DOCSLIB.ORG

Hemopoietic Progenitors + Differentiation of Human CD34

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Hemopoietic Progenitors + Differentiation of Human CD34 The Vitamin D3/Hox-A10 Pathway Supports MafB Function during the Monocyte Differentiation of Human CD34+ Hemopoietic Progenitors This information is current as of September 26, 2021. Claudia Gemelli, Claudia Orlandi, Tommaso Zanocco Marani, Andrea Martello, Tatiana Vignudelli, Francesco Ferrari, Monica Montanari, Sandra Parenti, Anna Testa, Alexis Grande and Sergio Ferrari J Immunol 2008; 181:5660-5672; ; Downloaded from doi: 10.4049/jimmunol.181.8.5660 http://www.jimmunol.org/content/181/8/5660 http://www.jimmunol.org/ References This article cites 70 articles, 23 of which you can access for free at: http://www.jimmunol.org/content/181/8/5660.full#ref-list-1 Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists by guest on September 26, 2021 • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2008 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology The Vitamin D3/Hox-A10 Pathway Supports MafB Function during the Monocyte Differentiation of Human CD34؉ Hemopoietic Progenitors1 Claudia Gemelli, Claudia Orlandi, Tommaso Zanocco Marani, Andrea Martello, Tatiana Vignudelli, Francesco Ferrari, Monica Montanari, Sandra Parenti, Anna Testa, Alexis Grande,2,3 and Sergio Ferrari2 Although a considerable number of reports indicate an involvement of the Hox-A10 gene in the molecular control of hemopoiesis, the conclusions of such studies are quite controversial given that they support, in some cases, a role in the stimulation of stem cell self-renewal and myeloid progenitor expansion, whereas in others they implicate this transcription factor in the induction of monocyte-macrophage differentiation. To clarify this issue, we analyzed the biological effects and the transcriptome changes Downloaded from determined in human primary CD34؉ hemopoietic progenitors by retroviral transduction of a full-length Hox-A10 cDNA. The results obtained clearly indicated that this homeogene is an inducer of monocyte differentiation, at least partly acting through the up-regulation of the MafB gene, recently identified as the master regulator of such a maturation pathway. By using a combined approach based on computational analysis, EMSA experiments, and luciferase assays, we were able to demonstrate the presence of a Hox-A10-binding site in the promoter region of the MafB gene, which suggested the likely molecular mechanism underlying http://www.jimmunol.org/ the observed effect. Stimulation of the same cells with the vitamin D3 monocyte differentiation inducer resulted in a clear increase of Hox-A10 and MafB transcripts, indicating the existence of a precise transactivation cascade involving vitamin D3 receptor, Hox-A10, and MafB transcription factors. Altogether, these data allow one to conclude that the vitamin D3/Hox-A10 pathway supports MafB function during the induction of monocyte differentiation. The Journal of Immunology, 2008, 181: 5660–5672. lthough hemopoiesis is a complex process, it can be in the molecular control of hemopoietic cell differentiation and the schematically divided into two sequential steps. In the so-called master or key regulators, which are by themselves able to initial commitment or lineage decision phase, multipo- promote the lineage commitment of pluripotent HSCs or the lin- A 4 tent hemopoietic stem cells (HSC) undergo a gradual restriction eage switching of already committed progenitors (5, 6). Additional by guest on September 26, 2021 of their differentiation potential, eventually resulting in the pro- properties of such regulators are also represented by the capacity to duction of unipotent hemopoietic progenitors/precursors (1, 2). inhibit the commitment toward alternative maturation lineages and During the subsequent terminal differentiation phase, these last the ability to transactivate and cooperate other transcription factors cells give rise to all the mature blood cells, characterized by dif- controlling the same differentiation lineage (7). Knockout and ferent phenotypes and specialized functions (1, 3, 4). Spontaneous transgenic mouse experiments have allowed the identification of a or exogenously induced up-regulation of transcription factors is large number in this last category of transcription factors, the most the mechanism that is generally invoked to explain the commit- important being represented by Pax-5 for B lymphopoiesis, ment of HSCs and the subsequent maturation of committed pro- GATA-1 for erythroid differentiation, PU-1 for early myeloid genitors (5, 6). In this regard, a clear distinction has been estab- commitment, and C/EBP␣ for granulocyte maturation (6). An ad- lished between transcription factors that are generically involved ditional method to characterize these master regulators in human hemopoiesis is represented by the viral transduction of the inves- ϩ Department of Biomedical Sciences, University of Modena and Reggio Emilia, Mo- tigated transcription factor in leukemic cell lines and CD34 he- dena, Italy mopoietic progenitors (8, 9) or, alternatively, by the stimulation of Received for publication August 10, 2007. Accepted for publication August 7, 2008. these cells with soluble compounds that are able to modulate dif- The costs of publication of this article were defrayed in part by the payment of page ferentiation genetic programs (10–12). Data obtained using this charges. This article must therefore be hereby marked advertisement in accordance approach provided a clear and definitive demonstration of the cru- with 18 U.S.C. Section 1734 solely to indicate this fact. cial role played by VDR and MafB transcription factors in the 1 This work was supported by a grant from Associazione Italiana per la Ricerca sul Cancro (2006) and from Ministero dell’Universita`e della Ricerca Scientifica e Tech- molecular control of monocyte-macrophage differentiation (8, 10). ϩ nologica-Cofin (2007). C.G. is a fellow of the Ergentech Laboratory of Genetics and In fact: 1) stimulation of cord blood CD34 stem/progenitor cells Biotechnology. ␣ with physiological levels of 1 ,25-dihydroxyvitamin D3 (VD) 2 These authors share the senior authorship of this investigation. leads to a massive induction of such differentiation, which is me- 3 Address correspondence and requests for reprints to Dr. Alexis Grande, Dipartimento di diated by its genomic VDR-dependent intracellular pathway (10); Scienze Biomediche, Sezione di Chimica Biologica, Universita` di Modena e Reggio Emilia, Via Campi 287, 41100 Modena, Italy. E-mail address: [email protected] and 2) retroviral transduction of MafB in the same cells results in a comparable effect (8). A further, although controversial, regula- 4 Abbreviations used in this paper: HSC, hemopoietic stem cells; VD, 1␣,25-dihy- droxyvitamin D3; HRE, Hox response element; NGFR, nerve growth factor receptor; tor of human monocytopoiesis is represented by the Hox-A10 tran- ⌬LNGFR, low-affinity NGFR; QRT-PCR, quantitative real-time RT-PCR; SLR, sig- scription factor. It is well known that Hox genes, originally iden- nal log ratio; CTS, cathepsin; NE, nuclear extract. tified as key regulators of embryonic development, also play a Copyright © 2008 by The American Association of Immunologists, Inc. 0022-1767/08/$2.00 fundamental role in normal and leukemic hemopoiesis, controlling www.jimmunol.org The Journal of Immunology 5661 both self-renewal and commitment-differentiation processes (13, Table I. Oligodeoxynucleotides used in RT-PCR reactions and in 14). In this regard, a number of reports indicate an involvement of Hox-A10 cDNA cloninga the Hox-A10 gene in the regulation of monocyte commitment that is fundamentally based on three experimental observations. First, Oligomers Nucleotide Sequence (5Ј-3Ј) ϩ Hox-A10 expression is restricted to the CD34 progenitor and my- HOXA10 DP TCCCACAACAATGTCATGCTCGGAGAG eloid precursor phase of hemopoiesis (15); secondly, this gene is a HOXA10 RP ACCGCGTCGCCTGGAGATTCATCAG primary response gene of the VD monocyte differentiation inducer MAFB DP GCTCCGGCCGGCCGCAAAGTTTCCC (16, 17); and finally, retroviral vector-mediated expression of its MAFB RP2 GGCGGCGGCGACGCTTGGTGA GCTCATCGTGGGCAGCTCTC cDNA induces the monocyte differentiation of U937 (16) and CD11b DP ϩ CD11b RP GCGACGGGAAGTCCCACTTCT CD34 hemopoietic progenitors (18) inhibiting, at the same time, CD163 DP GGAGCTGAGGCTAGTGGATG the commitment to lymphoid, erythroid, and granulocyte lineages CD163 RP CCTTGATGTTTGCAGTTCCAG (19). Despite this, a microarray study performed on CD34ϩ cells IL-1␤ DP ATGGCAGAAGTACCTAAGCTCGC ␤ retrovirally transduced with Hox-A10 disclosed the up-regulation IL-1 RP ACACAAATTGCATGGTGAAGTCAGTT IL7R DP ATGCACGATGTAGCTTACCGCCA of genes belonging to the Wnt pathway, suggesting a role in the IL7R RP TCTGGAGTGATGACTACATCCTC regulation of HSC self renewal (20). Similarly, in a distinct report, CD115 DP CAAGACAAACAGCCAGTGCAGA transplantation of Hox-A10-transduced CD34ϩ cells in NOD/
Load more

Recommended publications
  • Core Transcriptional Regulatory Circuitries in Cancer
    Oncogene (2020) 39:6633–6646 https://doi.org/10.1038/s41388-020-01459-w REVIEW ARTICLE Core transcriptional regulatory circuitries in cancer 1 1,2,3 1 2 1,4,5 Ye Chen ● Liang Xu ● Ruby Yu-Tong Lin ● Markus Müschen ● H. Phillip Koeffler Received: 14 June 2020 / Revised: 30 August 2020 / Accepted: 4 September 2020 / Published online: 17 September 2020 © The Author(s) 2020. This article is published with open access Abstract Transcription factors (TFs) coordinate the on-and-off states of gene expression typically in a combinatorial fashion. Studies from embryonic stem cells and other cell types have revealed that a clique of self-regulated core TFs control cell identity and cell state. These core TFs form interconnected feed-forward transcriptional loops to establish and reinforce the cell-type- specific gene-expression program; the ensemble of core TFs and their regulatory loops constitutes core transcriptional regulatory circuitry (CRC). Here, we summarize recent progress in computational reconstitution and biologic exploration of CRCs across various human malignancies, and consolidate the strategy and methodology for CRC discovery. We also discuss the genetic basis and therapeutic vulnerability of CRC, and highlight new frontiers and future efforts for the study of CRC in cancer. Knowledge of CRC in cancer is fundamental to understanding cancer-specific transcriptional addiction, and should provide important insight to both pathobiology and therapeutics. 1234567890();,: 1234567890();,: Introduction genes. Till now, one critical goal in biology remains to understand the composition and hierarchy of transcriptional Transcriptional regulation is one of the fundamental mole- regulatory network in each specified cell type/lineage.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Discovering Differences in Gender-Related Skeletal Muscle Aging Through the Majority Voting-Based Identification of Differently Expressed Genes
    Northumbria Research Link Citation: Dreder, Abdouladeem, Tahir, Muhammad, Seker, Huseyin and Anwar, Naveed (2016) Discovering differences in gender-related skeletal muscle aging through the majority voting-based identification of differently expressed genes. International Journal on Bioinformatics & Biosciences, 6 (2). pp. 1-14. ISSN 1839-9614 Published by: WSP URL: http://wireilla.com/papers/ijbb/V6N2/6216ijbb01.pd... <http://wireilla.com/papers/ijbb/V6N2/6216ijbb01.pdf> This version was downloaded from Northumbria Research Link: http://nrl.northumbria.ac.uk/id/eprint/27774/ Northumbria University has developed Northumbria Research Link (NRL) to enable users to access the University’s research output. Copyright © and moral rights for items on NRL are retained by the individual author(s) and/or other copyright owners. Single copies of full items can be reproduced, displayed or performed, and given to third parties in any format or medium for personal research or study, educational, or not-for-profit purposes without prior permission or charge, provided the authors, title and full bibliographic details are given, as well as a hyperlink and/or URL to the original metadata page. The content must not be changed in any way. Full items must not be sold commercially in any format or medium without formal permission of the copyright holder. The full policy is available online: http://nrl.northumbria.ac.uk/policies.html This document may differ from the final, published version of the research and has been made available online in accordance with
    [Show full text]
  • Retinoic Acid-Related Orphan Receptor Rorβ, Circadian Rhythm Abnormalities and Tumorigenesis (Review)
    INTERNATIONAL JOURNAL OF MOLECULAR MEDICINE 35: 1493-1500, 2015 Retinoic acid-related orphan receptor RORβ, circadian rhythm abnormalities and tumorigenesis (Review) SHUJIONG FENG1, SONG XU1, ZHENZHEN WEN1 and YONGLIANG ZHU1,2 1Laboratory of Gastroenterology, The Second Affiliated Hospital of Zhejiang University, School of Medicine; 2Cancer Institute and Education Ministry Key Laboratory of Cancer Prevention and Intervention, Zhejiang University School of Medicine, Hangzhou, Zhejiang 310009, P.R. China Received August 8, 2014; Accepted March 12, 2015 DOI: 10.3892/ijmm.2015.2155 Abstract. Nuclear receptors are a superfamily of transcription and have important physiological functions in cell develop- factors including the steroid hormone receptors, non-steroid ment and differentiation, circadian rhythm, metabolism and hormone receptors and the orphan nuclear receptor family. immune regulation. NRs consist of three components: the Retinoic acid-related orphan receptor (ROR)β, as a member of steroid hormone receptors, non-steroid hormone receptors the orphan nuclear receptor family, plays an important regula- and the orphan nuclear receptor family. Steroid and non- tory role in the maintenance of a variety of physiological and steroid hormone receptors have specific ligands, including pathological processes. RORβ has been determined to act as steroid hormones, thyroid hormones, retinoic acids and fatty an osteogenic repressor in regulating bone formation, and is acids. Ligands for orphan NRs have not yet been determined. involved in regulating circadian rhythm. The findings of recent Retinoic acid-related orphan receptors (RORs), also known studies concerning the association between tumorigenesis as nuclear receptor subfamily 1 group F members (NR1F), and circadian rhythm have shown that an aberrant circadian are specified by gene sequences, which are homologous to rhythm may promote tumorigenesis and tumor progression.
    [Show full text]
  • A Three-Dimensional Organoid Model Recapitulates Tumorigenic Aspects
    www.nature.com/scientificreports OPEN A three-dimensional organoid model recapitulates tumorigenic aspects and drug responses of Received: 22 June 2018 Accepted: 10 October 2018 advanced human retinoblastoma Published: xx xx xxxx Duangporn Saengwimol1, Duangnate Rojanaporn2, Vijender Chaitankar3, Pamorn Chittavanich4, Rangsima Aroonroch5, Tatpong Boontawon4, Weerin Thammachote4, Natini Jinawath4, Suradej Hongeng6 & Rossukon Kaewkhaw4 Persistent or recurrent retinoblastoma (RB) is associated with the presence of vitreous or/and subretinal seeds in advanced RB and represents a major cause of therapeutic failure. This necessitates the development of novel therapies and thus requires a model of advanced RB for testing candidate therapeutics. To this aim, we established and characterized a three-dimensional, self-organizing organoid model derived from chemotherapy-naïve tumors. The responses of organoids to drugs were determined and compared to relate organoid model to advanced RB, in terms of drug sensitivities. We found that organoids had histological features resembling retinal tumors and seeds and retained DNA copy-number alterations as well as gene and protein expression of the parental tissue. Cone signal circuitry (M/L+ cells) and glial tumor microenvironment (GFAP+ cells) were primarily present in organoids. Topotecan alone or the combined drug regimen of topotecan and melphalan efectively targeted proliferative tumor cones (RXRγ+ Ki67+) in organoids after 24-h drug exposure, blocking mitotic entry. In contrast, methotrexate showed the least efcacy against tumor cells. The drug responses of organoids were consistent with those of tumor cells in advanced disease. Patient-derived organoids enable the creation of a faithful model to use in examining novel therapeutics for RB. Retinoblastoma (RB) is a serious childhood retinal tumor that, if lef untreated, can cause death within 1–2 years.
    [Show full text]
  • Photoreceptor Cell Fate Specification in Vertebrates Joseph A
    © 2015. Published by The Company of Biologists Ltd | Development (2015) 142, 3263-3273 doi:10.1242/dev.127043 REVIEW Photoreceptor cell fate specification in vertebrates Joseph A. Brzezinski1 and Thomas A. Reh2,* ABSTRACT specification of photoreceptor fate (see Glossary, Box 1) remains Photoreceptors – the light-sensitive cells in the vertebrate retina – a fascinating and unresolved problem in developmental biology. have been extremely well-characterized with regards to their Diseases that affect the genesis, survival or function of biochemistry, cell biology and physiology. They therefore provide an photoreceptors are major causes of vision loss (Swaroop et al., excellent model for exploring the factors and mechanisms that drive 2010) (Box 2). With recent increases in the prospect of regenerative neural progenitors into a differentiated cell fate in the nervous system. therapies to reverse vision loss, interest in uncovering the As a result, great progress in understanding the transcriptional mechanisms that govern photoreceptor development has grown. network that controls photoreceptor specification and differentiation In this Review, we first provide an overview of retinal has been made over the last 20 years. This progress has also development. This topic has been discussed in many recent enabled the production of photoreceptors from pluripotent stem reviews (Agathocleous and Harris, 2009; Brzezinski and Reh, cells, thereby aiding the development of regenerative medical 2010; Bassett and Wallace, 2012; Xiang, 2013; Boije et al., 2014; approaches to eye disease. In this Review, we outline the signaling Cepko, 2014) and is covered only briefly here. We then discuss the and transcription factors that drive vertebrate photoreceptor current model of photoreceptor development that has emerged from development and discuss how these function together in gene over 25 years of studies on retinogenesis.
    [Show full text]
  • MAFB Promotes Cancer Stemness and Tumorigenesis in Osteosarcoma Through a Sox9-Mediated Positive Feedback Loop
    Author Manuscript Published OnlineFirst on March 31, 2020; DOI: 10.1158/0008-5472.CAN-19-1764 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. MAFB promotes cancer stemness and tumorigenesis in osteosarcoma through a Sox9-mediated positive feedback loop Yanyan Chen1,†, Bin Wang2, †, Mengxi Huang1, †, Tao Wang 2, †, Chao Hu 3,†, Qin Liu 2, Dong Han 4, Cheng Chen1, Junliang Zhang5, Zhiping Li4, Chao Liu 6, Wenbin Lei 7,Yue Chang1, Meijuan Wu1,Dan Xiang1, Yitian Chen1, Rui Wang1, Weiqian Huang5, Zengjie Lei1 ,* and Xiaoyuan Chu1, * 1 Department of Medical Oncology, Affiliated Jinling Hospital, Medical School of Nanjing University, Nanjing, Jiangsu Province, People’s Republic of China 2 Department of Gastroenterology, Daping Hospital, Third Military Medical University (Ar- my Medical University), Chongqing, People’s Republic of China 3 Department of Orthopedics, 904 Hospital of PLA, North Xingyuan Road, Beitang Dis- trict, Wuxi, Jiangsu, People’s Republic of China 4 Department of Medical Oncology, Jinling Hospital, Nanjing Clinical School of Southern Medical University, Nanjing, Jiangsu Province, People’s Republic of China 5 Department of Orthopedics, Affiliated Jinling Hospital, Medical School of Nanjing Univer- sity, Nanjing, Jiangsu Province, People’s Republic of China 6 Department of Medical Oncology, Jinling Hospital, Nanjing Clinical School of Nanjing Medical University, Nanjing, Jiangsu Province, People’s Republic of China 7Department of Orthopedics, Tianshui Cooperation of Chinese and Western Medicine Hospi- tal, Tianshui, Gansu Province, People’s Republic of China * To whom correspondence should be addressed. Xiaoyuan Chu, Tel: +86-25-80860131, Fax: +86-25-80860131, Email: [email protected]; Zengjie Lei, Email: leiz- [email protected] ; †The authors wish it to be known that, in their opinion, the first five authors should be regard- ed as joint First Authors.
    [Show full text]
  • Two Transcription Factors Can Direct Three Photoreceptor Outcomes from Rod Precursor Cells in Mouse Retinal Development
    11118 • The Journal of Neuroscience, August 3, 2011 • 31(31):11118–11125 Development/Plasticity/Repair Two Transcription Factors Can Direct Three Photoreceptor Outcomes from Rod Precursor Cells in Mouse Retinal Development Lily Ng,1 Ailing Lu,1 Alok Swaroop,1 David S. Sharlin,1 Anand Swaroop,2 and Douglas Forrest1 1NIDDK, Clinical Endocrinology Branch, and 2NEI, Neurobiology, Neurodegeneration and Repair Laboratory, National Institutes of Health, Bethesda, Maryland 20892-1772 The typical mammalian visual system is based upon three photoreceptor types: rods for dim light vision and two types of cones (M and S) for color vision in daylight. However, the process that generates photoreceptor diversity and the cell type in which diversity arises remain unclear. Mice deleted for thyroid hormone receptor ␤2 (TR␤2) and neural retina leucine zipper factor (NRL) lack M cones and rods, respectively, but gain S cones. We therefore tested the hypothesis that NRL and TR␤2 direct a common precursor to a rod, M cone, or S cone outcome using Nrl b2/b2 “knock-in” mice that express TR␤2 instead of NRL from the endogenous Nrl gene. Nrl b2/b2 mice lacked rods and produced excess M cones in contrast to the excess S cones in Nrl Ϫ/Ϫ mice. Notably, the presence of both factors yielded rods in Nrl ϩ/ b2 mice. The results demonstrate innate plasticity in postmitotic rod precursors that allows these cells to form three functional photoreceptor types in response to NRL or TR␤2. We also detected precursor cells in normal embryonic retina that transiently coex- pressedNrlandTR␤2,suggestingthatsomeprecursorsmayoriginateinaplasticstate.TheplasticityoftheprecursorsrevealedinNrl b2/b2 mice suggests that a two-step transcriptional switch can direct three photoreceptor fates: first, rod versus cone identity dictated by NRL, and second, if NRL fails to act, M versus S cone identity dictated by TR␤2.
    [Show full text]
  • Cell Cycle–Specific and Cell Type–Specific Expression of Rb in The
    Cell Cycle–Specific and Cell Type–Specific Expression of Rb in the Developing Human Retina Thomas C. Lee,1,2,3 Dena Almeida,1,2 Nidia Claros,1,2 David H. Abramson,2,4 and David Cobrinik1,2 PURPOSE. To define the pattern of Rb expression relative to cell type and developmental stage in which Rb functions have not cycle position and cell type in the developing human retina. been defined.4,5 METHODS. Cryosections of fetal week 11-18 retinas were immu- The human retina begins its development at Fwk 5 and nostained for Rb and cell cycle– or cell type–specific markers. initially consists of proliferating retinal progenitor cells (RPCs) within a neuroblastic layer (NBL).6 RPC nuclei undergo a cell RESULTS. Rb was prominent in retinal progenitor cells (RPCs) cycle–dependent migration within the NBL, in which mitotic expressing the cyclin D1, cyclin A, and cytoplasmic cyclin B nuclei are positioned at the ventricular (outermost) layer, S markers of G1, S, and early to mid G2 phases, but not in RPCs phase nuclei are located in the middle NBL, and G1 and G2 expressing the phosphohistone H3 marker of late G2 and M. Rb nuclei migrate between these positions.7,8 Mitotic RPCs may was not detected in the earliest postmitotic ganglion, ama- give rise to additional RPCs or to postmitotic precursors of crine, horizontal, and bipolar cell precursors migrating away each of the mature retinal cell types, with the fate influenced from the ventricular layer, but was detected as such cells by cell-intrinsic competence states and by extrinsic cues.9 underwent further differentiation.
    [Show full text]
  • Understanding Gene Regulatory Mechanisms of Mouse Immune Cells Using a Convolutional Neural Network
    Understanding gene regulatory mechanisms of mouse immune cells using a convolutional neural network by Alexandra Maslova B.Sc. Physics, The University of British Columbia, 2013 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE in The Faculty of Graduate Studies (Bioinformatics) THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver) April 2020 c Alexandra Maslova 2019 The following individuals certify that they have read, and recommend to the Faculty of Graduate and Postdoctoral Studies for acceptance, the thesis entitled: Understanding gene regulatory mechanisms of mouse immune cells using a convolutional neural network submitted by Alexandra Maslova in partial fulfillment of the requirements for the degree of Master of Science in Bioinformatics. Examining Committee: Sara Mostafavi, Statistics and Medical Genetics Supervisor Maxwell Libbrecht, Computing Science (Simon Fraser University) Supervisory Committee Member Elodie Portales-Casamar, Pediatrics Supervisory Committee Member Martin Hirst, Microbiology and Immunology Committee Chair ii Abstract Cell differentiation is controlled via complex interactions of genomic regu- latory sites such as promoters and enhancers that lead to precise cell type- specific patterns of gene expression through a process that is not yet well understood. Local chromatin accessibility at these sites is a requirement of regulatory activity, and is therefore an important component of the gene reg- ulation machinery. To understand how DNA sequence drives local chromatin accessibility within the context of immune cell differentiation, we examined a dataset of open chromatin regions (OCRs) derived with the ATAC-seq assay from 81 closely related mouse immune cell types. We trained a model that predicts local chromatin accessibility in each cell type based on DNA sequence alone, then analyzed the model to extract informative sequence features.
    [Show full text]
  • Procedures for the Endocrinologist
    PROCEDURES FOR THE ENDOCRINOLOGIST A Clinical Test Compendium PROCEDURES FOR THE ENDOCRINOLOGIST: A Clinical Test Compendium LabCorp provides the nation’s premier laboratory This compendium is intended as a resource for the services for the endocrinology specialist. Through endocrinologist and includes assays performed at the integration of regional laboratory testing and the LabCorp’s regional facilities as well as specialized expertise of Endocrine Sciences, a member of the testing from Endocrine Sciences. The procedures LabCorp Specialty Testing Group, LabCorp offers a listed are among the most commonly ordered by the full-service solution designed to enhance the care and endocrinology specialist. cost-effective treatment of patients. Contents Test Procedures and Ordering Information (Alphabetic List) . page 3 Endocrine Sciences . Specialized assays referred to Endocrine Sciences are identified in this compendium. The test numbers included here are for ordering testing through LabCorp only. Alternative test numbers are available for setting up service directly with Endocrine Sciences. Please ask your account representative for assistance. Specimen Requirements . Additional specimen types not listed in this compendium may be available for testing. For more information, please consult the electronic Directory of Services and Interpretive Guide at https://www.labcorp.com/wps/portal/provider/testmenu, LabCorp’s comprehensive menu of clinical procedures. Test Procedure Index by Disease State . page 14 Test Procedure Index by Disease State . The index was developed by LabCorp, Endocrine Sciences, and their clinical consultants. The information included here is provided for the convenience of clients. It is not comprehensive and is not intended to replace sound clinical judgment. Multiple Sample/Timed-specimen Testing .
    [Show full text]
  • 81964717.Pdf
    Developmental Biology 393 (2014) 195–208 Contents lists available at ScienceDirect Developmental Biology journal homepage: www.elsevier.com/locate/developmentalbiology Review The role of homeobox genes in retinal development and disease Jamie L. Zagozewski a,1, Qi Zhang b,1, Vanessa I. Pinto c, Jeffrey T. Wigle c,d, David D. Eisenstat a,c,e,n a Department of Medical Genetics, University of Alberta, Edmonton, AB, Canada T6G 2H7 b Department of Human Anatomy and Cell Science, University of Manitoba, Winnipeg, MB, Canada R3E 0J9 c Department of Biochemistry and Medical Genetics, University of Manitoba, Winnipeg, MB, Canada R3E 0J9 d Institute of Cardiovascular Sciences, St. Boniface Hospital Research Institute, Winnipeg, MB, Canada R2H 2A6 e Department of Pediatrics, University of Alberta, Edmonton, AB, Canada T6G 1C9 article info abstract Article history: Homeobox genes are an evolutionarily conserved class of transcription factors that are critical for Received 24 March 2014 development of many organ systems, including the brain and eye. During retinogenesis, homeodomain- Received in revised form containing transcription factors, which are encoded by homeobox genes, play essential roles in the 2 July 2014 regionalization and patterning of the optic neuroepithelium, specification of retinal progenitors and Accepted 8 July 2014 differentiation of all seven of the retinal cell classes that derive from a common progenitor. Home- Available online 15 July 2014 odomain transcription factors control retinal cell fate by regulating the expression of target genes Keywords: required for retinal progenitor cell fate decisions and for terminal differentiation of specific retinal cell Retina types. The essential role of homeobox genes during retinal development is demonstrated by the number Vertebrate of human eye diseases, including colobomas and anophthalmia, which are attributed to homeobox gene Homeobox mutations.
    [Show full text]