The Vitamin D3/Hox-A10 Pathway Supports MafB Function during the Monocyte Differentiation of Human CD34+ Hemopoietic Progenitors This information is current as of September 26, 2021. Claudia Gemelli, Claudia Orlandi, Tommaso Zanocco Marani, Andrea Martello, Tatiana Vignudelli, Francesco Ferrari, Monica Montanari, Sandra Parenti, Anna Testa, Alexis Grande and Sergio Ferrari J Immunol 2008; 181:5660-5672; ; Downloaded from doi: 10.4049/jimmunol.181.8.5660 http://www.jimmunol.org/content/181/8/5660 http://www.jimmunol.org/ References This article cites 70 articles, 23 of which you can access for free at: http://www.jimmunol.org/content/181/8/5660.full#ref-list-1 Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists by guest on September 26, 2021 • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2008 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology The Vitamin D3/Hox-A10 Pathway Supports MafB Function during the Monocyte Differentiation of Human CD34؉ Hemopoietic Progenitors1 Claudia Gemelli, Claudia Orlandi, Tommaso Zanocco Marani, Andrea Martello, Tatiana Vignudelli, Francesco Ferrari, Monica Montanari, Sandra Parenti, Anna Testa, Alexis Grande,2,3 and Sergio Ferrari2 Although a considerable number of reports indicate an involvement of the Hox-A10 gene in the molecular control of hemopoiesis, the conclusions of such studies are quite controversial given that they support, in some cases, a role in the stimulation of stem cell self-renewal and myeloid progenitor expansion, whereas in others they implicate this transcription factor in the induction of monocyte-macrophage differentiation. To clarify this issue, we analyzed the biological effects and the transcriptome changes Downloaded from determined in human primary CD34؉ hemopoietic progenitors by retroviral transduction of a full-length Hox-A10 cDNA. The results obtained clearly indicated that this homeogene is an inducer of monocyte differentiation, at least partly acting through the up-regulation of the MafB gene, recently identified as the master regulator of such a maturation pathway. By using a combined approach based on computational analysis, EMSA experiments, and luciferase assays, we were able to demonstrate the presence of a Hox-A10-binding site in the promoter region of the MafB gene, which suggested the likely molecular mechanism underlying http://www.jimmunol.org/ the observed effect. Stimulation of the same cells with the vitamin D3 monocyte differentiation inducer resulted in a clear increase of Hox-A10 and MafB transcripts, indicating the existence of a precise transactivation cascade involving vitamin D3 receptor, Hox-A10, and MafB transcription factors. Altogether, these data allow one to conclude that the vitamin D3/Hox-A10 pathway supports MafB function during the induction of monocyte differentiation. The Journal of Immunology, 2008, 181: 5660–5672. lthough hemopoiesis is a complex process, it can be in the molecular control of hemopoietic cell differentiation and the schematically divided into two sequential steps. In the so-called master or key regulators, which are by themselves able to initial commitment or lineage decision phase, multipo- promote the lineage commitment of pluripotent HSCs or the lin- A 4 tent hemopoietic stem cells (HSC) undergo a gradual restriction eage switching of already committed progenitors (5, 6). Additional by guest on September 26, 2021 of their differentiation potential, eventually resulting in the pro- properties of such regulators are also represented by the capacity to duction of unipotent hemopoietic progenitors/precursors (1, 2). inhibit the commitment toward alternative maturation lineages and During the subsequent terminal differentiation phase, these last the ability to transactivate and cooperate other transcription factors cells give rise to all the mature blood cells, characterized by dif- controlling the same differentiation lineage (7). Knockout and ferent phenotypes and specialized functions (1, 3, 4). Spontaneous transgenic mouse experiments have allowed the identification of a or exogenously induced up-regulation of transcription factors is large number in this last category of transcription factors, the most the mechanism that is generally invoked to explain the commit- important being represented by Pax-5 for B lymphopoiesis, ment of HSCs and the subsequent maturation of committed pro- GATA-1 for erythroid differentiation, PU-1 for early myeloid genitors (5, 6). In this regard, a clear distinction has been estab- commitment, and C/EBP␣ for granulocyte maturation (6). An ad- lished between transcription factors that are generically involved ditional method to characterize these master regulators in human hemopoiesis is represented by the viral transduction of the inves- ϩ Department of Biomedical Sciences, University of Modena and Reggio Emilia, Mo- tigated transcription factor in leukemic cell lines and CD34 he- dena, Italy mopoietic progenitors (8, 9) or, alternatively, by the stimulation of Received for publication August 10, 2007. Accepted for publication August 7, 2008. these cells with soluble compounds that are able to modulate dif- The costs of publication of this article were defrayed in part by the payment of page ferentiation genetic programs (10–12). Data obtained using this charges. This article must therefore be hereby marked advertisement in accordance approach provided a clear and definitive demonstration of the cru- with 18 U.S.C. Section 1734 solely to indicate this fact. cial role played by VDR and MafB transcription factors in the 1 This work was supported by a grant from Associazione Italiana per la Ricerca sul Cancro (2006) and from Ministero dell’Universita`e della Ricerca Scientifica e Tech- molecular control of monocyte-macrophage differentiation (8, 10). ϩ nologica-Cofin (2007). C.G. is a fellow of the Ergentech Laboratory of Genetics and In fact: 1) stimulation of cord blood CD34 stem/progenitor cells Biotechnology. ␣ with physiological levels of 1 ,25-dihydroxyvitamin D3 (VD) 2 These authors share the senior authorship of this investigation. leads to a massive induction of such differentiation, which is me- 3 Address correspondence and requests for reprints to Dr. Alexis Grande, Dipartimento di diated by its genomic VDR-dependent intracellular pathway (10); Scienze Biomediche, Sezione di Chimica Biologica, Universita` di Modena e Reggio Emilia, Via Campi 287, 41100 Modena, Italy. E-mail address: [email protected] and 2) retroviral transduction of MafB in the same cells results in a comparable effect (8). A further, although controversial, regula- 4 Abbreviations used in this paper: HSC, hemopoietic stem cells; VD, 1␣,25-dihy- droxyvitamin D3; HRE, Hox response element; NGFR, nerve growth factor receptor; tor of human monocytopoiesis is represented by the Hox-A10 tran- ⌬LNGFR, low-affinity NGFR; QRT-PCR, quantitative real-time RT-PCR; SLR, sig- scription factor. It is well known that Hox genes, originally iden- nal log ratio; CTS, cathepsin; NE, nuclear extract. tified as key regulators of embryonic development, also play a Copyright © 2008 by The American Association of Immunologists, Inc. 0022-1767/08/$2.00 fundamental role in normal and leukemic hemopoiesis, controlling www.jimmunol.org The Journal of Immunology 5661 both self-renewal and commitment-differentiation processes (13, Table I. Oligodeoxynucleotides used in RT-PCR reactions and in 14). In this regard, a number of reports indicate an involvement of Hox-A10 cDNA cloninga the Hox-A10 gene in the regulation of monocyte commitment that is fundamentally based on three experimental observations. First, Oligomers Nucleotide Sequence (5Ј-3Ј) ϩ Hox-A10 expression is restricted to the CD34 progenitor and my- HOXA10 DP TCCCACAACAATGTCATGCTCGGAGAG eloid precursor phase of hemopoiesis (15); secondly, this gene is a HOXA10 RP ACCGCGTCGCCTGGAGATTCATCAG primary response gene of the VD monocyte differentiation inducer MAFB DP GCTCCGGCCGGCCGCAAAGTTTCCC (16, 17); and finally, retroviral vector-mediated expression of its MAFB RP2 GGCGGCGGCGACGCTTGGTGA GCTCATCGTGGGCAGCTCTC cDNA induces the monocyte differentiation of U937 (16) and CD11b DP ϩ CD11b RP GCGACGGGAAGTCCCACTTCT CD34 hemopoietic progenitors (18) inhibiting, at the same time, CD163 DP GGAGCTGAGGCTAGTGGATG the commitment to lymphoid, erythroid, and granulocyte lineages CD163 RP CCTTGATGTTTGCAGTTCCAG (19). Despite this, a microarray study performed on CD34ϩ cells IL-1␤ DP ATGGCAGAAGTACCTAAGCTCGC ␤ retrovirally transduced with Hox-A10 disclosed the up-regulation IL-1 RP ACACAAATTGCATGGTGAAGTCAGTT IL7R DP ATGCACGATGTAGCTTACCGCCA of genes belonging to the Wnt pathway, suggesting a role in the IL7R RP TCTGGAGTGATGACTACATCCTC regulation of HSC self renewal (20). Similarly, in a distinct report, CD115 DP CAAGACAAACAGCCAGTGCAGA transplantation of Hox-A10-transduced CD34ϩ cells in NOD/