Death-Associated Protein Kinase 1 Is an IRF3/7-Interacting Protein That Is Involved in the Cellular Antiviral Immune Response

RESEARCH ARTICLE

Death-associated protein kinase 1 is an IRF3/7-interacting protein that is involved in the cellular antiviral immune response

Jing Zhang, Ming-Ming Hu, Hong-Bing Shu and Shu Li

Interferon regulatory factor (IRF) 7 has been demonstrated to be a master regulator of virus-induced type I interferon production (IFN), and it plays a central role in the innate immune response against viruses. Here, we identified death-associated protein kinase 1 (DAPK1) as an IRF7-interacting protein by tandem affinity purification (TAP). Viral infection induced DAPK1–IRF7 and DAPK1–IRF3 interactions and overexpression of DAPK1 enhanced virus-induced activation of the interferon-stimulated response element (ISRE) and IFN-b promoters and the expression of the IFNB1 gene. Knockdown of DAPK1 attenuated the induction of IFNB1 and RIG-I expression triggered by viral infection or IFN-b, and they were enhanced by viral replication. In addition, viral infection or IFN-b treatment induced the expression of DAPK1. IFN-b treatment also activated DAPK1 by decreasing its phosphorylation level at serine 308. Interestingly, the involvement of DAPK1 in virus-induced signaling was independent of its kinase activity. Therefore, our study identified DAPK1 as an important regulator of the cellular antiviral response. Cellular & Molecular Immunology (2014) 11, 245–252; doi:10.1038/cmi.2013.65; published online 17 February 2014

Keywords: DAPK1; innate antiviral response; IRF3/7; type I interferon

INTRODUCTION that lead to the expression of type I IFNs. For example, Toll-like Upon viral infection, host cells activate a series of signaling receptor 3 binds to double-stranded RNA, and this binding cascades that lead to the production of type I interferons triggers TRIF-dependent signaling.4–6 Additionally, RIG-I (IFNs). Type I IFNs are secreted by cells, and they bind to type recognizes viral RNA and recruits VISA (also known as I IFN receptors in a paracrine or autocrine manner, leading to MAVS, IPS-1 and Cardif) to activate downstream signaling.2 the dimerization of IFN receptors. The dimerized IFN recep- TRIF and VISA are two critical adaptor proteins that act as tors recruit and activate the kinase JAK1, which phosphorylates platforms for the recruitment of downstream signaling com- STAT1 and STAT2, and they form a transcriptional complex plexes.5,7,8 TRAF6 and RIP1 promote the assembly and activa- together with interferon regulatory factor (IRF) 9. The STAT– tion of the IKK complex, which leads to the phosphorylation IRF9 complex (also known as ISGF3) binds to conserved DNA and degradation of the inhibitor of NF-kB a and subsequent sequences in the promoters of a wide range of IFN-stimulated activation of NF-kB. Additionally, TRAF3, TBK1 and/or IKKe genes (ISGs), and it activates the expression of these genes, are recruited to form an IRF signaling complex that phosphor- eliciting an innate antiviral response. Thus, type I IFNs play a ylates IRF3 or IRF7.9,10 Other components have been identified central role in innate antiviral immunity.1–3 as necessary for the assembly of these signaling complexes, The detection of invading viruses depends on the host germ- including TRADD, FADD, MITA and GSK3b.11–15 line-encoded pattern recognition receptors, which recognize IRF3 and IRF7 are two transcription factors that bind to the pathogen-associated molecular patterns from viruses, such as interferon-stimulated response element (ISRE) that is located on double-stranded RNA. Of all the characterized pattern recog- the promoters of type I IFN genes.16 IRF3 is constitutively nition receptors, Toll-like receptors and RIG-I-like receptors are expressed and is responsible for the initial wave of virus-induced well known for their ability to detect viral pathogen-associated transcription of the IFNB1 gene, whereas IRF7 is induced by molecular patterns and activate signal transduction pathways viralinfectionandisrequiredforsustainedtranscriptional

College of Life Sciences, Wuhan University, Wuhan, China Correspondence: Dr S Li, College of Life Sciences, Wuhan University, Wuhan 430072, China. E-mail: [email protected] Received: 17 July 2013; Revised: 29 November 2013; Accepted: 9 December 2013 DAPK1 is involved in the innate antiviral response J Zhang et al 246

activation of IFNB1 and IFNA genes at later infection time Protein purification and mass spectrometry analysis points.17 Therefore, IRF7 is a master regulator of type I IFN pro- We first made a pCTAP-IRF7 construct, in which the IRF7 cDNA duction, and its activity is tightly controlled to prevent excessive was fused in frame to the C-terminal calmodulin-binding peptide type I IFN responses.18 It has been reported that IRF7 is regulated and streptavidin-binding peptide tags in the pCTAP-A plasmid at three different levels, including the transcriptional, post-tran- (Stratagene, Santa Clara, CA, USA). In total, 293 cells (13109) scriptional and post-translational levels. Transcription of the IRF7 were stably transfected with pCTAP-IRF7 then stimulated with gene is induced by viral infection or type I IFN stimulation,19 SeV for 3 h. The cells were then collected, and the cell lysate was while the stability of IRF7 mRNA is regulated by FoxO3.20 The subjected to tandem affinity purification procedures with the inter- post-translational regulation of the IRF7 protein includes phos- play Mammalian TAP System (Stratagene, Cat. no. 240107). The phorylation, sumoylation and ubiquitination. It has been reported purified IRF7-interacting proteins were digested by trypsin in solu- that TBK1, IKKe and IKKa phosphorylate IRF7, which results in tion. The tryptic peptides were analyzed by HPLC-ES/MS with a its activation.10,21 TRAF6 catalyzes K63-linked ubiquitination of Thermo Finnigan LTQ adapted for nanospray ionization. The IRF7, which is required for full activation of IRF7,22 whereas tandem spectra were searched against the Homo Sapiens another E3 ubiquitin ligase, RAUL, targets IRF7 for K48-linked National Center for Biotechnology Information reference database ubiquitination and degradation.23 Although these mechanisms using SEQUEST. The results was filtered by Xcorr 11 .1.9, 12 have been characterized, the regulation of IRF7 at different levels .2.2, 13 .3.5, sp.500, Deltcn.0.1, Rspf5. is still not fully understood, and whether other mechanisms are Transfection and reporter assays involved in the regulation of IRF7 is of great interest. 5 To search for potential IRF7-interacting proteins, we per- The 293 cells (1310 ) were seeded in 24-well plates and were formed tandem-affinity purification (TAP) with IRF7 as the bait. transfected the following day by the standard calcium phos- This effort led to the identification of death-associated protein phate precipitation method. An empty control plasmid was kinase 1 (DAPK1) as an IRF7-interacting protein. Viral infection added to ensure that each transfection received the same resulted in an endogenous interaction between DAPK1 and IRF3/ amount of total DNA. To normalize for transfection efficiency, 7. Overexpression of DAPK1 resulted in virus-induced activation 0.01 mg of pRL-TK (Renilla luciferase) reporter plasmid was of the IFN-b promoter and expression of the IFNB1 gene. In added to each transfection. Approximately 18 h after the trans- contrast, knockdown of DAPK1 abrogated virus-induced expres- fections, luciferase assays were performed using a dual-specifi- sion of downstream genes. In addition, DAPK1 was induced by city luciferase assay kit (Promega, Madison, WI, USA). viral infection and was required for the cellular antiviral response. Co-immunoprecipitation, immunoblot analysis and VSV Therefore, our findings demonstrate that DAPK1 is an IRF3/7- plaque assays associated protein that is required for virus-triggered type I IFN These experiments were performed as previously described.7,24,26,27 induction and the innate antiviral response. Virus manipulation MATERIALS AND METHODS Two hundred and ninety-three cells grown in media containing Reagents and antibodies 1% fetal bovine serum were incubated with VSV at a multiplicity Recombinant TNF-a (R&D Systems, Minneapolis, MN, USA), of infection (MOI) of 0.1 for 1 h before the medium was replaced recombinant IFN-b (Peprotech, Rocky Hill, NJ, USA) and mouse with complete media containing 10% Fetal Bovine Serum (FBS, monoclonal antibodies against FLAG (Sigma, St. Louis, MO, fetal bovine serum). Twenty-four hours later, the supernatant USA), HA (Roche, Basel, Switzerland), b-actin (Sigma), IRF3 was harvested and diluted to infect confluent BHK21 cells that (Santa Cruz Biotechnology, Santa Cruz, CA, USA), phospho- were cultured in 24-well dishes. One hour post-infection, the cell IRF3(S396) (CST, Boston, MA, USA), DAPK1 (Sigma, Cat. no. culture medium was removed and 2% methylcellulose was over- SAB4500620) and phospho(S308)-DAPK1 (Sigma) were pur- laid on the cells. On day 3 post-infection, the overlay was chased from the indicated manufacturers. The viruses Sendai removed and the cells were fixed with 0.5% glutaraldehyde for virus (SeV), vesicular stomatitis virus (VSV) and GFP- 30 min and stained with 1% crystal violet in 70% methanol for Newcastle disease virus (NDV), and the antibodies for RIG-I 15 min. The plaques were counted, averaged and multiplied by a 14,24,25 and ISG56, have been previously described. Amouse dilution factor to determine the viral titer as a log10 (pfu/ml). anti-IRF7 antibody was raised against recombinant human full- The viral infection was performed when the cells were 70% length IRF7. confluent. The culture medium was replaced by serum-free DMEM, and NDV-GFP was added into the medium at various Plasmid constructs MOIs, which were determined by the specific experiments. NF-kB, ISRE and IFN-b promoter luciferase reporter plasmids, After 1 h, the medium was removed and replaced with mammalian expression plasmids for HA- or FLAG-tagged DMEM containing 2% methylcellulose. NDV-GFP replication IRF7, RIG-I, MDA5, VISA, TRAF3, TRAF6, TBK1, IKKe and in 293 cells was visualized by fluorescence microscopy. IRF3 have been previously described.7,24,26,27 Mammalian expression plasmids for human HA- or FLAG-DAPK1 and RNAi experiments its mutants, and HA- or FLAG-STAT1 were constructed by Double-stranded oligonucleotides corresponding to target standard molecular biology techniques. sequences were cloned into the pSuper.Retro RNAi plasmid

Cellular & Molecular Immunology DAPK1 is involved in the innate antiviral response J Zhang et al 247

(Oligoengine Inc., Seattle, WA, USA). The following sequences PCR analysis to measure mRNA expression. The following were used for the human DAPK1 cDNA:28 DAPK1-RNAi #1: gene-specific primer sequences were used: CAAGAAACGTTAGCAAATG; RNAi #2: GGTCAAGGA- IFNB1: TTGTTGAGAACCTCCTGGCT (forward), TCCAAAGAAG. TGACTATGGTCCAGGCACAG (reverse); Real-time PCR RIG-I: ACGCAGCCTGCAAGCCTTCC (forward); Total RNA was isolated from cells using Trizol reagent TGTGGCAGCCTCCATTGGGC (reverse); (TAKARA, Japan, Dalian, China) and subjected to real-time ISG56: tcatcaggtcaaggatagtc (forward);

a b Flag: IRF3 DAPK1 HA: DAPK1 IRF7 IRF9 mock SeV mock SeV IP: lgG aF lgG aF lgG aF IP: lgG aDAPK1 lgG aDAPK1 lgG aIRF3 lgG aIRF3 IRF7 DAPK1

IB: aHA DAPK1 DAPK1 Lysate Lysate lgG-H IRF7 IRF3

DAPK1 Lysate IRF7 IRF3 IRF9

c ISRE d DAPK1-RNAi 50 ** mock Con #1 #2 40 SeV Overexp. F-DAPK1 30 F-IRF7 20 DAPK1-RNAi Con #1 #2

Rel. Luc. Act. Rel. Luc. 10 Endo. DAPK1 0 b-actin Vec F-DAPK1

e f ISRE 40 mock SeV 30 Con DAPK1-RNAi SeV: 012 24 48 012 24 48 (hr) 20 p-IRF3 10 ** ** IRF3 Rel. Luc. Act. Rel. Luc. b-action 0 Con #1 #2 DAPK1-RNAi

Figure 1 DAPK1 interacts with IRF7 and IRF3. (a) DAPK1 interacts with IRF7 and IRF3 in a mammalian overexpression system. Two hundred and ninety-three cells (13107) were transfected with the indicated plasmids (8 mg each). Co-immunoprecipitation and immunoblot analysis were performed with the indicated antibodies. (b) Endogenous association between DAPK1 and IRF7/IRF3 was investigated. In total, 293 cells (83107) were left uninfected or infected with SeV for 8 h prior to co-immunoprecipitation. An immunoblot analysis was performed with the indicated antibodies. (c) Overexpression of DAPK1 enhances SeV-induced ISRE activation in 293 cells. These 293 cells (13105) were transfected with an ISRE reporter and a DAPK1 expression plasmid. Eighteen hours after transfection, the cells were infected with SeV or left untreated. Luciferase assays were performed 12 h after infection. The graphs show the mean6s.d., n53. *P,0.05; **P,0.01. (d) Effects of DAPK1-RNAi plasmids on the expression of transfected and endogenous DAPK1. In the upper panels, 293 cells (23105) were transfected with expression plasmids for FLAG- DAPK1, FLAG-IRF7 (0.5 mg each) and the indicated RNAi plasmids (1 mg each). Twenty-four hours after transfection, the cell lysates were analyzed by immunoblot with anti-FLAG. In the lower panels, 293 cells (13107) were transfected with a control or the indicated DAPK1-RNAi plasmids (8 mg each) for 36 h. The lysates were analyzed by immunoblot with the indicated antibodies. (e) Effects of DAPK1-RNAi on SeV-induced ISRE activation in 293 cells. In total, 293 cells (23105) were transfected with the indicated RNAi plasmids (1 mg each) and an ISRE reporter plasmid (0.1 mg). Twenty-four hours after transfection, the cells were left untreated or were infected with SeV for 12 h before the luciferase assays were performed. The graphs show the mean6s.d., n53. *P,0.05; **P,0.01. (f) The 293 cells (13106) were transfected with the indicated RNAi plasmids (2 mg each). Twelve hours after transfection, the cells were selected with puromycin (1 mg/ml) for 24 h, then infected with SeV or left uninfected for the indicated time points. The cell lysates were analyzed by immunoblot with the indicated antibodies. DAPK, death-associated protein kinase; IRF, interferon regulatory factor; ISRE, interferon-stimulated response element; SeV, Sendai virus.

Cellular & Molecular Immunology DAPK1 is involved in the innate antiviral response J Zhang et al 248

abIFN-b IFN-b plasmids (1 mg each). Twelve hours after transfection, the cells were selected with puromycin (1 mg/ml) for 36 h, then treated with or left 8 ** Vec 60 ** Con F-DAPK1 DAPK1-RNAi 6 45 untreated with the JAK inhibitor Ruxolitinib (0.05 M) for 4 h. Reporter assays were performed after the cells were infected with SeV for 12 h. 4 30 The graphs show the mean6s.d., n53. *P,0.05; **P,0.01. (e) 2 15

Rel. Luc. Act. Rel. Luc. Effects of DAPK1-RNAi on SeV-induced transcription of RIG-I, ISG56 0 Act. Rel. Luc. 0 mock SeV mock SeV and IFNB1 genes in 293 cells. In total, 293 cells (23105) were trans- c fected with the indicated RNAi plasmids (2 mg each). Twelve hours after ISRE transfection, the cells were selected with puromycin (1 mg/ml) for 24 h, 25 * 1200 * then infected with SeV or left uninfected for 12 h before real-time PCR 20 900 Con 15 DAPK1-RNAi was performed. The graphs show the mean6s.d., n53. *P,0.05; 600 10 **P,0.01. (f) Effects of DAPK1-RNAi on SeV-induced transcription 5 300 of RIG-I, ISG56 and IFNB1 genes in HeLa cells. Real-time PCR was Rel. Lucif. Act Rel. Lucif. 0 Vec F-IRF3 Vec F-IRF7 performed as in Figure 1e. The graphs show the mean6s.d., n53. d *P,0.05; **P,0.01. (g) Knockdown of DAPK1 inhibited SeV-induced ISRE ISRE 5 160 expression of RIG-I and ISG56 proteins. In total, 293 cells (2310 ) mock * 120 70 ** were transfected with a DAPK1-RNAi plasmid for 12 h, selected with IFN-b * mock 80 50 SeV puromycin (1 mg/ml) for 24 h and then infected with SeV or left unin- 40 30 fected for the indicated time points. The cell lysates were analyzed by ** ** Rel. Lucif. Act Rel. Lucif. 0 an immunoblot with the indicated antibodies. *P,0.05; **P,0.01. m 10 Rux: 0 0.05 0.1 m Act Rel. Lucif. 0 DAPK, death-associated protein kinase; IFN, interferon; IRF, interferon IFN-b: ––++– + DAPK1-RNAi: ––++ pSTAT1 Rux: ––++ regulatory factor; ISRE, interferon-stimulated response element; SeV, STAT1 Sendai virus. b-actin

e 293-RIG-I 293-ISG56 293-IFNB1 CCACACTGTATTTGGTGTCTAGG (reverse); 40 100 ** 250 ** ** Con IFNA1: TGGTCCTGGTGGTGCTCAGC (forward); 30 80 200 DAPK1-RNAi 60 150 CCAGGCTGTGGGTCTCAGGG (reverse); 20 40 100 IRF7: CCCCCATCTTCGACTTCAGA (forward); 10 20 50 0 CAGGACCAGGCTCTTCTCCTT (reverse); Rel. mRNALevel mock SeV mock SeV mock SeV DAPK1: AATGGAGTTGGCGATTTCAGCGTG (forward); f HeLa-RIG-I HeLa-ISG56 HeLa-IFNB1 AAGGGACTTCAGGAAACTGAGCCA (reverse); 30 ** 400 ** 1600 ** Con GAPDH: GAGTCAACGGATTTGGTCGT (forward), 25 DAPK1-RNAi 20 300 1200 GACAAGCTTCCCGTTCTCAG (reverse). 15 200 800 10 400 5 100 0 RESULTS Rel. mRNALevel mock SeV mock SeV mock SeV Identification of DAPK1 as an IRF7-interacting protein g Con DAPK1-RNAi Previous studies have demonstrated that IRF7 is a master regu- SeV: 0480412 12 8 (hr) ISG56 lator of type I IFN-dependent immune responses. To inves- RIG-I tigate how IRF7 is regulated in virus-induced signaling events, b -actin we attempted to identify IRF7-interacting proteins by TAP as 29 Figure 2 Effects of DAPK1 on viral induction of downstream genes. (a) previously described. An expression plasmid for IRF7 tagged Overexpression of DAPK1 enhances SeV-induced activation of the IFN- with calmodulin-binding peptide and streptavidin-binding b promoter in 293 cells. Luciferase assays were performed as in peptide was stably transfected into 293 cells, and the IRF7- Figure 1c. The graphs show the mean6s.d., n53. *P,0.05; interacting proteins were purified by using the TAP purifica- **P,0.01. (b) Effects of DAPK1-RNAi on SeV-induced activation of tion system. The eluted proteins were identified through a the IFN-b promoter in 293 cells. Reporter assays were performed as shot-gun mass spectometry analysis method. By comparing in Figure 1e. The graphs show the mean6s.d., n53. *P,0.05; the experimental purification with other non-related purifica- **P,0.01. (c) Effects of DAPK1-RNAi on IRF3/7-mediated activation of the IFN-b promoter in 293 cells. DAKP1-RNAi-expressing cells tions using the same method, we identified DAPK1 in the (23105) were transfected with an ISRE reporter (0.05 mg each) and a purified proteins as specifically interacting with IRF7. FLAG-IRF3/7 expression plasmid (0.1 mg each). Luciferase assays were DAPK1 is a Ser/Thr protein kinase that has been shown to performed 18 h after infection. The graphs show the mean6s.d., n53. regulate IFN-c-induced apoptosis.30 Recent studies have also *P,0.05; **P,0.01. (d) Effects of DAPK1-RNAi on IRF3-dependent shown that DAPK1 is involved in a diverse range of signaling 5 signaling. In the left panels, 293 cells (2310 ) were transfected with an pathways and that it functions as a tumor suppressor.31–36 ISRE reporter (0.05 mg each). Eighteen hours after transfection, the However, whether and how DAPK1 is involved in virus-trig- cells were treated with or left untreated with the indicated concentra- tions of the JAK inhibitor Ruxolitinib for 4 h. Reporter assays were gered type I IFN induction is unknown. performed after the cells were infected with SeV for 12 h. The cell lysates To validate the DAPK1-IRF7 association, we generated were analyzed by immunoblot with the indicated antibodies. In the right FLAG- or HA-tagged DAPK1 expression plasmids and per- panels, 293 cells (23105) were transfected with the indicated RNAi formed transient transfections and co-immunoprecipitation

Cellular & Molecular Immunology DAPK1 is involved in the innate antiviral response J Zhang et al 249 experiments. The results suggest that DAPK1 interacted with Figure 2, overexpression of DAPK1 enhanced SeV-induced IRF7, IRF3 and VISA but not with IRF9, RIG-I or MDA5 activation of the IFN-b promoter (Figure 2a), while knock- (Figure 1a and Supplementary Figure 1). We next examined down of DAPK1 attenuated SeV-induced activation of the the endogenous association between DAPK1 and IRF7 or IFN-b promoter in 293 cell reporter assays (Figure 2b), indi- IRF3. As shown in Figure 1b, DAPK1 did not interact with, or cating that DAPK1 is important for virus-induced type I IFN interacted weakly with, IRF7 or IRF3 in resting cells, and these induction. Because DAPK1 interacted with IRF3 and IRF7, we associations were enhanced by SeV infection. These data suggest hypothesized that DAPK1 functioned at the level of IRF3 or that DAPK1 interacts with IRF7 and IRF3 after viral infection. IRF7. The reporter assay results indicated that knockdown of Because DAPK1 interacted with IRF7 and IRF3, we examined DAPK1 inhibited IRF3- and IRF7-mediated activation of ISRE whether DAPK1 was involved in virus-induced ISRE activation. (Figure 2c). It has been reported that IRF3 is constitutively We observed that overexpression of DAPK1 enhanced SeV- expressed in cells and is responsible for the initial wave of induced activation of ISRE in 293 cell reporter assays (Figure 1c). virus-induced transcription from the IFNB1 gene, whereas We next constructed two human DAPK1-RNAi plasmids viral infection or type I IFNs induced the expression of IRF7. (DAPK1-RNAi#1 and DAPK1-RNAi#2), both of which could IRF7 is required for sustained transcriptional activation of the markedly inhibit the expression of transfected and endogenous IFNB1 and IFNA genes following viral infection.17 To deter- DAPK1 in 293 cells (Figure 1d). We found that knockdown of mine whether DAPK1 mediated SeV-triggered IRF3-dependent DAPK1 inhibited SeV-induced ISRE activation (Figure 1e). We signaling, we treated 293 cells that were transfected with a selected the DAPK1-RNAi#1 plasmid for the experiments control or a DAPK1-RNAi plasmid with the JAK inhibitor described below, and similar results were obtained with the #2 Ruxolitinib, then infected the cells with SeV and performed RNAi plasmid. Consistent with the observations made in the reporter assays. The results suggested that SeV-induced activa- reporter assays, knockdown of DAPK1 inhibited SeV-induced tion of ISRE was inhibited by the knockdown of DAPK1 in the phosphorylation of IRF3 (Figure 1f). These data suggest that presence or absence of Ruxolitinib (Figure 2d), indicating that DAPK1 is important for SeV-induced ISRE activation. DAPK1 regulates a SeV-triggered IRF3-dependent signaling event. Consistent with these observations, the results from the DAPK1 is involved in virus-triggered type I IFN signaling quantitative real-time PCR analysis showed that knockdown of We next examined the effect of DAPK1 and DAPK1-RNAi on DAPK1 inhibited SeV-induced transcription of IFNB1, RIG-I virus-induced activation of the IFN-b promoter. As shown in and ISG56 in 293 and HeLa cells (Figure 2e and f). In addition,

a ISG56 RIG-I IRF7 IFNA1 IFNB1 12 ** 120 ** 12 16 ** 20 ** Con ** DAPK1-RNAi 9 90 9 12 15 6 60 6 8 10 3 30 3 4 5

Rel. mRNALevel 0 mock IFN-b mock IFN-b mock IFN-b mock IFN-b mock IFN-b

b c F-DAPK1 F-IKKe F-DAPK1 mock IFN-b HA-: IRF9 STAT1 STAT1 HA-: IKKe TBK1 DAPK-RNAi: –+ –+ IP:lgG aF lgG aFlgG aF IP: lgG aF lgG aF ISG56 RIG-I b-actin lgG-H

DAPK1 DAPK1 Lysate STAT1 Lysate TBK1 IKKe IKKe IRF9

Figure 3 Effects of DAPK1 on IFN-b-induced signaling. (a) Effects of DAPK1-RNAi on IFN-b-induced transcription of RIG-I, ISG56, IRF7, IFNA and IFNB1 genes. In total, 293 cells (23105) were transfected with the indicated RNAi plasmids (2 mg each). Twelve hours after transfection, the cells were selected with puromycin (1 mg/ml) for 24 h, then treated with IFN-b or left untreated for 12 h before real-time PCR was performed. The graphs show the mean6s.d., n53. *P,0.05; **P,0.01. (b) Knockdown of DAPK1 inhibited IFN-b-induced protein expression of RIG-I and ISG56. In total, 293 cells (23105) were transfected with a DAPK1-RNAi plasmid for 12 h, selected with puromycin (1 mg/ml) for 24 h and then treated with IFN-b or left untreated for the indicated time points. The cell lysates were analyzed by immunoblot with the indicated antibodies. (c) DAPK1 interacts with STAT1 and IKKe, but not with IRF9 or TBK1. In total, 293 cells (13107) were transfected with the indicated plasmids (6 mg each). Co-immunoprecipitation and immunoblot analysis were performed with the indicated antibodies. DAPK, death-associated protein kinase; IFN, interferon; IRF, interferon regulatory factor.

Cellular & Molecular Immunology DAPK1 is involved in the innate antiviral response J Zhang et al 250

knockdown of DAPK1 inhibited SeV-induced expression of the ab VSV (MOI=0.1) RIG-I and ISG56 proteins (Figure 2g). Collectively, these data 9 suggest that DAPK1 is important for virus-induced expression 8.9 ** Bright Field GFP-NDV of downstream genes. 8.8 8.7 Con 8.6 DAPK1 is involved in IFN-b-triggered signaling 8.5 ConDAPK1-RNAib-actin Log(pfu/ml) 8.4 GFP Because both viral infection and type I IFNs induce expression DAPK1-RNAi REL:1.05.6 of RIG-I, ISG56 and IFNB1 genes, and because treatment with 8.3 ** 8.2 Ruxolitinib partially restored the DAPK1-RNAi-mediated Con inhibition of SeV-induced IFN-b activation, we hypothesized

that DAPK1 mediated type I IFN signaling. The results of the DAPK1-RNAi real-time PCR analysis indicated that knockdown of DAPK1 inhibited the IFN-b-induced transcription of downstream Figure 4 Roles of DAPK1 in cellular antiviral response. (a) Effects of genes, such as ISG56, RIG-I, IRF7, IFNA1 and IFNB1, in 293 DAPK1-RNAi on VSV replication. Two hundred and ninety-three cells (13105) were transfected with the indicated expression plasmids (1 mg cells (Figure 3a). Consistent with this hypothesis, the results each). Twenty-four hours after transfection, the cells were infected with from an immunoblot analysis indicated that knockdown of VSV (MOI50.1). The supernatants were harvested 24 h after infection DAPK1 attenuated IFN-b-induced RIG-I and ISG56 protein for standard plaque assays. The graphs show the mean6s.d., n53. expression (Figure 3b). In the transient transfection and co- *P,0.05; **P,0.01. (b) Effects of DAPK1-RNAi on NDV replication. In immunoprecipitation experiments, DAPK1 interacted with the left panels, 293 cells were transfected with a DAPK1-RNAi plasmid STAT1 and IKKe, but not with IRF9 or TBK1 (Figure 3c). In (1 mg each). Twenty-four hours later, the cells were infected with NDV- addition, we found that the knockdown of DAPK1 inhibited GFP (MOI50.1) for 36 h and then imaged by microscopy. In the right panels, the cell lysates were analyzed by immunoblot with the indicated e TBK1- or IKK -mediated activation of ISRE (Supplementary antibodies. The GFP bands from three independent experiments were Figure 3). It has previously been demonstrated that TBK1 and quantitated using the Bio-Rad Quantity One Program and normalized to IKKe phosphorylate IRF3/7 after virus infection to induce the the levels of the control protein b-actin. The graphs show the transcription of the IFNB1 gene,9,37 while IKKe phosphorylates mean6s.d., n53. *P,0.05; **P,0.01. DAPK, death-associated pro- STAT1 to mediate IFN-b-dependent signaling.38 These find- tein kinase; MOI, multiplicity of infection; NDV, Newcastle disease virus; ings indicate that DAPK1 interacts with IKKe and is involved in VSV, vesicular stomatitis virus. both virus- and IFN-b-induced signaling. Because DAPK1 is involved in both virus- and IFN-b- the conclusion that DAPK1 is involved in SeV- and IFN-b- induced signaling, we examined its role in the cellular antiviral induced signaling. response. Knockdown of DAPK1 by RNAi increased VSV and NDV replication (Figure 4a). These results indicated that DISCUSSION DAPK1 is important for efficient cellular antiviral responses IRF7 and IRF3 are master transcription factors of the type I IFN- through the regulation of both virus-induced type I IFN pro- dependent immune response. In this study, we identified duction and type I IFN-induced signaling. DAPK1 as an IRF7/3-interacting protein. Although DAPK1 interacted with IRF7/3 constitutively in a mammalian overex- DAPK1 is induced by SeV infection and IFN-b treatment pression system, the endogenous association was viral infection- When performing the real-time PCR experiments, we repea- dependent. This finding can be explained by the observation that tedly found that the expression of the DAPK1 gene was DAPK1 was expressed at low levels under physiological condi- increased in cells that were stimulated by SeV or IFN-b tions and was induced following viral infection. (Figure 5a). SeV- or IFN-b-induced expression of DAPK1 In our study, we found that overexpression of DAPK1 was confirmed at the protein level with immunoblot analysis increased virus-triggered activation of ISRE and the IFN-b pro- (Figure 5b). Autophosphorylation at Ser308 was demonstrated moter, whereas knockdown of DAPK1 inhibited both virus- to inhibit the catalytic activity of DAPK1, and the dephosphor- and IFN-b-triggered induction of downstream genes, including ylation of Ser308 was required for DAPK1 activation.39 IFNB1, RIG-I and ISG56. DAPK1 was specifically involved in Interestingly, we found that the level of Ser308-phosphorylated SeV-induced activation of the IFN-b promoter, but not in DAPK1 (DAPK1-pS308) was decreased following these sti- TNFa-induced activation of NF-kB (Supplementary Figure 2a muli, indicating that DAPK1 was activated after viral infection and b), which was consistent with an earlier report showing that or IFN-b treatment (Figure 5b). Interestingly, however, we DAPK1 has no effect on TNFa-induced activation of NF-kB.28 found that both the kinase active mutant DAPK1(S308A) Taken together, these results demonstrate an important role for and inactive mutant DAPK1(K42A) could increase SeV- DAPK1 in the type I IFN-mediated immune response. induced activation of ISRE to similar levels as wild-type Our study showed that DAPK1 expression was induced and DAPK1 (Figure 5c), indicating that the kinase activity of DAPK1Ser308 phosporylation was decreased following viral DAPK1 is dispensable for mediating virus-induced signaling. infection, indicating that viral infection activates DAPK1. Taken together, these data suggest that DAPK1 is induced and However, both the DAPK1 inactive (K42A) and active mutants activated by SeV infection and IFN-b stimulation, supporting (S308A) could increase the SeV-triggered activation of ISRE,

Cellular & Molecular Immunology DAPK1 is involved in the innate antiviral response J Zhang et al 251

a These results suggest that DAPK1 also plays a role in the sig- DAPK1 DAPK1 5 10 ** naling triggered by type I IFNs. Taken together, our results ** 4 8 demonstrate that DAPK1 is an important modulator of 3 ** 6 ** virus-induced expression of type I IFNs and other downstream 2 ** 4 genes and that it plays an important role in the innate antiviral 1 2 response. Rel.mRNALevel 0 Rel.mRNALevel 0 02412 48 (hr) 0246 (hr) SeV IFN-b ACKNOWLEDGEMENTS We thank the members of our laboratory for their technical help and b stimulating discussions. This work was supported by grants from the SeV: 0243660369 48 (hr) DAPK1 Ministry of Science and Technology of China (2012CB910201, 2010CB911802) and the National Natural Science Foundation of DAPK1-pS308 China (31221061, 31130020, 31101019 and 91029302). b-actin

IFN-b: 0246 12 (hr) Supplementary Information accompanies the paper on Cellular & DAPK1 Molecular Immunology’s website. (http://www.nature.com/cmi). DAPK1-pS308 b-actin

1 Takeuchi O, Akira S. Pattern recognition receptors and inflammation. c Cell 2010; 140: 805–820. IFN-b ISRE 2 Akira S, Uematsu S, Takeuchi O. Pathogen recognition and innate 8 16 mock mock immunity. Cell 2006; 124: 783–801. SeV SeV 12 6 3 Garcia-Sastre A, Biron CA. Type 1 interferons and the virus-host relationship: a lesson in detente. Science 2006; 312: 879–882. 8 4 4 O’Neill, LA, Bowie AG. The family of five: TIR-domain-containing adaptors 2 in Toll-like receptor signalling. Nat Rev Immunol 2007; 7:353–364. 4 Rel.Luc. Act. Rel.Luc. Act. 5 Oshiumi H, Matsumoto M, Funami K, Akazawa T, Seya T. TICAM-1, an 0 0 adaptor molecule that participates in Toll-like receptor 3-mediated

Vec Vec interferon-beta induction. Nat Immunol 2003; 4: 161–167. DAPK1 DAPK1 6 Yamamoto M, Sato S, Hemmi H, Hoshino K, Kaisho T, Sanjo H et al.

DAPK1K42A DAPK1K42A Role of adaptor TRIF in the MyD88-independent Toll-like receptor DAPK1S308A DAPK1S308A signaling pathway. Science 2003; 301: 640–643. 7 Xu LG, Wang YY, Han KJ, Li LY, Zhai Z, Shu HB. VISA is an adapter Figure 5 DAPK1 is induced and activated by SeV and IFN-b.(a) SeV protein required for virus-triggered IFN-beta signaling. Mol Cell 2005; and IFN-b inducethetranscriptionofDAPK1.Intotal,293cells 19: 727–740. 5 (2310 ) were treated with SeV or IFN-b for the indicated time points 8 O’Neill LA, Bowie AG. Sensing and signaling in antiviral innate before real-time PCR was performed. The graphs show the mean6s.d., immunity. Curr Biol 2010; 20: R328–R333. n53. (b) Effects of SeV and IFN-b on the expression of total and phos- 9 Fitzgerald KA, McWhirter SM, Faia KL, Rowe DC, Latz E, Golenbock phorylated DAPK1. In total, 293 cells (13107) were treated with SeV or DT et al. IKKepsilon and TBK1 are essential components of the IRF3 IFN-b for the indicated time points. The cell lysates were analyzed by signaling pathway. Nat Immunol 2003; 4: 491–496. immunoblot with the indicated antibodies. (c) Overexpression of 10 Sharma S, tenOever BR, Grandvaux N, Zhou GP, Lin R, Hiscott J. DAPK1 mutations enhance SeV-induced ISRE and IFN-b promoter Triggering the interferon antiviral response through an IKK-related activation to the same level as wild-type DAPK1 in 293 cells. A luciferase pathway. Science 2003; 300: 1148–1151. assay was performed as in Figure 1c. The graphs show the mean6s.d., 11 Ermolaeva MA, Michallet MC, Papadopoulou N, Utermo¨hlen O, Kranidioti K, Kollias G et al. Function of TRADD in tumor n53. DAPK, death-associated protein kinase; IFN, interferon; ISRE, necrosis factor receptor 1 signaling and in TRIF-dependent interferon-stimulated response element; SeV, Sendai virus. inflammatory responses. Nat Immunol 2008; 9: 1037–1046. 12 Michallet MC, Meylan E, Ermolaeva MA, Vazquez J, Rebsamen M, suggesting that the kinase activity of DAPK1 is dispensable for Curran J et al. TRADD protein is an essential component of the RIG- mediating virus-induced type I IFN signaling. We and others like helicase antiviral pathway. Immunity 2008; 28: 651–661. b 13 Balachandran S, Venkataraman T, Fisher PB, Barber GN. Fas- have shown that two kinases, RIP1 and GSK3 , mediate viral associated death domain-containing protein-mediated antiviral infection-induced signaling independent of their kinase innate immune signaling involves the regulation of Irf7. J Immunol activity.15,40,41 It is possible that viral infection leads to the 2007; 178: 2429–2439. induction and activation of DAPK1, which then interacts with 14 Zhong B, Yang Y, Li S, Wang YY, Li Y, Diao F et al. The adaptor protein MITA links virus-sensing receptors to IRF3 transcription factor IRF3 and IRF7, contributing to the amplification of type I IFN. activation. Immunity 2008; 29: 538–550. Interestingly, we also found that the knockdown of DAPK1 15 Lei CQ, Zhong B, Zhang Y, Zhang J, Wang S, Shu HB et al. Glycogen inhibited IFN-b-induced expression of downstream genes, synthase kinase 3beta regulates IRF3 transcription factor-mediated such as ISG56, RIG-I, IRF7, IFNA1 and IFNB1. Consistent with antiviral response via activation of the kinase TBK1. Immunity 2010; these findings, co-immunoprecipitation experiments demon- 33: 878–889. 16 Tamura T, Yanai H, Savitsky D, Taniguchi T. The IRF family strated that DAPK1 interacted with STAT1 and IKKe, which transcription factors in immunity and oncogenesis. Annu Rev are components of the IFN-b-induced signaling pathway. Immunol 2008; 26: 535–584.

Cellular & Molecular Immunology DAPK1 is involved in the innate antiviral response J Zhang et al 252

17 Hiscott J. Triggering the innate antiviral response through IRF-3 and virus-triggered IRF3 and NF-kappaB activation. Proc Natl Acad activation. J Biol Chem 2007; 282: 15325–15329. Sci USA 2010; 107: 815–820. 18 Honda K, Yanai H, Negishi H, Asagiri M, Sato M, Mizutani T et al. IRF- 30 Deiss LP, Feinstein E, Berissi H, Cohen O, Kimchi A. Identification of 7 is the master regulator of type-I interferon-dependent immune a novel serine/threonine kinase and a novel 15-kD protein as potential responses. Nature 2005; 434: 772–777. mediators of the gamma interferon-induced cell death. Genes Dev 19 Lu R, Au WC, Yeow WS, Hageman N, Pitha PM. Regulation of the 1995; 9: 15–30. promoter activity of interferon regulatory factor-7 gene. Activation 31 Levine B, Klionsky DJ. Development by self-digestion: molecular by interferon snd silencing by hypermethylation. J Biol Chem 2000; mechanisms and biological functions of autophagy. Dev Cell 2004; 275: 31805–31812. 6: 463–477. 20 Litvak V, Ratushny AV, Lampano AE, Schmitz F, Huang AC, Raman A 32 Bialik S, Kimchi, A. The death-associated protein kinases: structure, et al. A FOXO3-IRF7 gene regulatory circuit limits inflammatory function, and beyond. Annu Rev Biochem 2006; 75: 189–210. sequelae of antiviral responses. Nature 2012; 490: 421–425. 33 Kuo JC, Wang WJ, Yao CC, Wu PR, Chen RH. The tumor suppressor 21 Wang RP, Zhang M, Li Y, Diao FC, Chen D, Zhai Z et al. Differential DAPK inhibits cell motility by blocking the integrin-mediated polarity regulation of IKK alpha-mediated activation of IRF3/7 by NIK. Mol pathway. J Cell Biol 2006; 172: 619–631. Immunol 2008; 45: 1926–1934. 34 Harrison B, Kraus M, Burch L, Stevens C, Craig A, Gordon-Weeks P 22 Ning S, Campos AD, Darnay BG, Bentz GL, Pagano JS. TRAF6 and the et al. DAPK-1 binding to a linear peptide motif in MAP1B stimulates three C-terminal lysine sites on IRF7 are required for its autophagy and membrane blebbing. J Biol Chem 2008; 283: 9999– ubiquitination-mediated activation by the tumor necrosis factor 10014. receptor family member latent membrane protein 1. Mol Cell Biol 35 Kang BN, Ahmad AS, Saleem S, Patterson RL, Hester L, Dore´Set al. 2008; 28: 6536–6546. Death-associated protein kinase-mediated cell death modulated by 23 Yu Y, Hayward GS. The ubiquitin E3 ligase RAUL negatively regulates interaction with DANGER. J Neurosci 2010; 30: 93–98. type i interferon through ubiquitination of the transcription factors 36 Zidi I, Mestiri S, Bartegi A, Amor NB. TNF-alpha and its inhibitors in IRF7 and IRF3. Immunity 2010; 33: 863–877. cancer. Med Oncol 2009; 27: 185–198. 24 Mao AP, Li S, Zhong B, Li Y, Yan J, Li Q et al. Virus-triggered ubiquitination of TRAF3/6 by cIAP1/2 is essential for induction of 37 Perry AK, Chow EK, Goodnough JB, Yeh WC, Cheng G. Differential interferon-beta (IFN-beta) and cellular antiviral response. JBiol requirement for TANK-binding kinase-1 in type I interferon responses Chem 2010; 285: 9470–9476. to Toll-like receptor activation and viral infection. J Exp Med 2004; 25 Li Y, Li C, Xue P, Zhong B, Mao AP, Ran Y et al. ISG56 is a negative- 199: 1651–1658. feedback regulator of virus-triggered signaling and cellular antiviral 38 Tenoever BR, Ng SL, Chua MA, McWhirter SM, Garcı´a-Sastre A, response. Proc Natl Acad Sci USA 2009; 106: 7945–7950. Maniatis T. Multiple functions of the IKK-related kinase IKKepsilon 26 Diao F, Li S, Tian Y, Zhang M, Xu LG, Zhang Y et al. Negative regulation in interferon-mediated antiviral immunity. Science 2007; 315: of MDA5- but not RIG-I-mediated innate antiviral signaling by the 1274–1278. dihydroxyacetone kinase. Proc Natl Acad Sci USA 2007; 104: 39 Shohat G, Spivak-Kroizman T, Cohen O, Bialik S, Shani G, Berrisi H 11706–11711. et al. The pro-apoptotic function of death-associated protein kinase is 27 Huang J, Liu T, Xu LG, Chen D, Zhai Z, Shu HB. SIKE is an IKK controlled by a unique inhibitory autophosphorylation-based epsilon/TBK1-associated suppressor of TLR3- and virus-triggered mechanism. J Biol Chem 2001; 276: 47460–47467. IRF-3 activation pathways. EMBO J 2005; 24: 4018–4028. 40 Hsu H, Huang J, Shu HB, Baichwal V, Goeddel DV. TNF-dependent 28 Chuang YT, Fang LW, Lin-Feng MH, Chen RH, Lai MZ. The tumor recruitment of the protein kinase RIP to the TNF receptor-1 signaling suppressor death-associated protein kinase targets to TCR-stimulated complex. Immunity 1996; 4: 387–396. NF-kappa B activation. J Immunol 2008; 180: 3238–3249. 41EaCK,DengL,XiaZP,PinedaG,ChenZJ.ActivationofIKKby 29 Wang YY, Liu LJ, Zhong B, Liu TT, Li Y, Yang Y et al.WDR5is TNFalpha requires site-specific ubiquitination of RIP1 and essential for assembly of the VISA-associated signaling complex polyubiquitin binding by NEMO. Mol Cell 2006; 22: 245–257.

Cellular & Molecular Immunology