Hemopoietic Progenitors + Differentiation of Human CD34

Home , NRL (gene)

The Vitamin D3/Hox-A10 Pathway Supports MafB Function during the Monocyte Differentiation of Human CD34+ Hemopoietic Progenitors This information is current as of September 26, 2021. Claudia Gemelli, Claudia Orlandi, Tommaso Zanocco Marani, Andrea Martello, Tatiana Vignudelli, Francesco Ferrari, Monica Montanari, Sandra Parenti, Anna Testa, Alexis Grande and Sergio Ferrari

J Immunol 2008; 181:5660-5672; ; Downloaded from doi: 10.4049/jimmunol.181.8.5660 http://www.jimmunol.org/content/181/8/5660 http://www.jimmunol.org/ References This article cites 70 articles, 23 of which you can access for free at: http://www.jimmunol.org/content/181/8/5660.full#ref-list-1

Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists by guest on September 26, 2021

• Fast Publication! 4 weeks from acceptance to publication

*average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2008 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology

The Vitamin D3/Hox-A10 Pathway Supports MafB Function during the Monocyte Differentiation of Human CD34؉ Hemopoietic Progenitors1

Claudia Gemelli, Claudia Orlandi, Tommaso Zanocco Marani, Andrea Martello, Tatiana Vignudelli, Francesco Ferrari, Monica Montanari, Sandra Parenti, Anna Testa, Alexis Grande,2,3 and Sergio Ferrari2

Although a considerable number of reports indicate an involvement of the Hox-A10 gene in the molecular control of hemopoiesis, the conclusions of such studies are quite controversial given that they support, in some cases, a role in the stimulation of stem cell self-renewal and myeloid progenitor expansion, whereas in others they implicate this transcription factor in the induction of monocyte-macrophage differentiation. To clarify this issue, we analyzed the biological effects and the transcriptome changes Downloaded from determined in human primary CD34؉ hemopoietic progenitors by retroviral transduction of a full-length Hox-A10 cDNA. The results obtained clearly indicated that this homeogene is an inducer of monocyte differentiation, at least partly acting through the up-regulation of the MafB gene, recently identiﬁed as the master regulator of such a maturation pathway. By using a combined approach based on computational analysis, EMSA experiments, and luciferase assays, we were able to demonstrate the presence of a Hox-A10-binding site in the promoter region of the MafB gene, which suggested the likely molecular mechanism underlying http://www.jimmunol.org/ the observed effect. Stimulation of the same cells with the vitamin D3 monocyte differentiation inducer resulted in a clear increase of Hox-A10 and MafB transcripts, indicating the existence of a precise transactivation cascade involving vitamin D3 receptor,

Hox-A10, and MafB transcription factors. Altogether, these data allow one to conclude that the vitamin D3/Hox-A10 pathway supports MafB function during the induction of monocyte differentiation. The Journal of Immunology, 2008, 181: 5660–5672.

lthough hemopoiesis is a complex process, it can be in the molecular control of hemopoietic cell differentiation and the schematically divided into two sequential steps. In the so-called master or key regulators, which are by themselves able to initial commitment or lineage decision phase, multipo- promote the lineage commitment of pluripotent HSCs or the lin- A 4 tent hemopoietic stem cells (HSC) undergo a gradual restriction eage switching of already committed progenitors (5, 6). Additional by guest on September 26, 2021 of their differentiation potential, eventually resulting in the pro- properties of such regulators are also represented by the capacity to duction of unipotent hemopoietic progenitors/precursors (1, 2). inhibit the commitment toward alternative maturation lineages and During the subsequent terminal differentiation phase, these last the ability to transactivate and cooperate other transcription factors cells give rise to all the mature blood cells, characterized by dif- controlling the same differentiation lineage (7). Knockout and ferent phenotypes and specialized functions (1, 3, 4). Spontaneous transgenic mouse experiments have allowed the identification of a or exogenously induced up-regulation of transcription factors is large number in this last category of transcription factors, the most the mechanism that is generally invoked to explain the commit- important being represented by Pax-5 for B lymphopoiesis, ment of HSCs and the subsequent maturation of committed pro- GATA-1 for erythroid differentiation, PU-1 for early myeloid genitors (5, 6). In this regard, a clear distinction has been estab- commitment, and C/EBP␣ for granulocyte maturation (6). An ad- lished between transcription factors that are generically involved ditional method to characterize these master regulators in human hemopoiesis is represented by the viral transduction of the inves- ϩ Department of Biomedical Sciences, University of Modena and Reggio Emilia, Mo- tigated transcription factor in leukemic cell lines and CD34 he- dena, Italy mopoietic progenitors (8, 9) or, alternatively, by the stimulation of Received for publication August 10, 2007. Accepted for publication August 7, 2008. these cells with soluble compounds that are able to modulate dif- The costs of publication of this article were defrayed in part by the payment of page ferentiation genetic programs (10–12). Data obtained using this charges. This article must therefore be hereby marked advertisement in accordance approach provided a clear and definitive demonstration of the cru- with 18 U.S.C. Section 1734 solely to indicate this fact. cial role played by VDR and MafB transcription factors in the 1 This work was supported by a grant from Associazione Italiana per la Ricerca sul Cancro (2006) and from Ministero dell’Universitaè della Ricerca Scientifica e Tech- molecular control of monocyte-macrophage differentiation (8, 10). ϩ nologica-Cofin (2007). C.G. is a fellow of the Ergentech Laboratory of Genetics and In fact: 1) stimulation of cord blood CD34 stem/progenitor cells Biotechnology. ␣ with physiological levels of 1 ,25-dihydroxyvitamin D3 (VD) 2 These authors share the senior authorship of this investigation. leads to a massive induction of such differentiation, which is me- 3 Address correspondence and requests for reprints to Dr. Alexis Grande, Dipartimento di diated by its genomic VDR-dependent intracellular pathway (10); Scienze Biomediche, Sezione di Chimica Biologica, Universita` di Modena e Reggio Emilia, Via Campi 287, 41100 Modena, Italy. E-mail address: [email protected] and 2) retroviral transduction of MafB in the same cells results in a comparable effect (8). A further, although controversial, regula- 4 Abbreviations used in this paper: HSC, hemopoietic stem cells; VD, 1␣,25-dihydroxyvitamin D3; HRE, Hox response element; NGFR, nerve growth factor receptor; tor of human monocytopoiesis is represented by the Hox-A10 tran- ⌬LNGFR, low-affinity NGFR; QRT-PCR, quantitative real-time RT-PCR; SLR, sig- scription factor. It is well known that Hox genes, originally iden- nal log ratio; CTS, cathepsin; NE, nuclear extract. tified as key regulators of embryonic development, also play a Copyright © 2008 by The American Association of Immunologists, Inc. 0022-1767/08/$2.00 fundamental role in normal and leukemic hemopoiesis, controlling www.jimmunol.org The Journal of Immunology 5661 both self-renewal and commitment-differentiation processes (13, Table I. Oligodeoxynucleotides used in RT-PCR reactions and in 14). In this regard, a number of reports indicate an involvement of Hox-A10 cDNA cloninga the Hox-A10 gene in the regulation of monocyte commitment that is fundamentally based on three experimental observations. First, Oligomers Nucleotide Sequence (5Ј-3Ј) ϩ Hox-A10 expression is restricted to the CD34 progenitor and my- HOXA10 DP TCCCACAACAATGTCATGCTCGGAGAG eloid precursor phase of hemopoiesis (15); secondly, this gene is a HOXA10 RP ACCGCGTCGCCTGGAGATTCATCAG primary response gene of the VD monocyte differentiation inducer MAFB DP GCTCCGGCCGGCCGCAAAGTTTCCC (16, 17); and finally, retroviral vector-mediated expression of its MAFB RP2 GGCGGCGGCGACGCTTGGTGA GCTCATCGTGGGCAGCTCTC cDNA induces the monocyte differentiation of U937 (16) and CD11b DP ϩ CD11b RP GCGACGGGAAGTCCCACTTCT CD34 hemopoietic progenitors (18) inhibiting, at the same time, CD163 DP GGAGCTGAGGCTAGTGGATG the commitment to lymphoid, erythroid, and granulocyte lineages CD163 RP CCTTGATGTTTGCAGTTCCAG (19). Despite this, a microarray study performed on CD34ϩ cells IL-1␤ DP ATGGCAGAAGTACCTAAGCTCGC ␤ retrovirally transduced with Hox-A10 disclosed the up-regulation IL-1 RP ACACAAATTGCATGGTGAAGTCAGTT IL7R DP ATGCACGATGTAGCTTACCGCCA of genes belonging to the Wnt pathway, suggesting a role in the IL7R RP TCTGGAGTGATGACTACATCCTC regulation of HSC self renewal (20). Similarly, in a distinct report, CD115 DP CAAGACAAACAGCCAGTGCAGA transplantation of Hox-A10-transduced CD34ϩ cells in NOD/ CD115 RP GCAGACAGGGCAGTAGTGCGT SCID mice resulted in a proliferative expansion of the myeloid p21 DP AGTTCCTTGTGGAGCCGGAGCTGGG TCCAGGACTGCAGGCTTCCTGTGGG progenitor compartment (19). Both reports confirmed the previ- p21 RP GAPDH DP GAAGGTGAAGGTCGGAGTC ously reported inhibition of erythroid differentiation, whereas the GAPDH RP GAAGGCCATGCCAGTGAGCT Downloaded from former also claimed a down-regulation of monocyte-related genes a Oligonucleotide primers were synthesized by MWG Biotech. All the synthesized thus contradicting the previously mentioned data. This controversy oligomers were compared with the National Institutes of Health GenBank database is further complicated by the observation that transplantation of through the BLAST software to avoid homologies with other gene sequences. Hox-A10-transduced murine stem cells in recipient mice gives rise to an expansion of megakaryocyte progenitors, observed only in Ϫ8 vitro, and the appearance of acute myeloid leukemias in vivo (21). cells with VD was achieved by treatment with a 5 ϫ 10 M concentration http://www.jimmunol.org/ A recent report, based on a transgenic mouse model in which tran- of this nuclear hormone (Hoffman-Laroche). scription of the transgene is controlled through an inducible sys- Primary hemopoietic cells tem, indicated Hox-A10 expression levels as the crucial parameter ϩ able to determine different biological responses (22). In this study, Human CD34 hemopoietic stem-progenitor cells were purified from um- bilical cord blood samples as described (10, 23) and maintained in liquid a low/intermediate expression of the transgene was associated with culture for 2 wk. During the initial 5 days of culture, necessary for retro- increased self-renewal activity of HSCs, whereas a higher expres- viral transduction, these cells were seeded at a 5–10 ϫ 104/ml density in sion resulted in a remarkable inhibition of erythroid and IMDM (Euroclone) containing 10% human serum (BioWhittaker) and ear- megakaryocyte differentiation. Both the conditions led to increased ly-acting human hemopoietic cytokines: 50 ng/ml stem cell factor and Flt3 numbers of macrophages and neutrophils. Although some of these ligand, 20 ng/ml thrombopoietin, 10 ng/ml IL-6 and IL-3 (R&D Systems). by guest on September 26, 2021 The subsequent phase of culture was accomplished under similar condi- findings could be simply explained in terms of species specificity tions without thrombopoietin and in the presence of 20% FBS. These ex- of the biological actions promoted by the considered gene, the role perimental conditions normally promote a mixed granulomonocyte differ- exerted by Hox-A10 in the molecular regulation of hemopoiesis entiation of CD34ϩ cells that is generally achieved within 14 days from is, according to the previously cited literature data, quite plating (10, 24, 25). Treatment with VD was conducted with the same modalities of U937 cells. Myeloblasts, monoblasts, erythroblasts, and controversial. megakaryoblasts were generated by in vitro culture of cord blood CD34ϩ To better characterize this role we constructed a bicistronic ret- hemopoietic progenitors performed as already described (23, 25, 26). Nor- roviral vector expressing a full-length Hox-A10 cDNA and a trun- mal human monocytes, neutrophils, and eosinophils were selected from cated version of low-affinity nerve growth factor receptor Ficoll-separated PBMCs of adult samples and collected by immunomag- (⌬LNGFR) used as marker gene. The biological effects exerted by netic systems (8). Purity of isolated primary cell populations, determined by flow cytometry and morphological analysis (May-Gru¨nwald-Giemsa Hox-A10 on hemopoiesis were assessed, infecting the U937 mono- staining), always exceeded 95%. blastic cell line initially and primary CD34ϩ hemopoietic cells subsequently. Modulation of gene transcription determined in Retroviral vector construction and packaging these last cells by Hox-A10 overexpression was also evaluated by Construction of the LXI⌬N and LMafBI⌬N retroviral vectors have been means of the microarray methodology. The results obtained clearly already described (8). To obtained the LHoxA10I⌬N retroviral vector, a suggested that the analyzed transcription factor is an inducer of full-length Hox-A10 cDNA was generated by RT-PCR performed on total monocyte-macrophage differentiation at least partly acting through RNA extracted from U937 cells using Hox-A10 primers (Table I). PCR amplification was conducted using a proofreading thermostable DNA poly- the up-regulation of the MafB gene, recently indicated as master merase (Fast Start High Fidelity PCR System; Roche Diagnostics) and an regulator of such maturation pathway. Additional investigation annealing temperature of 60°C. The amplified fragment was then inserted based on computational analysis, EMSA experiments, and lucif- in the pCR2.1 TOPO T/A cloning vector (Invitrogen) generating the erase assays allowed the identification of a Hox-A10-binding site pCR2.1HoxA10 plasmid, where it was fully sequenced to exclude poly- merase-induced mutations. Hox-A10 cDNAs were then excised with in the promoter region of MafB, providing a plausible molecular EcoRI and cloned in the EcoRI site of LXI⌬N vector (27) resulting in the mechanism explaining the observed differentiation effect. construction of LHoxA10I⌬N retroviral vector. Packaging lines for the described construct were generated by transinfection in the ecotropic Phoe- nix and amphotropic GPϩenvAm12 cells, as previously described (25). Viral titers were assessed by flow cytometry analysis of ⌬LNGFR expres- Materials and Methods sion percentage upon infection of U937 cells and CD34ϩ hemopoietic Hemopoietic cell lines progenitors. K562, KG1a, KG1, KASUMI1, HL60, NB4, THP1, and U937 cell lines Hemopoietic cell transduction and NGFR purification were obtained from American Type Culture Collection and cultured in RPMI 1640 (Euroclone), supplemented with 10% heat-inactivated FBS U937 hemopoietic cell line was transduced by two to three cycles of in- (BioWhittaker) and 1 mM L-glutamine (Euroclone). Stimulation of U937 fection (4 h each) with viral supernatant in the presence of polybrene (8 5662 MafB IS A TARGET GENE OF VD/Hox-A10 SIGNALING PATHWAY

␮g/ml). CD34ϩ hemopoietic progenitors, preactivated for 48 h in liquid Plasmid expression vectors and cell transfection culture, were transduced by two cycles of infection (12 h each) with viral supernatant on retronectin-coated plates (10 ␮g/cm2). NGFR purification An overhang double-strand oligomer HRE1 probe, obtained by annealing Ј of transduced cells was performed after a 48-h post-transduction incubation single-strand oligonucleotides modified at the 5 end with the BamHI and using a purified mouse anti-human p75NGFR mAb and tiny FACS-compat- SalI restriction sites, was inserted into the BamHI/SalI-digested pT81Luc ible magnetic nanoparticles in a column-free magnetic system (EasySep vector generating the pT81LucHRE1 plasmid. Nucleotide sequence anal- Do-It-Your Self Selection Kit; Stem Cells Technologies) following the ysis of this plasmid demonstrated that HRE1 site had been inserted as manufacturer’s guidelines. single-copy oligomer. Hox-A10 cDNA was excised with EcoRI from pCR2.1HoxA10 construct and then inserted in the EcoRI site of pcDNA3 vector (Invitrogen), obtaining the pcDNA3HoxA10 construct. The Flow cytometric, cytochemical, and morphological analysis of pCMVFlagHox-A10 plasmid, coding for a N-terminal Flag-tagged Hox- differentiated hemopoietic cells A10 protein under the control of the CMV enhancer/promoter, was kindly ϩ provided by Prof. Fulvio Mavilio’s laboratory. HEK293T cells used in gel The extent of myeloid differentiation in transduced U937 and CD34 cells shift experiments were transiently transfected with 20 ␮gofthe was monitored by flow cytometric, cytochemical, and morphological anal- pCMVFlagHox-A10 vector using the calcium phosphate procedure. For ysis. Flow cytometry analysis of CD11b, CD14, and CD163 Ags was con- luciferase assays, transient transfection of HEK293T cells was conducted ducted as already described (8) using a Coulter Epics XL flow cytometer. in a 24-well plate with Lipofectamine 2000 (Invitrogen), using 200 ng of Cytochemical evaluation of specific chloroacetate esterase was performed pT81LucHRE1 reporter plasmid, 50 ng of pcDNA3HoxA10 expression using the naphthol AS-D chloroacetate (specific esterase) kit (Sigma- vector, 200 ng of pCMV␤-galactosidase (Clontech) to normalize for trans- Aldrich). Morphological analysis was accomplished on cytocentrifuged fection efficiency, and a carrier plasmid to maintain a total DNA concen- cell samples upon May-Gru¨nwald-Giemsa staining. tration of 800 ng. Mock-transfected HEK293T cells were used as control.

RNA purification, semiquantitative and quantitative RT-PCR Downloaded from Reporter gene assay Total RNA was extracted from the various analyzed cell populations by ϫ means of total RNA purification kits as recommended by the manufacturer Forty-eight hours after transfection, cells were washed twice in cold 1 (Qiagen). RNA integrity and concentration was then verified by the Bio- PBS, resuspended in lysis buffer (1% Triton X-100, 25 mM glycylglycine (pH 7.8), 15 mM MgSO4, 4 mM EDTA (pH 8), 1 mM DTT), and assayed Analyzer technique (Applied Biosystems). Semiquantitative RT-PCR anal- ␤ ysis was performed as previously described (28), using oligonucleotide for -galactosidase and luciferase expression. Luciferase measurements primers reported in Table I. Normalization of the amplified samples was were performed using a Lumat LB 9501 (Berthold) luminometer. Each

transfection was done in duplicate in the same experiment and luciferase http://www.jimmunol.org/ obtained by the GAPDH housekeeping gene (10). Results of a representa- Ϯ tive experiment of three performed were presented in each corresponding activities were represented as the mean SEM values of three independent ﬁgure. Quantitative real-time RT-PCR (QRT-PCR) was performed with an experiments. ABI PRISM 7900 sequence detection system (Applied Biosystems) as already described (8), amplifying GAPDH mRNA as endogenous control. Biotin-labeled transcription, GeneChip hybridization, and Statistical analysis of the QRT-PCR results was obtained using the Ϫ⌬⌬ microarray data analysis (2 Ct) method (29) which calculates relative changes in gene expression of the target gene normalized to the endogenous control and relative to a RNA pools (100 ng) of LXI⌬N- and LHoxA10I⌬N-transduced CD34ϩ calibrator sample. QRT-PCR reactions were performed on three indepen- Ϯ cells, obtained from three independent experiments, were converted in la- dent experiments and always presented as means SEM. beled cRNA according to the two-cycle protocol advised by Affymetrix.

cRNA has been used to hybridize Affymetrix HG-U133A GeneChip arrays by guest on September 26, 2021 Nuclear extract (NE) preparation and Western blot analysis as already described (23). Images obtained by scanning chips of untrans- duced and LXI⌬N- and LHoxA10I⌬N-transduced CD34ϩ cells were pro- NEs were conducted as previously described with minor modifications (10) cessed using GeneChip operating software. This software allows assign- and used either for gel shift experiments (see EMSA) or Western blot anal- ment of a detection (absent or present), to quantify mRNA expression ysis. The latter was performed as follows. Briefly, 20 ␮g of NEs of the levels in terms of a signal value and to attribute a change, increased, de- analyzed cell populations were loaded onto 10% SDS-PAGE and blotted as creased, or not changed to each transcript when comparing two analyzed described (10). Membrane was preblocked in blocking solution, supple- cell populations. Changes in the expression levels of the analyzed mRNAs, mented with 5% nonfat powdered milk (Roche Diagnostics) for 1 h at room observed comparing the considered sample (LHoxA10I⌬N-transduced temperature, and then incubated with a 1/200 dilution of goat polyclonal cells) to the baseline (LXI⌬N-transduced cells), were then expressed as anti-Hox-A10 (Santa Cruz Biotechnology), followed by a 1-h incubation at signal log ratio (SLR; fold change, 2SLR). The transcripts showing change room temperature with a secondary Ab anti-goat conjugated to HRP equal to increased, SLR Ն1, signal Ն100, and detection present were se- 1/3000 (Sigma-Aldrich). Expression of ␤-actin (Sigma-Aldrich) was also lected as increased; on the contrary, the transcripts showing change equal analyzed to normalize the amounts of NE loaded in the various lanes. to decreased, SLR ՅϪ1 and, in the baseline sample, signal Ն100 and Detection was conducted by using the BM chemiluminescence blotting detection present were selected as decreased. substrate (Roche Diagnostics). Results of a representative experiments of To identify similarities between gene expression profiles of Hox-A10- three performed were presented in each corresponding figure. transduced CD34ϩ progenitors and the transcriptome of other myeloid cells, we analyzed a wider dataset including data previously obtained in our ϩ EMSA laboratory (30) and concerning hemopoietic CD34 stem/progenitors, in vitro-differentiated precursors, HoxA-10-orMafB-transduced CD34ϩ The following single-strand oligomers and their complement, correspond- cells. Gene expression data were scaled to target intensity 150 using ing to putative Hox-A10-binding Hox response elements (HRE) 1 and 2, GeneChip operating software (Affymetrix). Gene expression profiles were were used as probes in gel shift assay: HRE1 probe: 5Ј-GCACTTTAT then analyzed using GeneSpring GX software version 7.3 (Agilent); per GCCTG-3Ј (spanning from Ϫ943 bp to Ϫ929 bp from transcriptional start chip and per gene normalization were achieved, respectively, dividing each site); HRE2 probe: 5Ј-TCTGCTTAATCGTTA-3Ј (spanning from Ϫ896 signal by the median of signals across the chip and the median of its values bp to Ϫ881 from transcriptional start site). Complementary oligonucleo- across samples. To remove genes that are not expressed or always ex- tides were annealed and 5Ј end labeled using [␥-32P]ATP (6000 Ci/mmol; pressed at low levels, normalized data were filtered using GeneSpring to GE Healthcare Europe) and T4 polynucleotide kinase (New England Bio- select transcripts detected as present according to MAS 5.0 absolute anal- labs) and purified with Microspin G-25 columns (GE Healthcare). The ysis algorithm in at least 10% of samples. Then genes, the normalized mobility shift reactions were conducted in gel shift buffer (10 mM Tris (pH expression levels of which were always between 0.5 and 2 across all of the

7.5), 50 mM KCl, 5 mM MgCl2, 1 mM EDTA, 20% glycerol, 1 mM DTT) samples, were filtered out. The gene list generated was used to perform supplemented with 1 ␮g of polydeoxyinosinic-polydeoxycytidylic, 1.0 ϫ unsupervised hierarchical clustering analysis, using Pearson correlation as 105 cpm of the indicated labeled probe, and 10 ␮g of NE, in a total volume a similarity measure and average linkage. Supervised analysis was subse- of 20 ␮l. Supershift was obtained by adding, to the gel shift mix, an anti- quently conducted to select genes differentially expressed among CD34ϩ Flag Ab (Sigma-Aldrich). Binding reactions were incubated at room tem- cells and myeloid precursors. With the use of GeneSpring GX software, perature for 30 min, resolved using a nondenaturing 4% polyacrylamide gel data were further filtered to select genes with 2-fold change difference in 0.5ϫTris-buffered EDTA, and prerun for1hatroom temperature. Fi- between CD34ϩ and at least one of the precursor cells contexts. The nally, the gel was fixed, vacuum dried, and exposed to x-ray films. selected gene list was then analyzed performing a one-way ANOVA The Journal of Immunology 5663 Downloaded from FIGURE 2. Expression of Hox-A10 mRNA and protein in retrovirally transduced and in VD-treated U937 cells. a, Schematic map of the LHoxA10I⌬N retroviral vector used to infect U937 cells. In this vector, the viral long terminal repeat (LTR) drives the expression of a bicistronic FIGURE 1. Hox-A10 expression in normal hemopoietic cell popula- transcript containing Hox-A10 cDNA and the ⌬LNGFR marker gene in- a tions and in leukemic cell lines. , Microarray analysis results showing the serted downstream of an internal ribosome entry site (IRES) sequence. levels of Hox-A10 expression in primary hemopoietic cell contexts: normal ␺ http://www.jimmunol.org/ ϩ ϩ Arrow, transcription start site; SD, splice donor; , packaging signal; SA, cord blood CD34 stem/progenitor cells; CD34 -derived erythroblasts, splice acceptor; A(n), polyadenylation site. b, RT-PCR analysis of Hox- megakaryoblasts, myeloblasts, and monoblasts; and adult peripheral blood A10 mRNA expression performed 7 days after infection in transduced and x y monocytes, neutrophils, and eosinophils. -axis, Sample populations; - NGFR-purified U937 cells. Western blot analysis of Hox-A10 protein ex- Hox-A10 b axis, signals of expression levels. , Expression levels of pression was performed 7 days postinfection on nuclear extracts of trans- Hox-A10 mRNA in hemopoietic cell lines, having different phenotypes, were duced/NGR-purified (c) and VD-treated (d) U937 cells. In b and c, U937 assessed by semiquantitative RT-PCR analysis. GAPDH mRNA was also am- cells infected with the empty vector (LXI⌬N) were used as control. The plified to normalize RNA amounts of the different analyzed samples. Agarose size of the detected protein is reported on the right; the analyzed samples gels stained with ethidium bromide are shown. The size of amplified gene are described at the top of each panel. Expression of ␤-actin was also fragments is reported on the right of each panel. analyzed to normalize the amounts of nuclear extract loaded in the various lanes. by guest on September 26, 2021

between the myeloid cell contexts (CD34ϩ and precursor cells) to identify differentially expressed genes: 1009 transcripts were selected ap- Biological effects promoted by retroviral Hox-A10 transduction plying Benjamini and Hochberg multiple testing correction and p value in U937 cells cutoff of 0.01. Data concerning these genes were used for per gene and On the basis of data described thus far, we initially overexpressed per chip hierarchical clustering analysis based on Pearson correlation and average linkage method. Expression profiles of cell populations Hox-A10 cDNA in the U937 hemopoietic cell line, due to its used for this analysis were retrieved from the publicly available monoblastic phenotype and responsivity to compounds inducing www.xlab.unimo.it/XLab/ExpDataView.php. monocyte-macrophage differentiation. For this purpose, we constructed the LHoxA10I⌬N retroviral vector expressing a Hox-A10 full-length cDNA and a truncated version of ⌬LNGFR, used as Results marker gene, in the context of a bicistronic transcript driven by the Endogenous expression of Hox-A10 gene in hemopoietic cells viral long terminal repeat (Fig. 2a). Biological effects promoted by Hox-A10 overexpression were always assessed by comparison To define the appropriate cell context in which the effect exerted with the LXI⌬N retroviral vector (empty vector), containing only by Hox-A10 in the commitment/differentiation process could be the marker gene, and all assays necessary to monitor such effects investigated, we analyzed the endogenous expression of this Hox were conducted on cells transduced with the mentioned vectors gene in primary cells and cell lines of the hemopoietic system. and purified for NGFR expression. Microarray data obtained in our laboratory using primary he- RT-PCR and Western blot analysis performed on transduced mopoietic cells evidenced that Hox-A10 mRNA is expressed in ϩ U937 cells evidenced that the retroviral transcript was regularly CD34 stem/progenitor cells, in myeloblasts, in monoblasts, and produced (Fig. 2b), and expression of the transgene at the protein to a lesser extent in megakaryoblasts, whereas it is completely level was comparable with that obtained upon VD stimulation, as absent in erythroblasts and in terminally differentiated cells, such demonstrated by densitometric analysis showing respectively a as granulocytes and monocytes (Fig. 1a). Accordingly, semiquan- 5.1- and 3.3-fold increase over the corresponding controls, i.e., titative RT-PCR analysis, performed in hemopoietic cell lines, re- “empty” vector for Hox-A10-transduced cells and untreated cells vealed that Hox-A10 is selectively expressed in early myeloblastic for VD stimulation, respectively (Fig. 2, c, lanes 1 and 2, and d, (KG1a, KG1) and monoblastic cell lines (Kasumi1, THP1, U937; lanes 1 and 3). Fig. 1b). These data globally suggest that Hox-A10 expression is A preliminary assessment of Hox-A10 differentiation capacity restricted to the myeloid progenitor/precursor compartment of was performed by flow cytometry analysis evidencing, in cells hemopoiesis. transduced with this transcription factor, a gradual increase of 5664 MafB IS A TARGET GENE OF VD/Hox-A10 SIGNALING PATHWAY

moglobin-aptoglobin complex, the CD115 Ag, receptor for the M- CSF, the IL-1␤ and IL-7R, previously detected at high levels in monocyte precursors (23), the MafB transcription factors (8) and the p21waf-1 growth arrest gene (Fig. 3c). Among the others, the induced expression of MafB appeared of particular interest due to the crucial role that this transcription factor plays in the molecular control of monocyte differentiation. In this regard it is worth un- derlining that QRT-PCR, performed on the same cell samples, confirmed this finding evidencing a 3.9 Ϯ 0.2 (mean Ϯ SEM) increase of MafB mRNA levels. Cell counts demonstrated that the induction of monocyte differentiation observed in Hox-A10-transduced cells was accompanied by a reduced proliferation activity given that the number of expansions in these cells averaged 6.9 vs 13.8 of control cells transduced with the empty vector (Fig. 3d). This observation was in agreement with the up-regulated expression of the p21waf-1 gene detected in Hox-A10-transduced cells (Fig. 3c). These results substantially confirm previous studies indicating

that retroviral transduction of Hox-A10 induces the monocyte dif- Downloaded from ferentiation of U937 cells. At the same time, they allowed us to sensibly enrich the list of monocyte-related genes up-regulated in this cell context by transduction with the analyzed transcription factor. http://www.jimmunol.org/ Differentiation effect observed in human CD34ϩ hemopoietic progenitors upon retroviral Hox-A10 transduction To confirm these data in a primary cell model, the retroviral vectors described thus far were used to transduce cord blood CD34ϩ hemopoietic stem/progenitor cells expanded in liquid culture (see Materials and Methods for details). The experimental plan adopted for these cells included a 48-h pre-activation period, a 24-h transduction conducted by two cycles of infection (12 h each), and a further 48-h post-transduction incubation that was immediately by guest on September 26, 2021 followed by NGFR purification. Myeloid differentiation was then monitored on transduced/NGFR-purified cells by a combination of immunophenotypic, cytochemical, and morphological analysis that were performed at day 14 of liquid culture. FIGURE 3. Differentiation effect promoted by Hox-A10 transduction in Transgene dosage analysis, performed in these cells by QRT- U937 cells. a, Histogram reporting the results of flow cytometry analysis of PCR, indicated that Hox-A10 mRNA was 25 Ϯ 4 (mean Ϯ SEM) the myeloid related CD11b Ag, measured as positivity percentage, in Hox- ϩ f u times more expressed in Hox-A10-transduced CD34 cells as A10 ( ) and empty vector ( )-transduced U937 cells. x-axis, Days post- ϩ transduction. y-axis, mean Ϯ SEM. b, Morphological analysis performed compared with VD-stimulated CD34 cells, i.e., the biological 14 days postinfection on empty vector and Hox-A10-transduced/NGFR pu- sample used in our experimental system as control for endogenous rified U937 cells. c, Semiquantitative RT-PCR analysis of a distinct panel Hox-A10 expression. Although this result is in apparent contrast of myeloid-related genes conducted under the same experimental condi- with that observed in U937 cells, it is substantially the conse- tions. Agarose gels stained with ethidium bromide are presented. Top, An- quence of a different basal mRNA endogenous levels of Hox-A10, alyzed cell populations; sides, investigated genes. Normalization of ampli- which is remarkably higher in hemopoietic cell lines (including fied RNA amounts was achieved by the GAPDH housekeeping gene. d, U937) as compared with primary hemopoietic cells (Ref. 15 and Histogram showing cell counts obtained in U937 cells transduced with data not shown). In addition, by using a sophisticated transgenic empty vector (LXI⌬N; Ⅺ) and Hox-A10 (LHox-A10I⌬N; E). x-axis, Days mouse model allowing an inducible expression of Hox-A10 in post-transduction. y-axis, mean Ϯ SEM obtained from three independent experiments. vivo, Magnusson et al. (22) have recently demonstrated that the monocytopoietic effect driven by this transcription factor is observed in a wide range of transgene expression levels up to ϳ500- CD11b expression that reached 33.8 Ϯ 0.5% positivity (mean Ϯ fold higher than endogenous controls. SEM) at day 7 post-infection (Fig. 3a), and by morphological anal- Flow cytometry analysis of Hox-A10-transduced cells revealed ysis indicating that these cells assumed a pro-monocytic phenotype an evident up-regulation of several monocyte specific surface (Fig. 3b). markers such as the CD14 and CD163 Ags. In a representative To provide additional evidence of such capacity, we also inves- experiment, reported in Fig. 4a, CD14 Ag reached a 44.4% posi- tigated, by means of semiquantitative RT-PCR, the induction at the tivity in Hox-A10-transduced cells vs 23.5% of control cells in- mRNA level of a number of myeloid differentiation markers se- fected with the empty vector. Similarly, these values appeared to lected on the basis of expression profiling data previously obtained be, respectively, 52.9 and 26.6% for the CD163 Ag (Fig. 4a). The in our laboratory (8, 23). Beside the already mentioned CD11b Ag, up-regulated expression of these surface Ags was also observed on these reactions also disclosed the up-regulation of other monocyte- mean fluorescence intensities varying from 20.7 to 44.6 for CD14 related genes, such as the CD163 Ag, scavenger receptor for he- and from 4.9 to 10.7 for CD163 (Fig. 4a). The Journal of Immunology 5665

Morphological analysis, performed on cytological specimens upon May-Gru¨nwald-Giemsa staining, confirmed the results of previous assays evidencing an enrichment of neutrophils and their immediate precursors in control cells and a clear increase of monocytes and macrophages among Hox-A10-transduced cells (Fig. 4c). Our phenotypic analysis consequently indicates that the induction of monocyte differentiation observed in Hox-A10-transduced CD34ϩ cells is accompanied by a parallel and remarkable inhibition of granulocyte differentiation. Gene expression profiling of Hox-A10-transduced CD34ϩ hemopoietic progenitors To characterize the genetic program underlying the observed differentiation capacity, we analyzed transcriptome changes induced by retroviral transduction of Hox-A10 in CD34ϩ hemopoietic progenitors using the Affymetrix microarray methodology. The expression profile determined in this cell background by Hox-A10 overexpression was, again, desumed by comparison with control

cells infected with the empty vector. All of the data have been Downloaded from deposited in the Gene Expression Omnibus MIAME-compliant public database at http://www.ncbi.nlm.nih.gov/geo and are acces- sible through GEO Series accession number GSE12396. Microarray analysis was conducted at the end of the transduction/NGFR puriﬁcation procedure (day 5 of liquid culture), there-

fore under experimental conditions in which the stem/progenitor http://www.jimmunol.org/ phenotype of analyzed cells was substantially maintained, as evidenced by the 70–80% positivity of CD34 Ag (data not shown). This experimental design allowed performance of mRNA expression profiling in the differentiation window in which, standing on our data, endogenous Hox-A10 is preferentially expressed. The results of this analysis disclosed the up-regulation of 167 genes and the down-regulation of 64 genes (SLR Նϩ 1 and ՅϪ1, respectively). Detailed analysis of the obtained expression profiles indicated that the majority of up-regulated genes could be classi- by guest on September 26, 2021 fied into the following functional categories: CD Ags; degradation enzymes; secretory proteins; surface receptors; cell cycle/apoptosis regulators; and transcription factors. In agreement with flow cytometry data, Hox-A10 transduction leaded to an increased mRNA expression of the CD14 and CD11b monocyte-related markers. More in general, virtually all up-regulated CD Ags have been previously detected on the monocyte/ macrophage surface where they mediate a variety of biological functions related to innate and specific immunity and particularly: FIGURE 4. Analysis of myeloid differentiation in Hox-A10-transduced cell adhesion and migration (CD9, CD11b, CD24, CD39, CD44, CD34ϩ cells. Representative experiment showing the results of flow cy- CD54, CD87); recognition and scavenging of inflammatory mol- tometry, cytochemical and morphological analysis performed at day 14 of ecules (CD14 and CD163); and Ag presentation and activation of liquid culture in CD34ϩ cells transduced with the empty vector (LXI⌬N, T cell-mediated immune responses (CD1a–e, CD83, CD85D) left) and with the Hox-A10 transcription factor (LHox-A10I⌬N, right). a, (Fig. 5). For a detailed description regarding expression pattern Flow cytometry analysis of CD14 (top) and CD163 (bottom) Ag expres- and biological functions of the above-mentioned CD Ags, see sion. Entities of surface Ag expression are shown inside the histograms in www.ncbi.nlm.nih.gov/prow. terms of positivity percentage and mean fluorescence intensity (MFI). b, ϩ Consistent with these findings, Hox-A10-transduced CD34 Cytochemical analysis of naphthol AS-D chloroacetate-specific esterase; c, morphological analysis, performed on May-Gru¨nwald-Giemsa staining, on cells also showed an increased expression of genes coding for cytocentrifuged specimens. proteins mediating degradation processes related to monocyte- macrophage activation and inflammation response. Among them we detected: 1) granule proteins, such as cathepsins (CTSB, CTSG, CTSL; Refs. 31–33), CPVL (34), and RNase 1 (33) all The effect that Hox-A10 overexpression was able to exert on involved in intracellular Ag degradation; 2) STX 12, a protein that, granulocyte differentiation was assessed by cytochemical analysis together with STX 7, is responsible for fusion of endosomes and of the chloroacetate-specific esterase. By using this assay, activity lysosomes with the phagosome, i.e., the intracellular compartment of the studied enzyme, indicated as mean Ϯ SEM, was detected in where phagocytic cells kill and degrade internalized foreign par- 52 Ϯ 5% of controls cells and only 8 Ϯ 2% of Hox-A10-trans- ticles (35); 3) MMP9 and MMP12, responsible for the remodeling duced cells (Fig. 4b). Again, the decrease of positivity percentage of extracellular matrix that is necessary for cell migration (36); 4) was coupled with a reduced staining score on single-reacting cells other enzymes such as PTGS2, catalyzing the first rate-limiting (Fig. 4b). step in the conversion of arachidonic acid to prostaglandins (37), 5666 MafB IS A TARGET GENE OF VD/Hox-A10 SIGNALING PATHWAY

PLA2G7, encoding for platelet activating factor acetylhydrolase (38), and HMOX1, involved in the cytoprotection against inﬂam- mation induced oxidative stress (39) (Fig. 5). Analyzing the secretory proteins and surface receptors categories, we could detect a number of up-regulated genes that are known to play a role in other aspects of innate immunity. In particular, inside the former we observed inﬂammatory cytokines (Ref. 40; IL-1␤, IL-8, TGF␤1) and molecules exerting a chemoat- tractant activity on monocytes/macrophages (chemokines, described in Ref. 41; galectin-3, described in Ref. 42), whereas the latter disclosed the presence of receptors involved in chemokine/ cytokine signaling (CCR5, described in Refs. 43 and 44; IL-1R1 and IL-1R2, described in Ref. 45), recognition and scavenging of bacterial products (TLR2, described in Ref. 46; MRC1, described in Ref. 47), and activation of monocytes (IFNGR, TNFRSF21, TREM1, IL1RN, all described in Ref. 33) (Fig. 5). The majority of transcription factors exhibiting an up-regulated expression in Hox-A10-transduced CD34ϩ cells have been already

implicated in monocyte-macrophage differentiation. In fact: 1) the Downloaded from Hox-A9 gene, localized upstream of the Hox-A10 gene on chromosome 7 (13), has been involved in the molecular pathogenesis of a subset of acute myeloid leukemias (48–50); 2) endogenous expression of MafB and MafF is remarkably induced during monocyte-macrophage differentiation of CD34ϩ hemopoietic progeni-

tors (23) and viral transduction of these cells with a MafB cDNA http://www.jimmunol.org/ induces a massive commitment toward the macrophage lineage (8); 3) c-jun determines a partial monocyte differentiation when transfected into hemopoietic cell lines (51) and is a recognized dimerization partner of Maf family proteins (52, 53); 4) expression of KLF4 (54), STAT4 (55), and NR4A2 (56) is normally induced in macrophages in response to inflammation stimuli. Analysis of cell cycle regulators revealed an increased mRNA expression of the GADD45B (57), CFLAR (57), BTG1 (58), and DUSP2 (59) growth arrest/proapoptotic gene and a clear down- by guest on September 26, 2021 regulation of universally recognized proliferation markers as the c-myc proto-oncogene (60) and cyclin A1 (CCNA1; Ref. 61) (Fig. 5). Down-regulated genes included a remarkable number of markers belonging to nonmonocytic differentiation lineages. Among them, we observed transcription factors (KLF1, GATA2, and NFE2), globin chains (␣, ␤, ␥), and surface Ags (glycophorin C), associated with erythroid differentiation (62, 63) and granule proteins related to neutrophil (ELA2B, RNase 2, CLC, PRG2, MPO; Ref. 64), eosinophil (EPX; Ref. 65) and basophil maturation (HDC; Refs. 66 and 67) (Fig. 5). These results are consistent with the biological effects observed in CD34ϩ cells upon retroviral transduction with Hox-A10 (see previous paragraph). More importantly, they confirm in a primary hemopoietic cell context our observation, previously obtained in U937 cells, indicating a capacity of the investigated transcription factor to up-regulate MafB expression. Similarly to the U937 cells, this finding was validated by QRT-PCR showing a 2.7 Ϯ 0.3 induction of MafB mRNA levels following Hox-A10 transduction of CD34ϩ cells. Altogether these data raise the possibility that MafB might be a direct target gene of Hox-A10.

FIGURE 5. Gene expression profile induced by Hox-A10 transduction classified in the following functional categories: CD Ags (light blue bars)-; in CD34ϩ hemopoietic stem/progenitor cells. Microarray analysis was per- degradation enzyme (purple bars)-; secretory proteins (black bars)-; surface formed at day 5 of liquid culture on CD34ϩ cells transduced with the receptors (green bars)-; transcription factors (blue bars)-; cell cycle-related LXI⌬N and with the LHoxA10I⌬N retroviral vectors and subsequently genes (gray bars)-; erythroid (red bars)-; and granulocyte (yellow bars)- purified for NGFR expression. Changes in gene expression were assessed associated genes. A list of selected mRNA induced by Hox-A10 is pre- by comparison between cells transduced with the two analyzed vectors and sented and indicated by gene symbols (complete/extended designation and reported on the x-axis of the shown histogram as SLR (fold change, 2SLR). description of each gene is available in the OMIM website). See Materials Up- and down-regulated genes (SLR Ն ϩ 1 and Յ-1, respectively) were and Methods for details. The Journal of Immunology 5667

Clustering analysis on expression profiles of human primary hemopoietic cells under different experimental conditions As already underlined in Introduction, it is to date still controversial whether Hox-A10 is implicated in hemopoietic stem and progenitor expansion or in the differentiation of specific hemopoietic lineages. To clarify this issue and to better understand the relationship existing between genetic programs activated by Hox- A10 and MafB upon transduction of CD34ϩ cells, we used GeneSpring software to perform a supervised hierarchical clustering analysis in which the expression profiles of such cell populations were compared with those of fresh CD34ϩ cells and CD34ϩ-derived normal monoblasts, myeloblasts, erythroblasts, and megakaryocytes. These samples were analyzed using a probe list containing all genes exhibiting a differential expression in the comparison among the CD34ϩ cells and the already-mentioned hemopoietic precursor populations. Results of this analysis, reported in Fig. 6 as Eisen map, allowed to distinguish several classes of samples corresponding to the various analyzed cell types. Examination of the condition tree and Downloaded from gene tree indicated that, as expected, MafB- and Hox-A10-transduced CD34ϩ cells clusterized with the monoblast cell populations (Fig. 6). Unsupervised hierarchical clustering analysis, performed on all expressed genes, confirmed this observation (data not shown). These data provided additional evidence sup- porting the involvement of Hox-A10 in the molecular control of http://www.jimmunol.org/ monocyte-macrophage differentiation.

Identification of a Hox-A10-binding site in the promoter region of MafB gene Molecular analysis of U937 and CD34ϩ cells transduced with Hox- A10 clearly indicated MafB as a possible direct target gene of the analyzed transcription factor. To verify this hypothesis, we assessed the extent of interspecies conservation in the 5Ј-flanking region of by guest on September 26, 2021 MafB gene using the UCSC Genome Browser (68). This preliminary analysis was based on the principle that sequence conservation frequently discloses the presence of relevant transcription regulatory elements. The results obtained revealed that the highest degree of conservation is observed in the region spanning from the Ϫ1000 to the ϩ1 nt, whereas sequence similarity exhibits a gradual decrease up to the Ϫ2000 nt and a substantial drop further upstream (Fig. 7a). For this reason, we fo- cused our attention on the 1-kb region placed immediately FIGURE 6. Hierarchical clustering analysis performed on expression upstream the transcription start site of the MafB gene. The pres- profiles of human primary hemopoietic cells under different experimental ence of Hox-binding sites within this region was then investigated conditions. Supervised clustering analysis was performed comparing the by a computational search of the TAAT and TTAT core motifs. gene expression profile of Hox-A10- and MafB-transduced CD34ϩ cells This approach resulted in the identification of two putative binding with a probe list containing all genes that are differentially expressed in the sites for Hox-A10, conventionally named HRE1 and -2, placed, differentiation transition of CD34ϩ cells to hemopoietic precursors (my- respectively, at position Ϫ934 and Ϫ886 nt inside highly con- eloblasts, monoblasts, erythroblasts, and megakaryoblasts). Results are served genomic regions (Fig. 7b). presented as an Eisen map. Analyzed cell populations are reported on the The capacity of Hox-A10 protein to bind these elements was bottom and are discriminated by a color bar. Top, Condition tree; left or- assessed by means of EMSA experiments for which we used dinate, gene tree. NEs of U937 cells under different treatment conditions and 14- mer double-strand oligonucleotide probes encompassing the formed using NE of HEK293T cells transiently transfected with two putative sites. Results of this assay, presented in Fig. 8a, the pCMVFlagHox-A10 plasmid expression vector, coding for showed that incubation of NE obtained from VD-treated or a Flag-tagged version of Hox-A10 protein. Under these exper- Hox-A10-transduced U937 cells with HRE1 oligonucleotide imental conditions, we were able to reproduce the shift complex probe generated an evident shift complex (Fig. 8, lanes 2 and 4) formed with HRE1 oligonucleotide probe (Fig. 8a, lane 3, bot- that was not observed using NE of untreated or empty vector- tom arrow). Incubation of the same sample with an anti-Flag Ab transduced U937 cells (Fig. 8, lanes 1 and 3). This complex was resulted in a mixed pattern of competition and supershift (Fig. on the contrary undetectable when EMSA was performed with 8a, lane 4, top arrow), indicating that the observed shift com- HRE2 oligonucleotide probe (not shown). To further character- plex actually contains Hox-A10 protein. ize the specificity of the shift complex observed with HRE1 To verify the capacity of the identified Hox-A10-binding site to oligonucleotide probe, we optimized a supershift assay per- activate gene transcription, the HRE1 oligonucleotide probe was 5668 MafB IS A TARGET GENE OF VD/Hox-A10 SIGNALING PATHWAY Downloaded from

FIGURE 7. Computational analysis of the promoter region of human MafB gene. a, Alignment and conservation diagram reporting the interspecies comparison of the human MafB genomic sequence spanning from

Ϫ2000 bp upstream to ϩ3378 bp downstream to the transcriptional start http://www.jimmunol.org/ site (chromosome 20: 38749500-38752500). The highest density of inter- ,ء .species conservation is indicated by histograms and the alignment net Position of the two putative Hox-A10 binding sites. b, Top, Schematic representation of the 1000 bp upstream of the transcription start site of MafB genomic region. By computational analysis, two different putative Hox-A10-binding sites (HRE1 and -2, f) were identified within the analyzed genomic region. Middle, Interspecies conservation of these sites. e, FIGURE 8. EMSA and luciferase assays performed to validate the iden- Hox-A10-binding site cores. Bottom, Nucleotide sequences of Hox-A10 tified putative Hox-A10-binding sites. a, Left, results of EMSA analysis putative recognition sites on the complementary strand are reported. performed on nuclear extracts obtained from untreated, VD-treated, empty by guest on September 26, 2021 X_ tropicalis, Xenopus tropicalis. vector-transduced (LXI⌬N), and Hox-A10-transduced (LHox-A10I⌬N) and NGFR-purified U937 cells. Based on the experiment presented in Fig. cloned in the pT81Luc plasmid, where it was placed upstream a 2, VD treatment was conducted for 24 h. The assay was performed by ␥ 32 minimal promoter and the luciferase reporter gene, obtaining the using [ - P]ATP-labeled HRE1 probe. Arrow, Hox-A10 gel shift complex. Right, results of EMSA analysis conducted on nuclear extracts of pT81LucHRE1 construct. This vector was then transiently trans- mock-transfected (Mock) and pCMVFlagHoxA10-transfected HEK293T fected in HEK293T cells together with the pcDNA3Hox-A10 plas- cells. The specificity of the Hox-A10 complex was confirmed by incubation mid, coding for wild-type Hox-A10 protein, to perform a set of with an anti-Flag Ab, generating a supershift complex (upper arrow). b, transactivation assays based on the luciferase reporter system. The Histogram reporting the results of luciferase assays performed in results of these experiments clearly demonstrated that the analyzed HEK293T cells transfected with the pT81LucHRE1 reporter plasmid and element was able to determine a 3.6-fold activation of the reporter pcDNA3HoxA10 plasmid expression vector. x-axis, Combinations of gene in the presence of the required Hox-A10 transcription factor transfected plasmids. y-axis, Luciferase activity reported as ␤-galactosi- (Fig. 8c). dase normalized value. Bars represent the mean luciferase activity Ϯ SEM Based on our bioinformatic analysis, EMSA experiments and of three independent experiments. transactivation assays, it is therefore possible to state that the MafB gene is a direct target of Hox-A10 transcription activity.

Activation of Hox-A10 and MafB expression in response sitory increase of Hox-A10 mRNA peaking at 24 h of treatment. ϩ to VD stimulation of CD34 hemopoietic stem The entity of the observed up-regulation, reported as mean Ϯ progenitor cells SEM value, was 3.7 Ϯ 0.5. Consistent with this result, MafB The observation that Hox-A10 is a VD target gene has been, to mRNA underwent a 2.6 Ϯ 0.4 (mean Ϯ SEM) increase that was date, exclusively obtained in cell lines and never veriﬁed on pri- detected at a later time (72 h; Fig. 9a, middle). CD14 mRNA mary normal cell populations, especially those belonging to the levels, analyzed as control, exhibited the expected increase over hemopoietic system. time that reached a 21 Ϯ 2.4 (mean Ϯ SEM) value at 72 h of On the basis of this consideration and data presented thus far, treatment (Fig. 9a, bottom). we performed a set of time course experiments in which CD34ϩ Data obtained by this quantitative analysis of endogenous hemopoietic progenitors was stimulated with VD for 72 h and Hox-A10 and MafB expression in response to VD treatment is then the mRNA levels of the Hox-A10 and MafB genes were therefore consistent with the existence of a transactivation cas- estimated by QRT-PCR at various treatment times. As reported cade involving sequentially VDR, Hox-A10, and MafB tran- in Fig. 9a (top), exposure of CD34ϩ hemopoietic progenitors to scription factors during the induction of monocyte-macrophage the mentioned nuclear hormone gave rise to a rapid and tran- commitment. The Journal of Immunology 5669 Downloaded from http://www.jimmunol.org/

FIGURE 9. Comparative analysis of the monocyte differentiation effect determined in CD34ϩ hemopoietic stem/progenitor cells by VD stimulation and by retroviral transduction with the Hox-A10 and MafB transcription factors. a, Time course experiment performed to estimate, by QRT-PCR, Hox-A10 (top), MafB (middle) and CD14 (bottom) mRNA levels in CD34ϩ cells stimulated with VD. x-axis, Analyzed times; y-axis, mRNA levels shown as mean Ϯ by guest on September 26, 2021 SEM RQ values deriving from three independent experiments. b, Histogram reporting the results of ﬂow cytometry analysis of CD14 and CD163 Ag expression in CD34ϩ cells stimulated with VD and retrovirally transduced with MafB (LMafBI⌬N) and with Hox-A10 (LHox-A10I⌬N). VD treatment was performed on cells transduced with the empty vector (LXI⌬N). x-axis, Analyzed samples. y-axis Results presented as mean Ϯ SEM values obtained from three independent experiments. c, Histogram summarizing cell counts obtained on CD34ϩ cells under the same treatment conditions described in b. Cells transduced with the empty vector, treated with VD, and transduced with Hox-A10 and MafB are described in the ﬁgure key. y-axis, Measured cellularities reported as mean Ϯ SEM values obtained from three independent experiments. Days of culture are indicated on x-axis. Day 0 of comparative cell counts corresponds to day 5 of liquid culture.

Direct comparison of the monocyte-macrophage differentiation Cell counts showed that, although all samples underwent a cer- effect determined by VD stimulation and Hox-A10 or MafB tain degree of proliferative expansions, the three analyzed stimuli retroviral transduction of CD34ϩ hemopoietic progenitors determined an about double reduction of cellularity in comparison Although the biological effects exerted on CD34ϩ hemopoietic with control cells at day 14 of liquid culture (day 9 post-transduc- progenitors by VD stimulation and Hox-A10 or MafB transduction tion-NGFR purification; Fig. 9c). This result confirms the prolif- have been already studied in previous reports, we decided to per- eration inhibitory activity of Hox-A10 already observed in U937 form a number of similar experiments to obtain a direct compar- cells. ison among all these monocyte differentiation inducers and to provide a more accurate estimation of their relative efficiency. As Discussion control for these experiments we used empty vector-transduced/ A significant number of reports have demonstrated the role played VD-untreated cells. by Hox genes in the molecular control of self-renewal and differ- Flow cytometry analysis, performed on the various samples at entiation of hemopoietic stem/progenitor cells. These observations day 14 of liquid culture, evidenced an ϳ4-fold increase of CD14 are substantially based on endogenous expression studies and viral positivity in Hox-A10- and MafB-transduced CD34ϩ cells and a vector mediated overexpression experiments (14). Since the mid- ϳ3-fold induction of the same Ag in VD-stimulated CD34ϩ cells dle of the 1990s, the former approach has led to the evidence that, (Fig. 9b). The CD163 Ag exhibited a similar trend even if with less among Hox genes, Hox-A10 exhibited the highest specificity of pronounced variations of expression (Fig. 9b). These data substan- expression pattern. In fact, in normal cell populations, its transcript tially indicate that treatment of CD34ϩ cells with the analyzed was detected in CD34ϩ progenitors but not in terminally differ- inducers results in comparable differentiation effects. In this re- entiated neutrophils and monocytes; and in neoplastic tissues gard, the weaker effect promoted by VD is not surprising in light (fresh leukemic populations and cell lines) Hox-A10 expression of the different nature of the compared stimuli, i.e., hormone stim- appeared to be restricted to the myeloblast-monoblast cell contexts ulation in one case and retroviral transduction in the other two. (15). Although these last findings had not been verified on normal 5670 MafB IS A TARGET GENE OF VD/Hox-A10 SIGNALING PATHWAY hemopoietic precursors, data reported thus far globally indicated ated with this maturation lineage. They also evidenced a de- a myeloid-restricted and differentiation stage-related expression creased expression of genes related to erythroid and granulocyte of Hox-A10, suggesting a role in the regulation of myeloid com- differentiation programs. This last effect was also confirmed by mitment. Overexpression experiments, performed in subsequent cytochemical and morphological evaluation of Hox-A10-trans- years, gave rise to contradictory results since they evidenced, in duced CD34ϩ cells. Modulation of cell cycle-related genes was some cases, a role in stem cell maintenance (20) and myeloid consistent with the inhibitory effect exerted by Hox-A10 on pro- progenitor expansion (19) whereas, in others, a remarkable dif- liferation activity. ferentiation activity (16, 18). In addition, the precise maturation The microarray data reported in this paper are significantly di- lineage affected by the latter effect varied significantly among vergent in comparison with those recently published by the H. J. the different studies, allowing one to conclude that the exact Lawrence (20) group using a similar approach in terms of target function of Hox-A10 inside the hemopoietic system is still un- cells, culture conditions, and viral transduction, but different mi- clear. The considered species (murine or human) also appeared croarray platform, probe preparation, and analysis procedure. A as a crucial factor, able to deeply influence the nature and entity number of comparative studies have clearly shown that these are of observed effects. The aim of the experimental work per- crucial parameters resulting in remarkable differences in the final formed in our laboratory was to clarify the controversy focusing output of microarray experiments and, in this regard, oligonucle- the attention on human models of hemopoiesis. For this pur- otide platforms based on the Affymetrix technology are the most pose, we analyzed endogenous Hox-A10 mRNA expression in a reliable for accuracy and precision (69–71). An additional aspect number of hemopoietic cells of human origin and transduced contributing to these controversial results might be represented by ϩ the U937 monoblastic cell line and cord blood CD34 hemo- the different transgene levels obtained in the two reports. Regard- Downloaded from poietic stem/progenitor cells with a retroviral vector expressing less of the possible factors accounting for data discrepancy, the full-length Hox-A10 cDNA and the ⌬LNGFR marker gene. main claims of the cited paper (induction of HSC self-renewal and Semiquantitative RT-PCR analysis showed that, as expected, inhibition of myeloid differentiation) are based on limited gene Hox-A10 mRNA expression is restricted to cell lines having a subsets and are not supported by the proper functional demonstra- myeloblastic or monoblastic phenotype. Consistently, microar- tion. Nevertheless, the compared studies are in complete agree-

ray analysis performed on eight normal primary hemopoietic ment with regard to the down-regulation of erythroid-related http://www.jimmunol.org/ cell populations at different maturation levels (progenitors, pre- genes. cursors, terminally differentiated cells) evidenced that Hox-A10 Clustering analysis of expression profiles, performed on a con- is expressed in CD34ϩ cells, in myeloblasts and in monoblasts, siderable number of hemopoietic cell contexts under rigorous sta- whereas it is low or not expressed in other precursor contexts or tistical conditions, paired Hox-A10- and MafB transduced CD34ϩ in more mature cells. These data, for the first time including a cells with monoblasts rather than with cell populations represen- complete analysis on normal hemopoietic precursors, substan- tative of stem/progenitor or non-monocyte lineage phenotypes tially confirmed previous studies, defining the existence of a (fresh CD34ϩ cells and non-monocyte precursors, respectively). precise differentiation window for endogenous Hox-A10 expres- This observation indicates that, at least in our experimental con- sion, spanning from CD34ϩ progenitors to myeloid precursors ditions, the Hox-A10 genetic program is univocally associated with by guest on September 26, 2021 (myeloblasts and monoblasts). monocyte-macrophage differentiation. Under the experimental conditions used in our laboratory, Taken together, our data demonstrate the existence of a pre- retroviral vector-mediated expression of Hox-A10 led to a mas- cise transactivation cascade in which stimulation of the VDR- sive induction of monocyte-macrophage differentiation, ob- dependent pathway leads to the induction of Hox-A10 gene in served in both the analyzed cell types (U937 and CD34ϩ cells) turn up-regulating MafB expression, allowing us to conclude and accompanied by an evident inhibition of proliferation ac- that the vitamin D3/Hox-A10 pathway cooperates MafB func- tivity. Although these results represent a confirmation of the tion in the regulation of monocyte commitment. This conclu- data published by the Freedman (16) and Leclercq (18) groups, sion is also supported by the observation that all these inducers respectively, the differentiation effect was corroborated, in our (VD, Hox-A10, MafB) comparably stimulated the monocyte- study, by the up-regulation of a broader panel of monocyte- macrophage differentiation of CD34ϩ cells and that treatment macrophage-related genes assessed, in U937 cells, by RT-PCR of the same cells with VD resulted in the sequential induction analysis and, in CD34ϩ cells, by microarray analysis conducted of Hox-A10 and MafB expression. using Affymetrix methodology. Among them, we were able to identify the MafB transcription factor, previously described as Acknowledgments the master regulator of monocyte-macrophage commitment (8); This paper is dedicated to the memory of Stefano Ferrari, Professor of this observation was also confirmed by means of the QRT-PCR Biochemistry at the University of Modena and Reggio Emilia (Italy). reaction. Computational analysis, subsequently validated by gel shift experiments and by transactivation assays, demonstrated Disclosures that MafB is a direct target of the Hox-A10 transcription factor. The authors have no financial conflict of interest. This finding suggests a plausible molecular mechanism explaining the biological effects promoted by Hox-A10 transduction of References human hemopoietic cells. 1. Bellantuono, I. 2004. Haemopoietic stem cells. Int. J. Biochem. Cell Biol. 36: Microarray analysis of Hox-A10-transduced CD34ϩ cells 607–620. 2. Kondo, M., A. J. Wagers, M. G. Manz, S. S. Prohaska, D. C. Scherer, provided a substantial contribute for a better comprehension of G. F. Beilhack, J. A. Shizuru, and I. L. Weissman. 2003. Biology of hematopoi- the biological effects driven by this transcription factor in hu- etic stem cells and progenitors: implications for clinical application. Annu. Rev. man primary hemopoietic stem/progenitor cells. Results of this Immunol. 21: 759–806. 3. Metcalf, D. 1989. The molecular control of cell division, differentiation commit- analysis confirmed the stimulatory effect exerted by Hox-A10 ment and maturation in haemopoietic cells. Nature 339: 27–30. on monocytopoiesis, disclosing an up-regulated expression of 4. Payne, K. J., and G. M. Crooks. 2002. Human hematopoietic lineage commitment. Immunol. Rev. 187: 48–64. transcription factors and differentiation markers (CD Ags, gran- 5. Tenen, D. G., R. Hromas, J. D. Licht, and D. E. Zhang. 1997. Transcription ule proteins, cytokines/chemokines) that are typically associ- factors, normal myeloid development, and leukemia. Blood 90: 489–519. The Journal of Immunology 5671

6. Orkin, S. H. 2000. Diversification of haematopoietic stem cells to specific lin- 30. Ferrari, F., S. Bortoluzzi, A. Coppe, D. Basso, S. Bicciato, R. Zini, C. Gemelli, eages. Nat. Rev. Genet. 1: 57–64. G. A. Danieli, and S. Ferrari. 2007. Genomic expression during human myelo- 7. Loose, M., and R. Patient. 2006. Global genetic regulatory networks controlling poiesis. BMC Genomics 8: 264. hematopoietic cell fates. Curr. Opin. Hematol. 13: 229–236. 31. Turk, B., D. Turk, and V. Turk. 2000. Lysosomal cysteine proteases: more than 8. Gemelli, C., M. Montanari, E. Tenedini, M. T. Zanocco, T. Vignudelli, scavengers. Biochim. Biophys. Acta 1477: 98–111. M. Siena, R. Zini, S. Salati, E. Tagliafico, R. Manfredini, et al. 2006. Virally 32. Turk, V., B. Turk, and D. Turk. 2001. Lysosomal cysteine proteases: facts and mediated MafB transduction induces the monocyte commitment of human opportunities. EMBO J. 20: 4629–4633. CD34ϩ hematopoietic stem/progenitor cells. Cell Death Differ. 13: 33. Weinberg, J. B. 2004. Mononuclear phagocytes. In The Normal Hematologic 1686–1696. System. Lippincott Williams & Wilkins, Philadelphia, pp. 377–414. 9. Hegde, S. P., J. Zhao, R. A. Ashmun, and L. H. Shapiro. 1999. c-Maf induces 34. Mahoney, J. A., B. Ntolosi, R. P. DaSilva, S. Gordon, and A. J. McKnight. 2001. monocytic differentiation and apoptosis in bipotent myeloid progenitors. Blood Cloning and characterization of CPVL, a novel serine carboxypeptidase, from 94: 1578–1589. human macrophages. Genomics 72: 243–251. 10. Grande, A., M. Montanari, E. Tagliafico, R. Manfredini, T. Z. Marani, M. Siena, 35. Collins, R. F., A. D. Schreiber, S. Grinstein, and W. S. Trimble. 2002. Syntaxins E. Tenedini, A. Gallinelli, and S. Ferrari. 2002. Physiological levels of 1␣,25- 13 and 7 function at distinct steps during phagocytosis. J. Immunol. 169: ϩ dihydroxyvitamin D3 induce the monocytic commitment of CD34 hematopoi- 3250–3256. etic progenitors. J. Leukocyte Biol. 71: 641–651. 36. Parks, W. C., C. L. Wilson, and Y. S. Lopez-Boado. 2004. Matrix metallopro- 11. Tagliafico, E., E. Tenedini, A. Bergamaschi, R. Manfredini, R. Percudani, teinases as modulators of inflammation and innate immunity. Nat. Rev. Immunol. M. Siena, T. Zanocco-Marani, A. Grande, M. Montanari, C. Gemelli, et al. 4: 617–629. 2002. Gene expression profile of vitamin D3 treated HL60 cells shows an 37. Jiang, Y. J., B. Lu, P. C. Choy, and G. M. Hatch. 2003. Regulation of cytosolic ␣ incomplete molecular phenotypic conversion to monocytes. Cell Death Differ. phospholipase A2, cyclooxygenase-1 and -2 expression by PMA, TNF , LPS, 9: 1185–1195. and M-CSF in human monocytes and macrophages. Mol. Cell. Biochem. 246: 12. Manfredini, R., F. Trevisan, A. Grande, E. Tagliafico, M. Montanari, R. Lemoli, 31–38. G. Visani, S. Tura, S. Ferrari, and S. Ferrari. 1999. Induction of a functional 38. Tjoelker, L. W., C. Wilder, C. Eberhardt, D. M. Stafforini, G. Dietsch, vitamin D receptor in all-trans-retinoic acid-induced monocytic differentiation of B. Schimpf, S. Hooper, H. Le Trong, L. S. Cousens, G. A. Zimmerman, et al.

M2-type leukemic blast cells. Cancer Res. 59: 3803–3811. 1995. Anti-inflammatory properties of a platelet-activating factor acetylhydro- Downloaded from 13. Daftary, G. S., and H. S. Taylor. 2006. Endocrine regulation of HOX genes. lase. Nature 374: 549–553. Endocr. Rev. 27: 331–355. 39. Turcanu, V., M. Dhouib, and P. Poindron. 1998. Nitric oxide synthase inhibition 14. Magli, M. C., C. Largman, and H. J. Lawrence. 1997. Effects of HOX homeobox by haem oxygenase decreases macrophage nitric-oxide-dependent cytotoxicity: a genes in blood cell differentiation. J. Cell. Physiol. 173: 168–177. negative feedback mechanism for the regulation of nitric oxide production. Res. 15. Lawrence, H. J., G. Sauvageau, N. Ahmadi, A. R. Lopez, M. M. LeBeau, Immunol. 149: 741–744. M. Link, K. Humphries, and C. Largman. 1995. Stage- and lineage-specific ex- 40. Smithgall, T. E. 1998. Signal transduction pathways regulating hematopoietic pression of the HOXA10 homeobox gene in normal and leukemic hematopoietic differentiation. Pharmacol. Rev. 50: 1–19. cells. Exp. Hematol. 23: 1160–1166. 41. Moser, B., M. Wolf, A. Walz, and P. Loetscher. 2004. Chemokines: multiple http://www.jimmunol.org/ 16. Rots, N. Y., M. Liu, E. C. Anderson, and L. P. Freedman. 1998. A differential levels of leukocyte migration control. Trends Immunol. 25: 75–84. screen for ligand-regulated genes: identification of HoxA10 as a target of 42. Sano, H., D. K. Hsu, J. R. Apgar, L. Yu, B. B. Sharma, I. Kuwabara, S. Izui, and vitamin D3 induction in myeloid leukemic cells. Mol. Cell. Biol. 18: F. T. Liu. 2003. Critical role of galectin-3 in phagocytosis by macrophages. 1911–1918. J. Clin. Invest. 112: 389–397. 17. Du, H., G. S. Daftary, S. I. Lalwani, and H. S. Taylor. 2005. Direct regulation of 43. Luster, A. D. 1998. Chemokines: chemotactic cytokines that mediate inflamma- HOXA10 by 1,25-(OH)2D3 in human myelomonocytic cells and human endo- tion. N. Engl. J. Med. 338: 436–445. metrial stromal cells. Mol. Endocrinol. 19: 2222–2233. 44. Mantovani, A. 1999. The chemokine system: redundancy for robust outputs. Im- 18. Taghon, T., F. Stolz, M. De Smedt, M. Cnockaert, B. Verhasselt, J. Plum, and munol. Today 20: 254–257. G. Leclercq. 2002. HOX-A10 regulates hematopoietic lineage commitment: ev- 45. O’Neill, L. 2000. The Toll/interleukin-1 receptor domain: a molecular switch for idence for a monocyte-specific transcription factor. Blood 99: 1197–1204. inflammation and host defence. Biochem. Soc. Trans. 28: 557–563. 19. Buske, C., M. Feuring-Buske, J. Antonchuk, P. Rosten, D. E. Hogge, C. J. Eaves, 46. Medzhitov, R. 2001. Toll-like receptors and innate immunity. Nat. Rev. Immunol.

and R. K. Humphries. 2001. Overexpression of HOXA10 perturbs human lym- 1: 135–145. by guest on September 26, 2021 phomyelopoiesis in vitro and in vivo. Blood 97: 2286–2292. 47. Apostolopoulos, V., and I. F. McKenzie. 2001. Role of the mannose receptor in 20. Ferrell, C. M., S. T. Dorsam, H. Ohta, R. K. Humphries, M. K. Derynck, C. Haqq, the immune response. Curr. Mol. Med. 1: 469–474. C. Largman, and H. J. Lawrence. 2005. Activation of stem-cell specific genes by 48. Tedeschi, F. A., and F. E. Zalazar. 2006. HOXA9 gene expression in the chronic HOXA9 and HOXA10 homeodomain proteins in CD34ϩ human cord blood myeloid leukemia progression. Leukemia Res. 30: 1453–1456. cells. Stem Cells 23: 644–655. 49. Sindt, A., B. Deau, W. Brahim, A. Staal, S. Visanica, P. Villarese, J. P. Rault, 21. Thorsteinsdottir, U., G. Sauvageau, M. R. Hough, W. Dragowska, P. M. Lans- E. Macintyre, and E. Delabesse. 2006. Acute monocytic leukemia with co- dorp, H. J. Lawrence, C. Largman, and R. K. Humphries. 1997. Overexpres- expression of minor BCR-ABL1 and PICALM-MLLT10 fusion genes along sion of HOXA10 in murine hematopoietic cells perturbs both myeloid and with overexpression of HOXA9. Genes Chromosomes Cancer 45: 575–582. lymphoid differentiation and leads to acute myeloid leukemia. Mol. Cell. Biol. 50. Lahortiga, I., E. Belloni, I. Vazquez, X. Agirre, M. J. Larrayoz, J. L. Vizmanos, 17: 495–505. M. Valganon, I. Zudaire, B. Saez, M. C. Mateos, et al. 2005. NUP98 is fused to 22. Magnusson, M., A. C. Brun, N. Miyake, J. Larsson, M. Ehinger, J. M. Bjornsson, HOXA9 in a variant complex t(7;11:13;17) in a patient with AML-M2. Cancer A. Wutz, M. Sigvardsson, and S. Karlsson. 2007. HOXA10 is a critical regulator Genet. Cytogenet. 157: 151–156. for hematopoietic stem cells and erythroid/megakaryocyte development. Blood 51. Lord, K. A., A. Abdollahi, B. Hoffman-Liebermann, and D. A. Liebermann. 109: 3687–3696. 1993. Proto-oncogenes of the fos/jun family of transcription factors are positive 23. Montanari, M., C. Gemelli, E. Tenedini, M. T. Zanocco, T. Vignudelli, M. Siena, regulators of myeloid differentiation. Mol. Cell. Biol. 13: 841–851. R. Zini, S. Salati, G. Chiossi, E. Tagliafico, et al. 2005. Correlation between 52. Kerppola, T. K., and T. Curran. 1994. Maf and Nrl can bind to AP-1 sites and differentiation plasticity and mRNA expression profiling of CD34ϩ-derived form heterodimers with Fos and Jun. Oncogene 9: 675–684. Ϫ ϩ CD14 and CD14 human normal myeloid precursors. Cell Death Differ. 12: 53. Blank, V., and N. C. Andrews. 1997. The Maf transcription factors: regulators of 1588–1600. differentiation. Trends Biochem. Sci. 22: 437–441. 24. Piacibello, W., F. Sanavio, L. Garetto, A. Severino, A. Dane, L. Gammaitoni, and 54. Feinberg, M. W., Z. Cao, A. K. Wara, M. A. Lebedeva, S. Senbanerjee, and M. Aglietta. 1998. Differential growth factor requirement of primitive cord blood M. K. Jain. 2005. Kruppel-like factor 4 is a mediator of proinflammatory signal- hematopoietic stem cell for self-renewal and amplification vs proliferation and ing in macrophages. J. Biol. Chem. 280: 38247–38258. differentiation. Leukemia 12: 718–727. 55. Frucht, D. M., M. Aringer, J. Galon, C. Danning, M. Brown, S. Fan, 25. Grande, A., B. Piovani, A. Aiuti, S. Ottolenghi, F. Mavilio, and G. Ferrari. 1999. M. Centola, C. Y. Wu, N. Yamada, H. El Gabalawy, and J. J. O’Shea. 2000. Transcriptional targeting of retroviral vectors to the erythroblastic progeny of Stat4 is expressed in activated peripheral blood monocytes, dendritic cells, transduced hematopoietic stem cells. Blood 93: 3276–3285. and macrophages at sites of Th1-mediated inflammation. J. Immunol. 164: 26. Tenedini, E., M. E. Fagioli, N. Vianelli, P. L. Tazzari, F. Ricci, E. Tagliafico, 4659–4664. P. Ricci, L. Gugliotta, G. Martinelli, S. Tura, et al. 2004. Gene expression pro- 56. Pei, L., A. Castrillo, M. Chen, A. Hoffmann, and P. Tontonoz. 2005. Induction of filing of normal and malignant CD34-derived megakaryocytic cells. Blood 104: NR4A orphan nuclear receptor expression in macrophages in response to inflam- 3126–3135. matory stimuli. J. Biol. Chem. 280: 29256–29262. 27. Urbinati, F., F. Lotti, G. Facchini, M. Montanari, G. Ferrari, F. Mavilio, and 57. Han, D. K., P. M. Chaudhary, M. E. Wright, C. Friedman, B. J. Trask, A. Grande. 2005. Competitive engraftment of hematopoietic stem cells geneti- R. T. Riedel, D. G. Baskin, S. M. Schwartz, and L. Hood. 1997. MRIT, a cally modified with a truncated erythropoietin receptor. Hum. Gene Ther. 16: novel death-effector domain-containing protein, interacts with caspases and 594–608. BclXL and initiates cell death. Proc. Natl. Acad. Sci. USA 94: 11333–11338. 28. Grande, A., R. Manfredini, E. Tagliafico, R. Balestri, M. Pizzanelli, S. Papa, 58. Cortes, U., C. Moyret-Lalle, N. Falette, C. Duriez, F. E. Ghissassi, C. Barnas, P. Zucchini, L. Bonsi, G. Bagnara, U. Torelli, et al. 1995. All-trans-retinoic acid A. P. Morel, P. Hainaut, J. P. Magaud, and A. Puisieux. 2000. BTG gene ex- induces simultaneously granulocytic differentiation and expression of inflamma- pression in the p53-dependent and -independent cellular response to DNA dam- tory cytokines in HL-60 cells. Exp. Hematol. 23: 117–125. age. Mol. Carcinog. 27: 57–64. 29. Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expression 59. Yin, Y., Y. X. Liu, Y. J. Jin, E. J. Hall, and J. C. Barrett. 2003. PAC1 phosphatase Ϫ⌬⌬ data using real-time quantitative PCR and the 2( CT method. Methods 25: is a transcription target of p53 in signalling apoptosis and growth suppression. 402–408. Nature 422: 527–531. 5672 MafB IS A TARGET GENE OF VD/Hox-A10 SIGNALING PATHWAY

60. Bouchard, C., K. Thieke, A. Maier, R. Saffrich, J. Hanley-Hyde, W. Ansorge, basophilic and/or megakaryocytic differentiation. Exp. Hematol. 27: S. Reed, P. Sicinski, J. Bartek, and M. Eilers. 1999. Direct induction of cyclin D2 1295–1305. by Myc contributes to cell cycle progression and sequestration of p27. EMBO J. 67. Mamune-Sato, R., K. Yamauchi, Y. Tanno, Y. Ohkawara, H. Ohtsu, D. Katayose, 18: 5321–5333. K. Maeyama, T. Watanabe, S. Shibahara, and T. Takishima. 1992. Functional 61. Yang, R., R. Morosetti, and H. P. Koeffler. 1997. Characterization of a second analysis of alternatively spliced transcripts of the human histidine decarboxylase human cyclin A that is highly expressed in testis and in several leukemic cell gene and its expression in human tissues and basophilic leukemia cells. Eur. lines. Cancer Res. 57: 913–920. J. Biochem. 209: 533–539. 62. Koury, M. J., S. T. Sawyer, and S. J. Brandt. 2002. New insights into erythro- 68. Kent, W. J., C. W. Sugnet, T. S. Furey, K. M. Roskin, T. H. Pringle, A. M. Zahler, poiesis. Curr. Opin. Hematol. 9: 93–100. and D. Haussler. 2002. The human genome browser at UCSC. Genome Res. 12: 996–1006. 63. Ingley, E., P. A. Tilbrook, and S. P. Klinken. 2004. New insights into the regu- 69. Hoheisel, J. D. 2006. Microarray technology: beyond transcript profiling and lation of erythroid cells. IUBMB Life 56: 177–184. genotype analysis. Nat. Rev. Genet. 7: 200–210. 64. Borregaard, N., and J. B. Cowland. 1997. Granules of the human neutrophilic 70. Park, P. J., Y. A. Cao, S. Y. Lee, J. W. Kim, M. S. Chang, R. Hart, and polymorphonuclear leukocyte. Blood 89: 3503–3521. S. Choi. 2004. Current issues for DNA microarrays: platform comparison, 65. Venge, P. 1990. The human eosinophil in inflammation. Agents Actions 29: double linear amplification, and universal RNA reference. J. Biotechnol. 112: 122–126. 225–245. 66. Dy, M., M. Pacilio, A. Arnould, F. Machavoine, P. Mayeux, O. Hermine, 71. Jarvinen, A. K., S. Hautaniemi, H. Edgren, P. Auvinen, J. Saarela, M. Bodger, and E. Schneider. 1999. Modulation of histidine decarboxylase O. P. Kallioniemi, and O. Monni. 2004. Are data from different gene expression activity and cytokine synthesis in human leukemic cell lines: relationship with microarray platforms comparable? Genomics 83: 1164–1168. Downloaded from http://www.jimmunol.org/ by guest on September 26, 2021