DOCSLIB.ORG

81964717.Pdf

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
81964717.Pdf Developmental Biology 393 (2014) 195–208 Contents lists available at ScienceDirect Developmental Biology journal homepage: www.elsevier.com/locate/developmentalbiology Review The role of homeobox genes in retinal development and disease Jamie L. Zagozewski a,1, Qi Zhang b,1, Vanessa I. Pinto c, Jeffrey T. Wigle c,d, David D. Eisenstat a,c,e,n a Department of Medical Genetics, University of Alberta, Edmonton, AB, Canada T6G 2H7 b Department of Human Anatomy and Cell Science, University of Manitoba, Winnipeg, MB, Canada R3E 0J9 c Department of Biochemistry and Medical Genetics, University of Manitoba, Winnipeg, MB, Canada R3E 0J9 d Institute of Cardiovascular Sciences, St. Boniface Hospital Research Institute, Winnipeg, MB, Canada R2H 2A6 e Department of Pediatrics, University of Alberta, Edmonton, AB, Canada T6G 1C9 article info abstract Article history: Homeobox genes are an evolutionarily conserved class of transcription factors that are critical for Received 24 March 2014 development of many organ systems, including the brain and eye. During retinogenesis, homeodomain- Received in revised form containing transcription factors, which are encoded by homeobox genes, play essential roles in the 2 July 2014 regionalization and patterning of the optic neuroepithelium, specification of retinal progenitors and Accepted 8 July 2014 differentiation of all seven of the retinal cell classes that derive from a common progenitor. Home- Available online 15 July 2014 odomain transcription factors control retinal cell fate by regulating the expression of target genes Keywords: required for retinal progenitor cell fate decisions and for terminal differentiation of specific retinal cell Retina types. The essential role of homeobox genes during retinal development is demonstrated by the number Vertebrate of human eye diseases, including colobomas and anophthalmia, which are attributed to homeobox gene Homeobox mutations. In the following review, we highlight the role of homeodomain transcription factors during Transcription factor Coloboma retinogenesis and regulation of their gene targets. Understanding the complexities of vertebrate retina Anophthalmia development will enhance our ability to drive differentiation of specific retinal cell types towards novel cell-based replacement therapies for retinal degenerative diseases. & 2014 Elsevier Inc. All rights reserved. Introduction restricted to produce the correct retinal cell types within the appropriate temporal window. Initiation of intrinsic transcription The retina is a remarkably complex, yet structurally simple factor expression in the RPC population plays a critical role in laminar tissue made up of seven distinct retinal cell types (6 directing these multipotent cells to adopt specific retinal cell fates neuronal and 1 glial), that are born sequentially in a temporally (Marquardt, 2003; Ohsawa and Kageyama, 2008). Transcription ordered and overlapping manner (Young, 1985). These cells are factors of the homeodomain, basic helix-loop-helix (bHLH) and organized into three cellular layers, which include the ganglion forkhead box (FOX) families work in concert to direct retinal cell cell layer (GCL), the inner nuclear layer (INL) and the outer nuclear fate specification and differentiation. Homeobox genes encode layer (ONL) (Fig. 1). As mouse embryonic retinal development transcription factors containing a 60 amino acid DNA-binding proceeds, retinal ganglion cells (RGC) are generated first, followed homeodomain. These homeodomains canonically bind to core by cone photoreceptors, horizontal cells and amacrine cells. tetranucelotide TAAT/ATTA motifs (Gehring et al., 1994). Unique During the postnatal period, rod photoreceptors, bipolar cells adjacent consensus motifs impart specificity of binding of indivi- and Müller glia are specified and complete differentiation. Retinal dual transcription factors (Gehring et al., 1994). Homeobox genes cells arise from a common pool of multipotent retinal progenitor can be further classified based on the presence of additional cells (RPC) (Livesey and Cepko, 2001; Turner and Cepko, 1987; conserved domains, such as the paired and LIM domains. Homeo- Wetts and Fraser, 1988). RPC competence gradually becomes box genes play a number of critical roles during vertebrate forebrain (Wigle and Eisenstat, 2008) and eye development including specification of the eye field and the optic stalk, n Corresponding author at: Depatments of Pediatrics, Medical Genetics and progenitor cell fate determination, and retinal cell differentiation Oncology, Room 8-43B, Medical Sciences Building, University of Alberta, Edmonton, and survival. Due to these critical roles, mutations in human AB, Canada T6G 2H7. Fax: þ780 492 1998. E-mail address: [email protected] (D.D. Eisenstat). homeobox genes can lead to a number of ocular abnormalities, 1 JLZ and QZ are co-first authors. ranging from colobomas to anophthalmia (Table 1). We will focus http://dx.doi.org/10.1016/j.ydbio.2014.07.004 0012-1606/& 2014 Elsevier Inc. All rights reserved. 196 J.L. Zagozewski et al. / Developmental Biology 393 (2014) 195–208 Fig. 1. Expression of homeobox genes in the mature vertebrate retina. Homeobox genes are required for specification and differentiation of retinal cells. RGCs (green, G) are located in the GCL which also contains displaced amacrine cells (not shown). The INL contains the cell bodies of the amacrine cells (pink, A), horizontal cells (purple, H), bipolar cells (gray, B) and the Müller glia (black, M). The ONL contains the light-sensitive rod and cone photoreceptors (red, P). Synaptic connections between the photoreceptors in the ONL and horizontal and bipolar cells are made in the OPL while connections between bipolar cells and horizontal cells are made with the RGC in the IPL. Homeobox genes are expressed in all retinal cell types, including RPC. Specific homeobox genes expressed in the cells of the vertebrate retina are shown on the right and are also color coordinated with the cell type in which they are expressed. In addition, the first letter corresponding to the retinal cell types is indicated next to the homeobox genes expressed in that specific cell type. [GCL, ganglion cell layer; INL, inner nuclear layer; IPL, inner plexiform layer; ONL, outer nuclear layer; OPL, outer plexiform layer; RGC, retinal ganglion cell; RPC, retinal progenitor cell]. our review on members of the homeobox gene family, and the have been associated with both anophthalmia and microphthal- critical role each gene plays in RPC fate specification, retinal cell mia (Table 1)(Abouzeid et al., 2012; Bardakjian and Schneider, type differentiation and inherited eye diseases. 2011; Voronina et al., 2004). Mutations are typically located in either the DNA binding homeodomain or the OAR domain and Rax result in impaired expression of RAX target genes (Lequeux et al., 2008). Retina and anterior neural fold homeobox gene (Rax), pre- In addition to a role in early eye development, Rax regulates viously referred to as the retinal homeobox gene (Rx), belongs to expression of genes required for photoreceptor development the paired-like (Prd-L) homeodomain (HD) family. In addition to (Fig. 2). Knockdown of zebrafish and Xenopus Rax orthologs results the paired-like homeodomain, the RAX protein contains a con- in reduction of photoreceptor-specific gene expression (Nelson et served OAR domain in the C-terminus named for conservation of al., 2009; Pan et al., 2010). Early in vitro studies demonstrated that this region between opt, aristaless and rax (Furukawa et al., 1997). RAX can directly bind to labeled oligonucleotide probes of the Rax genes have been identified in a number of model systems arrestin promoter (a photoreceptor specific gene) through the including mice, zebrafish, chick, Xenopus, and Drosophila with the photoreceptor conserved element (PCE-1) in vitro and activate number of Rax genes varying depending on the species. Both the expression of arrestin in reporter gene assays (Kimura et al., 2000). structure and the expression pattern of the Rax genes are highly More recently, the Xenopus Rax gene was demonstrated to occupy conserved across these species (Chuang and Raymond, 2001; PCE-1 containing promoter elements of rhodopsin and red cone Furukawa et al., 1997; Mathers et al., 1997; Muranishi et al., opsin in vivo (Pan et al., 2010). Rax has also been shown to regulate 2012). Rax is among the earliest genes expressed in the developing the expression of the murine homolog of orthodenticle (Otx2), a retina. During zebrafish gastrulation, rx3 expression in the anterior homeobox gene essential for determination of photoreceptor cell forebrain permits specification of the eye field over telencephalic fate (Muranishi et al., 2011). A conserved enhancer upstream of the fate (Stigloher et al., 2006). Murine Rax is first expressed at E7.5 in OTX2 initiation codon was identified and termed the embryonic the cephalic neural fold (Furukawa et al., 1997; Mathers et al., enhancer locus for photoreceptor Otx2 transcription (EELPOT). 1997). At E9.5, Rax expression initiates in the optic vesicle and is RAX was shown to bind to EELPOT in vivo by chromatin immuno- subsequently localized to the neural retina. Rax is expressed precipitation (ChIP), and significantly activates EELPOT-luciferase uniformly throughout the developing neuroblastic layer (NBL), reporters in vitro. Additionally, Otx2 expression is dramatically with peak expression observed at E16.5. With the onset of retinal decreased with concomitant decrease in cone–rod homeobox (Crx)
Load more

Recommended publications
  • THE ROLE of HOMEODOMAIN TRANSCRIPTION FACTOR IRX5 in CARDIAC CONTRACTILITY and HYPERTROPHIC RESPONSE by © COPYRIGHT by KYOUNG H
    THE ROLE OF HOMEODOMAIN TRANSCRIPTION FACTOR IRX5 IN CARDIAC CONTRACTILITY AND HYPERTROPHIC RESPONSE By KYOUNG HAN KIM A THESIS SUBMITTED IN CONFORMITY WITH THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY GRADUATE DEPARTMENT OF PHYSIOLOGY UNIVERSITY OF TORONTO © COPYRIGHT BY KYOUNG HAN KIM (2011) THE ROLE OF HOMEODOMAIN TRANSCRIPTION FACTOR IRX5 IN CARDIAC CONTRACTILITY AND HYPERTROPHIC RESPONSE KYOUNG HAN KIM DOCTOR OF PHILOSOPHY GRADUATE DEPARTMENT OF PHYSIOLOGY UNIVERSITY OF TORONTO 2011 ABSTRACT Irx5 is a homeodomain transcription factor that negatively regulates cardiac fast transient + outward K currents (Ito,f) via the KV4.2 gene and is thereby a major determinant of the transmural repolarization gradient. While Ito,f is invariably reduced in heart disease and changes in Ito,f can modulate both cardiac contractility and hypertrophy, less is known about a functional role of Irx5, and its relationship with Ito,f, in the normal and diseased heart. Here I show that Irx5 plays crucial roles in the regulation of cardiac contractility and proper adaptive hypertrophy. Specifically, Irx5-deficient (Irx5-/-) hearts had reduced cardiac contractility and lacked the normal regional difference in excitation-contraction with decreased action potential duration, Ca2+ transients and myocyte shortening in sub-endocardial, but not sub-epicardial, myocytes. In addition, Irx5-/- mice showed less cardiac hypertrophy, but increased interstitial fibrosis and greater contractility impairment following pressure overload. A defect in hypertrophic responses in Irx5-/- myocardium was confirmed in cultured neonatal mouse ventricular myocytes, exposed to norepinephrine while being restored with Irx5 replacement. Interestingly, studies using mice ii -/- virtually lacking Ito,f (i.e. KV4.2-deficient) showed that reduced contractility in Irx5 mice was completely restored by loss of KV4.2, whereas hypertrophic responses to pressure-overload in hearts remained impaired when both Irx5 and Ito,f were absent.
    [Show full text]
  • Core Transcriptional Regulatory Circuitries in Cancer
    Oncogene (2020) 39:6633–6646 https://doi.org/10.1038/s41388-020-01459-w REVIEW ARTICLE Core transcriptional regulatory circuitries in cancer 1 1,2,3 1 2 1,4,5 Ye Chen ● Liang Xu ● Ruby Yu-Tong Lin ● Markus Müschen ● H. Phillip Koeffler Received: 14 June 2020 / Revised: 30 August 2020 / Accepted: 4 September 2020 / Published online: 17 September 2020 © The Author(s) 2020. This article is published with open access Abstract Transcription factors (TFs) coordinate the on-and-off states of gene expression typically in a combinatorial fashion. Studies from embryonic stem cells and other cell types have revealed that a clique of self-regulated core TFs control cell identity and cell state. These core TFs form interconnected feed-forward transcriptional loops to establish and reinforce the cell-type- specific gene-expression program; the ensemble of core TFs and their regulatory loops constitutes core transcriptional regulatory circuitry (CRC). Here, we summarize recent progress in computational reconstitution and biologic exploration of CRCs across various human malignancies, and consolidate the strategy and methodology for CRC discovery. We also discuss the genetic basis and therapeutic vulnerability of CRC, and highlight new frontiers and future efforts for the study of CRC in cancer. Knowledge of CRC in cancer is fundamental to understanding cancer-specific transcriptional addiction, and should provide important insight to both pathobiology and therapeutics. 1234567890();,: 1234567890();,: Introduction genes. Till now, one critical goal in biology remains to understand the composition and hierarchy of transcriptional Transcriptional regulation is one of the fundamental mole- regulatory network in each specified cell type/lineage.
    [Show full text]
  • Sorbonne Université́
    Sorbonne Université́ École Doctorale ED515 – Complexité́ du vivant INSERM UMRS 933 : Physiopathologie des maladies génétiques d'expression pédiatrique Mécanismes physiopathologiques impliqués dans la différenciation du tractus génital masculin Matthieu Peycelon Thèse de Doctorat de Génétique Humaine Dirigée par Pr. Jean-Pierre Siffroi Présentée et soutenue publiquement le 19 décembre 2019 Devant un jury composé de : Brigitte BENZACKEN PU-PH Université Paris 13 Rapporteur Anne-Françoise SPINOIT Professeur Université de Gand Rapporteur Irène NETCHINE PU-PH Université Paris 6 Examinateur Nicolas KALFA PU-PH Université de Montpellier Examinateur Alaa EL GHONEIMI PU-PH Université Paris 7 Président Jean-Pierre SIFFROI PU-PH Université Paris 6 Directeur de thèse Sorbonne Université́ École Doctorale ED515 – Complexité́ du vivant INSERM UMRS 933 : Physiopathologie des maladies génétiques d'expression pédiatrique Mécanismes physiopathologiques impliqués dans la différenciation du tractus génital masculin Matthieu Peycelon Thèse de Doctorat de Génétique Humaine Dirigée par Pr. Jean-Pierre Siffroi Présentée et soutenue publiquement le 19 décembre 2019 Devant un jury composé de : Brigitte BENZACKEN PU-PH Université Paris 13 Rapporteur Anne-Françoise SPINOIT Professeur Université de Gand Rapporteur Irène NETCHINE PU-PH Université Paris 6 Examinateur Nicolas KALFA PU-PH Université de Montpellier Examinateur Alaa EL GHONEIMI PU-PH Université Paris 7 Président Jean-Pierre SIFFROI PU-PH Université Paris 6 Directeur de thèse Ce travail de thèse a été réalisé́ sous la direction du Professeur Jean-Pierre Siffroi, au sein de l’unité́ mixte de recherche INSERM / Sorbonne Université UMR_S933 dirigée par le Professeur Serge Amselem. Adresse : Département de Génétique Médicale, Hôpital Armand Trousseau ; 26 avenue du Docteur Arnold Netter, 75012, Paris.
    [Show full text]
  • Overlap of Vitamin a and Vitamin D Target Genes with CAKUT- Related Processes [Version 1; Peer Review: 1 Approved with Reservations]
    F1000Research 2021, 10:395 Last updated: 21 JUL 2021 BRIEF REPORT Overlap of vitamin A and vitamin D target genes with CAKUT- related processes [version 1; peer review: 1 approved with reservations] Ozan Ozisik1, Friederike Ehrhart 2,3, Chris T Evelo 2, Alberto Mantovani4, Anaı̈s Baudot 1,5 1Aix Marseille University, Inserm, MMG, Marseille, 13385, France 2Department of Bioinformatics - BiGCaT, Maastricht University, Maastricht, 6200 MD, The Netherlands 3Department of Bioinformatics, NUTRIM/MHeNs, Maastricht University, Maastricht, 6200 MD, The Netherlands 4Istituto Superiore di Sanità, Rome, 00161, Italy 5Barcelona Supercomputing Center (BSC), Barcelona, 08034, Spain v1 First published: 18 May 2021, 10:395 Open Peer Review https://doi.org/10.12688/f1000research.51018.1 Latest published: 18 May 2021, 10:395 https://doi.org/10.12688/f1000research.51018.1 Reviewer Status Invited Reviewers Abstract Congenital Anomalies of the Kidney and Urinary Tract (CAKUT) are a 1 group of abnormalities affecting the kidneys and their outflow tracts, which include the ureters, the bladder, and the urethra. CAKUT version 1 patients display a large clinical variability as well as a complex 18 May 2021 report aetiology, as only 5% to 20% of the cases have a monogenic origin. It is thereby suspected that interactions of both genetic and 1. Elena Menegola, Università degli Studi di environmental factors contribute to the disease. Vitamins are among the environmental factors that are considered for CAKUT aetiology. In Milano, Milan, Italy this study, we collected vitamin A and vitamin D target genes and Any reports and responses or comments on the computed their overlap with CAKUT-related gene sets.
    [Show full text]
  • Detailed Review Paper on Retinoid Pathway Signalling
    1 1 Detailed Review Paper on Retinoid Pathway Signalling 2 December 2020 3 2 4 Foreword 5 1. Project 4.97 to develop a Detailed Review Paper (DRP) on the Retinoid System 6 was added to the Test Guidelines Programme work plan in 2015. The project was 7 originally proposed by Sweden and the European Commission later joined the project as 8 a co-lead. In 2019, the OECD Secretariat was added to coordinate input from expert 9 consultants. The initial objectives of the project were to: 10 draft a review of the biology of retinoid signalling pathway, 11 describe retinoid-mediated effects on various organ systems, 12 identify relevant retinoid in vitro and ex vivo assays that measure mechanistic 13 effects of chemicals for development, and 14 Identify in vivo endpoints that could be added to existing test guidelines to 15 identify chemical effects on retinoid pathway signalling. 16 2. This DRP is intended to expand the recommendations for the retinoid pathway 17 included in the OECD Detailed Review Paper on the State of the Science on Novel In 18 vitro and In vivo Screening and Testing Methods and Endpoints for Evaluating 19 Endocrine Disruptors (DRP No 178). The retinoid signalling pathway was one of seven 20 endocrine pathways considered to be susceptible to environmental endocrine disruption 21 and for which relevant endpoints could be measured in new or existing OECD Test 22 Guidelines for evaluating endocrine disruption. Due to the complexity of retinoid 23 signalling across multiple organ systems, this effort was foreseen as a multi-step process.
    [Show full text]
  • Podocyte Specific Knockdown of Klf15 in Podocin-Cre Klf15flox/Flox Mice Was Confirmed
    SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure 1: Podocyte specific knockdown of Klf15 in Podocin-Cre Klf15flox/flox mice was confirmed. (A) Primary glomerular epithelial cells (PGECs) were isolated from 12-week old Podocin-Cre Klf15flox/flox and Podocin-Cre Klf15+/+ mice and cultured at 37°C for 1 week. Real-time PCR was performed for Nephrin, Podocin, Synaptopodin, and Wt1 mRNA expression (n=6, ***p<0.001, Mann-Whitney test). (B) Real- time PCR was performed for Klf15 mRNA expression (n=6, *p<0.05, Mann-Whitney test). (C) Protein was also extracted and western blot analysis for Klf15 was performed. The representative blot of three independent experiments is shown in the top panel. The bottom panel shows the quantification of Klf15 by densitometry (n=3, *p<0.05, Mann-Whitney test). (D) Immunofluorescence staining for Klf15 and Wt1 was performed in 12-week old Podocin-Cre Klf15flox/flox and Podocin-Cre Klf15+/+ mice. Representative images from four mice in each group are shown in the left panel (X 20). Arrows show colocalization of Klf15 and Wt1. Arrowheads show a lack of colocalization. Asterisk demonstrates nonspecific Wt1 staining. “R” represents autofluorescence from RBCs. In the right panel, a total of 30 glomeruli were selected in each mouse and quantification of Klf15 staining in the podocytes was determined by the ratio of Klf15+ and Wt1+ cells to Wt1+ cells (n=6 mice, **p<0.01, unpaired t test). Supplementary Figure 2: LPS treated Podocin-Cre Klf15flox/flox mice exhibit a lack of recovery in proteinaceous casts and tubular dilatation after DEX administration.
    [Show full text]
  • Table S1 the Four Gene Sets Derived from Gene Expression Profiles of Escs and Differentiated Cells
    Table S1 The four gene sets derived from gene expression profiles of ESCs and differentiated cells Uniform High Uniform Low ES Up ES Down EntrezID GeneSymbol EntrezID GeneSymbol EntrezID GeneSymbol EntrezID GeneSymbol 269261 Rpl12 11354 Abpa 68239 Krt42 15132 Hbb-bh1 67891 Rpl4 11537 Cfd 26380 Esrrb 15126 Hba-x 55949 Eef1b2 11698 Ambn 73703 Dppa2 15111 Hand2 18148 Npm1 11730 Ang3 67374 Jam2 65255 Asb4 67427 Rps20 11731 Ang2 22702 Zfp42 17292 Mesp1 15481 Hspa8 11807 Apoa2 58865 Tdh 19737 Rgs5 100041686 LOC100041686 11814 Apoc3 26388 Ifi202b 225518 Prdm6 11983 Atpif1 11945 Atp4b 11614 Nr0b1 20378 Frzb 19241 Tmsb4x 12007 Azgp1 76815 Calcoco2 12767 Cxcr4 20116 Rps8 12044 Bcl2a1a 219132 D14Ertd668e 103889 Hoxb2 20103 Rps5 12047 Bcl2a1d 381411 Gm1967 17701 Msx1 14694 Gnb2l1 12049 Bcl2l10 20899 Stra8 23796 Aplnr 19941 Rpl26 12096 Bglap1 78625 1700061G19Rik 12627 Cfc1 12070 Ngfrap1 12097 Bglap2 21816 Tgm1 12622 Cer1 19989 Rpl7 12267 C3ar1 67405 Nts 21385 Tbx2 19896 Rpl10a 12279 C9 435337 EG435337 56720 Tdo2 20044 Rps14 12391 Cav3 545913 Zscan4d 16869 Lhx1 19175 Psmb6 12409 Cbr2 244448 Triml1 22253 Unc5c 22627 Ywhae 12477 Ctla4 69134 2200001I15Rik 14174 Fgf3 19951 Rpl32 12523 Cd84 66065 Hsd17b14 16542 Kdr 66152 1110020P15Rik 12524 Cd86 81879 Tcfcp2l1 15122 Hba-a1 66489 Rpl35 12640 Cga 17907 Mylpf 15414 Hoxb6 15519 Hsp90aa1 12642 Ch25h 26424 Nr5a2 210530 Leprel1 66483 Rpl36al 12655 Chi3l3 83560 Tex14 12338 Capn6 27370 Rps26 12796 Camp 17450 Morc1 20671 Sox17 66576 Uqcrh 12869 Cox8b 79455 Pdcl2 20613 Snai1 22154 Tubb5 12959 Cryba4 231821 Centa1 17897
    [Show full text]
  • A Population-Based Study of Effects of Genetic Loci on Orofacial Clefts
    HHS Public Access Author manuscript Author ManuscriptAuthor Manuscript Author J Dent Res Manuscript Author . Author manuscript; Manuscript Author available in PMC 2017 October 01. Published in final edited form as: J Dent Res. 2017 October ; 96(11): 1322–1329. doi:10.1177/0022034517716914. A Population-Based Study of Effects of Genetic Loci on Orofacial Clefts L.M. Moreno Uribe1, T. Fomina2, R.G. Munger3, P.A. Romitti4, M.M. Jenkins5, H.K. Gjessing2,6, M. Gjerdevik2,6, K. Christensen7, A.J. Wilcox8, J.C. Murray9, R.T. Lie2,6,*, and G.L. Wehby10,* 1Department of Orthodontics and Dows Institute, College of Dentistry, University of Iowa, Iowa City, IA, USA 2Department of Global Public Health and Primary Care, University of Bergen, Bergen, Norway 3Department of Nutrition and Food Sciences, Utah State University, Logan, UT, USA 4Department of Epidemiology, College of Public Health, University of Iowa, Iowa City, IA, USA 5National Center on Birth Defects and Developmental Disabilities, Centers for Disease Control and Prevention, Atlanta, GA, USA 6Norwegian Institute of Public Health, Bergen and Oslo, Norway 7Department of Public Health, University of Southern Denmark; Department of Clinical Genetics and Department of Biochemistry and Pharmacology, Odense University Hospital, Odense, Denmark 8Epidemiology Branch, National Institute of Environmental Health Sciences, National Institutes of Health, Durham, NC, USA 9Department of Pediatrics, Carver College of Medicine, University of Iowa, Iowa City, IA, USA 10Departments of Health Management and Policy, Economics, and Preventive and Community Dentistry, and Public Policy Center, University of Iowa, Iowa City, IA, USA Abstract Prior genome-wide association studies for oral clefts have focused on clinic-based samples with unclear generalizability.
    [Show full text]
  • Supplemental Materials ZNF281 Enhances Cardiac Reprogramming
    Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7
    [Show full text]
  • 22 Ultra-Conserved Elements in Vertebrate and Fly Genomes Mathias Drton Nicholas Eriksson Garmay Leung
    22 Ultra-Conserved Elements in Vertebrate and Fly Genomes Mathias Drton Nicholas Eriksson Garmay Leung Ultra-conserved elements in an alignment of multiple genomes are consecutive nucleotides that are in perfect agreement across all the genomes. For aligned vertebrate and fly genomes, we give descriptive statistics of ultra-conserved elements, explain their biological relevance, and show that the existence of ultra-conserved elements is highly improbable in neutrally evolving regions. 22.1 The data Our analyses of ultra-conserved elements are based on multiple sequence align- ments produced by MAVID [Bray and Pachter, 2004]. Prior to the alignment of multiple genomes, homology mappings (from Mercator [Dewey, 2005]) group into bins genomic regions that are anchored together by neighboring homolo- gous exons. A multiple sequence alignment is then produced for each of these alignment bins. MAVID is a global multiple alignment program, and therefore homologous regions with more than one homologous hit to another genome may not be found aligned together. Table 22.1 shows an example of Merca- tor’s output for a single region along with the beginning of the resulting MAVID multiple sequence alignment. Species Chrom. Start End Alignment Dog chrX 752057 864487 + A----AACCAAA--------- Chicken chr1 122119382 122708162 − TGCTGAGCTAAAGATCAGGCT Zebrafish chr9 19018916 19198136 + ------ATGCAACATGCTTCT Pufferfish chr2 7428614 7525502 + ---TAGATGGCAGACGATGCT Fugufish asm1287 21187 82482 + ---TCAAGGG----------- Table 22.1. Mercator output for a single bin, giving the position and orientation on the chromosome. Notice that the Fugu fish genome has not been fully assembled into chromosomes (cf. Section 4.2). The vertebrate dataset consists of 10,279 bins over 9 genomes (Table 22.2).
    [Show full text]
  • Accompanies CD8 T Cell Effector Function Global DNA Methylation
    Global DNA Methylation Remodeling Accompanies CD8 T Cell Effector Function Christopher D. Scharer, Benjamin G. Barwick, Benjamin A. Youngblood, Rafi Ahmed and Jeremy M. Boss This information is current as of October 1, 2021. J Immunol 2013; 191:3419-3429; Prepublished online 16 August 2013; doi: 10.4049/jimmunol.1301395 http://www.jimmunol.org/content/191/6/3419 Downloaded from Supplementary http://www.jimmunol.org/content/suppl/2013/08/20/jimmunol.130139 Material 5.DC1 References This article cites 81 articles, 25 of which you can access for free at: http://www.jimmunol.org/content/191/6/3419.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists by guest on October 1, 2021 • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2013 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Global DNA Methylation Remodeling Accompanies CD8 T Cell Effector Function Christopher D. Scharer,* Benjamin G. Barwick,* Benjamin A. Youngblood,*,† Rafi Ahmed,*,† and Jeremy M.
    [Show full text]
  • Understanding Chronic Kidney Disease: Genetic and Epigenetic Approaches
    University of Pennsylvania ScholarlyCommons Publicly Accessible Penn Dissertations 2017 Understanding Chronic Kidney Disease: Genetic And Epigenetic Approaches Yi-An Ko Ko University of Pennsylvania, [email protected] Follow this and additional works at: https://repository.upenn.edu/edissertations Part of the Bioinformatics Commons, Genetics Commons, and the Systems Biology Commons Recommended Citation Ko, Yi-An Ko, "Understanding Chronic Kidney Disease: Genetic And Epigenetic Approaches" (2017). Publicly Accessible Penn Dissertations. 2404. https://repository.upenn.edu/edissertations/2404 This paper is posted at ScholarlyCommons. https://repository.upenn.edu/edissertations/2404 For more information, please contact [email protected]. Understanding Chronic Kidney Disease: Genetic And Epigenetic Approaches Abstract The work described in this dissertation aimed to better understand the genetic and epigenetic factors influencing chronic kidney disease (CKD) development. Genome-wide association studies (GWAS) have identified single nucleotide polymorphisms (SNPs) significantly associated with chronic kidney disease. However, these studies have not effectively identified target genes for the CKD variants. Most of the identified variants are localized to non-coding genomic regions, and how they associate with CKD development is not well-understood. As GWAS studies only explain a small fraction of heritability, we hypothesized that epigenetic changes could explain part of this missing heritability. To identify potential gene targets of the genetic variants, we performed expression quantitative loci (eQTL) analysis, using genotyping arrays and RNA sequencing from human kidney samples. To identify the target genes of CKD-associated SNPs, we integrated the GWAS-identified SNPs with the eQTL results using a Bayesian colocalization method, coloc. This resulted in a short list of target genes, including PGAP3 and CASP9, two genes that have been shown to present with kidney phenotypes in knockout mice.
    [Show full text]