were present at the deep sites as well; however, there was little overlap at the species level between the upper and lower slope communities. One major difference in community structure between the upper and lower slope seeps was the dominance of the ophiuroid Ophioctenella acies in the deeper communities.
    [Show full text]