Research at a Glance 2011
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Ensembl Genomes: Extending Ensembl Across the Taxonomic Space P
Published online 1 November 2009 Nucleic Acids Research, 2010, Vol. 38, Database issue D563–D569 doi:10.1093/nar/gkp871 Ensembl Genomes: Extending Ensembl across the taxonomic space P. J. Kersey*, D. Lawson, E. Birney, P. S. Derwent, M. Haimel, J. Herrero, S. Keenan, A. Kerhornou, G. Koscielny, A. Ka¨ ha¨ ri, R. J. Kinsella, E. Kulesha, U. Maheswari, K. Megy, M. Nuhn, G. Proctor, D. Staines, F. Valentin, A. J. Vilella and A. Yates EMBL-European Bioinformatics Institute, Wellcome Trust Genome Campus, Cambridge CB10 1SD, UK Received August 14, 2009; Revised September 28, 2009; Accepted September 29, 2009 ABSTRACT nucleotide archives; numerous other genomes exist in states of partial assembly and annotation; thousands of Ensembl Genomes (http://www.ensemblgenomes viral genomes sequences have also been generated. .org) is a new portal offering integrated access to Moreover, the increasing use of high-throughput genome-scale data from non-vertebrate species sequencing technologies is rapidly reducing the cost of of scientific interest, developed using the Ensembl genome sequencing, leading to an accelerating rate of genome annotation and visualisation platform. data production. This not only makes it likely that in Ensembl Genomes consists of five sub-portals (for the near future, the genomes of all species of scientific bacteria, protists, fungi, plants and invertebrate interest will be sequenced; but also the genomes of many metazoa) designed to complement the availability individuals, with the possibility of providing accurate and of vertebrate genomes in Ensembl. Many of the sophisticated annotation through the similarly low-cost databases supporting the portal have been built in application of functional assays. -
Abstracts Genome 10K & Genome Science 29 Aug - 1 Sept 2017 Norwich Research Park, Norwich, Uk
Genome 10K c ABSTRACTS GENOME 10K & GENOME SCIENCE 29 AUG - 1 SEPT 2017 NORWICH RESEARCH PARK, NORWICH, UK Genome 10K c 48 KEYNOTE SPEAKERS ............................................................................................................................... 1 Dr Adam Phillippy: Towards the gapless assembly of complete vertebrate genomes .................... 1 Prof Kathy Belov: Saving the Tasmanian devil from extinction ......................................................... 1 Prof Peter Holland: Homeobox genes and animal evolution: from duplication to divergence ........ 2 Dr Hilary Burton: Genomics in healthcare: the challenges of complexity .......................................... 2 INVITED SPEAKERS ................................................................................................................................. 3 Vertebrate Genomics ........................................................................................................................... 3 Alex Cagan: Comparative genomics of animal domestication .......................................................... 3 Plant Genomics .................................................................................................................................... 4 Ksenia Krasileva: Evolution of plant Immune receptors ..................................................................... 4 Andrea Harper: Using Associative Transcriptomics to predict tolerance to ash dieback disease in European ash trees ............................................................................................................ -
The ELIXIR Core Data Resources: Fundamental Infrastructure for The
Supplementary Data: The ELIXIR Core Data Resources: fundamental infrastructure for the life sciences The “Supporting Material” referred to within this Supplementary Data can be found in the Supporting.Material.CDR.infrastructure file, DOI: 10.5281/zenodo.2625247 (https://zenodo.org/record/2625247). Figure 1. Scale of the Core Data Resources Table S1. Data from which Figure 1 is derived: Year 2013 2014 2015 2016 2017 Data entries 765881651 997794559 1726529931 1853429002 2715599247 Monthly user/IP addresses 1700660 2109586 2413724 2502617 2867265 FTEs 270 292.65 295.65 289.7 311.2 Figure 1 includes data from the following Core Data Resources: ArrayExpress, BRENDA, CATH, ChEBI, ChEMBL, EGA, ENA, Ensembl, Ensembl Genomes, EuropePMC, HPA, IntAct /MINT , InterPro, PDBe, PRIDE, SILVA, STRING, UniProt ● Note that Ensembl’s compute infrastructure physically relocated in 2016, so “Users/IP address” data are not available for that year. In this case, the 2015 numbers were rolled forward to 2016. ● Note that STRING makes only minor releases in 2014 and 2016, in that the interactions are re-computed, but the number of “Data entries” remains unchanged. The major releases that change the number of “Data entries” happened in 2013 and 2015. So, for “Data entries” , the number for 2013 was rolled forward to 2014, and the number for 2015 was rolled forward to 2016. The ELIXIR Core Data Resources: fundamental infrastructure for the life sciences 1 Figure 2: Usage of Core Data Resources in research The following steps were taken: 1. API calls were run on open access full text articles in Europe PMC to identify articles that mention Core Data Resource by name or include specific data record accession numbers. -
ANNUAL REPORT 2010 Contents
ANNUAL REPORT 2010 Contents I. Overviews ...............................................................................................................3 Year 2010 in review, Director of FIMM ............................................................................. 3 Views from the former and current Chair of the Board ...................................................5 II. FIMM Launch Event ................................................................................................ 6 III. How is the Nordic EMBL Partnership build-up progressing in Oslo and Umeå? ..........7 IV. Academician of Science, Professor Leena Peltonen-Palotie in memoriam .............. 8 V. Research ................................................................................................................ 10 Human Genomics ..........................................................................................................10 Medical Systems Biology and Translational Research ..................................................... 14 Research collaborations and highlights ..........................................................................21 Personalized medicine of cancer becoming a reality.......................................................25 Doctoral Training ...........................................................................................................26 VI. Technology Centre .................................................................................................28 Genomics Unit ..............................................................................................................28 -
IST Annual Report 2019
Annual Report 2019 IST Austria administrative and The people of IST Austria technical support staff by nationality Austria 59.4% Nationalities on campus Germany 5.6% Hungary 3.1% Poland 2.5% Romania 2.5% Scientists as well as administrative and technical support staff come Italy 2.1% Russia 1.7% from all over the world to conduct and back research at IST Austria. Czech Republic 1.4% As of December 31, 2019, a total of 72 nationalities were represented India 1.4% Slovakia 1.4% on campus. Spain 1.4% UK 1.4% Other 16.1% North America Europe Asia Canada Albania Italy Afghanistan Cuba Andorra Latvia Bangladesh El Salvador Armenia Lithuania China Mexico Austria Luxembourg South Korea USA Belarus Macedonia India Belgium Malta Iran Bosnia and Netherlands Israel Herzegovina Norway Japan Bulgaria Poland Jordan Croatia Portugal Kazakhstan Cyprus Romania Lebanon Czech Republic Serbia Mongolia Denmark Slovakia Philippines Finland Slovenia Russia France Spain Singapore Georgia Sweden Syria Germany Switzerland Vietnam Greece Turkey Hungary UK Ireland Ukraine Africa Egypt Kenya IST Austria scientists by nationality Libya Austria 14.7% Nigeria Germany 10.9% South America Italy 7.4% Argentina India 5.9% Russia 4.7% Brazil Slovakia 4.1% Chile China 4.1% Colombia Hungary 3.7% Peru Spain 3.3% Uruguay USA 3.1% Czech Republic 2.9% UK 2.4% Oceania Other 32.8% Australia Content 2 HAPPY BIRTHDAY! 40 RESEARCH 4 Foreword by the president 42 Biology 5 Board member voices 44 Computer science 6 “An Austrian miracle” 46 Mathematics A year of celebration 48 Neuroscience -
Annual Scientific Report 2013 on the Cover Structure 3Fof in the Protein Data Bank, Determined by Laponogov, I
EMBL-European Bioinformatics Institute Annual Scientific Report 2013 On the cover Structure 3fof in the Protein Data Bank, determined by Laponogov, I. et al. (2009) Structural insight into the quinolone-DNA cleavage complex of type IIA topoisomerases. Nature Structural & Molecular Biology 16, 667-669. © 2014 European Molecular Biology Laboratory This publication was produced by the External Relations team at the European Bioinformatics Institute (EMBL-EBI) A digital version of the brochure can be found at www.ebi.ac.uk/about/brochures For more information about EMBL-EBI please contact: [email protected] Contents Introduction & overview 3 Services 8 Genes, genomes and variation 8 Molecular atlas 12 Proteins and protein families 14 Molecular and cellular structures 18 Chemical biology 20 Molecular systems 22 Cross-domain tools and resources 24 Research 26 Support 32 ELIXIR 36 Facts and figures 38 Funding & resource allocation 38 Growth of core resources 40 Collaborations 42 Our staff in 2013 44 Scientific advisory committees 46 Major database collaborations 50 Publications 52 Organisation of EMBL-EBI leadership 61 2013 EMBL-EBI Annual Scientific Report 1 Foreword Welcome to EMBL-EBI’s 2013 Annual Scientific Report. Here we look back on our major achievements during the year, reflecting on the delivery of our world-class services, research, training, industry collaboration and European coordination of life-science data. The past year has been one full of exciting changes, both scientifically and organisationally. We unveiled a new website that helps users explore our resources more seamlessly, saw the publication of ground-breaking work in data storage and synthetic biology, joined the global alliance for global health, built important new relationships with our partners in industry and celebrated the launch of ELIXIR. -
Strategic Plan 2011-2016
Strategic Plan 2011-2016 Wellcome Trust Sanger Institute Strategic Plan 2011-2016 Mission The Wellcome Trust Sanger Institute uses genome sequences to advance understanding of the biology of humans and pathogens in order to improve human health. -i- Wellcome Trust Sanger Institute Strategic Plan 2011-2016 - ii - Wellcome Trust Sanger Institute Strategic Plan 2011-2016 CONTENTS Foreword ....................................................................................................................................1 Overview .....................................................................................................................................2 1. History and philosophy ............................................................................................................ 5 2. Organisation of the science ..................................................................................................... 5 3. Developments in the scientific portfolio ................................................................................... 7 4. Summary of the Scientific Programmes 2011 – 2016 .............................................................. 8 4.1 Cancer Genetics and Genomics ................................................................................ 8 4.2 Human Genetics ...................................................................................................... 10 4.3 Pathogen Variation .................................................................................................. 13 4.4 Malaria -
Browsing Genomes with Ensembl Annotation
Browsing genomes with EnsEMBL Annotation • During recent years release of large amounts of sequence data • Raw sequence data are not so useful on its own. They are most valuable when provided with comprehensive good quality annotation CCCAACAAGAATGTAAAATCTTTAAGTGCCTGTTTTCATACTTATTTGACCACCCTATCTCTAGAATCTTGCATGATG TCTAGCCCTAGTAGGATCAAAAAATACTTACAAAGCAACTGAATAGCTACATGAATAGATGGATGAATAAATGCATG GGTGGATGGATGGATTAATGAAATCATTTATATGACTTAAAGTTTGCAGAGGAGTATCATATTTGGAAGGCAGTAAG GAAGTCTGTGTAGTCGATGGTAAAGGCAATTGGGAAGTTTGTTAGGCACAATAGGTCAAAATTTGTTTTTGAAGTCC TGTTACTTCACGTTTCTTTGTTTCACTTTCTTAAAACAGGAAACTCTTTTCTATGATCATTCTTCCAGGGCCTGGCTCT TCATCTGCAACCCAGTAATATCCCTAATGTCAAAAAGCTACTGGTTTAATTCGTGCCATTTTCAAAGAGGACTACTGA ATTCTGATGTGGCTTCAAACATTTAGGTTAGGCATATCTAATGGAGAACTTGCAGCCACACTGACTTGTAGTGAAAT ATCTATTTTGAGCCTGCCCAGTGTTGCTTAAATTGTAGTTTTCCTTGCCAGCTATTCATACAAGAGATGTGAGAAGCA CCATAAAAGGCGTTGTGAGGAGTTGTGGGGGAGTGAGGGAGAGAAGAGGTTGAAAAGCTTATTAGCTGCTGTACGG TAAAAGTGAGCTCTTACGGGAATGGGAATGTAGTTTTAGCCCTCCAGGGATTCTATTTAGCCCGCCAGGAATTAACC TTGACTATAAATAGGCCATCAATGACCTTTCCAGAGAATGTTCAGAGACCTCAACTTTGTTTAGAGATCTTGTGTGGG TGGAACTTCCTGTTTGCACACAGAGCAGCATAAAGCCCAGTTGCTTTGGGAAGTGTTTGGGACCAGATGGATTGTAG GGAGTAGGGTACAATACAGTCTGTTCTCCTCCAGCTCCTTCTTTCTGCAACATGGGGAAGAACAAACTCCTTCATCC AAGTCTGGTTCTTCTCCTCTTGGTCCTCCTGCCCACAGACGCCTCAGTCTCTGGAAAACCGTGAGTTCCACACAGAG AGCGTGAAGCATGAACCTAGAGTCCTTCATTTATTGCAGATTTTTCTTTATATCATTCCTTTTTCTTTCCTATGATACT GTCATCTTCTTATCTCTAAGATTCCTTCCAGATTTTACAAATCTAGTTTACTCATTACTTGCTTACTTTTAATCATTCT TCCCCAACTCTCTGAAGCTCTAATATGCAAAGCCTTCCTAAGGGGTGTCAGAAATTTTTAGCTTTTTAAAAGAATAAA -
NEWSLETTER – March 2016
BRITISH SOCIETY FOR PROTEOME RESEARCH www.bspr.org UK Charity Number 1121692 Registered Company No.6319769 NEWSLETTER – March 2016 BSPR 2016 – PROTEOMIC APPROACHES TO HEALTH AND DISEASE University of Glasgow – 25-27 July 2016 th th The 2016 meeting of the Society will be held in the Western Infirmary Lecture Theatre building from Mon 25 – Wed 27 July 2016. For up to date information: (www.bspr.org/node/527) Abstract submission now open. Deadline: Mon 6th May. Registration opening shortly! Speakers include: Plenary - Matthias Mann – Max-Planck Institute for Biochemistry, Martinsried (GER) Rob Beynon (BSPR Lecturer 2016) – University of Liverpool (UK) Keynote: -Cancer: Judit Villen – University of Washington, Genome Sciences (US) Integration Omics: David Matthews – University of Bristol (UK) Metabolic disease: Harald Mischak – University of Glasgow (UK) Development and ageing: Xavier Druart - French Nat’l Inst for Agricultural Res, Nouzilly (FR) Nutrition/Lifestyle & Food Security: David Eckersall - University of Glasgow (UK) Infectious disease and Microbiome: Frank Schmidt – University of Greifswald (GER) New Technologies - Matthias Hentze – EMBL Heidelberg (GER) Data Analysis – Maria Martin – EMBL-EBI Cambridge (UK) Translation – Chris Sander, New York (US) More than 20 abstracts will be selected for oral presentation! Bursaries and Awards BSPR 2016 - The Society will be awarding the MJ Dunn Fellowship for attendance at BSPR 2016, and will also be awarding Bursaries to student members (£250) to enable them to attend a conference of their choice, including BSPR 2016. 10th European Summer School EMBO Workshop “Advanced Proteomics”, July 31st – August 6th, 2016. The Society will be awarding one or two bursaries (residential registration fee) to student members to enable them attend this workshop which will be held in Kloster Neustift, Brixen/Bressanone, South Tyrol, Italy. -
The Helicase Ded1p Controls Use of Near-Cognate Translation Initiation Codons in 5Utrs
The helicase Ded1p controls use of near- cognate translation initiation codons in 5# UTRs The MIT Faculty has made this article openly available. Please share how this access benefits you. Your story matters. Citation Guenther, Ulf-Peter et al. "The helicase Ded1p controls use of near- cognate translation initiation codons in 5# UTRs." Nature 559, 7712 (June 2018): 130–134. © 2018 Macmillan Publishers Ltd., part of Springer Nature As Published http://dx.doi.org/10.1038/s41586-018-0258-0 Publisher Springer Science and Business Media LLC Version Author's final manuscript Citable link https://hdl.handle.net/1721.1/125996 Terms of Use Creative Commons Attribution-Noncommercial-Share Alike Detailed Terms http://creativecommons.org/licenses/by-nc-sa/4.0/ HHS Public Access Author manuscript Author ManuscriptAuthor Manuscript Author Nature. Manuscript Author Author manuscript; Manuscript Author available in PMC 2018 December 27. Published in final edited form as: Nature. 2018 July ; 559(7712): 130–134. doi:10.1038/s41586-018-0258-0. The helicase Ded1p controls use of near-cognate translation initiation codons in 5′UTRs Ulf-Peter Guenther1,*, David E. Weinberg2,3,*, Meghan M. Zubradt2,4,*, Frank A. Tedeschi1, Brittany N. Stawicki1, Leah L. Zagore1, Gloria A. Brar5, Donny D. Licatalosi1, David P. Bartel3, Jonathan S. Weissman2,4, and Eckhard Jankowsky1,6,7 1Center for RNA Science and Therapeutics, School of Medicine, Case Western Reserve University, Cleveland, OH 44106, USA 2Department of Cellular and Molecular Pharmacology, University of California, -
The Genomic Basis of Circadian and Circalunar Timing Adaptations in a Midge Tobias S
OPEN ARTICLE doi:10.1038/nature20151 The genomic basis of circadian and circalunar timing adaptations in a midge Tobias S. Kaiser1,2,3†, Birgit Poehn1,3, David Szkiba2, Marco Preussner4, Fritz J. Sedlazeck2†, Alexander Zrim2, Tobias Neumann1,2, Lam-Tung Nguyen2,5, Andrea J. Betancourt6, Thomas Hummel3,7, Heiko Vogel8, Silke Dorner1, Florian Heyd4, Arndt von Haeseler2,3,5 & Kristin Tessmar-Raible1,3 Organisms use endogenous clocks to anticipate regular environmental cycles, such as days and tides. Natural variants resulting in differently timed behaviour or physiology, known as chronotypes in humans, have not been well characterized at the molecular level. We sequenced the genome of Clunio marinus, a marine midge whose reproduction is timed by circadian and circalunar clocks. Midges from different locations show strain-specific genetic timing adaptations. We examined genetic variation in five C. marinus strains from different locations and mapped quantitative trait loci for circalunar and circadian chronotypes. The region most strongly associated with circadian chronotypes generates strain-specific differences in the abundance of calcium/calmodulin-dependent kinase II.1 (CaMKII.1) splice variants. As equivalent variants were shown to alter CaMKII activity in Drosophila melanogaster, and C. marinus (Cma)-CaMKII.1 increases the transcriptional activity of the dimer of the circadian proteins Cma-CLOCK and Cma-CYCLE, we suggest that modulation of alternative splicing is a mechanism for natural adaptation in circadian timing. Around the new or full moon, during a few specific hours surround- Our study aimed to identify the genetic basis of C. marinus adaptation ing low tide, millions of non-biting midges of the species C. -
Future Plans from the New Head of Personnel What's It Really Like to Come to EMBL As a Predoc? Official: Nordic EMBL Partnersh
41 EMBL October 2007 &Newslettercetera of the European Molecular Biology Laboratory What’s it really like to come to EMBL as a predoc? A predoc’s first few weeks at EMBL can be a culture shock. It often means coping with a new language, finding a new home, meeting so many people that you can’t remember any names and, more often than not, leaving friends behind. But it’s also the beginning of a brilliant opportunity. Inside, Mateusz Putyrski, a new PhD in Carsten Schultz’s lab at EMBL Heidelberg in August, talks about how to settle in smoothly – and once settled in, how to stay connected to the outside world. page 5 Future plans from the new Head of Personnel One of Yann Chabod’s first tasks as Head of the Personnel department will be to oversee the imple- mentation of its new SAP HR database early next year, replacing the old PAISY system, which will be, as he says, “a big, big change in the way we do everything. The day-to-day job is being done well already. We’ve got very good people here but we can still improve the quality of our customer service with the right tools. I’m here to help and support them... and to learn about this new field!” page 3 Official: Nordic EMBL Partnership for Molecular Medicine University rectors and ministry and council representatives from Scandinavia came to EMBL Heidelberg on October 3 for the official agreement signing of the Nordic EMBL Partnership for Molecular Medicine. The partnership will combine the recognised, complementary strengths of all four partners to collaborate closely in the area of molecular medicine, tackling some of the most challeng- ing problems in biomedicine.