DOCSLIB.ORG

Ensembl Bacteria Coursebook

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Ensembl Bacteria Coursebook Browsing Bacterial Genomes www.ensemblgenomes.org bacteria.ensembl.org Coursebook http://www.ebi.ac.uk/~dstaines/Workshops/2014/Marseille Marseille – 23rd June 2014 1 TABLE OF CONTENTS Introduction to Ensembl Bacteria ........................................................... 3 What can I do with Ensembl Bacteria? ................................................. 3 Exploring the Ensembl Bacteria genome browser ............................ 5 Demo: Finding genomes .............................................................................. 5 Exercise: Finding genomes......................................................................... 7 Demo: The Region in detail view ............................................................. 7 Exercises: The Region in Detail view ...................................................10 Genes and transcripts .............................................................................. 11 Demo: The gene tab .....................................................................................11 Demo: The transcript tab ..........................................................................16 Demo: Searching by sequence ................................................................19 Exercises: Genes and transcripts ...........................................................21 Comparative genomics ............................................................................ 22 Demo: Gene trees and homologues ......................................................22 Demo: Gene familes .....................................................................................24 Exercises: Comparative genomics ........................................................26 Using your own data ................................................................................. 27 Demo: Viewing your data in the browser ..........................................27 Demo: The Variant Effect Predictor (VEP) ........................................29 Exercises: Using your own data .............................................................31 Downloading data ...................................................................................... 32 Exporting individual data .........................................................................32 Downloading whole genomes .................................................................33 Programming with Ensembl Bacteria ................................................. 34 Getting started with the REST API ........................................................34 Getting started with the Perl API ...........................................................34 2 Introduction to Ensembl Bacteria Ensembl Genomes (www.ensemblgenomes.org) is an integrating resource for genome-scale data from non-vertebrate species, provided by the EBI (European Bioinformatics Institute). The project exploits and extends technologies for genome annotation, analysis and dissemination, developed in the context of the vertebrate-focused Ensembl project (www.ensembl.org), and provides a complementary set of resources for non-vertebrate species through a consistent set of programmatic and interactive interfaces. These provide access to data including reference sequence, gene models, transcriptional data, polymorphisms and comparative analysis. The Ensembl Genomes project includes the Ensembl Bacteria portal, which provides access to over 10,000 genomes from more than 2,000 species of bacteria and archaea. What can I do with Ensembl Bacteria? Explore more than 10,000 genomes from over 2,000 bacterial and archaeal species. View genes with other annotation along the chromosome. View detailed annotation for genes Download gene sequences and annotation for individual genes or genomic regions Explore homologues and phylogenetic trees across the taxonomic range for selected genomes. Find genes in the same family for any gene Upload your own data for viewing in a genome. Find sequences matching your own from any genome. Determine how your variants affect genes and transcripts using the Variant Effect Predictor. Find genes involved in metabolic pathways Share Ensembl views with your colleagues and collaborators. Download data in different formats for any genome Use Ensembl Bacteria data in your own programs and scripts using the REST and Perl APIs 3 Need more help? Read our documentation View the FAQs Read some publications Stay in touch! E-mail the team with comments or questions at [email protected] Sign up to a mailing list Further reading Kersey, PJ et al. Ensembl Genomes 2013: scaling up access to genome-wide data Nucleic acids research 2014, 42 (D1): D546-D552 PMID: 24163254 doi:10.1093/nar/gkt979 Spudich, GM and Fernández-Suárez, XM Touring Ensembl: A practical guide to genome browsing BMC Genomics 2010, 11:295 (11 May 2010) 4 Exploring the Ensembl Bacteria genome browser Aims By the end of this section, you should know how to… …find a genome you’re interested in …find information about a genome …browse the genome Demo: Finding genomes The front page of Ensembl Bacteria is found at bacteria.ensembl.org. It contains lots of information and links to help you navigate: Link back to homepage Tools Help Search Top bar present on every page Search for a gene Information on Ensembl Bacteria Complete genome list News Whilst there is a full genome list for bacteria, the large number of genomes makes it hard to navigate. To find a particular genome, the 5 easiest way is to start to type the species name into the genome search box. A drop down list will appear with possible genomes. You can then select your choice. Alternatively, if you hit enter at this point, you’ll be taken to a search page where you can examine the possible matches. For example, to find a substrain of Clostridium difficile type in Clostridium d. The drop down contains various strains of Clostridium difficile. Let’s choose Clostridium difficile 630. This will take us to the genome homepage, where we can explore various features. Search this Annotation genome examples Comparative examples Launch the VEP tool 6 Exercise: Finding genomes Go to Ensembl Bacteria and find the species Belliella baltica. How many coding and non-coding genes does it have? Demo: The Region in detail view The Region in Detail view shows the genes and other features present in an area of the genome, and allows you to navigate around the genome. We’ll search for C. difficile as we did before. On the species homepage there’s a link to a sample region Chromosome:1889811-1890515. Click on it to jump to the Region in Detail page. Circular chromosome – plasmids may also be shown 100kb shown in this view 7 Let’s look at the chromosome in more detail: Origin of sequencing (sometimes this is also the origin of replication but not Gene density always) GC skew GC content Our region of interest You can jump to a different region of interest by dragging out the handles of the region slice. This gives you a red highlighted slice that you can click on to jump to a new region. Next, the upper panel in this display shows an overview of genes, colour-coded by type in the region: Contig Controls for Controls for configuration, configuration, sharing and sharing and export Gene export Region to show in detail 8 Finally the lower panel shows a detailed view of the region selected in the red box, including features such as transcripts: Controls for configuration, Contig sharing and export Transcript %GC You can find out more about features in either panel by clicking on them. There are also options to configure the images in bacteria by clicking the “Configure this page” button. This opens a new panel where you can choose new tracks to show in the display including repeats, genomic features and translated sequences: Controls for configuration, sharing and Active track export Inactive track 9 Exercises: The Region in Detail view Exercise – Exploring a genomic region in E. coli (a) Find the genome of E. coli str. K-12 substrain MG1655. Go to the region from 2,781,249 to 2,860,361 bp on the chromosome. What is the name of the sequence read on which this genome is based? (b) Zoom in on the proV gene. (c) Turn on the All Repeats track in this view. Are there any repeats near the proV gene? (d) Create a Share link for this display. Email it to yourself and open the link. (e) Export the genomic sequence of the region you are looking at in FASTA format. (f) Turn off all tracks you added to the Region in detail page. 10 Genes and transcripts Aims By the end of this section, you should know how to… …find out about a particular gene …search for a gene by keyword or name …search for a gene by sequence similarity Demo: The gene tab If you click on any one of the transcripts in the Region in detail image, a pop-up menu will appear, allowing you to jump directly to that gene or transcript. Links Another way to go to a gene of interest is to search directly for it. You can do this from the gene search box home page, from the search box in the top bar, or from the genome-specific search box on the home page for a particular genome. We’re going to use the gene search box on the home page. We’re going to look at the lacZ gene in E. coli. This gene encodes beta- galactosidase, an enzyme involved in the metabolism of lactose, and part of the well-studied lac operon. 11 From bacteria.ensembl.org, type lacZ into the gene search box and click the Go button: Gene search You will get a list of hits from all genomes: Result type Genome filter 12 To filter for a given
Load more

Recommended publications
  • Ensembl Genomes: Extending Ensembl Across the Taxonomic Space P
    Published online 1 November 2009 Nucleic Acids Research, 2010, Vol. 38, Database issue D563–D569 doi:10.1093/nar/gkp871 Ensembl Genomes: Extending Ensembl across the taxonomic space P. J. Kersey*, D. Lawson, E. Birney, P. S. Derwent, M. Haimel, J. Herrero, S. Keenan, A. Kerhornou, G. Koscielny, A. Ka¨ ha¨ ri, R. J. Kinsella, E. Kulesha, U. Maheswari, K. Megy, M. Nuhn, G. Proctor, D. Staines, F. Valentin, A. J. Vilella and A. Yates EMBL-European Bioinformatics Institute, Wellcome Trust Genome Campus, Cambridge CB10 1SD, UK Received August 14, 2009; Revised September 28, 2009; Accepted September 29, 2009 ABSTRACT nucleotide archives; numerous other genomes exist in states of partial assembly and annotation; thousands of Ensembl Genomes (http://www.ensemblgenomes viral genomes sequences have also been generated. .org) is a new portal offering integrated access to Moreover, the increasing use of high-throughput genome-scale data from non-vertebrate species sequencing technologies is rapidly reducing the cost of of scientific interest, developed using the Ensembl genome sequencing, leading to an accelerating rate of genome annotation and visualisation platform. data production. This not only makes it likely that in Ensembl Genomes consists of five sub-portals (for the near future, the genomes of all species of scientific bacteria, protists, fungi, plants and invertebrate interest will be sequenced; but also the genomes of many metazoa) designed to complement the availability individuals, with the possibility of providing accurate and of vertebrate genomes in Ensembl. Many of the sophisticated annotation through the similarly low-cost databases supporting the portal have been built in application of functional assays.
    [Show full text]
  • Abstracts Genome 10K & Genome Science 29 Aug - 1 Sept 2017 Norwich Research Park, Norwich, Uk
    Genome 10K c ABSTRACTS GENOME 10K & GENOME SCIENCE 29 AUG - 1 SEPT 2017 NORWICH RESEARCH PARK, NORWICH, UK Genome 10K c 48 KEYNOTE SPEAKERS ............................................................................................................................... 1 Dr Adam Phillippy: Towards the gapless assembly of complete vertebrate genomes .................... 1 Prof Kathy Belov: Saving the Tasmanian devil from extinction ......................................................... 1 Prof Peter Holland: Homeobox genes and animal evolution: from duplication to divergence ........ 2 Dr Hilary Burton: Genomics in healthcare: the challenges of complexity .......................................... 2 INVITED SPEAKERS ................................................................................................................................. 3 Vertebrate Genomics ........................................................................................................................... 3 Alex Cagan: Comparative genomics of animal domestication .......................................................... 3 Plant Genomics .................................................................................................................................... 4 Ksenia Krasileva: Evolution of plant Immune receptors ..................................................................... 4 Andrea Harper: Using Associative Transcriptomics to predict tolerance to ash dieback disease in European ash trees ............................................................................................................
    [Show full text]
  • The ELIXIR Core Data Resources: ​Fundamental Infrastructure for The
    Supplementary Data: The ELIXIR Core Data Resources: fundamental infrastructure ​ for the life sciences The “Supporting Material” referred to within this Supplementary Data can be found in the Supporting.Material.CDR.infrastructure file, DOI: 10.5281/zenodo.2625247 (https://zenodo.org/record/2625247). ​ ​ Figure 1. Scale of the Core Data Resources Table S1. Data from which Figure 1 is derived: Year 2013 2014 2015 2016 2017 Data entries 765881651 997794559 1726529931 1853429002 2715599247 Monthly user/IP addresses 1700660 2109586 2413724 2502617 2867265 FTEs 270 292.65 295.65 289.7 311.2 Figure 1 includes data from the following Core Data Resources: ArrayExpress, BRENDA, CATH, ChEBI, ChEMBL, EGA, ENA, Ensembl, Ensembl Genomes, EuropePMC, HPA, IntAct /MINT , InterPro, PDBe, PRIDE, SILVA, STRING, UniProt ● Note that Ensembl’s compute infrastructure physically relocated in 2016, so “Users/IP address” data are not available for that year. In this case, the 2015 numbers were rolled forward to 2016. ● Note that STRING makes only minor releases in 2014 and 2016, in that the interactions are re-computed, but the number of “Data entries” remains unchanged. The major releases that change the number of “Data entries” happened in 2013 and 2015. So, for “Data entries” , the number for 2013 was rolled forward to 2014, and the number for 2015 was rolled forward to 2016. The ELIXIR Core Data Resources: fundamental infrastructure for the life sciences ​ 1 Figure 2: Usage of Core Data Resources in research The following steps were taken: 1. API calls were run on open access full text articles in Europe PMC to identify articles that ​ ​ mention Core Data Resource by name or include specific data record accession numbers.
    [Show full text]
  • Annual Scientific Report 2013 on the Cover Structure 3Fof in the Protein Data Bank, Determined by Laponogov, I
    EMBL-European Bioinformatics Institute Annual Scientific Report 2013 On the cover Structure 3fof in the Protein Data Bank, determined by Laponogov, I. et al. (2009) Structural insight into the quinolone-DNA cleavage complex of type IIA topoisomerases. Nature Structural & Molecular Biology 16, 667-669. © 2014 European Molecular Biology Laboratory This publication was produced by the External Relations team at the European Bioinformatics Institute (EMBL-EBI) A digital version of the brochure can be found at www.ebi.ac.uk/about/brochures For more information about EMBL-EBI please contact: [email protected] Contents Introduction & overview 3 Services 8 Genes, genomes and variation 8 Molecular atlas 12 Proteins and protein families 14 Molecular and cellular structures 18 Chemical biology 20 Molecular systems 22 Cross-domain tools and resources 24 Research 26 Support 32 ELIXIR 36 Facts and figures 38 Funding & resource allocation 38 Growth of core resources 40 Collaborations 42 Our staff in 2013 44 Scientific advisory committees 46 Major database collaborations 50 Publications 52 Organisation of EMBL-EBI leadership 61 2013 EMBL-EBI Annual Scientific Report 1 Foreword Welcome to EMBL-EBI’s 2013 Annual Scientific Report. Here we look back on our major achievements during the year, reflecting on the delivery of our world-class services, research, training, industry collaboration and European coordination of life-science data. The past year has been one full of exciting changes, both scientifically and organisationally. We unveiled a new website that helps users explore our resources more seamlessly, saw the publication of ground-breaking work in data storage and synthetic biology, joined the global alliance for global health, built important new relationships with our partners in industry and celebrated the launch of ELIXIR.
    [Show full text]
  • Strategic Plan 2011-2016
    Strategic Plan 2011-2016 Wellcome Trust Sanger Institute Strategic Plan 2011-2016 Mission The Wellcome Trust Sanger Institute uses genome sequences to advance understanding of the biology of humans and pathogens in order to improve human health. -i- Wellcome Trust Sanger Institute Strategic Plan 2011-2016 - ii - Wellcome Trust Sanger Institute Strategic Plan 2011-2016 CONTENTS Foreword ....................................................................................................................................1 Overview .....................................................................................................................................2 1. History and philosophy ............................................................................................................ 5 2. Organisation of the science ..................................................................................................... 5 3. Developments in the scientific portfolio ................................................................................... 7 4. Summary of the Scientific Programmes 2011 – 2016 .............................................................. 8 4.1 Cancer Genetics and Genomics ................................................................................ 8 4.2 Human Genetics ...................................................................................................... 10 4.3 Pathogen Variation .................................................................................................. 13 4.4 Malaria
    [Show full text]
  • Browsing Genomes with Ensembl Annotation
    Browsing genomes with EnsEMBL Annotation • During recent years release of large amounts of sequence data • Raw sequence data are not so useful on its own. They are most valuable when provided with comprehensive good quality annotation CCCAACAAGAATGTAAAATCTTTAAGTGCCTGTTTTCATACTTATTTGACCACCCTATCTCTAGAATCTTGCATGATG TCTAGCCCTAGTAGGATCAAAAAATACTTACAAAGCAACTGAATAGCTACATGAATAGATGGATGAATAAATGCATG GGTGGATGGATGGATTAATGAAATCATTTATATGACTTAAAGTTTGCAGAGGAGTATCATATTTGGAAGGCAGTAAG GAAGTCTGTGTAGTCGATGGTAAAGGCAATTGGGAAGTTTGTTAGGCACAATAGGTCAAAATTTGTTTTTGAAGTCC TGTTACTTCACGTTTCTTTGTTTCACTTTCTTAAAACAGGAAACTCTTTTCTATGATCATTCTTCCAGGGCCTGGCTCT TCATCTGCAACCCAGTAATATCCCTAATGTCAAAAAGCTACTGGTTTAATTCGTGCCATTTTCAAAGAGGACTACTGA ATTCTGATGTGGCTTCAAACATTTAGGTTAGGCATATCTAATGGAGAACTTGCAGCCACACTGACTTGTAGTGAAAT ATCTATTTTGAGCCTGCCCAGTGTTGCTTAAATTGTAGTTTTCCTTGCCAGCTATTCATACAAGAGATGTGAGAAGCA CCATAAAAGGCGTTGTGAGGAGTTGTGGGGGAGTGAGGGAGAGAAGAGGTTGAAAAGCTTATTAGCTGCTGTACGG TAAAAGTGAGCTCTTACGGGAATGGGAATGTAGTTTTAGCCCTCCAGGGATTCTATTTAGCCCGCCAGGAATTAACC TTGACTATAAATAGGCCATCAATGACCTTTCCAGAGAATGTTCAGAGACCTCAACTTTGTTTAGAGATCTTGTGTGGG TGGAACTTCCTGTTTGCACACAGAGCAGCATAAAGCCCAGTTGCTTTGGGAAGTGTTTGGGACCAGATGGATTGTAG GGAGTAGGGTACAATACAGTCTGTTCTCCTCCAGCTCCTTCTTTCTGCAACATGGGGAAGAACAAACTCCTTCATCC AAGTCTGGTTCTTCTCCTCTTGGTCCTCCTGCCCACAGACGCCTCAGTCTCTGGAAAACCGTGAGTTCCACACAGAG AGCGTGAAGCATGAACCTAGAGTCCTTCATTTATTGCAGATTTTTCTTTATATCATTCCTTTTTCTTTCCTATGATACT GTCATCTTCTTATCTCTAAGATTCCTTCCAGATTTTACAAATCTAGTTTACTCATTACTTGCTTACTTTTAATCATTCT TCCCCAACTCTCTGAAGCTCTAATATGCAAAGCCTTCCTAAGGGGTGTCAGAAATTTTTAGCTTTTTAAAAGAATAAA
    [Show full text]
  • The Genomic Basis of Circadian and Circalunar Timing Adaptations in a Midge Tobias S
    OPEN ARTICLE doi:10.1038/nature20151 The genomic basis of circadian and circalunar timing adaptations in a midge Tobias S. Kaiser1,2,3†, Birgit Poehn1,3, David Szkiba2, Marco Preussner4, Fritz J. Sedlazeck2†, Alexander Zrim2, Tobias Neumann1,2, Lam-Tung Nguyen2,5, Andrea J. Betancourt6, Thomas Hummel3,7, Heiko Vogel8, Silke Dorner1, Florian Heyd4, Arndt von Haeseler2,3,5 & Kristin Tessmar-Raible1,3 Organisms use endogenous clocks to anticipate regular environmental cycles, such as days and tides. Natural variants resulting in differently timed behaviour or physiology, known as chronotypes in humans, have not been well characterized at the molecular level. We sequenced the genome of Clunio marinus, a marine midge whose reproduction is timed by circadian and circalunar clocks. Midges from different locations show strain-specific genetic timing adaptations. We examined genetic variation in five C. marinus strains from different locations and mapped quantitative trait loci for circalunar and circadian chronotypes. The region most strongly associated with circadian chronotypes generates strain-specific differences in the abundance of calcium/calmodulin-dependent kinase II.1 (CaMKII.1) splice variants. As equivalent variants were shown to alter CaMKII activity in Drosophila melanogaster, and C. marinus (Cma)-CaMKII.1 increases the transcriptional activity of the dimer of the circadian proteins Cma-CLOCK and Cma-CYCLE, we suggest that modulation of alternative splicing is a mechanism for natural adaptation in circadian timing. Around the new or full moon, during a few specific hours surround- Our study aimed to identify the genetic basis of C. marinus adaptation ing low tide, millions of non-biting midges of the species C.
    [Show full text]
  • ALEXA: a Microarray Design Platform for Alternative Expression Analysis
    CORRESPONDENCE expression of alternative mRNA isoforms in 5-fluorouracil (5-FU)- ALEXA: a microarray design platform for sensitive and resistant colorectal cancer cell lines5 and compared alternative expression analysis the results to those from the Affymetrix ‘GeneChip Human Exon 1.0 ST’ array (see Supplementary Results, Supplementary Fig. 2 To the editor: Eukaryotic genomes are predicted to contain about and Supplementary Table 2 online). Genes and exons differentially 7,000–29,000 genes1. Each of these genes may be alternatively expressed between 5-FU–sensitive and resistant cells were identi- processed to produce multiple distinct mRNAs by alternative fied by both platforms (with significant overlap), but ALEXA arrays transcript initiation, splicing and polyadenylation (collectively provided additional information on the connectivity and boundar- referred to as alternative expression). Although analysis of avail- ies of exons (Table 1). Furthermore, alternative expression events able transcript resources indicates that up to ~75% of genes are identified by ALEXA were significantly enriched for known alterna- alternatively processed, most microarray expression platforms tive expression events represented in publicly available mRNA and cannot detect alternative transcripts2. expressed sequence tag (EST) databases (Supplementary Results methods Proof-of-principle experiments have described the use of oli- and Supplementary Data 1 online). Finally, we demonstrated the gonucleotide microarrays to profile transcript isoforms gener- advantage of the ALEXA approach by identifying several differen- ated by alternative expression, but resources to create such arrays tially expressed known and predicted isoforms with potential rele- are lacking3,4. To address this limitation we created a microarray vance to 5-FU resistance (Supplementary Fig. 3 and Supplementary .com/nature e design platform for alternative expression analysis (ALEXA), Tables 3 and 4 online).
    [Show full text]
  • Gene3d: Multi-Domain Annotations for Protein Sequence and Comparative Genome Analysis Jonathan G
    D240–D245 Nucleic Acids Research, 2014, Vol. 42, Database issue Published online 21 November 2013 doi:10.1093/nar/gkt1205 Gene3D: Multi-domain annotations for protein sequence and comparative genome analysis Jonathan G. Lees1,*, David Lee1, Romain A. Studer1, Natalie L. Dawson1, Ian Sillitoe1, Sayoni Das1, Corin Yeats2, Benoit H. Dessailly1, Robert Rentzsch3 and Christine A. Orengo1 1Division of Biosciences, Institute of Structural and Molecular Biology, University College London, Gower Street, London WC1E 6BT, UK, 2Department of Infectious Disease Epidemiology, Imperial College London, St Mary’s Campus, Norfolk Place, London W2 1PG, UK and 3Robert Koch Institut, Research Group Bioinformatics Ng4, Nordufer 20, 13353 Berlin, Germany Received October 1, 2013; Revised November 2, 2013; Accepted November 4, 2013 Downloaded from ABSTRACT contain long disordered sections that are also of functional importance. The CATH database which focuses on the Gene3D (http://gene3d.biochem.ucl.ac.uk) is a data- folded domain, classifies structures in the PDB into their base of protein domain structure annotations for constituent domains, and each domain is subsequently http://nar.oxfordjournals.org/ protein sequences. Domains are predicted using a assigned to a single superfamily by homology (1,2). The library of profile HMMs from 2738 CATH super- classified domain structure sequences are used in a families. Gene3D assigns domain annotations to pipeline to build domain superfamily specific HMMs that Ensembl and UniProt sequence sets including are then used to identify domains in structurally >6000 cellular genomes and >20 million unique uncharacterized protein sequences. As some CATH protein sequences. This represents an increase of superfamilies can be large and functionally diverse, we 45% in the number of protein sequences since our recently introduced protocols for subdividing each super- last publication.
    [Show full text]
  • What's New in Rnacentral and Rfam
    What’s new in RNAcentral and Rfam Anton Petrov [email protected] Benasque - July 20, 2018 What is https://www.vecteezy.com/vector-art/92726-question-mark-background-vector The non-coding RNA sequence database rnacentral.org • >10 million sequences • 27 databases • 800,000 species RNAcentral has lots of useful data • Sequence • Description • RNA type • Links to other databases • Genome locations • Publications • RNA modifications from MODOMICS and PDB http://rnacentral.org/rna/URS00005A4DCF/9606 Until recently just data aggregation, now additional analysis Two important new features 1. Quality control using Rfam 2. Comprehensive genome models mapping 1. Rfam models are used to annotate RNAcentral • ~90% of RNAcentral sequences match Rfam models • about 2% of RNAcentral sequences can be used to build new Rfam models Rfam annotations help detect: • truncated sequences • potential contamination • missing annotations 2. Comprehensive genome mapping for >250 species before after • genome mapping Ensembl genomes and blat • >95% of sequences mapped for human, mouse, and other key species • one of the largest collections RNA types of ncRNA genome annotations % of mapped human sequences Example of Rfam quality control and genome mapping Here is an Ensembl miRNA http://www.ensembl.org/Mus_musculus/Transcript/Summary?g=ENSMUSG00000106355;r=4:10874064-10874170;t =ENSMUST00000197675 But is it a miRNA or a tRNA? http://www.ensembl.org/Mus_musculus/Transcript/Summary?g=ENSMUSG00000106355;r=4:10874064-10874170;t =ENSMUST00000197675 RNAcentral shows a
    [Show full text]
  • Browsing Genes and Genomes with Ensembl
    Browsing Genes and Genomes with Ensembl Ensembl Workshop University of Cambridge 3rd September 2013 www.ensembl.org Denise Carvalho-Silva Ensembl Outreach Notes: This workshop is based on Ensembl release 72 (June 2013). 1) Presentation slides The pdf file of the talks presented in this workshop is available in the link below: http://www.ebi.ac.uk/~denise/naturimmun 2) Course booklet A diGital Copy of this course booklet can be found below: http://www.ebi.ac.uk/~denise/coursebooklet.pdf 3) Answers The answers to the exercises in this course booklet can be found below: http://www.ebi.ac.uk/~denise/answers 2 TABLE OF CONTENTS OVERVIEW ...................................................................................................... 4 INTRODUCTION TO ENSEMBL .................................................................. 5 BROWSER WALKTHROUGH .................................................................... 14 EXERCISES .................................................................................................... 38 BROWSER ..................................................................................................... 38 BIOMART ...................................................................................................... 41 VARIATION ................................................................................................... 48 COMPARATIVE GENOMICS ...................................................................... 50 REGULATION ..............................................................................................
    [Show full text]
  • Rfam 14: Expanded Coverage of Metagenomic, Viral and Microrna Families Ioanna Kalvari, Eric P
    Rfam 14: expanded coverage of metagenomic, viral and microRNA families Ioanna Kalvari, Eric P. Nawrocki, Nancy Ontiveros-Palacios, Joanna Argasinska, Kevin Lamkiewicz, Manja Marz, Sam Griffiths-Jones, Claire Toffano-Nioche, Daniel Gautheret, Zasha Weinberg, et al. To cite this version: Ioanna Kalvari, Eric P. Nawrocki, Nancy Ontiveros-Palacios, Joanna Argasinska, Kevin Lamkiewicz, et al.. Rfam 14: expanded coverage of metagenomic, viral and microRNA families. Nucleic Acids Research, 2020, 10.1093/nar/gkaa1047. hal-03031715 HAL Id: hal-03031715 https://hal.archives-ouvertes.fr/hal-03031715 Submitted on 14 Dec 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. This article has been accepted for publication in Nucleic Acid Research Published by Oxford University Press : • DOI : 10.1093/nar/gkaa1047 • PUBMED : 33211869 Nucleic Acids Research, 2020 1 doi: 10.1093/nar/gkaa1047 Rfam 14: expanded coverage of metagenomic, viral and microRNA families Ioanna Kalvari 1,EricP.Nawrocki 2, Nancy Ontiveros-Palacios 1, Joanna Argasinska 1, Kevin Lamkiewicz 3,4, Manja Marz 3,4, Sam Griffiths-Jones 5, Claire Toffano-Nioche 6, Daniel Gautheret 6, Zasha Weinberg 7, Elena Rivas 8, Sean R. Eddy 8,9,10, Downloaded from https://academic.oup.com/nar/advance-article/doi/10.1093/nar/gkaa1047/5992291 by guest on 14 December 2020 Robert D.
    [Show full text]