Mesoscale Modeling Reveals Formation of an Epigenetically Driven HOXC Gene
Total Page:16
File Type:pdf, Size:1020Kb
Load more
										Recommended publications
									
								- 
												  Core Transcriptional Regulatory Circuitries in CancerOncogene (2020) 39:6633–6646 https://doi.org/10.1038/s41388-020-01459-w REVIEW ARTICLE Core transcriptional regulatory circuitries in cancer 1 1,2,3 1 2 1,4,5 Ye Chen ● Liang Xu ● Ruby Yu-Tong Lin ● Markus Müschen ● H. Phillip Koeffler Received: 14 June 2020 / Revised: 30 August 2020 / Accepted: 4 September 2020 / Published online: 17 September 2020 © The Author(s) 2020. This article is published with open access Abstract Transcription factors (TFs) coordinate the on-and-off states of gene expression typically in a combinatorial fashion. Studies from embryonic stem cells and other cell types have revealed that a clique of self-regulated core TFs control cell identity and cell state. These core TFs form interconnected feed-forward transcriptional loops to establish and reinforce the cell-type- specific gene-expression program; the ensemble of core TFs and their regulatory loops constitutes core transcriptional regulatory circuitry (CRC). Here, we summarize recent progress in computational reconstitution and biologic exploration of CRCs across various human malignancies, and consolidate the strategy and methodology for CRC discovery. We also discuss the genetic basis and therapeutic vulnerability of CRC, and highlight new frontiers and future efforts for the study of CRC in cancer. Knowledge of CRC in cancer is fundamental to understanding cancer-specific transcriptional addiction, and should provide important insight to both pathobiology and therapeutics. 1234567890();,: 1234567890();,: Introduction genes. Till now, one critical goal in biology remains to understand the composition and hierarchy of transcriptional Transcriptional regulation is one of the fundamental mole- regulatory network in each specified cell type/lineage.
- 
												  A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes MellitusPage 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
- 
												  Variable Clinical Expression in Patients with a Germline MEN1 Disease Gene Mutation: Clues to a Genotype–Phenotype CorrelationCLINICS 2012;67(S1):49-56 DOI:10.6061/clinics/2012(Sup01)10 REVIEW Variable clinical expression in patients with a germline MEN1 disease gene mutation: clues to a genotype–phenotype correlation Cornelis J. Lips,I Koen M. Dreijerink,I Jo W. Ho¨ ppenerII I University Medical Center Utrecht, Department of Internal Medicine & Endocrinology, Utrecht, The Netherlands. II University Medical Center Utrecht, Department of Metabolic & Endocrine Diseases, Utrecht, The Netherlands. Multiple endocrine neoplasia type 1 is an inherited endocrine tumor syndrome, predominantly characterized by tumors of the parathyroid glands, gastroenteropancreatic tumors, pituitary adenomas, adrenal adenomas, and neuroendocrine tumors of the thymus, lungs or stomach. Multiple endocrine neoplasia type 1 is caused by germline mutations of the multiple endocrine neoplasia type 1 tumor suppressor gene. The initial germline mutation, loss of the wild-type allele, and modifying genetic and possibly epigenetic and environmental events eventually result in multiple endocrine neoplasia type 1 tumors. Our understanding of the function of the multiple endocrine neoplasia type 1 gene product, menin, has increased significantly over the years. However, to date, no clear genotype– phenotype correlation has been established. In this review we discuss reports on exceptional clinical presentations of multiple endocrine neoplasia type 1, which may provide more insight into the pathogenesis of this disorder and offer clues for a possible genotype–phenotype correlation. KEYWORDS: Multiple Endocrine Neoplasia type 1; MEN1; Menin; Genotype–Phenotype Correlation; Clinical Expression. Lips CJ, Dreijerink KM, Ho¨ ppener JW. Variable clinical expression in patients with a germline MEN1 disease gene mutation: clues to a genotype– phenotype correlation. Clinics. 2012;67(S1):49-56.
- 
												  Supplemental Materials ZNF281 Enhances Cardiac ReprogrammingSupplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7
- 
												  An Evolutionary Conserved Region (ECR) in the Human Dopamine Receptor D4 Gene Supports Reporter Gene Expression in Primary CultuParedes et al. BMC Neuroscience 2011, 12:46 http://www.biomedcentral.com/1471-2202/12/46 RESEARCHARTICLE Open Access An evolutionary conserved region (ECR) in the human dopamine receptor D4 gene supports reporter gene expression in primary cultures derived from the rat cortex Ursula M Paredes1,2, Vivien J Bubb1, Kate Haddley1, Gabriele A Macho1,3 and John P Quinn1* Abstract Background: Detecting functional variants contributing to diversity of behaviour is crucial for dissecting genetics of complex behaviours. At a molecular level, characterisation of variation in exons has been studied as they are easily identified in the current genome annotation although the functional consequences are less well understood; however, it has been difficult to prioritise regions of non-coding DNA in which genetic variation could also have significant functional consequences. Comparison of multiple vertebrate genomes has allowed the identification of non-coding evolutionary conserved regions (ECRs), in which the degree of conservation can be comparable with exonic regions suggesting functional significance. Results: We identified ECRs at the dopamine receptor D4 gene locus, an important gene for human behaviours. The most conserved non-coding ECR (D4ECR1) supported high reporter gene expression in primary cultures derived from neonate rat frontal cortex. Computer aided analysis of the sequence of the D4ECR1 indicated the potential transcription factors that could modulate its function. D4ECR1 contained multiple consensus sequences for binding the transcription factor Sp1, a factor previously implicated in DRD4 expression. Co-transfection experiments demonstrated that overexpression of Sp1 significantly decreased the activity of the D4ECR1 in vitro. Conclusion: Bioinformatic analysis complemented by functional analysis of the DRD4 gene locus has identified a) a strong enhancer that functions in neurons and b) a transcription factor that may modulate the function of that enhancer.
- 
												  The BTB-ZF Family of Transcription Factors: Key Regulators of LineageThe BTB-ZF Family of Transcription Factors: Key Regulators of Lineage Commitment and Effector Function Development in the Immune System This information is current as of September 27, 2021. Aimee M. Beaulieu and Derek B. Sant'Angelo J Immunol 2011; 187:2841-2847; ; doi: 10.4049/jimmunol.1004006 http://www.jimmunol.org/content/187/6/2841 Downloaded from References This article cites 103 articles, 44 of which you can access for free at: http://www.jimmunol.org/content/187/6/2841.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication by guest on September 27, 2021 *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2011 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The BTB-ZF Family of Transcription Factors: Key Regulators of Lineage Commitment and Effector Function Development in the Immune System Aimee M. Beaulieu* and Derek B. Sant’Angelo*,†,‡ Successful immunity depends upon the activity of mul- 1, -2, -4, -5, and -7 (1–11).
- 
												  Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel Kwww.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1.
- 
												  Accompanies CD8 T Cell Effector Function Global DNA MethylationGlobal DNA Methylation Remodeling Accompanies CD8 T Cell Effector Function Christopher D. Scharer, Benjamin G. Barwick, Benjamin A. Youngblood, Rafi Ahmed and Jeremy M. Boss This information is current as of October 1, 2021. J Immunol 2013; 191:3419-3429; Prepublished online 16 August 2013; doi: 10.4049/jimmunol.1301395 http://www.jimmunol.org/content/191/6/3419 Downloaded from Supplementary http://www.jimmunol.org/content/suppl/2013/08/20/jimmunol.130139 Material 5.DC1 References This article cites 81 articles, 25 of which you can access for free at: http://www.jimmunol.org/content/191/6/3419.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists by guest on October 1, 2021 • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2013 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Global DNA Methylation Remodeling Accompanies CD8 T Cell Effector Function Christopher D. Scharer,* Benjamin G. Barwick,* Benjamin A. Youngblood,*,† Rafi Ahmed,*,† and Jeremy M.
- 
												  SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promoteswww.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
- 
												  Hemopoietic Progenitors + Differentiation of Human CD34The Vitamin D3/Hox-A10 Pathway Supports MafB Function during the Monocyte Differentiation of Human CD34+ Hemopoietic Progenitors This information is current as of September 26, 2021. Claudia Gemelli, Claudia Orlandi, Tommaso Zanocco Marani, Andrea Martello, Tatiana Vignudelli, Francesco Ferrari, Monica Montanari, Sandra Parenti, Anna Testa, Alexis Grande and Sergio Ferrari J Immunol 2008; 181:5660-5672; ; Downloaded from doi: 10.4049/jimmunol.181.8.5660 http://www.jimmunol.org/content/181/8/5660 http://www.jimmunol.org/ References This article cites 70 articles, 23 of which you can access for free at: http://www.jimmunol.org/content/181/8/5660.full#ref-list-1 Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists by guest on September 26, 2021 • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2008 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal
- 
												  Identification of Potential Key Genes and Pathway Linked with Sporadic Creutzfeldt-Jakob Disease Based on Integrated Bioinformatics AnalysesmedRxiv preprint doi: https://doi.org/10.1101/2020.12.21.20248688; this version posted December 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. Identification of potential key genes and pathway linked with sporadic Creutzfeldt-Jakob disease based on integrated bioinformatics analyses Basavaraj Vastrad1, Chanabasayya Vastrad*2 , Iranna Kotturshetti 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. 3. Department of Ayurveda, Rajiv Gandhi Education Society`s Ayurvedic Medical College, Ron, Karnataka 562209, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India NOTE: This preprint reports new research that has not been certified by peer review and should not be used to guide clinical practice. medRxiv preprint doi: https://doi.org/10.1101/2020.12.21.20248688; this version posted December 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. Abstract Sporadic Creutzfeldt-Jakob disease (sCJD) is neurodegenerative disease also called prion disease linked with poor prognosis. The aim of the current study was to illuminate the underlying molecular mechanisms of sCJD. The mRNA microarray dataset GSE124571 was downloaded from the Gene Expression Omnibus database. Differentially expressed genes (DEGs) were screened.
- 
												  Single Cell Regulatory Landscape of the Mouse Kidney Highlights Cellular Differentiation Programs and Disease TargetsARTICLE https://doi.org/10.1038/s41467-021-22266-1 OPEN Single cell regulatory landscape of the mouse kidney highlights cellular differentiation programs and disease targets Zhen Miao 1,2,3,8, Michael S. Balzer 1,2,8, Ziyuan Ma 1,2,8, Hongbo Liu1,2, Junnan Wu 1,2, Rojesh Shrestha 1,2, Tamas Aranyi1,2, Amy Kwan4, Ayano Kondo 4, Marco Pontoglio 5, Junhyong Kim6, ✉ Mingyao Li 7, Klaus H. Kaestner2,4 & Katalin Susztak 1,2,4 1234567890():,; Determining the epigenetic program that generates unique cell types in the kidney is critical for understanding cell-type heterogeneity during tissue homeostasis and injury response. Here, we profile open chromatin and gene expression in developing and adult mouse kidneys at single cell resolution. We show critical reliance of gene expression on distal regulatory elements (enhancers). We reveal key cell type-specific transcription factors and major gene- regulatory circuits for kidney cells. Dynamic chromatin and expression changes during nephron progenitor differentiation demonstrates that podocyte commitment occurs early and is associated with sustained Foxl1 expression. Renal tubule cells follow a more complex differentiation, where Hfn4a is associated with proximal and Tfap2b with distal fate. Mapping single nucleotide variants associated with human kidney disease implicates critical cell types, developmental stages, genes, and regulatory mechanisms. The single cell multi-omics atlas reveals key chromatin remodeling events and gene expression dynamics associated with kidney development. 1 Renal, Electrolyte, and Hypertension Division, Department of Medicine, University of Pennsylvania, Perelman School of Medicine, Philadelphia, PA, USA. 2 Institute for Diabetes, Obesity, and Metabolism, University of Pennsylvania, Perelman School of Medicine, Philadelphia, PA, USA.