DOCSLIB.ORG

Browsing Genomes with Ensembl

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Browsing Genomes with Ensembl Browsing Genomes with Ensembl www.ensembl.org www.ensemblgenomes.org Coursebook v91 training.ensembl.org/events Erasmus MC, Rotterdam 13 - 14 February 2018 1 Introduction to Ensembl 3 Synopsis — What can I do with Ensembl? 4 Need more help? 5 Stay in touch! 5 Further reading 5 Exploring the Ensembl genome browser 7 Demo: Homepage, assemblies and species 7 Demo: The Location tab and Region in detail view 13 Genes and transcripts 20 Demo: The Gene tab 20 Demo: The Transcript tab 27 Variation 32 Demo: Exploring variants in Ensembl 32 Demo: The Variant Effect Predictor (VEP) 41 Comparative genomics 47 Demo: Gene trees and homologues 47 Demo: Whole genome alignments 50 Regulation 55 BioMart 63 Advanced access 68 Demo: Custom data upload: Upload small files 68 Demo: Track Hubs 71 Demo: REST API 75 Quick Guide to Databases and Projects 78 2 Introduction to Ensembl Getting started with Ensembl www.ensembl.org Ensembl is a project from the EMBL-EBI (European Molecular Biology ​ Laboratory-European Bioinformatics Institute) that focuses on the ​ annotation of vertebrate genomes. Gene sets from model organisms such as Saccharomyces cerevisiae, Caenorhabditis elegans and ​ ​ Drosophila melanogaster are also included for comparative analysis ​ by the Ensembl ‘Compara’ team. Most annotation is updated every two months, leading to increasing Ensembl versions (such as version 90), however the gene sets are determined less frequently. A sister browser at www.ensemblgenomes.org is set up to access ​ ​ non-vertebrates, namely bacteria, plants, fungi, metazoa, and protists. Ensembl provides genes and other annotation such as regulatory ​ ​ regions, conserved base pairs across species, and sequence variations. The Ensembl gene set is based on protein and mRNA evidence in UniProtKB and NCBI RefSeq databases, along with ​ ​ ​ ​ manual annotation from the VEGA/Havana group. All the data are ​ ​ freely available and can be accessed via the web browser at www.ensembl.org. ​ Perl programmers can directly access Ensembl databases through Application Programming Interfaces (Perl APIs), while a REST API is ​ ​ ​ ​ available to access Ensembl databases using other programming languages. Gene sequences can be downloaded from the Ensembl browser itself, or through the use of the BioMart web interface, ​ ​ which can extract information from the Ensembl databases without the need for programming knowledge by the user. Finally, all data can be downloaded via the Ensembl FTP server and code is available on ​ ​ GitHub. 3 Synopsis — What can I do with Ensembl? ● View genes with other annotation along the chromosomes. ● View alternative transcripts (i.e. splice variants) for a given gene. ● Explore homologues and phylogenetic trees across more than 100 species for any gene. ● Compare whole genome alignments and conserved regions across species. ● View microarray probe sequences that match to Ensembl genes. ● View ESTs, clones, mRNA and proteins for any chromosomal region. ● Examine single nucleotide polymorphisms (SNPs) for a gene or chromosomal region. ● View SNPs across strains (rat, mouse), populations (human), or breeds (dog). ● View positions and sequence of mRNAs and proteins that align with Ensembl genes. ● Upload your own data. ● Use BLAST, or BLAT against any genome in Ensembl. ● Export sequences or create a table with gene information using BioMart. ● Determine how variants affect genes and transcripts using the Variant Effect Predictor. ● Share Ensembl displays with your colleagues and collaborators. 4 Need more help? ● Check Ensembl documentation ​ ● Watch video tutorials on YouTube or YouKu ​ ​ ​ ● View the FAQs ​ ● Try some exercises ​ ● Read some publications ​ ● Take our online course ​ ● Watch our webinar series ​ Stay in touch! ● Email the team with comments or questions at [email protected] ​ ​ ● Follow the Ensembl blog ​ ● Sign up to a mailing list ​ ● Find us on Facebook: https://www.facebook.com/Ensembl.org/ ​ ​ ● Follow us on Twitter: @ensembl and @ensemblgenomes Further reading Zerbino, Daniel R. et al. ​ Ensembl 2018 Nucleic Acids Research (Database Issue) https://doi.org/10.1093/nar/gkx1098 Kersey, PJ et al. ​ Ensembl Genomes 2018: an integrated omics infrastructure for non-vertebrate species Nucleic Acids Research (Database Issue) https://doi.org/10.1093/nar/gkx1011 For a complete list of publications, visit: http://www.ensembl.org/info/about/publications.html http://ensemblgenomes.org/info/publications 5 6 Exploring the Ensembl genome browser All clickable links highlighted in blue. All typed and manually ​ ​ submitted text highlighted in red. ​ Demo: Homepage, assemblies and species The front page of Ensembl is found at ensembl.org. It contains lots of ​ ​ information and links to help you navigate Ensembl: At the top right you can see the current release number and what has come out in this release. To access old releases, scroll to the bottom of the page and click on View in archive site. ​ ​ 7 Click on the links to go to the archives. Alternatively, you can jump quickly to the correct release by adding it to the URL: for example, e78.ensembl.org jumps to release 78. ​ Click on View full list of all Ensembl species under the ‘All genomes’ ​ ​ heading. Click on the common name of your species of interest to go to the species homepage. We will click on Human. ​ ​ 8 To find out more about the genome assembly and genebuild, click on More information and statistics. ​ The current genome assembly for human is GRCh38. If you want to see the previous assembly, GRCh37, visit our dedicated site, grch37.ensembl.org. ​ 9 Let’s take a look at the Ensembl Genomes homepage at ensemblgenomes.org. ​ Click on Ensembl Bacteria, Fungi, Metazoa, Plants or Protists to see ​ ​ ​ ​ their homepages. Each one is colour-coded. 10 Protists Fungi Metazoa Plants Bacteria You can navigate most of the taxa in the same way as you would with Ensembl, but Ensembl Bacteria has a large number of genomes, so needs slightly different methods. Let’s look at it in more detail. 11 The search box does not include a full list of bacterial species as it would be hard to navigate them due to the large number of species. To find a species, start typing the species name into the genome search box. A drop-down list will appear with possible species. For example, to find a strain of Streptococcus pyogenes, start typing ​ ​ the species name. The autocomplete will retrieve useful results as soon as you get to stre. ​ ​ 12 The drop-down contains various strains of Streptococcus pyogenes. ​ ​ Let’s choose Streptococcus pyogenes AA216. This will take us to ​ ​ another species homepage, where we can explore various features. Demo: The Location tab and Region in detail view Start at the Ensembl front page, ensembl.org. You can search for a ​ ​ region by typing it into a search box, but you have to specify the species. Type (or copy and paste) human 4:122868000-122946000 into ​ ​ either search box. or Press Enter or click Go to jump directly to the Region in detail Page. ​ ​ ​ ​ ​ ​ Click on the button to view page-specific help. The help pages provide links to Frequently Asked Questions, a Glossary, Video Tutorials, and a form to Contact Helpdesk. There is a help video on this page at http://youtu.be/tTKEvgPUq94. ​ ​ 13 The Location tab shows three images: Chromosome, Overview and Region. Let’s look at each one in detail. The first image shows the chromosome: You can jump to a different region by dragging out a box in this image. Drag out a box on the chromosome; a pop-up menu will appear. 14 If you would like to move to the region, you could click on Jump to ​ region (### bp). To highlight it, click on Mark region (### bp). For ​ ​ ​ now, we will close the pop-up by clicking on the X on the corner. ​ ​ The second image shows a 1Mb region around our selected region. This view allows you to scroll back and forth along the chromosome. You can also drag out and jump to or mark a region. Click on the X to close the pop-up menu. ​ ​ 15 Click on the Drag/Select button to change the action ​ ​ of your mouse click. Now you can scroll along the chromosome by clicking and dragging within the image. As you do this you will see the image below grey out and two blue buttons appear. Clicking on Update this image would jump the lower image to the region central ​ to the scrollable image. We want to go back to where we started, so we will click on Reset scrollable image. ​ ​ The third image is a detailed, configurable view of the region. Click on the Drag/Select option at the top or bottom right to switch ​ ​ mouse action. On Drag, you can click and drag left or right to move ​ ​ along the genome; the page will reload when you drop the mouse button. On Select you can drag out a box to highlight or zoom in on a ​ ​ region of interest. With the tool set to Select, drag out a box around an exon and choose ​ ​ Mark region. ​ 16 The highlight will remain in place if you zoom in and out or move around the region. This allows you to keep track of regions or features of interest. You can edit what you see on this page by clicking on the blue Configure this page menu at the left. ​ This will open a menu that allows you to change the image. You can put some tracks on in different styles; more details are in this FAQ: http://www.ensembl.org/Help/Faq?id=335. ​ ​ 17 Let’s add some tracks to this image. Add: ● Proteins (mammal) from UniProt – Labels ● 1000 Genomes - EUR - short variants (SNPs and indels) Now click on the tick at top left to save and close the menu. Alternatively, click anywhere outside of the menu. You can now see the tracks in the image.
Load more

Recommended publications
  • Ensembl Genomes: Extending Ensembl Across the Taxonomic Space P
    Published online 1 November 2009 Nucleic Acids Research, 2010, Vol. 38, Database issue D563–D569 doi:10.1093/nar/gkp871 Ensembl Genomes: Extending Ensembl across the taxonomic space P. J. Kersey*, D. Lawson, E. Birney, P. S. Derwent, M. Haimel, J. Herrero, S. Keenan, A. Kerhornou, G. Koscielny, A. Ka¨ ha¨ ri, R. J. Kinsella, E. Kulesha, U. Maheswari, K. Megy, M. Nuhn, G. Proctor, D. Staines, F. Valentin, A. J. Vilella and A. Yates EMBL-European Bioinformatics Institute, Wellcome Trust Genome Campus, Cambridge CB10 1SD, UK Received August 14, 2009; Revised September 28, 2009; Accepted September 29, 2009 ABSTRACT nucleotide archives; numerous other genomes exist in states of partial assembly and annotation; thousands of Ensembl Genomes (http://www.ensemblgenomes viral genomes sequences have also been generated. .org) is a new portal offering integrated access to Moreover, the increasing use of high-throughput genome-scale data from non-vertebrate species sequencing technologies is rapidly reducing the cost of of scientific interest, developed using the Ensembl genome sequencing, leading to an accelerating rate of genome annotation and visualisation platform. data production. This not only makes it likely that in Ensembl Genomes consists of five sub-portals (for the near future, the genomes of all species of scientific bacteria, protists, fungi, plants and invertebrate interest will be sequenced; but also the genomes of many metazoa) designed to complement the availability individuals, with the possibility of providing accurate and of vertebrate genomes in Ensembl. Many of the sophisticated annotation through the similarly low-cost databases supporting the portal have been built in application of functional assays.
    [Show full text]
  • Abstracts Genome 10K & Genome Science 29 Aug - 1 Sept 2017 Norwich Research Park, Norwich, Uk
    Genome 10K c ABSTRACTS GENOME 10K & GENOME SCIENCE 29 AUG - 1 SEPT 2017 NORWICH RESEARCH PARK, NORWICH, UK Genome 10K c 48 KEYNOTE SPEAKERS ............................................................................................................................... 1 Dr Adam Phillippy: Towards the gapless assembly of complete vertebrate genomes .................... 1 Prof Kathy Belov: Saving the Tasmanian devil from extinction ......................................................... 1 Prof Peter Holland: Homeobox genes and animal evolution: from duplication to divergence ........ 2 Dr Hilary Burton: Genomics in healthcare: the challenges of complexity .......................................... 2 INVITED SPEAKERS ................................................................................................................................. 3 Vertebrate Genomics ........................................................................................................................... 3 Alex Cagan: Comparative genomics of animal domestication .......................................................... 3 Plant Genomics .................................................................................................................................... 4 Ksenia Krasileva: Evolution of plant Immune receptors ..................................................................... 4 Andrea Harper: Using Associative Transcriptomics to predict tolerance to ash dieback disease in European ash trees ............................................................................................................
    [Show full text]
  • The ELIXIR Core Data Resources: ​Fundamental Infrastructure for The
    Supplementary Data: The ELIXIR Core Data Resources: fundamental infrastructure ​ for the life sciences The “Supporting Material” referred to within this Supplementary Data can be found in the Supporting.Material.CDR.infrastructure file, DOI: 10.5281/zenodo.2625247 (https://zenodo.org/record/2625247). ​ ​ Figure 1. Scale of the Core Data Resources Table S1. Data from which Figure 1 is derived: Year 2013 2014 2015 2016 2017 Data entries 765881651 997794559 1726529931 1853429002 2715599247 Monthly user/IP addresses 1700660 2109586 2413724 2502617 2867265 FTEs 270 292.65 295.65 289.7 311.2 Figure 1 includes data from the following Core Data Resources: ArrayExpress, BRENDA, CATH, ChEBI, ChEMBL, EGA, ENA, Ensembl, Ensembl Genomes, EuropePMC, HPA, IntAct /MINT , InterPro, PDBe, PRIDE, SILVA, STRING, UniProt ● Note that Ensembl’s compute infrastructure physically relocated in 2016, so “Users/IP address” data are not available for that year. In this case, the 2015 numbers were rolled forward to 2016. ● Note that STRING makes only minor releases in 2014 and 2016, in that the interactions are re-computed, but the number of “Data entries” remains unchanged. The major releases that change the number of “Data entries” happened in 2013 and 2015. So, for “Data entries” , the number for 2013 was rolled forward to 2014, and the number for 2015 was rolled forward to 2016. The ELIXIR Core Data Resources: fundamental infrastructure for the life sciences ​ 1 Figure 2: Usage of Core Data Resources in research The following steps were taken: 1. API calls were run on open access full text articles in Europe PMC to identify articles that ​ ​ mention Core Data Resource by name or include specific data record accession numbers.
    [Show full text]
  • Annual Scientific Report 2013 on the Cover Structure 3Fof in the Protein Data Bank, Determined by Laponogov, I
    EMBL-European Bioinformatics Institute Annual Scientific Report 2013 On the cover Structure 3fof in the Protein Data Bank, determined by Laponogov, I. et al. (2009) Structural insight into the quinolone-DNA cleavage complex of type IIA topoisomerases. Nature Structural & Molecular Biology 16, 667-669. © 2014 European Molecular Biology Laboratory This publication was produced by the External Relations team at the European Bioinformatics Institute (EMBL-EBI) A digital version of the brochure can be found at www.ebi.ac.uk/about/brochures For more information about EMBL-EBI please contact: [email protected] Contents Introduction & overview 3 Services 8 Genes, genomes and variation 8 Molecular atlas 12 Proteins and protein families 14 Molecular and cellular structures 18 Chemical biology 20 Molecular systems 22 Cross-domain tools and resources 24 Research 26 Support 32 ELIXIR 36 Facts and figures 38 Funding & resource allocation 38 Growth of core resources 40 Collaborations 42 Our staff in 2013 44 Scientific advisory committees 46 Major database collaborations 50 Publications 52 Organisation of EMBL-EBI leadership 61 2013 EMBL-EBI Annual Scientific Report 1 Foreword Welcome to EMBL-EBI’s 2013 Annual Scientific Report. Here we look back on our major achievements during the year, reflecting on the delivery of our world-class services, research, training, industry collaboration and European coordination of life-science data. The past year has been one full of exciting changes, both scientifically and organisationally. We unveiled a new website that helps users explore our resources more seamlessly, saw the publication of ground-breaking work in data storage and synthetic biology, joined the global alliance for global health, built important new relationships with our partners in industry and celebrated the launch of ELIXIR.
    [Show full text]
  • Strategic Plan 2011-2016
    Strategic Plan 2011-2016 Wellcome Trust Sanger Institute Strategic Plan 2011-2016 Mission The Wellcome Trust Sanger Institute uses genome sequences to advance understanding of the biology of humans and pathogens in order to improve human health. -i- Wellcome Trust Sanger Institute Strategic Plan 2011-2016 - ii - Wellcome Trust Sanger Institute Strategic Plan 2011-2016 CONTENTS Foreword ....................................................................................................................................1 Overview .....................................................................................................................................2 1. History and philosophy ............................................................................................................ 5 2. Organisation of the science ..................................................................................................... 5 3. Developments in the scientific portfolio ................................................................................... 7 4. Summary of the Scientific Programmes 2011 – 2016 .............................................................. 8 4.1 Cancer Genetics and Genomics ................................................................................ 8 4.2 Human Genetics ...................................................................................................... 10 4.3 Pathogen Variation .................................................................................................. 13 4.4 Malaria
    [Show full text]
  • Browsing Genomes with Ensembl Annotation
    Browsing genomes with EnsEMBL Annotation • During recent years release of large amounts of sequence data • Raw sequence data are not so useful on its own. They are most valuable when provided with comprehensive good quality annotation CCCAACAAGAATGTAAAATCTTTAAGTGCCTGTTTTCATACTTATTTGACCACCCTATCTCTAGAATCTTGCATGATG TCTAGCCCTAGTAGGATCAAAAAATACTTACAAAGCAACTGAATAGCTACATGAATAGATGGATGAATAAATGCATG GGTGGATGGATGGATTAATGAAATCATTTATATGACTTAAAGTTTGCAGAGGAGTATCATATTTGGAAGGCAGTAAG GAAGTCTGTGTAGTCGATGGTAAAGGCAATTGGGAAGTTTGTTAGGCACAATAGGTCAAAATTTGTTTTTGAAGTCC TGTTACTTCACGTTTCTTTGTTTCACTTTCTTAAAACAGGAAACTCTTTTCTATGATCATTCTTCCAGGGCCTGGCTCT TCATCTGCAACCCAGTAATATCCCTAATGTCAAAAAGCTACTGGTTTAATTCGTGCCATTTTCAAAGAGGACTACTGA ATTCTGATGTGGCTTCAAACATTTAGGTTAGGCATATCTAATGGAGAACTTGCAGCCACACTGACTTGTAGTGAAAT ATCTATTTTGAGCCTGCCCAGTGTTGCTTAAATTGTAGTTTTCCTTGCCAGCTATTCATACAAGAGATGTGAGAAGCA CCATAAAAGGCGTTGTGAGGAGTTGTGGGGGAGTGAGGGAGAGAAGAGGTTGAAAAGCTTATTAGCTGCTGTACGG TAAAAGTGAGCTCTTACGGGAATGGGAATGTAGTTTTAGCCCTCCAGGGATTCTATTTAGCCCGCCAGGAATTAACC TTGACTATAAATAGGCCATCAATGACCTTTCCAGAGAATGTTCAGAGACCTCAACTTTGTTTAGAGATCTTGTGTGGG TGGAACTTCCTGTTTGCACACAGAGCAGCATAAAGCCCAGTTGCTTTGGGAAGTGTTTGGGACCAGATGGATTGTAG GGAGTAGGGTACAATACAGTCTGTTCTCCTCCAGCTCCTTCTTTCTGCAACATGGGGAAGAACAAACTCCTTCATCC AAGTCTGGTTCTTCTCCTCTTGGTCCTCCTGCCCACAGACGCCTCAGTCTCTGGAAAACCGTGAGTTCCACACAGAG AGCGTGAAGCATGAACCTAGAGTCCTTCATTTATTGCAGATTTTTCTTTATATCATTCCTTTTTCTTTCCTATGATACT GTCATCTTCTTATCTCTAAGATTCCTTCCAGATTTTACAAATCTAGTTTACTCATTACTTGCTTACTTTTAATCATTCT TCCCCAACTCTCTGAAGCTCTAATATGCAAAGCCTTCCTAAGGGGTGTCAGAAATTTTTAGCTTTTTAAAAGAATAAA
    [Show full text]
  • The Genomic Basis of Circadian and Circalunar Timing Adaptations in a Midge Tobias S
    OPEN ARTICLE doi:10.1038/nature20151 The genomic basis of circadian and circalunar timing adaptations in a midge Tobias S. Kaiser1,2,3†, Birgit Poehn1,3, David Szkiba2, Marco Preussner4, Fritz J. Sedlazeck2†, Alexander Zrim2, Tobias Neumann1,2, Lam-Tung Nguyen2,5, Andrea J. Betancourt6, Thomas Hummel3,7, Heiko Vogel8, Silke Dorner1, Florian Heyd4, Arndt von Haeseler2,3,5 & Kristin Tessmar-Raible1,3 Organisms use endogenous clocks to anticipate regular environmental cycles, such as days and tides. Natural variants resulting in differently timed behaviour or physiology, known as chronotypes in humans, have not been well characterized at the molecular level. We sequenced the genome of Clunio marinus, a marine midge whose reproduction is timed by circadian and circalunar clocks. Midges from different locations show strain-specific genetic timing adaptations. We examined genetic variation in five C. marinus strains from different locations and mapped quantitative trait loci for circalunar and circadian chronotypes. The region most strongly associated with circadian chronotypes generates strain-specific differences in the abundance of calcium/calmodulin-dependent kinase II.1 (CaMKII.1) splice variants. As equivalent variants were shown to alter CaMKII activity in Drosophila melanogaster, and C. marinus (Cma)-CaMKII.1 increases the transcriptional activity of the dimer of the circadian proteins Cma-CLOCK and Cma-CYCLE, we suggest that modulation of alternative splicing is a mechanism for natural adaptation in circadian timing. Around the new or full moon, during a few specific hours surround- Our study aimed to identify the genetic basis of C. marinus adaptation ing low tide, millions of non-biting midges of the species C.
    [Show full text]
  • ALEXA: a Microarray Design Platform for Alternative Expression Analysis
    CORRESPONDENCE expression of alternative mRNA isoforms in 5-fluorouracil (5-FU)- ALEXA: a microarray design platform for sensitive and resistant colorectal cancer cell lines5 and compared alternative expression analysis the results to those from the Affymetrix ‘GeneChip Human Exon 1.0 ST’ array (see Supplementary Results, Supplementary Fig. 2 To the editor: Eukaryotic genomes are predicted to contain about and Supplementary Table 2 online). Genes and exons differentially 7,000–29,000 genes1. Each of these genes may be alternatively expressed between 5-FU–sensitive and resistant cells were identi- processed to produce multiple distinct mRNAs by alternative fied by both platforms (with significant overlap), but ALEXA arrays transcript initiation, splicing and polyadenylation (collectively provided additional information on the connectivity and boundar- referred to as alternative expression). Although analysis of avail- ies of exons (Table 1). Furthermore, alternative expression events able transcript resources indicates that up to ~75% of genes are identified by ALEXA were significantly enriched for known alterna- alternatively processed, most microarray expression platforms tive expression events represented in publicly available mRNA and cannot detect alternative transcripts2. expressed sequence tag (EST) databases (Supplementary Results methods Proof-of-principle experiments have described the use of oli- and Supplementary Data 1 online). Finally, we demonstrated the gonucleotide microarrays to profile transcript isoforms gener- advantage of the ALEXA approach by identifying several differen- ated by alternative expression, but resources to create such arrays tially expressed known and predicted isoforms with potential rele- are lacking3,4. To address this limitation we created a microarray vance to 5-FU resistance (Supplementary Fig. 3 and Supplementary .com/nature e design platform for alternative expression analysis (ALEXA), Tables 3 and 4 online).
    [Show full text]
  • Gene3d: Multi-Domain Annotations for Protein Sequence and Comparative Genome Analysis Jonathan G
    D240–D245 Nucleic Acids Research, 2014, Vol. 42, Database issue Published online 21 November 2013 doi:10.1093/nar/gkt1205 Gene3D: Multi-domain annotations for protein sequence and comparative genome analysis Jonathan G. Lees1,*, David Lee1, Romain A. Studer1, Natalie L. Dawson1, Ian Sillitoe1, Sayoni Das1, Corin Yeats2, Benoit H. Dessailly1, Robert Rentzsch3 and Christine A. Orengo1 1Division of Biosciences, Institute of Structural and Molecular Biology, University College London, Gower Street, London WC1E 6BT, UK, 2Department of Infectious Disease Epidemiology, Imperial College London, St Mary’s Campus, Norfolk Place, London W2 1PG, UK and 3Robert Koch Institut, Research Group Bioinformatics Ng4, Nordufer 20, 13353 Berlin, Germany Received October 1, 2013; Revised November 2, 2013; Accepted November 4, 2013 Downloaded from ABSTRACT contain long disordered sections that are also of functional importance. The CATH database which focuses on the Gene3D (http://gene3d.biochem.ucl.ac.uk) is a data- folded domain, classifies structures in the PDB into their base of protein domain structure annotations for constituent domains, and each domain is subsequently http://nar.oxfordjournals.org/ protein sequences. Domains are predicted using a assigned to a single superfamily by homology (1,2). The library of profile HMMs from 2738 CATH super- classified domain structure sequences are used in a families. Gene3D assigns domain annotations to pipeline to build domain superfamily specific HMMs that Ensembl and UniProt sequence sets including are then used to identify domains in structurally >6000 cellular genomes and >20 million unique uncharacterized protein sequences. As some CATH protein sequences. This represents an increase of superfamilies can be large and functionally diverse, we 45% in the number of protein sequences since our recently introduced protocols for subdividing each super- last publication.
    [Show full text]
  • What's New in Rnacentral and Rfam
    What’s new in RNAcentral and Rfam Anton Petrov [email protected] Benasque - July 20, 2018 What is https://www.vecteezy.com/vector-art/92726-question-mark-background-vector The non-coding RNA sequence database rnacentral.org • >10 million sequences • 27 databases • 800,000 species RNAcentral has lots of useful data • Sequence • Description • RNA type • Links to other databases • Genome locations • Publications • RNA modifications from MODOMICS and PDB http://rnacentral.org/rna/URS00005A4DCF/9606 Until recently just data aggregation, now additional analysis Two important new features 1. Quality control using Rfam 2. Comprehensive genome models mapping 1. Rfam models are used to annotate RNAcentral • ~90% of RNAcentral sequences match Rfam models • about 2% of RNAcentral sequences can be used to build new Rfam models Rfam annotations help detect: • truncated sequences • potential contamination • missing annotations 2. Comprehensive genome mapping for >250 species before after • genome mapping Ensembl genomes and blat • >95% of sequences mapped for human, mouse, and other key species • one of the largest collections RNA types of ncRNA genome annotations % of mapped human sequences Example of Rfam quality control and genome mapping Here is an Ensembl miRNA http://www.ensembl.org/Mus_musculus/Transcript/Summary?g=ENSMUSG00000106355;r=4:10874064-10874170;t =ENSMUST00000197675 But is it a miRNA or a tRNA? http://www.ensembl.org/Mus_musculus/Transcript/Summary?g=ENSMUSG00000106355;r=4:10874064-10874170;t =ENSMUST00000197675 RNAcentral shows a
    [Show full text]
  • Browsing Genes and Genomes with Ensembl
    Browsing Genes and Genomes with Ensembl Ensembl Workshop University of Cambridge 3rd September 2013 www.ensembl.org Denise Carvalho-Silva Ensembl Outreach Notes: This workshop is based on Ensembl release 72 (June 2013). 1) Presentation slides The pdf file of the talks presented in this workshop is available in the link below: http://www.ebi.ac.uk/~denise/naturimmun 2) Course booklet A diGital Copy of this course booklet can be found below: http://www.ebi.ac.uk/~denise/coursebooklet.pdf 3) Answers The answers to the exercises in this course booklet can be found below: http://www.ebi.ac.uk/~denise/answers 2 TABLE OF CONTENTS OVERVIEW ...................................................................................................... 4 INTRODUCTION TO ENSEMBL .................................................................. 5 BROWSER WALKTHROUGH .................................................................... 14 EXERCISES .................................................................................................... 38 BROWSER ..................................................................................................... 38 BIOMART ...................................................................................................... 41 VARIATION ................................................................................................... 48 COMPARATIVE GENOMICS ...................................................................... 50 REGULATION ..............................................................................................
    [Show full text]
  • Rfam 14: Expanded Coverage of Metagenomic, Viral and Microrna Families Ioanna Kalvari, Eric P
    Rfam 14: expanded coverage of metagenomic, viral and microRNA families Ioanna Kalvari, Eric P. Nawrocki, Nancy Ontiveros-Palacios, Joanna Argasinska, Kevin Lamkiewicz, Manja Marz, Sam Griffiths-Jones, Claire Toffano-Nioche, Daniel Gautheret, Zasha Weinberg, et al. To cite this version: Ioanna Kalvari, Eric P. Nawrocki, Nancy Ontiveros-Palacios, Joanna Argasinska, Kevin Lamkiewicz, et al.. Rfam 14: expanded coverage of metagenomic, viral and microRNA families. Nucleic Acids Research, 2020, 10.1093/nar/gkaa1047. hal-03031715 HAL Id: hal-03031715 https://hal.archives-ouvertes.fr/hal-03031715 Submitted on 14 Dec 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. This article has been accepted for publication in Nucleic Acid Research Published by Oxford University Press : • DOI : 10.1093/nar/gkaa1047 • PUBMED : 33211869 Nucleic Acids Research, 2020 1 doi: 10.1093/nar/gkaa1047 Rfam 14: expanded coverage of metagenomic, viral and microRNA families Ioanna Kalvari 1,EricP.Nawrocki 2, Nancy Ontiveros-Palacios 1, Joanna Argasinska 1, Kevin Lamkiewicz 3,4, Manja Marz 3,4, Sam Griffiths-Jones 5, Claire Toffano-Nioche 6, Daniel Gautheret 6, Zasha Weinberg 7, Elena Rivas 8, Sean R. Eddy 8,9,10, Downloaded from https://academic.oup.com/nar/advance-article/doi/10.1093/nar/gkaa1047/5992291 by guest on 14 December 2020 Robert D.
    [Show full text]