Fish and Shellfish Immunology 86 (2019) 246–252 Contents lists available at ScienceDirect Fish and Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi Full length article Gill symbionts of the cold-seep mussel Bathymodiolus platifrons: Composition, environmental dependency and immune control T ∗ ∗∗ Jiajia Yua,c, Minxiao Wanga,b, Baozhong Liua,b, Xin Yuea, , Chaolun Lia,b, a CAS Key Laboratory of Experimental Marine Biology, Institute of Oceanology, Center for Ocean Mega-Science, Chinese Academy of Sciences, 7 Nanhai Road, Qingdao, 266071, China b Laboratory for Marine Biology and Biotechnology, Qingdao National Laboratory for Marine Science and Technology, 1 Wenhai Road, Qingdao, 266000, China c University of Chinese Academy of Sciences, Beijing, 100049, China ARTICLE INFO ABSTRACT Keywords: Deep-sea Bathymodiolus mussels depend on the organic carbon supplied by symbionts inside their gills. In this Bathymodiolus platifrons study, optimized methods of quantitative real-time PCR and fluorescence in situ hybridization targeted to both Methanotrophs mRNA and 16S rRNA were used to investigate the gill symbionts of the cold-seep mussel Bathymodiolus platifrons, FISH including species composition, environmental dependency and immune control by the host. Our results showed qRT-PCR that methanotrophs were the major symbiotic bacteria in the gills of B. platifrons, while thiotrophs were scarce. Lysosomal system In the mussels freshly collected from the deep sea, methanotrophs were housed in bacteriocytes in a unique circular pattern, and a lysosome-related gene (VAMP) encoding a vesicle-associated membrane protein was expressed at a high level and presented exactly where the methanotrophs occurred. After the mussels were reared for three months in aquaria without methane supply, the abundance of methanotrophs decreased sig- nificantly and their circle-shaped distribution pattern disappeared; in addition, the expression of VAMP de- creased significantly. These results suggest that the symbiosis between B. platifrons and methanotrophs is in- fluenced by the environment and that the lysosomal system plays an important immune role in controlling the abundance of endosymbionts in host. This study provides a reliable method for investigating symbionts in deep- sea mussels and enriches the knowledge about symbionts in B. platifrons. 1. Introduction type I methanotrophs that use methane as an electron donor and energy source, have been observed in the gills of B. platifrons [10,11]. How- Mussels of the genus Bathymodiolus are one of the dominant species ever, thiotrophs, another type of typical symbiotic bacteria in Bath- in two kinds of unique deep-sea habitats, cold seeps and hydrothermal ymodiolus mussels, have not been investigated in B. platifrons. A study vents, which are characterized by abundant reduced compounds (i.e., investigating the composition of symbiotic bacteria in B. platifrons CH4,H2S). These mussels exhibit a very high biomass in the harsh deep- would provide more information about this mussel and its deep-sea sea environment [1], owning to their symbiosis with chemosynthetic adaptations. bacteria which can provide energy. Methanotrophs and thiotrophs have A large number of symbionts are able to present inside B. platifrons been reported to be the most typical symbiotic bacteria in Bath- and be controlled without unregulated proliferation. Therefore, there ymodiolus mussels. Some mussel species, e.g., B. childressi, B. japonicas must be a control or immunity mechanism in the host mussel re- and B. thermophilus, harbor only one kind of symbiotic bacteria [2–4]. sponsible for maintaining the balance of endosymbionts. The lysosomal Some species of Bathymodiolus, e.g., B. azoricus, B. sp. and B. brooksi, system plays an important role in the immune response to bacteria by a live in dual symbioses with two types of bacteria [5–8]. B. platifrons, host [12]. Previous studies in pea aphids showed that the lysosomal first described by Hashimoto and Okutani in 1994, is a deep-sea mussel system could regulate the Buchnera endosymbiont population and common in both cold seeps and hydrothermal vents in the Western maintain homeostasis by degrading the symbionts [13,14]. In a study Pacific Ocean [9]. High densities of symbionts, which appeared to be comparing deep-sea mussels to the shallow-water mussel Modiolus ∗ Corresponding author. ∗∗ Corresponding author. CAS Key Laboratory of Experimental Marine Biology, Institute of Oceanology, Center for Ocean Mega-Science, Chinese Academy of Sciences, 7 Nanhai Road, Qingdao, 266071, China. E-mail addresses: [email protected] (X. Yue), [email protected] (C. Li). https://doi.org/10.1016/j.fsi.2018.11.041 Received 8 June 2018; Received in revised form 16 October 2018; Accepted 16 November 2018 Available online 17 November 2018 1050-4648/ © 2018 Elsevier Ltd. All rights reserved. J. Yu et al. Fish and Shellfish Immunology 86 (2019) 246–252 kurilensis, Zheng et al. [15] found that the expression of most genes Table 1 involved in the lysosomal system were upregulated in the deep-sea Primers used in this study. mussels. The concurrence of an upregulated lysosomal gene expression Primer Sequence(5‘-3‘)Tm and a high endosymbiosis biomass suggests a key role of the lysosomal system in controlling the abundance of symbionts. The vesicle-asso- 16S rDNA-1 F:AAGCGTTCGTAGGCGGTTATT 60 °C ciated membrane protein (VAMP) is a key component of the lysosomal R:CTTTCGTTCCTCAGCGTCAGT fi 16S rDNA-2 F:GAGTAACGCGTAGGAATCTGC 58 °C system and is required for the formation of speci c membrane com- R:CGAAGGTCCTCCACTTTACTCCATAGAG partments, in which symbionts are hosted in a controlled manner by the VAMP-RT-1 F: CACAGAAGTCACAGACCAGA 60 °C host [16]. In this study, the expression of VAMP was analyzed to R: TGCTCGAACACCATACTGA identify the role of the lysosomal system in controlling the symbionts in 28S rDNA F:CCATCTAAGGCTAAATACCGACAC 60 °C the deep-sea mussel B. platifrons. R:GCGGGTCTTTACAGATCCCTATC VAMP-1 F: GAACAACTGTCTTAGCCAAAT 58 °C The abundance of chemosynthetic symbionts in Bathymodiolus R: CACCACAAGCTGCTGATAT mussels is reportedly environmentally dependent. In B. azoricus, the relative abundances of methanotrophs and thiotrophs differed between mussels from two hydrothermal vent sites [17]. In addition, Bettencourt 2.2. PCR amplification of 16S rDNAs/specific genes for methanotrophs and et al. [18] transferred B. azoricus from a vent to aquaria at atmospheric thiotrophs pressure and found that after two weeks, the number of symbionts decreased significantly. Sun et al. [19] investigated the change in the To validate the existence of methanotrophs and thiotrophs in B. abundance of methanotrophs in B. platifrons after a 34-day rearing and platifrons, PCR amplifications of the 16S rDNAs and specific genes of found that the abundance of symbionts declined significantly. None- methanotrophs and thiotrophs were performed. The primer pairs spe- theless, limited information is available regarding the response of cific to the 16S rDNA of methanotrophs (16S rDNA-1, Table 1) and symbionts in deep-sea mussels after a longer laboratory-rearing period, thiotrophs (16S rDNA-2, Table 1) were designed by Primer Premier 5 e.g., more than two months. based on the 16S rDNA sequences of methanotrophs or thiotrophs in Several different detection methods have been used to investigate deep-sea mussels provided by the NCBI database. The primer pairs used the change in symbionts abundance in Bathymodiolus mussels, including to amplify pmoA, a gene encoding subunit A of the particulate methane fluorescence in situ hybridization (FISH) [17,20,21] and quantitative monooxygenase (A189gc and Mb661), and aprA, a gene encoding the real-time PCR (qRT-PCR) [19,22]. For FISH, two kinds of probes were alpha-subunit of adenosine-5‘-phosphosulfate reductase (AprA-1-FW used, including the 16S rRNA probe and mRNA probe targeted to a and AprA-5-RV), correspond to sequences from previous studies specific functional gene of the symbiotic bacteria. For qRT-PCR, it also [21,23,24]. Total genomic DNA was extracted from the gills of each commonly targets to the 16S rDNA or a specific functional gene of the sampled mussel using a commercial DNA extraction kit especially for symbiotic bacteria. FISH technique helped to visually study the dis- marine animals (Tiangen, China). The DNA mixture of all freshly col- tribution pattern of symbionts, while qRT-PCR was used for quantifying lected individuals from deep sea was used as the PCR template. The the abundance of symbionts. The combination of FISH and qRT-PCR PCR reactions were performed using a LA PCR kit (TaKaRa, Japan). The provides comprehensive information on both the distribution and PCR parameters were as follows: 94 °C for 5 min, 35 cycles of 94 °C for quantity of symbionts. 30 s, nºC (n = Tm of each primer pair, Table 1) for 30 s and 72 °C for In this study, FISH and qRT-PCR methods were applied to analyze 1min, followed by the final extension at 72 °C for 10 min. The PCR symbiont composition in the gills of B. platifrons and to detect both the products were purified and then cloned into the pGEM-T-Easy vector change in symbionts abundance and the expression variance of VAMP (Promega, USA). The recombinant plasmids were transformed into in B. platifrons under different environments (i.e., cold seep in the deep competent Escherichia coli cells, which were cultured on the LB plates at sea or laboratory-reared in methane-absent seawater for three months). 37 °C overnight. Positive clones with the recombinant plasmid were We focused on whether two kinds of popular symbiotic bacteria (i.e., further confirmed by PCR and then were cultured and regrown in LB methanotrophs and thiotrophs) occurred in B. platifrons and the en- broth. A large number of the recombinant plasmids were extracted from vironmental dependency of these bacteria; furthermore, the role of the the bacteria culture and then sequenced by the Sanger method. The lysosomal system in the control of symbionts by the host was in- sequences were analyzed with BLAST against the NCBI database.