DOCSLIB.ORG

Ensembl Genomes: Extending Ensembl Across the Taxonomic Space P

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Ensembl Genomes: Extending Ensembl Across the Taxonomic Space P Published online 1 November 2009 Nucleic Acids Research, 2010, Vol. 38, Database issue D563–D569 doi:10.1093/nar/gkp871 Ensembl Genomes: Extending Ensembl across the taxonomic space P. J. Kersey*, D. Lawson, E. Birney, P. S. Derwent, M. Haimel, J. Herrero, S. Keenan, A. Kerhornou, G. Koscielny, A. Ka¨ ha¨ ri, R. J. Kinsella, E. Kulesha, U. Maheswari, K. Megy, M. Nuhn, G. Proctor, D. Staines, F. Valentin, A. J. Vilella and A. Yates EMBL-European Bioinformatics Institute, Wellcome Trust Genome Campus, Cambridge CB10 1SD, UK Received August 14, 2009; Revised September 28, 2009; Accepted September 29, 2009 ABSTRACT nucleotide archives; numerous other genomes exist in states of partial assembly and annotation; thousands of Ensembl Genomes (http://www.ensemblgenomes viral genomes sequences have also been generated. .org) is a new portal offering integrated access to Moreover, the increasing use of high-throughput genome-scale data from non-vertebrate species sequencing technologies is rapidly reducing the cost of of scientific interest, developed using the Ensembl genome sequencing, leading to an accelerating rate of genome annotation and visualisation platform. data production. This not only makes it likely that in Ensembl Genomes consists of five sub-portals (for the near future, the genomes of all species of scientific bacteria, protists, fungi, plants and invertebrate interest will be sequenced; but also the genomes of many metazoa) designed to complement the availability individuals, with the possibility of providing accurate and of vertebrate genomes in Ensembl. Many of the sophisticated annotation through the similarly low-cost databases supporting the portal have been built in application of functional assays. Many of these trends have first become visible in human genomics, but are close collaboration with the scientific community, spreading to other species as costs continue to fall. which we consider as essential for maintaining For example, the 1000 genomes project (to sequence the accuracy and usefulness of the resource. 1000 human genomes) has quickly been followed by the A common set of user interfaces (which include launch of similar initiatives in Arabidopsis (1), Plasmodium a graphical genome browser, FTP, BLAST search, (http://www.genome.gov/26523588), Drosophila (http:// a query optimised data warehouse, programmatic www.dpgp.org), and other species. access, and a Perl API) is provided for all domains. These developments place particular demands on bio- Data types incorporated include annotation of logical databases, but also represent an opportunity. The (protein and non-protein coding) genes, cross European Bioinformatics Institute (EBI) is involved references to external resources, and high (together with our collaborators) in the operation of a throughput experimental data (e.g. data from large number of archival databases, e.g. the European Nucleotide Archive (ENA) (2), ArrayExpress (3) (for scale studies of gene expression and polymorphism gene expression data), PRIDE (4) (for proteomics data) visualised in their genomic context). Additionally, etc. Such databases remain essential as a permanent extensive comparative analysis has been per- record of experimental effort, and are under continuous formed, both within defined clades and across the development to accommodate data produced by new wider taxonomy, and sequence alignments and technologies. The UniProt Knowledgebase (UniProtKB) gene trees resulting from this can be accessed (5), in contrast, uses information curated from the scien- through the site. tific literature to describe proteins, which can subsequently serve as reference data for systems designed to automati- cally transfer annotation to similar, less well-characterised INTRODUCTION sequences. However, such computed annotation is Since 1995, when the genome of a cellular organism best recalculated periodically as algorithms are refined was completely sequenced for the first time, genome and the quantity and quality of reference data increases. sequencing has transformed the biological sciences. Moreover, the interpretation of potentially huge raw Today, in excess of 1000 genomes have been sequenced, data sets as integrated features (e.g. a gene ‘built’ assembled, annotated and deposited in the public from transcriptional evidence) is a necessity if users are *To whom correspondence should be addressed. Tel: +44 1223 494 601; Fax: +44 1223 494 468; Email: [email protected] ß The Author(s) 2009. Published by Oxford University Press. This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/ by-nc/2.5/uk/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. D564 Nucleic Acids Research, 2010, Vol. 38, Database issue not to drown in an excess of information. This calls for a of Ensembl Genomes, breadth of taxonomic spread. different type of resource i.e. derived and interpreted, com- Moreover, Ensembl is not just a data visualisation plementing the archival and literature-based resources. tool, but a suite of programs for data production The structure of a genome provides a natural index (e.g. gene calling, comparative genomics) that can be through which data from other molecular biology experi- deployed individually according to the needs of an indi- ments can be accessed. The Ensembl (6) platform for vidual community. We are looking forward to working genome annotation and visualisation has been under with increasing numbers of collaborators to improve not development by the EBI and the Wellcome Trust only access to genome annotation, but the quality and Sanger Institute since 2000, with an initial focus on the depth of the annotation itself. human genome that has since widened to include other vertebrates. This paper describes ‘Ensembl Genomes’, a new resource recently launched by the EBI to complement Ensembl by providing access to genome-scale data from OVERVIEW OF ENSEMBL GENOMES non-vertebrate species through the same user interfaces as Ensembl Genomes (http://www.ensemblgenomes.org) Ensembl. There are two big advantages of this approach. consists of separate portals for each of five distinct First, the Ensembl software system has evolved in domains of life: bacteria, protists, fungi, plants, and inver- response to new data types that have frequently first tebrate metazoa. Each site contains data for selected species appeared in human genomic studies, but which are now from within their domain, chosen for their scientific increasingly appearing in the context of other species; its interest. Information is available about each species, re-use provides a cost-effective way of providing sophisti- including the assembly version and annotation methods cated data analysis and visualisation tools for a wider used, the overall composition of the genome, etc. These range of genomes. Secondly, the use of a common have been customised for the species in Ensembl system for all genomes greatly decreases the cost of Genomes; for example, in Ensembl Bacteria, a circular broad range comparative genomics and other inter- view of the genome is provided, and the top-level pages species data analysis. For example, since the launch of have been designed to provide structured access to the Ensembl Genomes, data from malarial parasites (genus large numbers of similar strains that have been sequenced Plasmodium, available through Ensembl Protists), the in many clades. The main functionality offered by the malarial vector (Anopheles gambiae, available through portals is access to a graphical view of each genome, Ensembl Metazoa), and the human host (in Ensembl) using the Ensembl genome browser software. The can now be accessed through a common set of interfaces. browser offers a number of views of locations in the With Ensembl Genomes, we aim to provide an genome, genes, and specific transcripts; tabs at the top of integrated portal to reference sequence and annotation the page allow users to switch between these different levels, from all species of scientific interest; and thereby to while a context-dependent left hand menu offers access to a complement, and provide convenient access to, data selection of data views specific to each. The main display from existing and novel community initiatives in particu- lar areas. Many of the databases that support Ensembl then appears in the central panel. Users can integrate their Genomes have been built by, or in close collaboration own analyses into appropriate displays by using the with, groups who maintain specialist data resources for Distributed Annotated System (10) (DAS). Specific views individual species, and we are actively seeking to extend exist for expression data, SNPs and other polymorphisms, the range of these collaborations. The development of and comparative genomics. With each new data release, the accurate and useful genome databases is wholly dependent browser software is updated to a recent version, ensuring on the involvement of scientists with knowledge of the that a consistent user experience is provided between most important data and its biological context. Ensembl Ensembl and Ensembl Genomes. Release frequency is Genomes can support such expertise through the provi- four to six times a year, tied to Ensembl releases where sion of a data analysis and service infrastructure, close practical. Use of the browser is illustrated in Figure 1. integration with the archival databases,
Load more

Recommended publications
  • Abstracts Genome 10K & Genome Science 29 Aug - 1 Sept 2017 Norwich Research Park, Norwich, Uk
    Genome 10K c ABSTRACTS GENOME 10K & GENOME SCIENCE 29 AUG - 1 SEPT 2017 NORWICH RESEARCH PARK, NORWICH, UK Genome 10K c 48 KEYNOTE SPEAKERS ............................................................................................................................... 1 Dr Adam Phillippy: Towards the gapless assembly of complete vertebrate genomes .................... 1 Prof Kathy Belov: Saving the Tasmanian devil from extinction ......................................................... 1 Prof Peter Holland: Homeobox genes and animal evolution: from duplication to divergence ........ 2 Dr Hilary Burton: Genomics in healthcare: the challenges of complexity .......................................... 2 INVITED SPEAKERS ................................................................................................................................. 3 Vertebrate Genomics ........................................................................................................................... 3 Alex Cagan: Comparative genomics of animal domestication .......................................................... 3 Plant Genomics .................................................................................................................................... 4 Ksenia Krasileva: Evolution of plant Immune receptors ..................................................................... 4 Andrea Harper: Using Associative Transcriptomics to predict tolerance to ash dieback disease in European ash trees ............................................................................................................
    [Show full text]
  • Rare Variant Contribution to Human Disease in 281,104 UK Biobank Exomes W ­ 1,19 1,19 2,19 2 2 Quanli Wang , Ryan S
    https://doi.org/10.1038/s41586-021-03855-y Accelerated Article Preview Rare variant contribution to human disease W in 281,104 UK Biobank exomes E VI Received: 3 November 2020 Quanli Wang, Ryan S. Dhindsa, Keren Carss, Andrew R. Harper, Abhishek N ag­­, I oa nn a Tachmazidou, Dimitrios Vitsios, Sri V. V. Deevi, Alex Mackay, EDaniel Muthas, Accepted: 28 July 2021 Michael Hühn, Sue Monkley, Henric O ls so n , S eb astian Wasilewski, Katherine R. Smith, Accelerated Article Preview Published Ruth March, Adam Platt, Carolina Haefliger & Slavé PetrovskiR online 10 August 2021 P Cite this article as: Wang, Q. et al. Rare variant This is a PDF fle of a peer-reviewed paper that has been accepted for publication. contribution to human disease in 281,104 UK Biobank exomes. Nature https:// Although unedited, the content has been subjectedE to preliminary formatting. Nature doi.org/10.1038/s41586-021-03855-y (2021). is providing this early version of the typeset paper as a service to our authors and Open access readers. The text and fgures will undergoL copyediting and a proof review before the paper is published in its fnal form. Please note that during the production process errors may be discovered which Ccould afect the content, and all legal disclaimers apply. TI R A D E T A R E L E C C A Nature | www.nature.com Article Rare variant contribution to human disease in 281,104 UK Biobank exomes W 1,19 1,19 2,19 2 2 https://doi.org/10.1038/s41586-021-03855-y Quanli Wang , Ryan S.
    [Show full text]
  • The ELIXIR Core Data Resources: ​Fundamental Infrastructure for The
    Supplementary Data: The ELIXIR Core Data Resources: fundamental infrastructure ​ for the life sciences The “Supporting Material” referred to within this Supplementary Data can be found in the Supporting.Material.CDR.infrastructure file, DOI: 10.5281/zenodo.2625247 (https://zenodo.org/record/2625247). ​ ​ Figure 1. Scale of the Core Data Resources Table S1. Data from which Figure 1 is derived: Year 2013 2014 2015 2016 2017 Data entries 765881651 997794559 1726529931 1853429002 2715599247 Monthly user/IP addresses 1700660 2109586 2413724 2502617 2867265 FTEs 270 292.65 295.65 289.7 311.2 Figure 1 includes data from the following Core Data Resources: ArrayExpress, BRENDA, CATH, ChEBI, ChEMBL, EGA, ENA, Ensembl, Ensembl Genomes, EuropePMC, HPA, IntAct /MINT , InterPro, PDBe, PRIDE, SILVA, STRING, UniProt ● Note that Ensembl’s compute infrastructure physically relocated in 2016, so “Users/IP address” data are not available for that year. In this case, the 2015 numbers were rolled forward to 2016. ● Note that STRING makes only minor releases in 2014 and 2016, in that the interactions are re-computed, but the number of “Data entries” remains unchanged. The major releases that change the number of “Data entries” happened in 2013 and 2015. So, for “Data entries” , the number for 2013 was rolled forward to 2014, and the number for 2015 was rolled forward to 2016. The ELIXIR Core Data Resources: fundamental infrastructure for the life sciences ​ 1 Figure 2: Usage of Core Data Resources in research The following steps were taken: 1. API calls were run on open access full text articles in Europe PMC to identify articles that ​ ​ mention Core Data Resource by name or include specific data record accession numbers.
    [Show full text]
  • (DDD) Project: What a Genomic Approach Can Achieve
    The Deciphering Development Disorders (DDD) project: What a genomic approach can achieve RCP ADVANCED MEDICINE, LONDON FEB 5TH 2018 HELEN FIRTH DM FRCP DCH, SANGER INSTITUTE 3,000,000,000 bases in each human genome Disease & developmental Health & development disorders Fascinating facts about your genome! –~20,000 protein-coding genes –~30% of genes have a known role in disease or developmental disorders –~10,000 protein altering variants –~100 protein truncating variants –~70 de novo mutations (~1-2 coding ie. In exons of genes) Rare Disease affects 1 in 17 people •Prior to DDD, diagnostic success in patients with rare paediatric disease was poor •Not possible to diagnose many patients with current methodology in routine use– maximum benefit in this group •DDD recruited patients with severe/extreme clinical features present from early childhood with high expectation of genetic basis •Recruitment was primarily of trios (ie The Doctor Sir Luke Fildes (1887) child and both parents) ~ 90% Making a genomic diagnosis of a rare disease improves care •Accurate diagnosis is the cornerstone of good medical practice – informing management, treatment, prognosis and prevention •Enables risk to other family members to be determined enabling predictive testing with potential for surveillance and therapy in some disorders February 28th 2018 •Reduces sense of isolation, enabling better access to support and information •Curtails the diagnostic odyssey •Not just a descriptive label; identifies the fundamental cause of disease A genomic diagnosis can be a gateway to better treatment •Not just a descriptive label; identifies the fundamental cause of disease •Biallelic mutations in the CFTR gene cause Cystic Fibrosis • CFTR protein is an epithelial ion channel regulating absorption/ secretion of salt and water in the lung, sweat glands, pancreas & GI tract.
    [Show full text]
  • Different Evolutionary Patterns of Snps Between Domains and Unassigned Regions in Human Protein‑Coding Sequences
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Springer - Publisher Connector Mol Genet Genomics (2016) 291:1127–1136 DOI 10.1007/s00438-016-1170-7 ORIGINAL ARTICLE Different evolutionary patterns of SNPs between domains and unassigned regions in human protein‑coding sequences Erli Pang1 · Xiaomei Wu2 · Kui Lin1 Received: 14 September 2015 / Accepted: 18 January 2016 / Published online: 30 January 2016 © The Author(s) 2016. This article is published with open access at Springerlink.com Abstract Protein evolution plays an important role in Furthermore, the selective strength on domains is signifi- the evolution of each genome. Because of their functional cantly greater than that on unassigned regions. In addition, nature, in general, most of their parts or sites are differently among all of the human protein sequences, there are 117 constrained selectively, particularly by purifying selection. PfamA domains in which no SNPs are found. Our results Most previous studies on protein evolution considered indi- highlight an important aspect of protein domains and may vidual proteins in their entirety or compared protein-coding contribute to our understanding of protein evolution. sequences with non-coding sequences. Less attention has been paid to the evolution of different parts within each pro- Keywords Human genome · Protein-coding sequence · tein of a given genome. To this end, based on PfamA anno- Protein domain · SNPs · Natural selection tation of all human proteins, each protein sequence can be split into two parts: domains or unassigned regions. Using this rationale, single nucleotide polymorphisms (SNPs) in Introduction protein-coding sequences from the 1000 Genomes Project were mapped according to two classifications: SNPs occur- Studying protein evolution is crucial for understanding ring within protein domains and those within unassigned the evolution of speciation and adaptation, senescence and regions.
    [Show full text]
  • Annual Scientific Report 2013 on the Cover Structure 3Fof in the Protein Data Bank, Determined by Laponogov, I
    EMBL-European Bioinformatics Institute Annual Scientific Report 2013 On the cover Structure 3fof in the Protein Data Bank, determined by Laponogov, I. et al. (2009) Structural insight into the quinolone-DNA cleavage complex of type IIA topoisomerases. Nature Structural & Molecular Biology 16, 667-669. © 2014 European Molecular Biology Laboratory This publication was produced by the External Relations team at the European Bioinformatics Institute (EMBL-EBI) A digital version of the brochure can be found at www.ebi.ac.uk/about/brochures For more information about EMBL-EBI please contact: [email protected] Contents Introduction & overview 3 Services 8 Genes, genomes and variation 8 Molecular atlas 12 Proteins and protein families 14 Molecular and cellular structures 18 Chemical biology 20 Molecular systems 22 Cross-domain tools and resources 24 Research 26 Support 32 ELIXIR 36 Facts and figures 38 Funding & resource allocation 38 Growth of core resources 40 Collaborations 42 Our staff in 2013 44 Scientific advisory committees 46 Major database collaborations 50 Publications 52 Organisation of EMBL-EBI leadership 61 2013 EMBL-EBI Annual Scientific Report 1 Foreword Welcome to EMBL-EBI’s 2013 Annual Scientific Report. Here we look back on our major achievements during the year, reflecting on the delivery of our world-class services, research, training, industry collaboration and European coordination of life-science data. The past year has been one full of exciting changes, both scientifically and organisationally. We unveiled a new website that helps users explore our resources more seamlessly, saw the publication of ground-breaking work in data storage and synthetic biology, joined the global alliance for global health, built important new relationships with our partners in industry and celebrated the launch of ELIXIR.
    [Show full text]
  • 1 Constructing the Scientific Population in the Human Genome Diversity and 1000 Genome Projects Joseph Vitti I. Introduction: P
    Constructing the Scientific Population in the Human Genome Diversity and 1000 Genome Projects Joseph Vitti I. Introduction: Populations Coming into Focus In November 2012, some eleven years after the publication of the first draft sequence of a human genome, an article published in Nature reported a new ‘map’ of the human genome – created from not one, but 1,092 individuals. For many researchers, however, what was compelling was not the number of individuals sequenced, but rather the fourteen worldwide populations they represented. Comparisons that could be made within and among these populations represented new possibilities for the scientific study of human genetic variation. The paper – which has been cited over 400 times in the subsequent year – was the output of the first phase of the 1000 Genomes Project, one of several international research consortia launched with the intent of identifying and cataloguing such variation. With the project’s phase three data release, anticipated in early spring 2014, the sample size will rise to over 2500 individuals representing twenty-six populations. Each individual’s full sequence data is made publicly available online, and is also preserved through the establishment of immortal cell lines, from which DNA can be extracted and distributed. With these developments, population-based science has been made genomic, and scientific conceptions of human populations have begun to crystallize (see appendix). Such extensive biobanking and databasing of human populations is remarkable for a number of reasons, not least among them the socially charged terrain that such an enterprise inevitably must navigate. While the 1000 Genomes Project (1000G) has been relatively uncontroversial in its reception, predecessors such as the Human Genome Diversity Project (HGDP), first conceived in 1991, faced greater difficulty.
    [Show full text]
  • NIH-GDS: Genomic Data Sharing
    NIH-GDS: Genomic Data Sharing National Institutes of Health Data type Explain whether the research being considered for funding involves human data, non- human data, or both. Information to be included in this section: • Type of data being collected: human, non-human, or both human & non-human. • Type of genomic data to be shared: sequence, transcriptomic, epigenomic, and/or gene expression. • Level of the genomic data to be shared: Individual-level, aggregate-level, or both. • Relevant associated data to be shared: phenotype or exposure. • Information needed to interpret the data: study protocols, survey tools, data collection instruments, data dictionary, software (including version), codebook, pipeline metadata, etc. This information should be provided with unrestricted access for all data levels. Data repository Identify the data repositories to which the data will be submitted, and for human data, whether the data will be available through unrestricted or controlled-access. For human genomic data, investigators are expected to register all studies in the database of Genotypes and Phenotypes (dbGaP) by the time data cleaning and quality control measures begin in addition to submitting the data to the relevant NIH-designated data repository (e.g., dbGaP, Gene Expression Omnibus (GEO), Sequence Read Archive (SRA), the Cancer Genomics Hub) after registration. Non-human data may be made available through any widely used data repository, whether NIH- funded or not, such as GEO, SRA, Trace Archive, Array Express, Mouse Genome Informatics, WormBase, the Zebrafish Model Organism Database, GenBank, European Nucleotide Archive, or DNA Data Bank of Japan. Data in unrestricted-access repositories (e.g., The 1000 Genomes Project) are publicly available to anyone.
    [Show full text]
  • Strategic Plan 2011-2016
    Strategic Plan 2011-2016 Wellcome Trust Sanger Institute Strategic Plan 2011-2016 Mission The Wellcome Trust Sanger Institute uses genome sequences to advance understanding of the biology of humans and pathogens in order to improve human health. -i- Wellcome Trust Sanger Institute Strategic Plan 2011-2016 - ii - Wellcome Trust Sanger Institute Strategic Plan 2011-2016 CONTENTS Foreword ....................................................................................................................................1 Overview .....................................................................................................................................2 1. History and philosophy ............................................................................................................ 5 2. Organisation of the science ..................................................................................................... 5 3. Developments in the scientific portfolio ................................................................................... 7 4. Summary of the Scientific Programmes 2011 – 2016 .............................................................. 8 4.1 Cancer Genetics and Genomics ................................................................................ 8 4.2 Human Genetics ...................................................................................................... 10 4.3 Pathogen Variation .................................................................................................. 13 4.4 Malaria
    [Show full text]
  • Browsing Genomes with Ensembl Annotation
    Browsing genomes with EnsEMBL Annotation • During recent years release of large amounts of sequence data • Raw sequence data are not so useful on its own. They are most valuable when provided with comprehensive good quality annotation CCCAACAAGAATGTAAAATCTTTAAGTGCCTGTTTTCATACTTATTTGACCACCCTATCTCTAGAATCTTGCATGATG TCTAGCCCTAGTAGGATCAAAAAATACTTACAAAGCAACTGAATAGCTACATGAATAGATGGATGAATAAATGCATG GGTGGATGGATGGATTAATGAAATCATTTATATGACTTAAAGTTTGCAGAGGAGTATCATATTTGGAAGGCAGTAAG GAAGTCTGTGTAGTCGATGGTAAAGGCAATTGGGAAGTTTGTTAGGCACAATAGGTCAAAATTTGTTTTTGAAGTCC TGTTACTTCACGTTTCTTTGTTTCACTTTCTTAAAACAGGAAACTCTTTTCTATGATCATTCTTCCAGGGCCTGGCTCT TCATCTGCAACCCAGTAATATCCCTAATGTCAAAAAGCTACTGGTTTAATTCGTGCCATTTTCAAAGAGGACTACTGA ATTCTGATGTGGCTTCAAACATTTAGGTTAGGCATATCTAATGGAGAACTTGCAGCCACACTGACTTGTAGTGAAAT ATCTATTTTGAGCCTGCCCAGTGTTGCTTAAATTGTAGTTTTCCTTGCCAGCTATTCATACAAGAGATGTGAGAAGCA CCATAAAAGGCGTTGTGAGGAGTTGTGGGGGAGTGAGGGAGAGAAGAGGTTGAAAAGCTTATTAGCTGCTGTACGG TAAAAGTGAGCTCTTACGGGAATGGGAATGTAGTTTTAGCCCTCCAGGGATTCTATTTAGCCCGCCAGGAATTAACC TTGACTATAAATAGGCCATCAATGACCTTTCCAGAGAATGTTCAGAGACCTCAACTTTGTTTAGAGATCTTGTGTGGG TGGAACTTCCTGTTTGCACACAGAGCAGCATAAAGCCCAGTTGCTTTGGGAAGTGTTTGGGACCAGATGGATTGTAG GGAGTAGGGTACAATACAGTCTGTTCTCCTCCAGCTCCTTCTTTCTGCAACATGGGGAAGAACAAACTCCTTCATCC AAGTCTGGTTCTTCTCCTCTTGGTCCTCCTGCCCACAGACGCCTCAGTCTCTGGAAAACCGTGAGTTCCACACAGAG AGCGTGAAGCATGAACCTAGAGTCCTTCATTTATTGCAGATTTTTCTTTATATCATTCCTTTTTCTTTCCTATGATACT GTCATCTTCTTATCTCTAAGATTCCTTCCAGATTTTACAAATCTAGTTTACTCATTACTTGCTTACTTTTAATCATTCT TCCCCAACTCTCTGAAGCTCTAATATGCAAAGCCTTCCTAAGGGGTGTCAGAAATTTTTAGCTTTTTAAAAGAATAAA
    [Show full text]
  • The Genomic Basis of Circadian and Circalunar Timing Adaptations in a Midge Tobias S
    OPEN ARTICLE doi:10.1038/nature20151 The genomic basis of circadian and circalunar timing adaptations in a midge Tobias S. Kaiser1,2,3†, Birgit Poehn1,3, David Szkiba2, Marco Preussner4, Fritz J. Sedlazeck2†, Alexander Zrim2, Tobias Neumann1,2, Lam-Tung Nguyen2,5, Andrea J. Betancourt6, Thomas Hummel3,7, Heiko Vogel8, Silke Dorner1, Florian Heyd4, Arndt von Haeseler2,3,5 & Kristin Tessmar-Raible1,3 Organisms use endogenous clocks to anticipate regular environmental cycles, such as days and tides. Natural variants resulting in differently timed behaviour or physiology, known as chronotypes in humans, have not been well characterized at the molecular level. We sequenced the genome of Clunio marinus, a marine midge whose reproduction is timed by circadian and circalunar clocks. Midges from different locations show strain-specific genetic timing adaptations. We examined genetic variation in five C. marinus strains from different locations and mapped quantitative trait loci for circalunar and circadian chronotypes. The region most strongly associated with circadian chronotypes generates strain-specific differences in the abundance of calcium/calmodulin-dependent kinase II.1 (CaMKII.1) splice variants. As equivalent variants were shown to alter CaMKII activity in Drosophila melanogaster, and C. marinus (Cma)-CaMKII.1 increases the transcriptional activity of the dimer of the circadian proteins Cma-CLOCK and Cma-CYCLE, we suggest that modulation of alternative splicing is a mechanism for natural adaptation in circadian timing. Around the new or full moon, during a few specific hours surround- Our study aimed to identify the genetic basis of C. marinus adaptation ing low tide, millions of non-biting midges of the species C.
    [Show full text]
  • ALEXA: a Microarray Design Platform for Alternative Expression Analysis
    CORRESPONDENCE expression of alternative mRNA isoforms in 5-fluorouracil (5-FU)- ALEXA: a microarray design platform for sensitive and resistant colorectal cancer cell lines5 and compared alternative expression analysis the results to those from the Affymetrix ‘GeneChip Human Exon 1.0 ST’ array (see Supplementary Results, Supplementary Fig. 2 To the editor: Eukaryotic genomes are predicted to contain about and Supplementary Table 2 online). Genes and exons differentially 7,000–29,000 genes1. Each of these genes may be alternatively expressed between 5-FU–sensitive and resistant cells were identi- processed to produce multiple distinct mRNAs by alternative fied by both platforms (with significant overlap), but ALEXA arrays transcript initiation, splicing and polyadenylation (collectively provided additional information on the connectivity and boundar- referred to as alternative expression). Although analysis of avail- ies of exons (Table 1). Furthermore, alternative expression events able transcript resources indicates that up to ~75% of genes are identified by ALEXA were significantly enriched for known alterna- alternatively processed, most microarray expression platforms tive expression events represented in publicly available mRNA and cannot detect alternative transcripts2. expressed sequence tag (EST) databases (Supplementary Results methods Proof-of-principle experiments have described the use of oli- and Supplementary Data 1 online). Finally, we demonstrated the gonucleotide microarrays to profile transcript isoforms gener- advantage of the ALEXA approach by identifying several differen- ated by alternative expression, but resources to create such arrays tially expressed known and predicted isoforms with potential rele- are lacking3,4. To address this limitation we created a microarray vance to 5-FU resistance (Supplementary Fig. 3 and Supplementary .com/nature e design platform for alternative expression analysis (ALEXA), Tables 3 and 4 online).
    [Show full text]